Hugo_Symbol Chromosome Start_Position End_Position Variant_Classification Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 Tumor_Sample_Barcode transcript_name amino_acid_change CSMD2 chr1 33514368 33514368 3'UTR T T - TCGA-X7-A8DG-01A-11D-A423-09 ENST00000241312 RSBN1 chr1 113763954 113763954 3'UTR T T A TCGA-X7-A8DG-01A-11D-A423-09 ENST00000261441 TTN chr2 178776006 178776006 Missense_Mutation T T G TCGA-X7-A8DG-01A-11D-A423-09 ENST00000591111 p.E1953A SEC24A chr5 134727810 134727810 3'UTR A A - TCGA-X7-A8DG-01A-11D-A423-09 ENST00000398844 NACAD chr7 45083851 45083851 Missense_Mutation G G A TCGA-X7-A8DG-01A-11D-A423-09 ENST00000490531 p.P777S SH2D7 chr15 78104908 78104908 3'UTR T T - TCGA-X7-A8DG-01A-11D-A423-09 ENST00000328828 MIR6859-3 chr15 101972964 101972964 5'Flank G G A TCGA-X7-A8DG-01A-11D-A423-09 ENST00000621186 TCF4 chr18 55223709 55223710 3'UTR - - T TCGA-X7-A8DG-01A-11D-A423-09 ENST00000356073 BCR chr22 23317481 23317482 3'UTR - - C TCGA-X7-A8DG-01A-11D-A423-09 ENST00000305877 SCN2A chr2 165331520 165331520 Silent C C T TCGA-ZB-A96Q-01A-11D-A428-09 ENST00000283256 p.H780H ADAMTS9 chr3 64607053 64607053 Nonsense_Mutation G G T TCGA-ZB-A96Q-01A-11D-A428-09 ENST00000498707 p.Y1127* FGA chr4 154585655 154585655 Missense_Mutation C C T TCGA-ZB-A96Q-01A-11D-A428-09 ENST00000302053 p.G592R NIPBL chr5 37058981 37058981 Missense_Mutation C C T TCGA-ZB-A96Q-01A-11D-A428-09 ENST00000282516 p.R2501W OFCC1 chr6 9977558 9977558 Missense_Mutation G G A TCGA-ZB-A96Q-01A-11D-A428-09 ENST00000491508 p.T4I UST chr6 149076877 149076877 3'UTR T T - TCGA-ZB-A96Q-01A-11D-A428-09 ENST00000367463 MLLT4 chr6 167976333 167976334 3'Flank - - A TCGA-ZB-A96Q-01A-11D-A428-09 ENST00000392112 GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-ZB-A96Q-01A-11D-A428-09 ENST00000573035 p.L424H ESCO2 chr8 27777032 27777032 Missense_Mutation G G A TCGA-ZB-A96Q-01A-11D-A428-09 ENST00000305188 p.E242K ARHGAP21 chr10 24595001 24595002 Frame_Shift_Ins - - AT TCGA-ZB-A96Q-01A-11D-A428-09 ENST00000396432 p.F1276Cfs*7 ARHGAP21 chr10 24595002 24595002 Missense_Mutation T T C TCGA-ZB-A96Q-01A-11D-A428-09 ENST00000396432 p.K1275R SIAE chr11 124673867 124673867 5'UTR T T - TCGA-ZB-A96Q-01A-11D-A428-09 ENST00000263593 GOLGA6L17P chr15 82524111 82524111 RNA C C T TCGA-ZB-A96Q-01A-11D-A428-09 ENST00000614358 ADGRG4 chrX 136345461 136345461 Silent T T C TCGA-ZB-A96Q-01A-11D-A428-09 ENST00000370652 p.T585T SCN2A chr2 165391662 165391663 3'UTR - - A TCGA-3G-AB0O-01A-22D-A423-09 ENST00000283256 ATXN7 chr3 64002004 64002004 3'UTR A A - TCGA-3G-AB0O-01A-22D-A423-09 ENST00000295900 FOXP1 chr3 70956432 70956432 3'UTR G G T TCGA-3G-AB0O-01A-22D-A423-09 ENST00000318789 SKIV2L2 chr5 55307859 55307859 5'UTR A A - TCGA-3G-AB0O-01A-22D-A423-09 ENST00000230640 CPEB3 chr10 92050070 92050070 3'UTR A A - TCGA-3G-AB0O-01A-22D-A423-09 ENST00000265997 DPF3 chr14 72670636 72670637 Intron TC TC - TCGA-3G-AB0O-01A-22D-A423-09 ENST00000556509 SNAI1 chr20 49988448 49988448 3'UTR A A - TCGA-3G-AB0O-01A-22D-A423-09 ENST00000244050 PCDHB13 chr5 141215034 141215035 Frame_Shift_Ins - - A TCGA-5U-AB0F-01A-11D-A423-09 ENST00000341948 p.Q307Tfs*11 GTF2IRD2B chr7 75148882 75148882 Missense_Mutation T T C TCGA-5U-AB0F-01A-11D-A423-09 ENST00000472837 p.V812A XKR6 chr8 10896816 10896816 3'UTR C C A TCGA-5U-AB0F-01A-11D-A423-09 ENST00000416569 MTAP chr9 21859341 21859341 Silent C C T TCGA-5U-AB0F-01A-11D-A423-09 ENST00000380172 p.N243N OR8B12 chr11 124543235 124543236 Frame_Shift_Del AC AC - TCGA-5U-AB0F-01A-11D-A423-09 ENST00000306842 p.C140Ffs*30 CFAP54 chr12 96685166 96685166 Missense_Mutation G G A TCGA-5U-AB0F-01A-11D-A423-09 ENST00000524981 p.S1981N DIAPH3 chr13 59911815 59911815 Missense_Mutation C C T TCGA-5U-AB0F-01A-11D-A423-09 ENST00000400324 p.D763N ATG14 chr14 55368227 55368227 3'UTR T T - TCGA-5U-AB0F-01A-11D-A423-09 ENST00000247178 KANSL1 chr17 46193619 46193619 Intron G G A TCGA-5U-AB0F-01A-11D-A423-09 ENST00000574590 PTPRM chr18 7888206 7888206 Missense_Mutation T T G TCGA-5U-AB0F-01A-11D-A423-09 ENST00000332175 p.F99L CLDND2 chr19 51367919 51367919 Missense_Mutation C C T TCGA-5U-AB0F-01A-11D-A423-09 ENST00000291715 p.G93S PTPRA chr20 3035685 3035685 Missense_Mutation G G A TCGA-5U-AB0F-01A-11D-A423-09 ENST00000380393 p.R674Q SEZ6L chr22 26297046 26297046 Silent C C T TCGA-5U-AB0F-01A-11D-A423-09 ENST00000248933 p.D376D HNRNPR chr1 23310381 23310382 3'UTR - - T TCGA-4V-A9QQ-01A-11D-A423-09 ENST00000302271 IFT122 chr3 129440285 129440285 5'UTR G G A TCGA-4V-A9QQ-01A-11D-A423-09 ENST00000348417 EPHA7 chr6 93242857 93242857 3'UTR G G C TCGA-4V-A9QQ-01A-11D-A423-09 ENST00000369303 SEPHS1 chr10 13318741 13318741 3'UTR A A - TCGA-4V-A9QQ-01A-11D-A423-09 ENST00000327347 AKT1 chr14 104780145 104780145 Missense_Mutation C C T TCGA-4V-A9QQ-01A-11D-A423-09 ENST00000349310 p.E40K KLF13 chr15 31376708 31376708 3'UTR C C T TCGA-4V-A9QQ-01A-11D-A423-09 ENST00000307145 DNAH3 chr16 21145282 21145282 Nonsense_Mutation A A T TCGA-4V-A9QQ-01A-11D-A423-09 ENST00000261383 p.L116* STAG2 chrX 124049076 124049076 Nonsense_Mutation C C A TCGA-4V-A9QQ-01A-11D-A423-09 ENST00000371144 p.Y297* HES3 chr1 6245503 6245503 Missense_Mutation A A G TCGA-XU-A92T-01A-11D-A423-09 ENST00000377898 p.N186S LDLRAP1 chr1 25554893 25554893 Missense_Mutation A A T TCGA-XU-A92T-01A-11D-A423-09 ENST00000374338 p.T89S PPAP2B chr1 56495635 56495635 3'UTR A A C TCGA-XU-A92T-01A-11D-A423-09 ENST00000371250 FGGY chr1 59321602 59321602 Missense_Mutation G G T TCGA-XU-A92T-01A-11D-A423-09 ENST00000303721 p.G18V OVGP1 chr1 111425411 111425411 Missense_Mutation T T A TCGA-XU-A92T-01A-11D-A423-09 ENST00000369732 p.I97F RPRD2 chr1 150473317 150473317 Missense_Mutation T T G TCGA-XU-A92T-01A-11D-A423-09 ENST00000369068 p.F1457V MYO7B chr2 127626987 127626987 Nonsense_Mutation C C T TCGA-XU-A92T-01A-11D-A423-09 ENST00000409816 p.Q1384* SLMAP chr3 57858115 57858115 Missense_Mutation T T C TCGA-XU-A92T-01A-11D-A423-09 ENST00000428312 p.S215P FOXL2NB chr3 138949588 138949588 Missense_Mutation C C T TCGA-XU-A92T-01A-11D-A423-09 ENST00000383165 p.P57S ZNF718 chr4 124612 124612 5'UTR G G A TCGA-XU-A92T-01A-11D-A423-09 ENST00000510175 ENAM chr4 70642468 70642468 Missense_Mutation C C A TCGA-XU-A92T-01A-11D-A423-09 ENST00000396073 p.P348T GALNT7 chr4 173323128 173323128 3'UTR A A - TCGA-XU-A92T-01A-11D-A423-09 ENST00000265000 LIFR chr5 38528748 38528748 Missense_Mutation A A T TCGA-XU-A92T-01A-11D-A423-09 ENST00000263409 p.Y79N FKBPL chr6 32128947 32128947 Silent C C T TCGA-XU-A92T-01A-11D-A423-09 ENST00000375156 p.V278V DNAH8 chr6 38883972 38883972 Missense_Mutation C C T TCGA-XU-A92T-01A-11D-A423-09 ENST00000359357 p.P2528S MAP3K4 chr6 161112695 161112695 Missense_Mutation G G A TCGA-XU-A92T-01A-11D-A423-09 ENST00000392142 p.R1516H GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-XU-A92T-01A-11D-A423-09 ENST00000573035 p.L424H PPP1R42 chr8 67014437 67014438 Frame_Shift_Del TT TT - TCGA-XU-A92T-01A-11D-A423-09 ENST00000324682 p.K95Tfs*29 RP11-526D8.7 chr9 92884528 92884528 Intron G G A TCGA-XU-A92T-01A-11D-A423-09 ENST00000451452 KIAA1958 chr9 112660426 112660427 3'UTR - - A TCGA-XU-A92T-01A-11D-A423-09 ENST00000337530 CUBN chr10 17043826 17043826 Splice_Site C C T TCGA-XU-A92T-01A-11D-A423-09 ENST00000377833 p.X1277_splice HRAS chr11 534285 534285 Missense_Mutation C C A TCGA-XU-A92T-01A-11D-A423-09 ENST00000311189 p.G13V VWA5A chr11 124145972 124145972 3'UTR T T - TCGA-XU-A92T-01A-11D-A423-09 ENST00000392748 PTPN6 chr12 6946682 6946682 5'Flank C C - TCGA-XU-A92T-01A-11D-A423-09 ENST00000318974 GCN1L1 chr12 120127576 120127576 3'UTR T T C TCGA-XU-A92T-01A-11D-A423-09 ENST00000300648 CHRNA7 chr15 32168303 32168303 Missense_Mutation G G A TCGA-XU-A92T-01A-11D-A423-09 ENST00000306901 p.E452K GOLGA6L17P chr15 82523900 82523900 RNA A A G TCGA-XU-A92T-01A-11D-A423-09 ENST00000614358 GOLGA6L17P chr15 82523901 82523901 RNA C C T TCGA-XU-A92T-01A-11D-A423-09 ENST00000614358 GRIN2A chr16 9762982 9762982 3'Flank G G A TCGA-XU-A92T-01A-11D-A423-09 ENST00000330684 HNF1B chr17 37731440 37731440 Intron T T G TCGA-XU-A92T-01A-11D-A423-09 ENST00000617811 ZNF652 chr17 49296421 49296421 3'UTR T T C TCGA-XU-A92T-01A-11D-A423-09 ENST00000362063 PPM1E chr17 58980483 58980483 Nonsense_Mutation C C T TCGA-XU-A92T-01A-11D-A423-09 ENST00000308249 p.Q574* SCGB2B2 chr19 34594229 34594229 Missense_Mutation C C A TCGA-XU-A92T-01A-11D-A423-09 ENST00000379204 p.Q64H MYH14 chr19 50250661 50250661 Missense_Mutation C C A TCGA-XU-A92T-01A-11D-A423-09 ENST00000376970 p.D593E GTSF1L chr20 43726494 43726494 Missense_Mutation G G C TCGA-XU-A92T-01A-11D-A423-09 ENST00000373003 p.S67R KIAA1671 chr22 25038980 25038980 Missense_Mutation A A G TCGA-XU-A92T-01A-11D-A423-09 ENST00000358431 p.H617R SREBF2 chr22 41866945 41866947 In_Frame_Del GCA GCA - TCGA-XU-A92T-01A-11D-A423-09 ENST00000361204 p.S74del NDP chrX 43958720 43958720 5'UTR C C T TCGA-XU-A92T-01A-11D-A423-09 ENST00000378062 TRO chrX 54929921 54929921 Missense_Mutation A A G TCGA-XU-A92T-01A-11D-A423-09 ENST00000173898 p.N1066S RGAG4 chrX 72131182 72131182 Missense_Mutation G G C TCGA-XU-A92T-01A-11D-A423-09 ENST00000479991 p.P120R NXT2 chrX 109544471 109544471 3'UTR A A T TCGA-XU-A92T-01A-11D-A423-09 ENST00000372106 AIFM1 chrX 130136062 130136062 Missense_Mutation G G A TCGA-XU-A92T-01A-11D-A423-09 ENST00000287295 p.R430C TAS1R1 chr1 6578722 6578722 Missense_Mutation G G A TCGA-XU-A936-01A-11D-A428-09 ENST00000333172 p.R555H POU3F1 chr1 38044596 38044596 3'UTR T T - TCGA-XU-A936-01A-11D-A428-09 ENST00000373012 TRIM46 chr1 155177060 155177060 Silent C C G TCGA-XU-A936-01A-11D-A428-09 ENST00000334634 p.A266A SWT1 chr1 185221979 185221979 Missense_Mutation G G A TCGA-XU-A936-01A-11D-A428-09 ENST00000367500 p.R751K GMCL1 chr2 69879087 69879087 3'UTR G G C TCGA-XU-A936-01A-11D-A428-09 ENST00000282570 CLASP1 chr2 121337817 121337817 3'UTR T T - TCGA-XU-A936-01A-11D-A428-09 ENST00000263710 ATP6V1A chr3 113778795 113778795 Silent A A G TCGA-XU-A936-01A-11D-A428-09 ENST00000273398 p.K14K SMARCAD1 chr4 94278928 94278929 Frame_Shift_Ins - - A TCGA-XU-A936-01A-11D-A428-09 ENST00000354268 p.N768Kfs*28 NIPBL chr5 37065618 37065618 3'UTR T T A TCGA-XU-A936-01A-11D-A428-09 ENST00000282516 RAPGEF6 chr5 131479669 131479669 Missense_Mutation C C A TCGA-XU-A936-01A-11D-A428-09 ENST00000509018 p.R642L TNXB chr6 32062200 32062200 Silent G G A TCGA-XU-A936-01A-11D-A428-09 ENST00000375244 p.H2375H VPS13B chr8 99103099 99103099 Missense_Mutation C C T TCGA-XU-A936-01A-11D-A428-09 ENST00000358544 p.R187C CER1 chr9 14720323 14720323 Missense_Mutation C C T TCGA-XU-A936-01A-11D-A428-09 ENST00000380911 p.G191R RP11-87H9.2 chr9 40992530 40992530 RNA G G T TCGA-XU-A936-01A-11D-A428-09 ENST00000611606 CAMK1D chr10 12829237 12829237 3'UTR A A - TCGA-XU-A936-01A-11D-A428-09 ENST00000619168 IGF2 chr11 2133641 2133641 Missense_Mutation C C T TCGA-XU-A936-01A-11D-A428-09 ENST00000300632 p.R61H BSCL2 chr11 62694671 62694671 Missense_Mutation A A C TCGA-XU-A936-01A-11D-A428-09 ENST00000403550 p.L112R AP000721.4 chr11 63974696 63974696 Missense_Mutation C C T TCGA-XU-A936-01A-11D-A428-09 ENST00000535431 p.P6S NPAT chr11 108158147 108158147 3'UTR T T - TCGA-XU-A936-01A-11D-A428-09 ENST00000278612 TMEM225 chr11 123884603 123884603 Missense_Mutation G G A TCGA-XU-A936-01A-11D-A428-09 ENST00000375026 p.S72L DRAM1 chr12 101908330 101908330 Missense_Mutation A A T TCGA-XU-A936-01A-11D-A428-09 ENST00000258534 p.I163F ADAM10 chr15 58596626 58596626 3'UTR T T C TCGA-XU-A936-01A-11D-A428-09 ENST00000260408 SNN chr16 11678252 11678252 3'UTR G G T TCGA-XU-A936-01A-11D-A428-09 ENST00000329565 SNN chr16 11678253 11678253 3'UTR A A T TCGA-XU-A936-01A-11D-A428-09 ENST00000329565 ALOX12 chr17 7006561 7006561 Nonsense_Mutation G G A TCGA-XU-A936-01A-11D-A428-09 ENST00000251535 p.W498* CHD3 chr17 7907428 7907428 Missense_Mutation C C T TCGA-XU-A936-01A-11D-A428-09 ENST00000330494 p.P1622S SUPT6H chr17 28677793 28677793 Missense_Mutation G G C TCGA-XU-A936-01A-11D-A428-09 ENST00000314616 p.A326P ZNF614 chr19 52018434 52018434 Missense_Mutation C C A TCGA-XU-A936-01A-11D-A428-09 ENST00000270649 p.D26Y ARMCX4 chrX 101492612 101492612 Intron G G A TCGA-XU-A936-01A-11D-A428-09 ENST00000433011 SPOCD1 chr1 31790724 31790724 Missense_Mutation C C T TCGA-ZB-A962-01A-11D-A428-09 ENST00000360482 p.R1177H GOLT1A chr1 204199130 204199130 Intron C C T TCGA-ZB-A962-01A-11D-A428-09 ENST00000308302 CD200R1 chr3 112929357 112929357 Missense_Mutation G G A TCGA-ZB-A962-01A-11D-A428-09 ENST00000471858 p.T95I SPATA16 chr3 172913697 172913697 Silent T T C TCGA-ZB-A962-01A-11D-A428-09 ENST00000351008 p.R517R ELOVL6 chr4 110049888 110049888 3'UTR T T - TCGA-ZB-A962-01A-11D-A428-09 ENST00000302274 ADAMTS16 chr5 5146272 5146272 Silent C C T TCGA-ZB-A962-01A-11D-A428-09 ENST00000274181 p.H106H ATP6AP1L chr5 82305323 82305324 5'UTR - - A TCGA-ZB-A962-01A-11D-A428-09 ENST00000380167 LGSN chr6 63279887 63279887 3'UTR A A - TCGA-ZB-A962-01A-11D-A428-09 ENST00000370657 MAP3K7 chr6 90516349 90516349 3'UTR A A C TCGA-ZB-A962-01A-11D-A428-09 ENST00000369329 GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-ZB-A962-01A-11D-A428-09 ENST00000573035 p.L424H PDK4 chr7 95593767 95593767 Silent A A G TCGA-ZB-A962-01A-11D-A428-09 ENST00000005178 p.Y92Y PRKAR2B chr7 107157261 107157261 Missense_Mutation G G T TCGA-ZB-A962-01A-11D-A428-09 ENST00000265717 p.A354S UBE3C chr7 157268510 157268510 3'UTR A A G TCGA-ZB-A962-01A-11D-A428-09 ENST00000348165 NAA35 chr9 86022289 86022289 3'UTR A A - TCGA-ZB-A962-01A-11D-A428-09 ENST00000361671 PHF2 chr9 93679524 93679524 3'UTR G G T TCGA-ZB-A962-01A-11D-A428-09 ENST00000359246 NRG3 chr10 82166809 82166809 Intron C C T TCGA-ZB-A962-01A-11D-A428-09 ENST00000404547 HRAS chr11 534289 534289 Missense_Mutation C C G TCGA-ZB-A962-01A-11D-A428-09 ENST00000311189 p.G12R MUC2 chr11 1092435 1092435 RNA G G A TCGA-ZB-A962-01A-11D-A428-09 ENST00000361558 NCAM1 chr11 113273563 113273563 Intron C C A TCGA-ZB-A962-01A-11D-A428-09 ENST00000316851 SLC2A3 chr12 7921320 7921321 3'UTR AG AG - TCGA-ZB-A962-01A-11D-A428-09 ENST00000075120 KMT2D chr12 49019798 49019798 3'UTR A A - TCGA-ZB-A962-01A-11D-A428-09 ENST00000301067 OTOGL chr12 80329085 80329085 Missense_Mutation G G T TCGA-ZB-A962-01A-11D-A428-09 ENST00000547103 p.M1429I SYNE2 chr14 64139998 64139998 Silent G G T TCGA-ZB-A962-01A-11D-A428-09 ENST00000344113 p.L4967L SLC39A9 chr14 69428701 69428701 Intron C C T TCGA-ZB-A962-01A-11D-A428-09 ENST00000336643 CATSPERB chr14 91589556 91589556 Missense_Mutation G G C TCGA-ZB-A962-01A-11D-A428-09 ENST00000256343 p.N978K EXOC3L4 chr14 103104322 103104322 Missense_Mutation C C A TCGA-ZB-A962-01A-11D-A428-09 ENST00000380069 p.A406E FLYWCH1 chr16 2933737 2933737 Missense_Mutation C C T TCGA-ZB-A962-01A-11D-A428-09 ENST00000253928 p.T424M SLC9A5 chr16 67265082 67265082 Nonsense_Mutation C C T TCGA-ZB-A962-01A-11D-A428-09 ENST00000299798 p.R686* SPG7 chr16 89550523 89550523 Missense_Mutation A A G TCGA-ZB-A962-01A-11D-A428-09 ENST00000268704 p.K565E SLC47A1 chr17 19577385 19577388 Frame_Shift_Del TCAG TCAG - TCGA-ZB-A962-01A-11D-A428-09 ENST00000270570 p.S517Ifs*38 NF1 chr17 31350265 31350265 Missense_Mutation G G T TCGA-ZB-A962-01A-11D-A428-09 ENST00000358273 p.M2468I NF1 chr17 31350266 31350266 Nonsense_Mutation G G T TCGA-ZB-A962-01A-11D-A428-09 ENST00000358273 p.E2469* CRHR1 chr17 45807037 45807037 Missense_Mutation G G A TCGA-ZB-A962-01A-11D-A428-09 ENST00000398285 p.V21I PPP1R9B chr17 50133935 50133935 3'UTR G G C TCGA-ZB-A962-01A-11D-A428-09 ENST00000612501 DDX5 chr17 64500035 64500035 Missense_Mutation C C T TCGA-ZB-A962-01A-11D-A428-09 ENST00000225792 p.G578E SERTAD3 chr19 40440886 40440887 3'UTR - - AA TCGA-ZB-A962-01A-11D-A428-09 ENST00000322354 GLTSCR1 chr19 47702589 47702589 3'UTR G G - TCGA-ZB-A962-01A-11D-A428-09 ENST00000396720 NLRP8 chr19 55954613 55954613 Silent C C T TCGA-ZB-A962-01A-11D-A428-09 ENST00000291971 p.H185H ZIM3 chr19 57135502 57135502 Missense_Mutation A A G TCGA-ZB-A962-01A-11D-A428-09 ENST00000269834 p.Y279H SLC9A8 chr20 49855497 49855497 Missense_Mutation A A G TCGA-ZB-A962-01A-11D-A428-09 ENST00000361573 p.N210S ZNF217 chr20 53567845 53567845 3'UTR T T - TCGA-ZB-A962-01A-11D-A428-09 ENST00000302342 PPT1 chr1 40092426 40092426 Missense_Mutation G G T TCGA-YT-A95H-01A-11D-A428-09 ENST00000433473 p.S69Y HGFAC chr4 3444042 3444057 Frame_Shift_Del CCCTGGATCCCTGTGC CCCTGGATCCCTGTGC - TCGA-YT-A95H-01A-11D-A428-09 ENST00000382774 p.L161Pfs*81 E2F3 chr6 20493567 20493568 3'UTR AC AC - TCGA-YT-A95H-01A-11D-A428-09 ENST00000346618 VEGFA chr6 43784921 43784922 3'Flank TA TA - TCGA-YT-A95H-01A-11D-A428-09 ENST00000523873 GLCCI1 chr7 8088241 8088242 3'UTR TG TG - TCGA-YT-A95H-01A-11D-A428-09 ENST00000223145 PI15 chr8 74849332 74849332 3'UTR C C A TCGA-YT-A95H-01A-11D-A428-09 ENST00000260113 FAM95B1 chr9 40327086 40327086 RNA C C T TCGA-YT-A95H-01A-11D-A428-09 ENST00000592873 GABPB1 chr15 50278408 50278408 3'UTR A A - TCGA-YT-A95H-01A-11D-A428-09 ENST00000220429 ANKRD30B chr18 14852498 14852499 3'Flank AT AT - TCGA-YT-A95H-01A-11D-A428-09 ENST00000358984 HNRNPL chr19 38836462 38836462 3'UTR A A - TCGA-YT-A95H-01A-11D-A428-09 ENST00000221419 CSNK1E chr22 38290859 38290859 3'UTR A A - TCGA-YT-A95H-01A-11D-A428-09 ENST00000359867 SH3KBP1 chrX 19535693 19535693 3'UTR T T - TCGA-YT-A95H-01A-11D-A428-09 ENST00000397821 AJ271736.1 chrX 156021707 156021707 5'Flank G G A TCGA-YT-A95H-01A-11D-A428-09 ENST00000616415 AHCYL1 chr1 110023589 110023589 3'UTR A A - TCGA-X7-A8M7-01A-11D-A423-09 ENST00000369799 KCNK1 chr1 233671922 233671922 3'UTR A A - TCGA-X7-A8M7-01A-11D-A423-09 ENST00000366621 RREB1 chr6 7249800 7249802 3'UTR TAT TAT - TCGA-X7-A8M7-01A-11D-A423-09 ENST00000349384 C9orf163 chr9 136485477 136485477 RNA G G T TCGA-X7-A8M7-01A-11D-A423-09 ENST00000624034 TUBBP5 chr9 138174662 138174662 RNA G G A TCGA-X7-A8M7-01A-11D-A423-09 ENST00000503395 GATC chr12 120461900 120461900 3'UTR A A - TCGA-X7-A8M7-01A-11D-A423-09 ENST00000551765 DNM1P47 chr15 101758206 101758206 RNA C C T TCGA-X7-A8M7-01A-11D-A423-09 ENST00000561463 CHD5 chr1 6109910 6109910 Silent G G A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000262450 p.P1821P FPGT-TNNI3K chr1 74199665 74199665 Splice_Region C C T TCGA-ZB-A96V-01A-11D-A428-09 ENST00000557284 p.G41G COL24A1 chr1 85729423 85729424 3'UTR - - T TCGA-ZB-A96V-01A-11D-A428-09 ENST00000370571 NGF chr1 115286642 115286642 Missense_Mutation G G T TCGA-ZB-A96V-01A-11D-A428-09 ENST00000369512 p.R52S FLG chr1 152305688 152305688 Silent C C T TCGA-ZB-A96V-01A-11D-A428-09 ENST00000368799 p.V3066V ASH1L chr1 155346375 155346375 Splice_Region C C T TCGA-ZB-A96V-01A-11D-A428-09 ENST00000368346 INTS7 chr1 211968617 211968617 Missense_Mutation A A C TCGA-ZB-A96V-01A-11D-A428-09 ENST00000366994 p.C636G TBCE chr1 235414524 235414524 Missense_Mutation G G A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000366601 p.D93N TMEM87B chr2 112097077 112097077 Silent C C T TCGA-ZB-A96V-01A-11D-A428-09 ENST00000283206 p.L380L EPB41L5 chr2 120174899 120174899 Missense_Mutation G G A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000263713 p.E732K ARHGEF4 chr2 130914692 130914692 5'Flank G G T TCGA-ZB-A96V-01A-11D-A428-09 ENST00000326016 COL5A2 chr2 189086737 189086737 Missense_Mutation G G C TCGA-ZB-A96V-01A-11D-A428-09 ENST00000374866 p.Q227E IDH1 chr2 208248389 208248389 Missense_Mutation G G A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000345146 p.R132C TGFBR2 chr3 30691539 30691539 Silent G G A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000295754 p.S548S RASSF1 chr3 50332154 50332154 Missense_Mutation C C T TCGA-ZB-A96V-01A-11D-A428-09 ENST00000357043 p.D124N PHLDB2 chr3 111966643 111966643 Silent A A G TCGA-ZB-A96V-01A-11D-A428-09 ENST00000393925 p.E1036E UBA5 chr3 132660657 132660657 Missense_Mutation C C G TCGA-ZB-A96V-01A-11D-A428-09 ENST00000356232 p.I40M PLCH1 chr3 155482681 155482681 Missense_Mutation C C A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000340059 p.L1123F ADGRA3 chr4 22454916 22454916 Silent T T G TCGA-ZB-A96V-01A-11D-A428-09 ENST00000334304 p.I141I KLF3 chr4 38694862 38694862 Missense_Mutation A A G TCGA-ZB-A96V-01A-11D-A428-09 ENST00000261438 p.Y271C GRIA2 chr4 157321540 157321540 Missense_Mutation G G C TCGA-ZB-A96V-01A-11D-A428-09 ENST00000264426 p.E275Q TAF9 chr5 69366693 69366693 Intron C C T TCGA-ZB-A96V-01A-11D-A428-09 ENST00000380822 PCDHB2 chr5 141096447 141096447 Missense_Mutation G G A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000194155 p.V553M FAF2 chr5 176507514 176507515 3'UTR - - TA TCGA-ZB-A96V-01A-11D-A428-09 ENST00000261942 HIST1H2AD chr6 26199140 26199140 Missense_Mutation A A T TCGA-ZB-A96V-01A-11D-A428-09 ENST00000341023 p.L35H HIST1H4K chr6 27831518 27831518 Missense_Mutation G G A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000611927 p.R4C GPANK1 chr6 31662631 31662631 Missense_Mutation G G A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000375906 p.H236Y TAP1 chr6 32853051 32853051 Missense_Mutation G G A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000354258 p.L256F AIM1 chr6 106555787 106555787 Missense_Mutation G G A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000369066 p.E1461K PARP12 chr7 140023757 140023757 3'UTR A A C TCGA-ZB-A96V-01A-11D-A428-09 ENST00000263549 GIMAP8 chr7 150477419 150477419 Missense_Mutation C C A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000307271 p.A546E MTMR7 chr8 17371091 17371091 Nonsense_Mutation G G A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000180173 p.Q86* C8orf44 chr8 66677714 66677714 Silent G G A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000390159 p.R2R PLEC chr8 143921316 143921316 Silent G G A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000322810 p.F2972F GLIS3 chr9 3898613 3898613 Intron A A T TCGA-ZB-A96V-01A-11D-A428-09 ENST00000324333 CNTNAP3 chr9 39073068 39073068 3'UTR G G A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000297668 NEUROG3 chr10 69572799 69572799 Missense_Mutation C C T TCGA-ZB-A96V-01A-11D-A428-09 ENST00000242462 p.R82Q ACTA2 chr10 88932777 88932777 3'Flank C C T TCGA-ZB-A96V-01A-11D-A428-09 ENST00000458208 ADGRA1 chr10 133129139 133129139 Silent C C T TCGA-ZB-A96V-01A-11D-A428-09 ENST00000392607 p.A437A CYP2E1 chr10 133528495 133528495 Silent C C T TCGA-ZB-A96V-01A-11D-A428-09 ENST00000252945 p.F64F SOX6 chr11 16046568 16046568 Silent G G A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000528429 p.D523D DDX6 chr11 118786293 118786293 5'UTR G G C TCGA-ZB-A96V-01A-11D-A428-09 ENST00000526070 OPCML chr11 132437257 132437257 Missense_Mutation G G C TCGA-ZB-A96V-01A-11D-A428-09 ENST00000331898 p.A210G PYROXD1 chr12 21469916 21469916 3'UTR T T G TCGA-ZB-A96V-01A-11D-A428-09 ENST00000240651 ATP2B1 chr12 89588860 89588860 3'UTR C C T TCGA-ZB-A96V-01A-11D-A428-09 ENST00000428670 ANKS1B chr12 99246865 99246865 Splice_Site C C T TCGA-ZB-A96V-01A-11D-A428-09 ENST00000547776 p.X586_splice MYBPC1 chr12 101653125 101653125 Silent G G A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000550270 p.K523K UBE3B chr12 109490103 109490103 Intron G G A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000342494 HECTD4 chr12 112279242 112279242 Frame_Shift_Del A A - TCGA-ZB-A96V-01A-11D-A428-09 ENST00000550722 p.L414Cfs*4 RNF10 chr12 120575948 120575948 Missense_Mutation C C G TCGA-ZB-A96V-01A-11D-A428-09 ENST00000325954 p.S786C COL4A2 chr13 110512138 110512138 Missense_Mutation G G A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000360467 p.G1696S PCK2 chr14 24098536 24098536 Silent C C T TCGA-ZB-A96V-01A-11D-A428-09 ENST00000216780 p.I174I GPHN chr14 66507738 66507738 5'UTR C C T TCGA-ZB-A96V-01A-11D-A428-09 ENST00000315266 LGMN chr14 92711921 92711921 Silent C C T TCGA-ZB-A96V-01A-11D-A428-09 ENST00000334869 p.S215S NUSAP1 chr15 41332920 41332920 5'UTR G G C TCGA-ZB-A96V-01A-11D-A428-09 ENST00000559596 LDHAL6B chr15 59207063 59207063 Silent C C A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000307144 p.T41T CLCN7 chr16 1447079 1447079 Missense_Mutation G G A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000382745 p.S753L SRRM2 chr16 2768594 2768594 Intron T T G TCGA-ZB-A96V-01A-11D-A428-09 ENST00000301740 KIAA0430 chr16 15612615 15612615 Nonsense_Mutation G G C TCGA-ZB-A96V-01A-11D-A428-09 ENST00000396368 p.S1139* CCDC101 chr16 28590795 28590795 Missense_Mutation C C T TCGA-ZB-A96V-01A-11D-A428-09 ENST00000317058 p.R209C CYLD chr16 50777915 50777915 Nonsense_Mutation C C A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000311559 p.S371* SLC47A1 chr17 19548035 19548035 Silent T T C TCGA-ZB-A96V-01A-11D-A428-09 ENST00000270570 p.S119S TBC1D3P1-DHX40P1 chr17 59989315 59989315 RNA C C A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000587125 DNAH17 chr17 78526939 78526939 Missense_Mutation C C T TCGA-ZB-A96V-01A-11D-A428-09 ENST00000389840 p.V1189M KATNAL2 chr18 47069548 47069548 Missense_Mutation C C T TCGA-ZB-A96V-01A-11D-A428-09 ENST00000356157 p.S319F DSEL chr18 67514604 67514604 Missense_Mutation G G A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000310045 p.A12V RTTN chr18 70065832 70065832 Nonsense_Mutation G G A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000255674 p.Q1582* DUS3L chr19 5791117 5791117 Missense_Mutation G G T TCGA-ZB-A96V-01A-11D-A428-09 ENST00000309061 p.P9T MYO1F chr19 8550638 8550638 Silent G G A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000338257 p.L276L SMARCA4 chr19 11021837 11021837 Missense_Mutation C C T TCGA-ZB-A96V-01A-11D-A428-09 ENST00000344626 p.T910M SMARCA4 chr19 11030817 11030817 Missense_Mutation G G A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000344626 p.R1157Q PVR chr19 44649829 44649829 Missense_Mutation G G C TCGA-ZB-A96V-01A-11D-A428-09 ENST00000425690 p.E150Q EMP3 chr19 48329456 48329456 Missense_Mutation C C T TCGA-ZB-A96V-01A-11D-A428-09 ENST00000270221 p.L96F ZNF600 chr19 52766037 52766037 Silent A A C TCGA-ZB-A96V-01A-11D-A428-09 ENST00000338230 p.R573R IDH3B chr20 2658751 2658751 Nonstop_Mutation C C G TCGA-ZB-A96V-01A-11D-A428-09 ENST00000380843 p.*386Yext*29 ASXL1 chr20 32434638 32434639 Frame_Shift_Ins - - G TCGA-ZB-A96V-01A-11D-A428-09 ENST00000375687 p.G646Wfs*12 BACH1 chr21 29344353 29344353 3'UTR G G A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000286800 LRRC74B chr22 21048911 21048911 Intron C C A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000442047 TTC28 chr22 28105590 28105590 Missense_Mutation G G A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000397906 p.A999V CHEK2 chr22 28694061 28694061 Nonsense_Mutation C C A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000328354 p.E478* MAFF chr22 38216375 38216375 3'UTR A A - TCGA-ZB-A96V-01A-11D-A428-09 ENST00000338483 USP9X chrX 41223282 41223282 Missense_Mutation G G A TCGA-ZB-A96V-01A-11D-A428-09 ENST00000324545 p.D2211N DLG3 chrX 70450264 70450264 Missense_Mutation C C G TCGA-ZB-A96V-01A-11D-A428-09 ENST00000374360 p.Q267E KIAA2022 chrX 74743593 74743593 Silent G G T TCGA-ZB-A96V-01A-11D-A428-09 ENST00000055682 p.R322R CUL4B chrX 120524770 120524770 3'Flank T T - TCGA-ZB-A96V-01A-11D-A428-09 ENST00000404115 LRRC7 chr1 69919362 69919362 Intron G G A TCGA-XU-A930-01A-11D-A423-09 ENST00000035383 DNM3 chr1 171987805 171987805 Missense_Mutation G G A TCGA-XU-A930-01A-11D-A423-09 ENST00000355305 p.V129M PPP1R12B chr1 202495342 202495342 Missense_Mutation C C T TCGA-XU-A930-01A-11D-A423-09 ENST00000608999 p.T732M MIR205HG chr1 209432227 209432228 RNA - - GG TCGA-XU-A930-01A-11D-A423-09 ENST00000366437 TTC30A chr2 177618715 177618715 5'UTR G G A TCGA-XU-A930-01A-11D-A423-09 ENST00000355689 COL5A2 chr2 189045190 189045190 Missense_Mutation G G A TCGA-XU-A930-01A-11D-A423-09 ENST00000374866 p.R1118C IKZF2 chr2 213001379 213001380 3'Flank - - T TCGA-XU-A930-01A-11D-A423-09 ENST00000434687 MAP4 chr3 47891822 47891822 Intron A A C TCGA-XU-A930-01A-11D-A423-09 ENST00000360240 RICTOR chr5 38981828 38981828 Intron T T A TCGA-XU-A930-01A-11D-A423-09 ENST00000357387 RUFY1 chr5 179567536 179567536 Silent G G C TCGA-XU-A930-01A-11D-A423-09 ENST00000319449 p.V226V BMP5 chr6 55774115 55774115 Nonsense_Mutation G G A TCGA-XU-A930-01A-11D-A423-09 ENST00000370830 p.R321* ZAN chr7 100797587 100797587 Nonsense_Mutation C C T TCGA-XU-A930-01A-11D-A423-09 ENST00000613979 p.Q2793* PSMC2 chr7 103368034 103368034 Missense_Mutation C C T TCGA-XU-A930-01A-11D-A423-09 ENST00000292644 p.R428C NFIB chr9 14084291 14084291 3'UTR T T C TCGA-XU-A930-01A-11D-A423-09 ENST00000380959 PSIP1 chr9 15510277 15510277 5'UTR G G C TCGA-XU-A930-01A-11D-A423-09 ENST00000380733 SETX chr9 132263809 132263809 3'UTR T T - TCGA-XU-A930-01A-11D-A423-09 ENST00000224140 EED chr11 86268518 86268518 Missense_Mutation A A G TCGA-XU-A930-01A-11D-A423-09 ENST00000263360 p.Y308C BAZ2A chr12 56611540 56611540 Intron A A C TCGA-XU-A930-01A-11D-A423-09 ENST00000551812 PHLDA1 chr12 76030727 76030727 Missense_Mutation G G A TCGA-XU-A930-01A-11D-A423-09 ENST00000266671 p.P339S PPFIA2 chr12 81405862 81405862 Missense_Mutation T T G TCGA-XU-A930-01A-11D-A423-09 ENST00000549396 p.K229N NAA16 chr13 41358441 41358441 Nonsense_Mutation G G T TCGA-XU-A930-01A-11D-A423-09 ENST00000379406 p.E409* PABPN1 chr14 23325428 23325428 3'UTR G G C TCGA-XU-A930-01A-11D-A423-09 ENST00000216727 GMFB chr14 54477494 54477494 3'UTR C C T TCGA-XU-A930-01A-11D-A423-09 ENST00000358056 IGHV2-70 chr14 106775445 106775445 5'Flank A A C TCGA-XU-A930-01A-11D-A423-09 ENST00000617374 TGM5 chr15 43233335 43233335 Silent G G T TCGA-XU-A930-01A-11D-A423-09 ENST00000220420 p.V673V SIN3A chr15 75400065 75400065 Missense_Mutation T T C TCGA-XU-A930-01A-11D-A423-09 ENST00000360439 p.Y610C ADAMTSL3 chr15 83970567 83970567 Silent C C T TCGA-XU-A930-01A-11D-A423-09 ENST00000286744 p.L858L DNM1P47 chr15 101754120 101754120 RNA G G T TCGA-XU-A930-01A-11D-A423-09 ENST00000561463 GABARAP chr17 7242266 7242266 Missense_Mutation C C T TCGA-XU-A930-01A-11D-A423-09 ENST00000302386 p.R22Q SPDYE4 chr17 8758445 8758445 5'UTR C C T TCGA-XU-A930-01A-11D-A423-09 ENST00000328794 GAS2L2 chr17 35744972 35744972 Missense_Mutation C C T TCGA-XU-A930-01A-11D-A423-09 ENST00000604641 p.G842E USP32 chr17 60249556 60249556 Intron C C T TCGA-XU-A930-01A-11D-A423-09 ENST00000300896 APCDD1 chr18 10471544 10471544 Missense_Mutation C C T TCGA-XU-A930-01A-11D-A423-09 ENST00000355285 p.S86L ASXL1 chr20 32434639 32434639 Frame_Shift_Del G G - TCGA-XU-A930-01A-11D-A423-09 ENST00000375687 p.G645Vfs*58 SRPX2 chrX 100670841 100670841 Missense_Mutation A A C TCGA-XU-A930-01A-11D-A423-09 ENST00000373004 p.M418L POU3F1 chr1 38045276 38045276 3'UTR T T - TCGA-ZB-A96C-01A-11D-A428-09 ENST00000373012 LRRC7 chr1 69919803 69919803 Intron C C T TCGA-ZB-A96C-01A-11D-A428-09 ENST00000035383 ACVR2A chr2 147928165 147928165 3'UTR T T - TCGA-ZB-A96C-01A-11D-A428-09 ENST00000241416 CCDC108 chr2 219005537 219005537 Silent T T G TCGA-ZB-A96C-01A-11D-A428-09 ENST00000341552 p.R1650R PTPRN chr2 219300174 219300174 Missense_Mutation G G C TCGA-ZB-A96C-01A-11D-A428-09 ENST00000295718 p.P416R IQCA1 chr2 236338213 236338213 Missense_Mutation G G T TCGA-ZB-A96C-01A-11D-A428-09 ENST00000409907 p.S709Y HES1 chr3 194138185 194138185 Missense_Mutation C C G TCGA-ZB-A96C-01A-11D-A428-09 ENST00000232424 p.S265R GCNT2 chr6 10626643 10626643 3'UTR G G A TCGA-ZB-A96C-01A-11D-A428-09 ENST00000379597 ZSCAN16 chr6 28129665 28129665 Silent C C T TCGA-ZB-A96C-01A-11D-A428-09 ENST00000340487 p.H254H FILIP1 chr6 75313028 75313028 Missense_Mutation A A G TCGA-ZB-A96C-01A-11D-A428-09 ENST00000237172 p.F935S MARCKS chr6 113861089 113861089 3'UTR A A - TCGA-ZB-A96C-01A-11D-A428-09 ENST00000612661 LFNG chr7 2525715 2525715 Missense_Mutation G G A TCGA-ZB-A96C-01A-11D-A428-09 ENST00000222725 p.G256S GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-ZB-A96C-01A-11D-A428-09 ENST00000573035 p.L424H OPRK1 chr8 53229145 53229145 3'UTR T T A TCGA-ZB-A96C-01A-11D-A428-09 ENST00000265572 MAMDC4 chr9 136855775 136855775 Silent C C T TCGA-ZB-A96C-01A-11D-A428-09 ENST00000445819 p.D505D SLC22A6 chr11 62977382 62977382 Missense_Mutation G G T TCGA-ZB-A96C-01A-11D-A428-09 ENST00000377871 p.T456K P2RY6 chr11 73297749 73297749 3'UTR G G T TCGA-ZB-A96C-01A-11D-A428-09 ENST00000349767 P2RY6 chr11 73297750 73297750 3'UTR A A T TCGA-ZB-A96C-01A-11D-A428-09 ENST00000349767 PHLDB1 chr11 118656984 118656984 3'UTR A A G TCGA-ZB-A96C-01A-11D-A428-09 ENST00000361417 OR6M1 chr11 123805959 123805959 Missense_Mutation T T C TCGA-ZB-A96C-01A-11D-A428-09 ENST00000309154 p.T131A BBS10 chr12 76347666 76347666 Missense_Mutation G G A TCGA-ZB-A96C-01A-11D-A428-09 ENST00000393262 p.P107S PPFIA2 chr12 81295015 81295015 Silent C C T TCGA-ZB-A96C-01A-11D-A428-09 ENST00000549396 p.A915A SACS chr13 23339270 23339270 Missense_Mutation C C A TCGA-ZB-A96C-01A-11D-A428-09 ENST00000382292 p.V1536L GAN chr16 81379917 81379917 3'UTR T T - TCGA-ZB-A96C-01A-11D-A428-09 ENST00000568107 SPIRE2 chr16 89870228 89870228 Nonsense_Mutation C C T TCGA-ZB-A96C-01A-11D-A428-09 ENST00000378247 p.Q701* SERPINB5 chr18 63503884 63503884 3'UTR T T - TCGA-ZB-A96C-01A-11D-A428-09 ENST00000382771 IGFLR1 chr19 35739812 35739812 Missense_Mutation G G T TCGA-ZB-A96C-01A-11D-A428-09 ENST00000246532 p.P207T PTH2 chr19 49423273 49423274 In_Frame_Ins - - CAGAAG TCGA-ZB-A96C-01A-11D-A428-09 ENST00000270631 p.L21_L22dup EBF4 chr20 2749495 2749495 Missense_Mutation C C T TCGA-ZB-A96C-01A-11D-A428-09 ENST00000609451 p.A245V ATP9A chr20 51604869 51604869 Silent C C G TCGA-ZB-A96C-01A-11D-A428-09 ENST00000338821 p.L985L FAM230B chr22 21183850 21183850 RNA A A T TCGA-ZB-A96C-01A-11D-A428-09 ENST00000451257 MXRA5 chrX 3317552 3317552 Silent C C G TCGA-ZB-A96C-01A-11D-A428-09 ENST00000217939 p.A2043A PHEX chrX 22111474 22111474 Missense_Mutation G G A TCGA-ZB-A96C-01A-11D-A428-09 ENST00000379374 p.A363T FAM47A chrX 34130724 34130724 Missense_Mutation A A G TCGA-ZB-A96C-01A-11D-A428-09 ENST00000346193 p.S519P RPGR chrX 38287137 38287137 Missense_Mutation T T C TCGA-ZB-A96C-01A-11D-A428-09 ENST00000339363 p.E826G GPR173 chrX 53077024 53077024 Missense_Mutation A A G TCGA-ZB-A96C-01A-11D-A428-09 ENST00000332582 p.M135V FAM120C chrX 54072565 54072566 3'UTR - - A TCGA-ZB-A96C-01A-11D-A428-09 ENST00000375180 TMEM185A chrX 149611287 149611287 Missense_Mutation C C T TCGA-ZB-A96C-01A-11D-A428-09 ENST00000600449 p.R72Q ZNF2 chr2 95182461 95182462 3'UTR - - T TCGA-4V-A9QT-01A-11D-A423-09 ENST00000614034 CLASP1 chr2 121340503 121340504 3'UTR - - A TCGA-4V-A9QT-01A-11D-A423-09 ENST00000263710 JAKMIP2 chr5 147782569 147782570 5'UTR - - T TCGA-4V-A9QT-01A-11D-A423-09 ENST00000265272 FAM86B1 chr8 12188364 12188364 Intron C C T TCGA-4V-A9QT-01A-11D-A423-09 ENST00000448228 TRIM13 chr13 50015093 50015093 3'UTR A A T TCGA-4V-A9QT-01A-11D-A423-09 ENST00000378182 OTX2 chr14 56813284 56813284 5'Flank G G C TCGA-4V-A9QT-01A-11D-A423-09 ENST00000339475 ZNF407 chr18 75065003 75065003 3'UTR T T - TCGA-4V-A9QT-01A-11D-A423-09 ENST00000299687 TP73 chr1 3722028 3722028 Missense_Mutation C C T TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000378295 p.P146L HRNR chr1 152219894 152219894 Missense_Mutation C C T TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000368801 p.G579S FEZ2 chr2 36552985 36552985 3'UTR A A G TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000405912 SCN1A chr2 165992223 165992223 Silent G G A TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000303395 p.Y1684Y ATP2B2 chr3 10358762 10358762 Missense_Mutation T T C TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000352432 p.N689D TNIK chr3 171101725 171101725 Intron A A - TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000436636 RNF212 chr4 1056443 1056443 RNA G G A TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000503206 PCDHA9 chr5 140850104 140850104 Missense_Mutation G G A TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000532602 p.A537T PCDHA10 chr5 140857494 140857494 Silent C C T TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000307360 p.D482D JAKMIP2 chr5 147782569 147782570 5'UTR - - T TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000265272 GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000573035 p.L424H ADAM3A chr8 39493186 39493186 RNA T T A TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000490268 ERICH5 chr8 98064526 98064526 5'UTR C C T TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000318528 PKHD1L1 chr8 109438925 109438925 Silent T T C TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000378402 p.Y1263Y FAM91A1 chr8 123815181 123815182 3'UTR - - T TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000334705 ELAVL2 chr9 23690649 23690649 3'Flank A A C TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000380117 AGAP7P chr10 46129957 46129957 RNA G G A TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000582299 DBX1 chr11 20156368 20156368 Missense_Mutation G G A TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000524983 p.A293V KCNA4 chr11 30013195 30013195 5'UTR C C A TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000328224 ANO6 chr12 45390475 45390475 Missense_Mutation T T A TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000320560 p.C455S MYBPC1 chr12 101631612 101631612 Missense_Mutation C C A TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000550270 p.L86I ANKRD20A9P chr13 18838360 18838360 RNA T T C TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000457997 RP11-407N17.3 chr14 39234098 39234098 5'UTR C C G TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000553728 IGDCC4 chr15 65382095 65382095 3'UTR A A - TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000352385 MESDC1 chr15 81003962 81003962 3'UTR C C T TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000267984 DHX40 chr17 59577265 59577265 Splice_Site G G A TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000251241 p.X325_splice ANKRD12 chr18 9257212 9257212 Silent C C T TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000262126 p.V1315V ADGRE1 chr19 6919651 6919651 Silent G G A TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000312053 p.K508K CYP4F12 chr19 15695939 15695939 Silent C C T TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000550308 p.D373D PCNT chr21 46440105 46440105 Missense_Mutation A A T TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000359568 p.K3099M PCYT1B chrX 24562427 24562431 Frame_Shift_Del GGGTT GGGTT - TCGA-ZC-AAAF-01A-11D-A428-09 ENST00000379144 p.T325Efs*40 ZDBF2 chr2 206306875 206306875 Missense_Mutation T T C TCGA-4V-A9QX-01A-11D-A423-09 ENST00000374423 p.C783R SPHKAP chr2 228019054 228019054 Silent G G A TCGA-4V-A9QX-01A-11D-A423-09 ENST00000392056 p.P600P DENND6A chr3 57625641 57625641 3'UTR A A - TCGA-4V-A9QX-01A-11D-A423-09 ENST00000311128 C3orf58 chr3 143990300 143990300 3'UTR T T - TCGA-4V-A9QX-01A-11D-A423-09 ENST00000315691 MCC chr5 113488330 113488331 In_Frame_Ins - - GCTGCTGCTGCC TCGA-4V-A9QX-01A-11D-A423-09 ENST00000408903 p.S28_S29insGSSS HLA-V chr6 29792314 29792314 Intron G G T TCGA-4V-A9QX-01A-11D-A423-09 ENST00000476601 GNA12 chr7 2762691 2762691 Intron G G A TCGA-4V-A9QX-01A-11D-A423-09 ENST00000275364 DNAH11 chr7 21866478 21866478 Silent C C T TCGA-4V-A9QX-01A-11D-A423-09 ENST00000409508 p.A3835A ZBTB10 chr8 80487537 80487537 Missense_Mutation A A T TCGA-4V-A9QX-01A-11D-A423-09 ENST00000430430 p.M243L SCN2B chr11 118163714 118163717 3'UTR AGTC AGTC - TCGA-4V-A9QX-01A-11D-A423-09 ENST00000278947 CRABP1 chr15 78347924 78347924 Splice_Region C C T TCGA-4V-A9QX-01A-11D-A423-09 ENST00000299529 IL16 chr15 81285707 81285707 Silent C C T TCGA-4V-A9QX-01A-11D-A423-09 ENST00000302987 p.D403D PKMYT1 chr16 2974071 2974071 Silent C C T TCGA-4V-A9QX-01A-11D-A423-09 ENST00000262300 p.P413P RP11-231C14.4 chr16 29484079 29484079 3'Flank G G C TCGA-4V-A9QX-01A-11D-A423-09 ENST00000550665 MAP3K3 chr17 63695387 63695388 3'Flank AA AA - TCGA-4V-A9QX-01A-11D-A423-09 ENST00000361733 AAR2 chr20 36244817 36244817 Missense_Mutation C C G TCGA-4V-A9QX-01A-11D-A423-09 ENST00000320849 p.T293S SNAI1 chr20 49988448 49988448 3'UTR A A - TCGA-4V-A9QX-01A-11D-A423-09 ENST00000244050 PCK1 chr20 57566165 57566165 3'UTR G G A TCGA-4V-A9QX-01A-11D-A423-09 ENST00000319441 PPARA chr22 46243671 46243671 3'UTR T T G TCGA-4V-A9QX-01A-11D-A423-09 ENST00000262735 GLRA2 chrX 14531093 14531095 Intron ATC ATC - TCGA-4V-A9QX-01A-11D-A423-09 ENST00000218075 FAM120C chrX 54073096 54073096 Silent A A G TCGA-4V-A9QX-01A-11D-A423-09 ENST00000375180 p.N1076N SLITRK4 chrX 143630673 143630673 Missense_Mutation T T C TCGA-4V-A9QX-01A-11D-A423-09 ENST00000338017 p.I146V CASZ1 chr1 10637121 10637121 3'UTR T T - TCGA-4X-A9FB-01A-11D-A423-09 ENST00000377022 PPP1CB chr2 28801054 28801054 3'UTR T T - TCGA-4X-A9FB-01A-11D-A423-09 ENST00000296122 TMEM127 chr2 96251704 96251705 3'UTR - - A TCGA-4X-A9FB-01A-11D-A423-09 ENST00000258439 DENND6A chr3 57625641 57625641 3'UTR A A - TCGA-4X-A9FB-01A-11D-A423-09 ENST00000311128 AC023310.1 chr15 20573290 20573290 3'Flank C C T TCGA-4X-A9FB-01A-11D-A423-09 ENST00000408427 AC016629.3 chr19 58599407 58599407 5'Flank G G A TCGA-4X-A9FB-01A-11D-A423-09 ENST00000596427 FMNL2 chr2 152636504 152636504 Missense_Mutation C C T TCGA-XU-A92U-01A-11D-A423-09 ENST00000288670 p.H920Y ARHGEF28 chr5 73887675 73887675 Missense_Mutation C C G TCGA-XU-A92U-01A-11D-A423-09 ENST00000426542 p.A1128G UBN2 chr7 139283257 139283257 Silent T T A TCGA-XU-A92U-01A-11D-A423-09 ENST00000473989 p.P784P NCAPD3 chr11 134158391 134158391 Silent A A G TCGA-XU-A92U-01A-11D-A423-09 ENST00000534548 p.H1324H AC215219.2 chr12 17513 17513 RNA A A C TCGA-XU-A92U-01A-11D-A423-09 ENST00000611710 CAPS2 chr12 75316434 75316434 Missense_Mutation A A G TCGA-XU-A92U-01A-11D-A423-09 ENST00000409445 p.C176R WASIR2 chr16 18052 18052 5'Flank C C T TCGA-XU-A92U-01A-11D-A423-09 ENST00000527434 CDH11 chr16 65004799 65004799 Missense_Mutation G G A TCGA-XU-A92U-01A-11D-A423-09 ENST00000268603 p.A24V FAM187A chr17 44904711 44904711 Silent A A G TCGA-XU-A92U-01A-11D-A423-09 ENST00000331733 p.P294P FAM230B chr22 21183887 21183887 RNA G G C TCGA-XU-A92U-01A-11D-A423-09 ENST00000451257 ARMCX4 chrX 101493798 101493798 Intron C C - TCGA-XU-A92U-01A-11D-A423-09 ENST00000433011 C1orf86 chr1 2192895 2192895 Intron C A A TCGA-4V-A9QN-01A-11D-A423-09 ENST00000378546 XPO1 chr2 61478919 61478919 Silent T T C TCGA-4V-A9QN-01A-11D-A423-09 ENST00000401558 p.E1039E GLI2 chr2 120988336 120988336 Missense_Mutation A A G TCGA-4V-A9QN-01A-11D-A423-09 ENST00000361492 p.S808G ANKRD17 chr4 73258295 73258300 In_Frame_Del TCGTCG TCGTCG - TCGA-4V-A9QN-01A-11D-A423-09 ENST00000358602 p.D123_D124del TSSK1B chr5 113434446 113434446 Missense_Mutation C C T TCGA-4V-A9QN-01A-11D-A423-09 ENST00000390666 p.V132I PI16 chr6 36963151 36963151 Missense_Mutation C T T TCGA-4V-A9QN-01A-11D-A423-09 ENST00000373674 p.T270M KCNV2 chr9 2717989 2717989 Missense_Mutation G G A TCGA-4V-A9QN-01A-11D-A423-09 ENST00000382082 p.A84T NR2F2 chr15 96332421 96332421 Missense_Mutation A A C TCGA-4V-A9QN-01A-11D-A423-09 ENST00000394166 p.S106R SERPINB8 chr18 63986278 63986278 Intron G G T TCGA-4V-A9QN-01A-11D-A423-09 ENST00000353706 ZNF8 chr19 58278805 58278826 5'Flank GCCTTAGCTGAGTGCTCCCATT GCCTTAGCTGAGTGCTCCCATT - TCGA-4V-A9QN-01A-11D-A423-09 ENST00000621650 RLIM chrX 74595792 74595792 Intron A A C TCGA-4V-A9QN-01A-11D-A423-09 ENST00000332687 RLIM chrX 74595795 74595812 Splice_Site ATATGTAAGCATACCTGG ATATGTAAGCATACCTGG - TCGA-4V-A9QN-01A-11D-A423-09 ENST00000332687 p.X56_splice ANKRD13C chr1 70261955 70261956 3'UTR - - A TCGA-4V-A9QM-01A-11D-A423-09 ENST00000370944 ATOH8 chr2 85772675 85772675 Intron A A G TCGA-4V-A9QM-01A-11D-A423-09 ENST00000306279 ECE2 chr3 184258316 184258316 Intron G G A TCGA-4V-A9QM-01A-11D-A423-09 ENST00000402825 SMAP1 chr6 70798676 70798676 Missense_Mutation A A C TCGA-4V-A9QM-01A-11D-A423-09 ENST00000370455 p.K172T GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-4V-A9QM-01A-11D-A423-09 ENST00000573035 p.L424H LMTK2 chr7 98193037 98193037 Missense_Mutation A A T TCGA-4V-A9QM-01A-11D-A423-09 ENST00000297293 p.I858F AGAP3 chr7 151123194 151123196 Intron GCC GCC - TCGA-4V-A9QM-01A-11D-A423-09 ENST00000622464 PEX2 chr8 77000135 77000136 5'UTR - - A TCGA-4V-A9QM-01A-11D-A423-09 ENST00000357039 REXO1L1P chr8 85660839 85660839 RNA G G A TCGA-4V-A9QM-01A-11D-A423-09 ENST00000379010 MTAP chr9 21815457 21815457 Missense_Mutation C C G TCGA-4V-A9QM-01A-11D-A423-09 ENST00000380172 p.L20V PLCE1 chr10 94306685 94306685 Nonsense_Mutation C C T TCGA-4V-A9QM-01A-11D-A423-09 ENST00000260766 p.R1961* RP11-22B23.1 chr12 9301184 9301184 RNA G G A TCGA-4V-A9QM-01A-11D-A423-09 ENST00000539757 RBM23 chr14 22906258 22906258 Missense_Mutation G G A TCGA-4V-A9QM-01A-11D-A423-09 ENST00000359890 p.S113L DPF3 chr14 72670636 72670637 Intron TC TC - TCGA-4V-A9QM-01A-11D-A423-09 ENST00000556509 KIAA0556 chr16 27751886 27751886 Missense_Mutation C C T TCGA-4V-A9QM-01A-11D-A423-09 ENST00000261588 p.R1172W C19orf57 chr19 13890208 13890208 Silent C C T TCGA-4V-A9QM-01A-11D-A423-09 ENST00000586783 p.G216G RPS16 chr19 39433231 39433231 3'UTR A A G TCGA-4V-A9QM-01A-11D-A423-09 ENST00000251453 ALDH16A1 chr19 49464681 49464681 Missense_Mutation G G T TCGA-4V-A9QM-01A-11D-A423-09 ENST00000293350 p.C496F GGT7 chr20 34845441 34845441 Missense_Mutation C C T TCGA-4V-A9QM-01A-11D-A423-09 ENST00000336431 p.V626M EP300 chr22 41125968 41125968 Silent T T C TCGA-4V-A9QM-01A-11D-A423-09 ENST00000263253 p.T278T CMTM6 chr3 32482976 32482977 3'UTR - - A TCGA-XM-A8R8-01A-11D-A423-09 ENST00000205636 MUC4 chr3 195782159 195782159 Missense_Mutation T T C TCGA-XM-A8R8-01A-11D-A423-09 ENST00000463781 p.S3141G MYOD1 chr11 17720223 17720223 Silent G G T TCGA-XM-A8R8-01A-11D-A423-09 ENST00000250003 p.V147V C11orf31 chr11 57741480 57741480 5'Flank G G T TCGA-XM-A8R8-01A-11D-A423-09 ENST00000388857 GOLGA6L10 chr15 82345046 82345046 Missense_Mutation G G A TCGA-XM-A8R8-01A-11D-A423-09 ENST00000610657 p.R272C AGO1 chr1 35919616 35919616 3'UTR C C T TCGA-X7-A8D9-01A-11D-A423-09 ENST00000373204 PRKACB chr1 84237338 84237338 3'UTR A A G TCGA-X7-A8D9-01A-11D-A423-09 ENST00000370689 MIR137HG chr1 98046223 98046225 RNA CTG CTG - TCGA-X7-A8D9-01A-11D-A423-09 ENST00000424528 NBPF25P chr1 145578886 145578886 RNA T T C TCGA-X7-A8D9-01A-11D-A423-09 ENST00000619932 YWHAQ chr2 9584283 9584283 3'UTR C C A TCGA-X7-A8D9-01A-11D-A423-09 ENST00000238081 ALPP chr2 232379594 232379594 Missense_Mutation A A G TCGA-X7-A8D9-01A-11D-A423-09 ENST00000392027 p.T131A CYFIP2 chr5 157285376 157285376 Silent C C A TCGA-X7-A8D9-01A-11D-A423-09 ENST00000616178 p.V5V XXbac-BPG32J3.20 chr6 31713951 31713951 5'UTR C C A TCGA-X7-A8D9-01A-11D-A423-09 ENST00000461287 PERP chr6 138090725 138090725 3'UTR T T - TCGA-X7-A8D9-01A-11D-A423-09 ENST00000421351 NACAD chr7 45083778 45083778 Missense_Mutation G G A TCGA-X7-A8D9-01A-11D-A423-09 ENST00000490531 p.A801V GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-X7-A8D9-01A-11D-A423-09 ENST00000573035 p.L424H PI15 chr8 74825316 74825316 Missense_Mutation G G A TCGA-X7-A8D9-01A-11D-A423-09 ENST00000260113 p.V23I ST3GAL1 chr8 133475770 133475770 Silent C C T TCGA-X7-A8D9-01A-11D-A423-09 ENST00000399640 p.L85L OR1J2 chr9 122511410 122511410 Silent G G T TCGA-X7-A8D9-01A-11D-A423-09 ENST00000335302 p.G203G ZNF143 chr11 9478472 9478472 Silent G G A TCGA-X7-A8D9-01A-11D-A423-09 ENST00000396602 p.P152P LRMP chr12 25101219 25101219 Silent C C T TCGA-X7-A8D9-01A-11D-A423-09 ENST00000354454 p.H261H GRIP1 chr12 66394305 66394305 Missense_Mutation G G A TCGA-X7-A8D9-01A-11D-A423-09 ENST00000359742 p.R678C RILPL1 chr12 123472489 123472489 3'UTR A A G TCGA-X7-A8D9-01A-11D-A423-09 ENST00000376874 TMCO3 chr13 113549494 113549494 Missense_Mutation A A G TCGA-X7-A8D9-01A-11D-A423-09 ENST00000434316 p.I664V PPP1R36 chr14 64588227 64588227 Silent A A G TCGA-X7-A8D9-01A-11D-A423-09 ENST00000298705 p.Q338Q GOLGA6L3 chr15 85244616 85244616 RNA G G C TCGA-X7-A8D9-01A-11D-A423-09 ENST00000507199 TBL3 chr16 1975389 1975389 Missense_Mutation G G C TCGA-X7-A8D9-01A-11D-A423-09 ENST00000568546 p.Q252H ZFHX3 chr16 72796543 72796543 Missense_Mutation G G T TCGA-X7-A8D9-01A-11D-A423-09 ENST00000268489 p.P2047T TCF3 chr19 1611719 1611719 Silent G G A TCGA-X7-A8D9-01A-11D-A423-09 ENST00000262965 p.A651A TFAP2C chr20 56638264 56638265 3'UTR - - T TCGA-X7-A8D9-01A-11D-A423-09 ENST00000201031 ZNF275 chrX 153350950 153350950 3'UTR G G A TCGA-X7-A8D9-01A-11D-A423-09 ENST00000370251 SLC10A3 chrX 154487879 154487879 Silent G G A TCGA-X7-A8D9-01A-11D-A423-09 ENST00000263512 p.V354V USP46 chr4 52595033 52595034 3'UTR - - T TCGA-4V-A9QL-01A-11D-A423-09 ENST00000441222 GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-4V-A9QL-01A-11D-A423-09 ENST00000573035 p.L424H CPA6 chr8 67506863 67506863 Missense_Mutation C C T TCGA-4V-A9QL-01A-11D-A423-09 ENST00000297770 p.R187K INTS8 chr8 94880765 94880765 3'UTR A A - TCGA-4V-A9QL-01A-11D-A423-09 ENST00000523731 COL14A1 chr8 120206969 120206969 Missense_Mutation C C T TCGA-4V-A9QL-01A-11D-A423-09 ENST00000297848 p.P356S GLIDR chr9 39809423 39809423 RNA G G A TCGA-4V-A9QL-01A-11D-A423-09 ENST00000625350 KIAA1551 chr12 31983531 31983531 Missense_Mutation A A G TCGA-4V-A9QL-01A-11D-A423-09 ENST00000312561 p.H859R TSC22D1 chr13 44434104 44434104 3'UTR T T C TCGA-4V-A9QL-01A-11D-A423-09 ENST00000458659 HCN4 chr15 73325163 73325163 Silent C C A TCGA-4V-A9QL-01A-11D-A423-09 ENST00000261917 p.V590V FAM174B chr15 92618842 92618842 3'UTR A A T TCGA-4V-A9QL-01A-11D-A423-09 ENST00000327355 WASIR2 chr16 24306 24306 RNA G G A TCGA-4V-A9QL-01A-11D-A423-09 ENST00000527434 AC016629.3 chr19 58591512 58591512 3'Flank T T C TCGA-4V-A9QL-01A-11D-A423-09 ENST00000596029 MORC2 chr22 30935018 30935018 Missense_Mutation C C G TCGA-4V-A9QL-01A-11D-A423-09 ENST00000397641 p.K652N ADGRG2 chrX 18999189 18999189 Silent C C G TCGA-4V-A9QL-01A-11D-A423-09 ENST00000379869 p.V807V RER1 chr1 2403607 2403607 3'Flank G G C TCGA-XM-A8RI-01A-12D-A423-09 ENST00000488353 CYB5R1 chr1 202962608 202962608 Silent C C T TCGA-XM-A8RI-01A-12D-A423-09 ENST00000367249 p.G279G PLEKHG4B chr5 143113 143113 Missense_Mutation G G A TCGA-XM-A8RI-01A-12D-A423-09 ENST00000283426 p.G159E SLU7 chr5 160406621 160406621 Silent G G T TCGA-XM-A8RI-01A-12D-A423-09 ENST00000297151 p.G378G FOXC1 chr6 1610646 1610646 Nonsense_Mutation C C A TCGA-XM-A8RI-01A-12D-A423-09 ENST00000380874 p.Y67* CYP3A43 chr7 99861744 99861744 Silent G G A TCGA-XM-A8RI-01A-12D-A423-09 ENST00000354829 p.V386V LINC01410 chr9 62801499 62801499 RNA C C G TCGA-XM-A8RI-01A-12D-A423-09 ENST00000424345 POU2F3 chr11 120319854 120319854 3'Flank A A - TCGA-XM-A8RI-01A-12D-A423-09 ENST00000543440 CHEK1 chr11 125644583 125644583 Silent A A G TCGA-XM-A8RI-01A-12D-A423-09 ENST00000428830 p.Q391Q SNX19 chr11 130914398 130914398 Silent G G A TCGA-XM-A8RI-01A-12D-A423-09 ENST00000265909 p.A514A TDG chr12 103987731 103987731 3'UTR A A G TCGA-XM-A8RI-01A-12D-A423-09 ENST00000392872 SOX1 chr13 112067853 112067853 Silent G G A TCGA-XM-A8RI-01A-12D-A423-09 ENST00000330949 p.Q65Q GOLGA8T chr15 30135812 30135812 Intron C C T TCGA-XM-A8RI-01A-12D-A423-09 ENST00000569052 NLGN4X chrX 5903637 5903637 Missense_Mutation G G T TCGA-XM-A8RI-01A-12D-A423-09 ENST00000275857 p.D347E BCOR chrX 40072918 40072918 Nonsense_Mutation G G A TCGA-XM-A8RI-01A-12D-A423-09 ENST00000378444 p.R810* CASZ1 chr1 10637121 10637121 3'UTR T T - TCGA-XM-A8RL-01A-11D-A423-09 ENST00000377022 CDC25A chr3 48158363 48158363 3'UTR T T - TCGA-XM-A8RL-01A-11D-A423-09 ENST00000302506 CTGLF12P chr10 48011573 48011573 RNA G G A TCGA-XM-A8RL-01A-11D-A423-09 ENST00000585227 GOLGA6L10 chr15 82342394 82342395 3'Flank - - ACC TCGA-XM-A8RL-01A-11D-A423-09 ENST00000610657 C16orf71 chr16 4746952 4746954 In_Frame_Del GAG GAG - TCGA-XM-A8RL-01A-11D-A423-09 ENST00000299320 p.E409del ZFHX3 chr16 72782895 72782896 3'UTR - - T TCGA-XM-A8RL-01A-11D-A423-09 ENST00000268489 DLGAP4 chr20 36528137 36528137 3'UTR T T - TCGA-XM-A8RL-01A-11D-A423-09 ENST00000339266 CFAP57 chr1 43219421 43219421 Missense_Mutation T G G TCGA-X7-A8M3-01A-11D-A423-09 ENST00000372492 p.L711V LTBP1 chr2 33263348 33263348 Missense_Mutation C A A TCGA-X7-A8M3-01A-11D-A423-09 ENST00000404816 p.S858Y MCFD2 chr2 46905518 46905518 Missense_Mutation T C C TCGA-X7-A8M3-01A-11D-A423-09 ENST00000319466 p.D129G DIS3L2 chr2 232087663 232087663 Silent C A A TCGA-X7-A8M3-01A-11D-A423-09 ENST00000325385 p.I181I FYCO1 chr3 45918024 45918024 3'UTR G G T TCGA-X7-A8M3-01A-11D-A423-09 ENST00000296137 POGLUT1 chr3 119485369 119485369 Missense_Mutation C A A TCGA-X7-A8M3-01A-11D-A423-09 ENST00000295588 p.A207E TET2 chr4 105269697 105269697 Missense_Mutation T C C TCGA-X7-A8M3-01A-11D-A423-09 ENST00000380013 p.C1378R PPWD1 chr5 65572287 65572287 Splice_Site G G - TCGA-X7-A8M3-01A-11D-A423-09 ENST00000261308 p.X323_splice CEP120 chr5 123393359 123393359 Missense_Mutation G G A TCGA-X7-A8M3-01A-11D-A423-09 ENST00000306467 p.R251C PCDHB11 chr5 141201119 141201119 Missense_Mutation C C A TCGA-X7-A8M3-01A-11D-A423-09 ENST00000354757 p.P449T EBF1 chr5 159096979 159096979 Nonsense_Mutation C C A TCGA-X7-A8M3-01A-11D-A423-09 ENST00000313708 p.E96* B4GALT7 chr5 177609621 177609621 Missense_Mutation G G A TCGA-X7-A8M3-01A-11D-A423-09 ENST00000029410 p.G304R CNOT6 chr5 180577706 180577706 3'UTR C C A TCGA-X7-A8M3-01A-11D-A423-09 ENST00000261951 SCGN chr6 25701413 25701413 3'UTR G T T TCGA-X7-A8M3-01A-11D-A423-09 ENST00000377961 TDRG1 chr6 40379561 40379561 RNA G T T TCGA-X7-A8M3-01A-11D-A423-09 ENST00000373170 L3MBTL3 chr6 130104545 130104545 Missense_Mutation C G G TCGA-X7-A8M3-01A-11D-A423-09 ENST00000361794 p.A619G HYAL4 chr7 123848100 123848100 5'UTR C C T TCGA-X7-A8M3-01A-11D-A423-09 ENST00000223026 TOPORS chr9 32543747 32543747 Nonsense_Mutation G G A TCGA-X7-A8M3-01A-11D-A423-09 ENST00000360538 p.R260* FAM205BP chr9 34833202 34833202 RNA T T G TCGA-X7-A8M3-01A-11D-A423-09 ENST00000399773 DOCK1 chr10 127127677 127127677 Silent C C A TCGA-X7-A8M3-01A-11D-A423-09 ENST00000280333 p.T899T SLC22A25 chr11 63163919 63163919 Nonsense_Mutation C A A TCGA-X7-A8M3-01A-11D-A423-09 ENST00000306494 p.E517* MAP6 chr11 75587312 75587312 Missense_Mutation G T T TCGA-X7-A8M3-01A-11D-A423-09 ENST00000304771 p.T730K APOA5 chr11 116790415 116790416 In_Frame_Ins - GCC GCC TCGA-X7-A8M3-01A-11D-A423-09 ENST00000227665 p.G271dup PZP chr12 9200950 9200950 Silent C A A TCGA-X7-A8M3-01A-11D-A423-09 ENST00000261336 p.V204V RFXAP chr13 36819786 36819786 Nonsense_Mutation C G G TCGA-X7-A8M3-01A-11D-A423-09 ENST00000255476 p.Y143* NAA30 chr14 57410251 57410251 3'UTR G G T TCGA-X7-A8M3-01A-11D-A423-09 ENST00000556492 RCOR1 chr14 102727293 102727293 3'UTR C C T TCGA-X7-A8M3-01A-11D-A423-09 ENST00000262241 SHC4 chr15 48843418 48843418 Missense_Mutation G T T TCGA-X7-A8M3-01A-11D-A423-09 ENST00000332408 p.H492N HSD11B2 chr16 67436661 67436661 Silent G A A TCGA-X7-A8M3-01A-11D-A423-09 ENST00000326152 p.L292L C17orf107 chr17 4900555 4900555 3'UTR G T T TCGA-X7-A8M3-01A-11D-A423-09 ENST00000381365 CSH2 chr17 63873677 63873677 5'UTR A A T TCGA-X7-A8M3-01A-11D-A423-09 ENST00000392886 ARMC7 chr17 75110576 75110576 Nonsense_Mutation G G T TCGA-X7-A8M3-01A-11D-A423-09 ENST00000245543 p.E69* TRIM47 chr17 75874717 75874717 Missense_Mutation G G T TCGA-X7-A8M3-01A-11D-A423-09 ENST00000254816 p.F561L ZNF492 chr19 22664963 22664963 Nonsense_Mutation C C T TCGA-X7-A8M3-01A-11D-A423-09 ENST00000456783 p.Q432* AXL chr19 41238037 41238037 Missense_Mutation C C A TCGA-X7-A8M3-01A-11D-A423-09 ENST00000301178 p.Q293K SLC5A3 chr21 34099632 34099632 3'UTR G G T TCGA-X7-A8M3-01A-11D-A423-09 ENST00000381151 RIMBP3 chr22 18608371 18608371 Missense_Mutation G G T TCGA-X7-A8M3-01A-11D-A423-09 ENST00000619918 p.H1022N RP1-130H16.18 chr22 30285686 30285686 Splice_Region C C A TCGA-X7-A8M3-01A-11D-A423-09 ENST00000434291 p.V459V CBY1 chr22 38673235 38673235 Nonstop_Mutation G G T TCGA-X7-A8M3-01A-11D-A423-09 ENST00000216029 p.*127Lext*32 MAGEB16 chrX 35802402 35802402 Missense_Mutation G G T TCGA-X7-A8M3-01A-11D-A423-09 ENST00000399985 p.C69F RPS6KA6 chrX 84104594 84104594 Missense_Mutation C C A TCGA-X7-A8M3-01A-11D-A423-09 ENST00000262752 p.D507Y TDGF1P3 chrX 110520960 110520960 RNA A A G TCGA-X7-A8M3-01A-11D-A423-09 ENST00000602699 PHF6 chrX 134426073 134426073 3'UTR G G T TCGA-X7-A8M3-01A-11D-A423-09 ENST00000332070 PLXNA3 chrX 154467907 154467907 Nonsense_Mutation C C A TCGA-X7-A8M3-01A-11D-A423-09 ENST00000369682 p.Y1242* EPHA8 chr1 22603371 22603371 3'UTR G G - TCGA-X7-A8M0-01A-11D-A423-09 ENST00000166244 EFCAB14 chr1 46678350 46678350 3'UTR T T C TCGA-X7-A8M0-01A-11D-A423-09 ENST00000371933 OBSCN chr1 228286171 228286171 Missense_Mutation A A G TCGA-X7-A8M0-01A-11D-A423-09 ENST00000422127 p.Y3033C RHOB chr2 20449270 20449270 3'UTR C C T TCGA-X7-A8M0-01A-11D-A423-09 ENST00000272233 RAPGEF4 chr2 172983534 172983534 Missense_Mutation A A G TCGA-X7-A8M0-01A-11D-A423-09 ENST00000397081 p.Y348C NUP210P1 chr3 126667325 126667325 RNA G G T TCGA-X7-A8M0-01A-11D-A423-09 ENST00000357061 COL6A6 chr3 130571202 130571202 Missense_Mutation T T C TCGA-X7-A8M0-01A-11D-A423-09 ENST00000358511 p.L929P NDST4 chr4 114839549 114839549 Splice_Site C C T TCGA-X7-A8M0-01A-11D-A423-09 ENST00000264363 p.X706_splice NAA15 chr4 139389304 139389304 3'UTR A A G TCGA-X7-A8M0-01A-11D-A423-09 ENST00000296543 FYN chr6 111661353 111661353 3'UTR T T - TCGA-X7-A8M0-01A-11D-A423-09 ENST00000354650 GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-X7-A8M0-01A-11D-A423-09 ENST00000573035 p.L424H FAM110B chr8 58148059 58148059 3'UTR G G T TCGA-X7-A8M0-01A-11D-A423-09 ENST00000361488 ANKRD19P chr9 92837030 92837030 RNA C C A TCGA-X7-A8M0-01A-11D-A423-09 ENST00000473204 OR4A16 chr11 55344025 55344025 Silent T T C TCGA-X7-A8M0-01A-11D-A423-09 ENST00000314721 p.I275I CREBZF chr11 85661961 85661962 3'UTR TA TA - TCGA-X7-A8M0-01A-11D-A423-09 ENST00000490820 MSI1 chr12 120341653 120341653 3'UTR A A - TCGA-X7-A8M0-01A-11D-A423-09 ENST00000257552 TRAC chr14 22418713 22418713 Intron C C T TCGA-X7-A8M0-01A-11D-A423-09 ENST00000613353 SOCS4 chr14 55046029 55046030 3'UTR - - T TCGA-X7-A8M0-01A-11D-A423-09 ENST00000339298 TDRD9 chr14 104022159 104022159 Missense_Mutation C C T TCGA-X7-A8M0-01A-11D-A423-09 ENST00000409874 p.A812V FAM222B chr17 28756727 28756727 3'Flank T T - TCGA-X7-A8M0-01A-11D-A423-09 ENST00000452648 MAP2K7 chr19 7913050 7913050 3'UTR C C T TCGA-X7-A8M0-01A-11D-A423-09 ENST00000397979 AC005307.3 chr19 28722760 28722760 RNA T T A TCGA-X7-A8M0-01A-11D-A423-09 ENST00000592347 SPRY3 chrX 155777578 155777578 3'UTR C C A TCGA-X7-A8M0-01A-11D-A423-09 ENST00000302805 PQLC2 chr1 19327308 19327308 Missense_Mutation G G A TCGA-ZB-A96H-01A-11D-A428-09 ENST00000375153 p.V234M UBXN10 chr1 20191814 20191814 3'UTR A A T TCGA-ZB-A96H-01A-11D-A428-09 ENST00000375099 COL9A2 chr1 40312213 40312213 Intron T T - TCGA-ZB-A96H-01A-11D-A428-09 ENST00000372748 LIN9 chr1 226266251 226266251 Missense_Mutation G G A TCGA-ZB-A96H-01A-11D-A428-09 ENST00000328205 p.R316W NLRC4 chr2 32252549 32252549 Missense_Mutation C C A TCGA-ZB-A96H-01A-11D-A428-09 ENST00000360906 p.E44D PKP4 chr2 158673902 158673902 Missense_Mutation A A G TCGA-ZB-A96H-01A-11D-A428-09 ENST00000389759 p.H1010R UBA6 chr4 67623159 67623159 Frame_Shift_Del G G - TCGA-ZB-A96H-01A-11D-A428-09 ENST00000322244 p.L969Wfs*4 ZDHHC11B chr5 751242 751242 Silent A A G TCGA-ZB-A96H-01A-11D-A428-09 ENST00000382776 p.T173T SLC25A46 chr5 110739265 110739265 Missense_Mutation T T G TCGA-ZB-A96H-01A-11D-A428-09 ENST00000355943 p.I49S PCDHB6 chr5 141157672 141157672 3'Flank T T G TCGA-ZB-A96H-01A-11D-A428-09 ENST00000231136 FAM196B chr5 169883180 169883180 Missense_Mutation C C T TCGA-ZB-A96H-01A-11D-A428-09 ENST00000377365 p.R240H BZW2 chr7 16706190 16706190 3'UTR A A - TCGA-ZB-A96H-01A-11D-A428-09 ENST00000258761 GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-ZB-A96H-01A-11D-A428-09 ENST00000573035 p.L424H FAM110B chr8 58146147 58146147 5'UTR G G A TCGA-ZB-A96H-01A-11D-A428-09 ENST00000361488 TSPYL5 chr8 97277026 97277026 Silent T T A TCGA-ZB-A96H-01A-11D-A428-09 ENST00000322128 p.V273V WBP11 chr12 14786697 14786698 3'UTR - - T TCGA-ZB-A96H-01A-11D-A428-09 ENST00000261167 KRAS chr12 25245350 25245350 Missense_Mutation C C T TCGA-ZB-A96H-01A-11D-A428-09 ENST00000256078 p.G12D SEC23A chr14 39042835 39042835 Missense_Mutation C C G TCGA-ZB-A96H-01A-11D-A428-09 ENST00000307712 p.R646P CD226 chr18 69895788 69895788 Missense_Mutation C C G TCGA-ZB-A96H-01A-11D-A428-09 ENST00000280200 p.V214L FCGBP chr19 39875800 39875800 Silent G G T TCGA-ZB-A96H-01A-11D-A428-09 ENST00000616721 p.R3397R OPRL1 chr20 64098662 64098662 Missense_Mutation T T C TCGA-ZB-A96H-01A-11D-A428-09 ENST00000336866 p.F326L SDCCAG8 chr1 243316811 243316811 Missense_Mutation C C A TCGA-4X-A9FA-01A-11D-A423-09 ENST00000366541 p.T329K APOB chr2 21008754 21008754 Missense_Mutation C C G TCGA-4X-A9FA-01A-11D-A423-09 ENST00000233242 p.R2705T RBM5 chr3 50113245 50113245 Intron C C T TCGA-4X-A9FA-01A-11D-A423-09 ENST00000347869 COL6A6 chr3 130594314 130594314 Missense_Mutation C C T TCGA-4X-A9FA-01A-11D-A423-09 ENST00000358511 p.R1502C TNIP2 chr4 2747837 2747837 Missense_Mutation T T G TCGA-4X-A9FA-01A-11D-A423-09 ENST00000315423 p.S129R TMEM63B chr6 44139583 44139583 Missense_Mutation C C T TCGA-4X-A9FA-01A-11D-A423-09 ENST00000259746 p.P175L FKBP1C chr6 63211611 63211611 Missense_Mutation C C T TCGA-4X-A9FA-01A-11D-A423-09 ENST00000370659 p.R19C GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-4X-A9FA-01A-11D-A423-09 ENST00000573035 p.L424H TMEM139 chr7 143286069 143286069 Missense_Mutation G G T TCGA-4X-A9FA-01A-11D-A423-09 ENST00000359333 p.V38F UNC13B chr9 35377656 35377656 Missense_Mutation G G C TCGA-4X-A9FA-01A-11D-A423-09 ENST00000378495 p.D593H RECK chr9 36123176 36123176 3'UTR T T - TCGA-4X-A9FA-01A-11D-A423-09 ENST00000377966 C10orf71 chr10 49324855 49324855 Silent G G A TCGA-4X-A9FA-01A-11D-A423-09 ENST00000374144 p.K770K DLG5 chr10 77854336 77854336 Missense_Mutation G G C TCGA-4X-A9FA-01A-11D-A423-09 ENST00000372391 p.L191V RIN1 chr11 66334028 66334028 Silent T T C TCGA-4X-A9FA-01A-11D-A423-09 ENST00000311320 p.Q494Q ARHGAP5 chr14 32094101 32094101 Missense_Mutation T T G TCGA-4X-A9FA-01A-11D-A423-09 ENST00000345122 p.S1144R AC023310.1 chr15 20572044 20572044 5'Flank T T A TCGA-4X-A9FA-01A-11D-A423-09 ENST00000408427 CSNK1E chr22 38290801 38290802 3'UTR - - T TCGA-4X-A9FA-01A-11D-A423-09 ENST00000359867 TUBGCP6 chr22 50218745 50218745 Frame_Shift_Del G G - TCGA-4X-A9FA-01A-11D-A423-09 ENST00000248846 p.N1594Tfs*6 ATRX chrX 77508202 77508202 3'UTR A A - TCGA-4X-A9FA-01A-11D-A423-09 ENST00000373344 USP48 chr1 21687055 21687055 Intron T T C TCGA-ZB-A96I-01A-11D-A428-09 ENST00000308271 LUZP1 chr1 23094159 23094159 Missense_Mutation T T C TCGA-ZB-A96I-01A-11D-A428-09 ENST00000302291 p.K35E RBM15 chr1 110339370 110339370 5'UTR T T C TCGA-ZB-A96I-01A-11D-A428-09 ENST00000369784 HAO2 chr1 119392220 119392220 Silent T T C TCGA-ZB-A96I-01A-11D-A428-09 ENST00000325945 p.A294A SH3YL1 chr2 231121 231121 Missense_Mutation C C A TCGA-ZB-A96I-01A-11D-A428-09 ENST00000356150 p.D202Y BUB1 chr2 110661649 110661649 Missense_Mutation G G A TCGA-ZB-A96I-01A-11D-A428-09 ENST00000302759 p.P384S DHX30 chr3 47846342 47846342 Nonsense_Mutation C C T TCGA-ZB-A96I-01A-11D-A428-09 ENST00000445061 p.R424* NISCH chr3 52490074 52490074 Splice_Site G G T TCGA-ZB-A96I-01A-11D-A428-09 ENST00000345716 p.X1153_splice ZNF827 chr4 145870282 145870282 Silent T T G TCGA-ZB-A96I-01A-11D-A428-09 ENST00000508784 p.S648S PIK3R1 chr5 68294669 68294669 Frame_Shift_Del A A - TCGA-ZB-A96I-01A-11D-A428-09 ENST00000521381 p.I521Yfs*11 NSD1 chr5 177210650 177210650 Missense_Mutation C C T TCGA-ZB-A96I-01A-11D-A428-09 ENST00000439151 p.L751F C5orf60 chr5 179642369 179642369 Silent G G A TCGA-ZB-A96I-01A-11D-A428-09 ENST00000448248 p.S268S ITGB8 chr7 20414499 20414499 3'UTR C C A TCGA-ZB-A96I-01A-11D-A428-09 ENST00000222573 NRF1 chr7 129755299 129755299 3'UTR T T - TCGA-ZB-A96I-01A-11D-A428-09 ENST00000223190 NRG1 chr8 32764292 32764292 Missense_Mutation T T G TCGA-ZB-A96I-01A-11D-A428-09 ENST00000405005 p.F605V ZNF487 chr10 43481449 43481449 Missense_Mutation C C G TCGA-ZB-A96I-01A-11D-A428-09 ENST00000437590 p.L52V ANTXRL chr10 46297868 46297868 Missense_Mutation C C G TCGA-ZB-A96I-01A-11D-A428-09 ENST00000620264 p.A231G PTPRE chr10 128070832 128070832 Nonsense_Mutation A A T TCGA-ZB-A96I-01A-11D-A428-09 ENST00000254667 p.K440* SPTY2D1 chr11 18611535 18611535 Frame_Shift_Del A A - TCGA-ZB-A96I-01A-11D-A428-09 ENST00000336349 p.Y636Mfs*21 SLC22A9 chr11 63370124 63370124 Missense_Mutation T T C TCGA-ZB-A96I-01A-11D-A428-09 ENST00000279178 p.F23S SIK3 chr11 116877013 116877013 Missense_Mutation C C G TCGA-ZB-A96I-01A-11D-A428-09 ENST00000375300 p.V299L NEUROD4 chr12 55027144 55027144 Silent G G A TCGA-ZB-A96I-01A-11D-A428-09 ENST00000242994 p.S235S WIF1 chr12 65068835 65068835 Missense_Mutation A A G TCGA-ZB-A96I-01A-11D-A428-09 ENST00000286574 p.V156A SYNE2 chr14 64227656 64227656 3'Flank G G A TCGA-ZB-A96I-01A-11D-A428-09 ENST00000358025 EIF5 chr14 103338420 103338422 In_Frame_Del CAC CAC - TCGA-ZB-A96I-01A-11D-A428-09 ENST00000216554 p.P185del MGA chr15 41698899 41698899 Nonsense_Mutation G G T TCGA-ZB-A96I-01A-11D-A428-09 ENST00000219905 p.E684* PCSK6 chr15 101431320 101431320 Splice_Region A A G TCGA-ZB-A96I-01A-11D-A428-09 ENST00000611716 p.Y219Y DNM1P47 chr15 101760305 101760305 RNA G G A TCGA-ZB-A96I-01A-11D-A428-09 ENST00000561463 DNM1P47 chr15 101760306 101760306 RNA G G A TCGA-ZB-A96I-01A-11D-A428-09 ENST00000561463 SRRM2 chr16 2765545 2765545 Missense_Mutation A A G TCGA-ZB-A96I-01A-11D-A428-09 ENST00000301740 p.R1673G SPN chr16 29668845 29668845 3'UTR A A - TCGA-ZB-A96I-01A-11D-A428-09 ENST00000360121 ZNF431 chr19 21182932 21182932 Missense_Mutation G G A TCGA-ZB-A96I-01A-11D-A428-09 ENST00000311048 p.G210D ZNF676 chr19 22180757 22180757 Missense_Mutation C C G TCGA-ZB-A96I-01A-11D-A428-09 ENST00000397121 p.W320C B3GNT8 chr19 41431329 41431329 5'Flank G G - TCGA-ZB-A96I-01A-11D-A428-09 ENST00000321702 PAX7 chr1 18700752 18700752 Missense_Mutation G G A TCGA-XM-A8RF-01A-11D-A423-09 ENST00000420770 p.G296S UBR4 chr1 19144016 19144016 Missense_Mutation T T C TCGA-XM-A8RF-01A-11D-A423-09 ENST00000375254 p.T2715A NPHS2 chr1 179559762 179559762 Splice_Site C C A TCGA-XM-A8RF-01A-11D-A423-09 ENST00000367615 p.X151_splice RYR2 chr1 237614680 237614680 Missense_Mutation T T A TCGA-XM-A8RF-01A-11D-A423-09 ENST00000366574 p.F1851Y ADAM23 chr2 206594832 206594832 Missense_Mutation G G A TCGA-XM-A8RF-01A-11D-A423-09 ENST00000264377 p.C725Y SETMAR chr3 4317194 4317194 Missense_Mutation T T G TCGA-XM-A8RF-01A-11D-A423-09 ENST00000358065 p.L668R SCARB2 chr4 76179561 76179561 Missense_Mutation C C A TCGA-XM-A8RF-01A-11D-A423-09 ENST00000264896 p.V190F TAF9 chr5 69369489 69369489 Translation_Start_Site A A C TCGA-XM-A8RF-01A-11D-A423-09 ENST00000380822 p.M1? RP11-1277A3.2 chr5 177632217 177632217 RNA G G A TCGA-XM-A8RF-01A-11D-A423-09 ENST00000515045 GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-XM-A8RF-01A-11D-A423-09 ENST00000573035 p.L424H KHDRBS3 chr8 135542684 135542684 Missense_Mutation C C T TCGA-XM-A8RF-01A-11D-A423-09 ENST00000355849 p.R80C RALGPS1 chr9 127052853 127052853 Silent C C T TCGA-XM-A8RF-01A-11D-A423-09 ENST00000259351 p.L133L TOR4A chr9 137280603 137280603 3'UTR C C G TCGA-XM-A8RF-01A-11D-A423-09 ENST00000357503 TOR4A chr9 137280758 137280758 3'UTR C C G TCGA-XM-A8RF-01A-11D-A423-09 ENST00000357503 ZNF438 chr10 30849582 30849582 Missense_Mutation T T C TCGA-XM-A8RF-01A-11D-A423-09 ENST00000361310 p.T275A BDNF chr11 27659623 27659624 Intron - - TC TCGA-XM-A8RF-01A-11D-A423-09 ENST00000356660 PPFIBP1 chr12 27682438 27682438 Nonsense_Mutation C C T TCGA-XM-A8RF-01A-11D-A423-09 ENST00000318304 p.Q706* SCN8A chr12 51808514 51808514 3'UTR A A - TCGA-XM-A8RF-01A-11D-A423-09 ENST00000354534 SLC22A17 chr14 23347458 23347458 Splice_Site A A C TCGA-XM-A8RF-01A-11D-A423-09 ENST00000206544 p.X406_splice ABCD4 chr14 74293231 74293232 Frame_Shift_Ins - - GC TCGA-XM-A8RF-01A-11D-A423-09 ENST00000356924 p.H246Rfs*3 MAP2K1 chr15 66435105 66435105 Missense_Mutation T T G TCGA-XM-A8RF-01A-11D-A423-09 ENST00000307102 p.F53L AMDHD2 chr16 2527811 2527811 Missense_Mutation C T T TCGA-XM-A8RF-01A-11D-A423-09 ENST00000293971 p.R152W AC133555.1 chr16 29527601 29527601 5'Flank A A G TCGA-XM-A8RF-01A-11D-A423-09 ENST00000621224 FAM65A chr16 67541715 67541715 Missense_Mutation C C T TCGA-XM-A8RF-01A-11D-A423-09 ENST00000379312 p.T342I SNORD3B-1 chr17 19062109 19062109 RNA G G A TCGA-XM-A8RF-01A-11D-A423-09 ENST00000577988 KRT26 chr17 40771188 40771188 Missense_Mutation T T C TCGA-XM-A8RF-01A-11D-A423-09 ENST00000335552 p.N164D ENDOV chr17 80437325 80437325 3'UTR C C T TCGA-XM-A8RF-01A-11D-A423-09 ENST00000518137 RLN3 chr19 14030709 14030709 Splice_Site G G A TCGA-XM-A8RF-01A-11D-A423-09 ENST00000431365 p.X64_splice PINLYP chr19 43581344 43581344 Missense_Mutation G G C TCGA-XM-A8RF-01A-11D-A423-09 ENST00000599207 p.C107S TSKS chr19 49763138 49763138 Missense_Mutation C C T TCGA-XM-A8RF-01A-11D-A423-09 ENST00000246801 p.R37Q CNOT3 chr19 54155456 54155456 3'UTR C C T TCGA-XM-A8RF-01A-11D-A423-09 ENST00000221232 KIR3DL2 chr19 54866839 54866839 3'UTR C C T TCGA-XM-A8RF-01A-11D-A423-09 ENST00000326321 CTPS2 chrX 16693179 16693179 Missense_Mutation C C T TCGA-XM-A8RF-01A-11D-A423-09 ENST00000359276 p.V201I DMD chrX 32464698 32464698 Missense_Mutation T T G TCGA-XM-A8RF-01A-11D-A423-09 ENST00000357033 p.N1055T CCDC22 chrX 49249699 49249699 Missense_Mutation C C T TCGA-XM-A8RF-01A-11D-A423-09 ENST00000376227 p.R582W CITED1 chrX 72302817 72302817 Missense_Mutation G G A TCGA-XM-A8RF-01A-11D-A423-09 ENST00000246139 p.A18V AL078621.1 chr2 113595432 113595432 5'Flank G G A TCGA-3T-AA9L-01A-11D-A423-09 ENST00000613451 ARSI chr5 150297254 150297254 Frame_Shift_Del A A - TCGA-3T-AA9L-01A-11D-A423-09 ENST00000328668 p.F557Sfs*8 COL10A1 chr6 116119758 116119758 3'UTR T T - TCGA-3T-AA9L-01A-11D-A423-09 ENST00000243222 XKR6 chr8 10897592 10897593 3'UTR - - T TCGA-3T-AA9L-01A-11D-A423-09 ENST00000416569 PLAG1 chr8 56163681 56163682 3'UTR AC AC - TCGA-3T-AA9L-01A-11D-A423-09 ENST00000316981 IGDCC4 chr15 65382095 65382095 3'UTR A A - TCGA-3T-AA9L-01A-11D-A423-09 ENST00000352385 GOLGA6L17P chr15 82524068 82524068 RNA A A G TCGA-3T-AA9L-01A-11D-A423-09 ENST00000614358 CSNK1E chr22 38290801 38290802 3'UTR - - T TCGA-3T-AA9L-01A-11D-A423-09 ENST00000359867 AL078621.1 chr2 113596717 113596717 3'Flank A A T TCGA-ZC-AAAH-01A-11D-A428-09 ENST00000613451 KCNJ3 chr2 154855625 154855625 3'UTR T T - TCGA-ZC-AAAH-01A-11D-A428-09 ENST00000295101 FOXP1 chr3 70957990 70957990 3'UTR T T - TCGA-ZC-AAAH-01A-11D-A428-09 ENST00000318789 FOXC1 chr6 1612185 1612185 3'UTR A A - TCGA-ZC-AAAH-01A-11D-A428-09 ENST00000380874 SEMA4D chr9 89377969 89377969 3'UTR A A - TCGA-ZC-AAAH-01A-11D-A428-09 ENST00000356444 DNM1P47 chr15 101760553 101760553 RNA G G C TCGA-ZC-AAAH-01A-11D-A428-09 ENST00000561463 EXOSC10 chr1 11098138 11098138 Missense_Mutation C C A TCGA-ZB-A96E-01A-11D-A428-09 ENST00000376936 p.V44L PADI3 chr1 17265676 17265676 Missense_Mutation G G T TCGA-ZB-A96E-01A-11D-A428-09 ENST00000375460 p.D122Y HP1BP3 chr1 20743123 20743123 3'UTR T T - TCGA-ZB-A96E-01A-11D-A428-09 ENST00000312239 RSBN1 chr1 113761877 113761877 3'UTR A A - TCGA-ZB-A96E-01A-11D-A428-09 ENST00000261441 TP53BP2 chr1 223814351 223814351 Missense_Mutation G G A TCGA-ZB-A96E-01A-11D-A428-09 ENST00000343537 p.R60C ATG7 chr3 11342171 11342171 Silent G G T TCGA-ZB-A96E-01A-11D-A428-09 ENST00000354449 p.L339L ATG7 chr3 11342172 11342172 Missense_Mutation A A T TCGA-ZB-A96E-01A-11D-A428-09 ENST00000354449 p.M340L LRRFIP2 chr3 37112918 37112918 Silent T T A TCGA-ZB-A96E-01A-11D-A428-09 ENST00000336686 p.L145L DCP1A chr3 53290746 53290746 Intron T T C TCGA-ZB-A96E-01A-11D-A428-09 ENST00000294241 MUC4 chr3 195783008 195783008 Missense_Mutation A A G TCGA-ZB-A96E-01A-11D-A428-09 ENST00000463781 p.S2858P HCRTR2 chr6 55174765 55174765 Missense_Mutation G G T TCGA-ZB-A96E-01A-11D-A428-09 ENST00000370862 p.G60W NOD1 chr7 30451651 30451651 Missense_Mutation T T C TCGA-ZB-A96E-01A-11D-A428-09 ENST00000222823 p.N589S TYW1 chr7 66996934 66996934 5'UTR G G T TCGA-ZB-A96E-01A-11D-A428-09 ENST00000359626 GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-ZB-A96E-01A-11D-A428-09 ENST00000573035 p.L424H CALD1 chr7 134891495 134891495 Intron A A G TCGA-ZB-A96E-01A-11D-A428-09 ENST00000361675 ABHD17B chr9 71866939 71866939 Missense_Mutation C C A TCGA-ZB-A96E-01A-11D-A428-09 ENST00000333421 p.D239Y AFAP1L2 chr10 114295016 114295016 3'UTR T T A TCGA-ZB-A96E-01A-11D-A428-09 ENST00000304129 HRAS chr11 534284 534285 In_Frame_Ins - - CCG TCGA-ZB-A96E-01A-11D-A428-09 ENST00000311189 p.G13dup PHRF1 chr11 609650 609650 Silent C C T TCGA-ZB-A96E-01A-11D-A428-09 ENST00000264555 p.A1398A PLEKHA7 chr11 16788084 16788084 3'UTR A A G TCGA-ZB-A96E-01A-11D-A428-09 ENST00000355661 ATG13 chr11 46650278 46650278 Missense_Mutation T T G TCGA-ZB-A96E-01A-11D-A428-09 ENST00000359513 p.L140R GRIA4 chr11 105752984 105752984 Missense_Mutation G G A TCGA-ZB-A96E-01A-11D-A428-09 ENST00000282499 p.C84Y DYRK4 chr12 4605066 4605066 Nonsense_Mutation C C T TCGA-ZB-A96E-01A-11D-A428-09 ENST00000010132 p.Q312* OLFM4 chr13 53034415 53034415 Missense_Mutation A A G TCGA-ZB-A96E-01A-11D-A428-09 ENST00000219022 p.D91G CTCF chr16 67636852 67636852 Splice_Site G G T TCGA-ZB-A96E-01A-11D-A428-09 ENST00000264010 p.X667_splice SUPT4H1 chr17 58352152 58352154 5'UTR AAC AAC - TCGA-ZB-A96E-01A-11D-A428-09 ENST00000225504 MYO15B chr17 75594548 75594548 RNA C C T TCGA-ZB-A96E-01A-11D-A428-09 ENST00000610510 RYR1 chr19 38463818 38463818 Missense_Mutation C C A TCGA-ZB-A96E-01A-11D-A428-09 ENST00000359596 p.N918K ZNF544 chr19 58261731 58261731 Silent T T G TCGA-ZB-A96E-01A-11D-A428-09 ENST00000269829 p.T375T SLC5A3 chr21 34098464 34098464 3'UTR T T - TCGA-ZB-A96E-01A-11D-A428-09 ENST00000381151 BCOR chrX 40052325 40052335 Frame_Shift_Del AAAATTGCAGC AAAATTGCAGC - TCGA-ZB-A96E-01A-11D-A428-09 ENST00000378444 p.R1681Pfs*35 BCOR chrX 40052336 40052336 Missense_Mutation G G C TCGA-ZB-A96E-01A-11D-A428-09 ENST00000378444 p.R1681G USP9X chrX 41136925 41136925 Frame_Shift_Del T T - TCGA-ZB-A96E-01A-11D-A428-09 ENST00000324545 p.I186Tfs*36 MAGEA3 chrX 152701492 152701492 Missense_Mutation A A T TCGA-ZB-A96E-01A-11D-A428-09 ENST00000370278 p.K220N TSPY1 chrY 9467135 9467135 Silent G G A TCGA-ZB-A96E-01A-11D-A428-09 ENST00000451548 p.V45V CCDC28B chr1 32205167 32205167 Intron A A G TCGA-XM-AAZ1-01A-11D-A423-09 ENST00000373602 NRAS chr1 114716113 114716113 Missense_Mutation T T G TCGA-XM-AAZ1-01A-11D-A423-09 ENST00000369535 p.K16N CCDC88A chr2 55287894 55287894 3'UTR G G A TCGA-XM-AAZ1-01A-11D-A423-09 ENST00000436346 SV2C chr5 76325587 76325587 3'UTR C C T TCGA-XM-AAZ1-01A-11D-A423-09 ENST00000502798 SLC29A1 chr6 44232849 44232849 Missense_Mutation C C G TCGA-XM-AAZ1-01A-11D-A423-09 ENST00000371708 p.R368G RNF146 chr6 127287417 127287417 Missense_Mutation A A T TCGA-XM-AAZ1-01A-11D-A423-09 ENST00000368314 p.E268D TNFRSF11B chr8 118926664 118926664 Missense_Mutation G G A TCGA-XM-AAZ1-01A-11D-A423-09 ENST00000297350 p.T216M AC215219.2 chr12 17513 17513 RNA A A C TCGA-XM-AAZ1-01A-11D-A423-09 ENST00000611710 EIF1AX chrX 20141630 20141630 Missense_Mutation T T C TCGA-XM-AAZ1-01A-11D-A423-09 ENST00000379607 p.N4S TMSB10 chr2 84906575 84906575 3'UTR C C - TCGA-X7-A8M4-01A-11D-A423-09 ENST00000233143 POU3F2 chr6 98838497 98838498 3'UTR - - T TCGA-X7-A8M4-01A-11D-A423-09 ENST00000328345 CCDC3 chr10 13001209 13001209 Missense_Mutation A A T TCGA-X7-A8M4-01A-11D-A423-09 ENST00000378825 p.F121Y ZFAND4 chr10 45615989 45615990 3'UTR - - A TCGA-X7-A8M4-01A-11D-A423-09 ENST00000344646 MUC2 chr11 1097399 1097399 RNA C C T TCGA-X7-A8M4-01A-11D-A423-09 ENST00000361558 PABPC5 chrX 91437852 91437852 3'UTR A A - TCGA-X7-A8M4-01A-11D-A423-09 ENST00000312600 REXO1L1P chr8 85660928 85660928 RNA G G - TCGA-XU-AAY1-01A-11D-A428-09 ENST00000379010 PRKCB chr16 24215658 24215659 Intron - - A TCGA-XU-AAY1-01A-11D-A428-09 ENST00000321728 DYNC1LI2 chr16 66721333 66721333 3'UTR T T - TCGA-XU-AAY1-01A-11D-A428-09 ENST00000258198 FLJ35934 chr17 18411648 18411648 RNA T T C TCGA-XU-AAY1-01A-11D-A428-09 ENST00000577684 ITGA3 chr17 50068282 50068282 Frame_Shift_Del C C - TCGA-XU-AAY1-01A-11D-A428-09 ENST00000320031 p.G216Vfs*11 KIAA0355 chr19 34353925 34353925 3'UTR A A - TCGA-XU-AAY1-01A-11D-A428-09 ENST00000299505 FSIP2 chr2 185801042 185801042 Silent G G A TCGA-XM-A8RC-01A-11D-A423-09 ENST00000424728 p.L3912L TRAK2 chr2 201420448 201420448 Silent A A G TCGA-XM-A8RC-01A-11D-A423-09 ENST00000332624 p.N20N FAM208A chr3 56623508 56623508 3'UTR T T C TCGA-XM-A8RC-01A-11D-A423-09 ENST00000493960 CMSS1 chr3 100167786 100167786 Missense_Mutation C C T TCGA-XM-A8RC-01A-11D-A423-09 ENST00000421999 p.S155L POGLUT1 chr3 119493146 119493147 3'UTR - - A TCGA-XM-A8RC-01A-11D-A423-09 ENST00000295588 ACSL1 chr4 184757195 184757195 Missense_Mutation G G A TCGA-XM-A8RC-01A-11D-A423-09 ENST00000281455 p.A676V KCNQ5 chr6 73169791 73169791 Missense_Mutation G G A TCGA-XM-A8RC-01A-11D-A423-09 ENST00000370398 p.C505Y SRPK2 chr7 105116378 105116379 3'UTR - - A TCGA-XM-A8RC-01A-11D-A423-09 ENST00000357311 FLNC chr7 128838637 128838637 Silent G G A TCGA-XM-A8RC-01A-11D-A423-09 ENST00000325888 p.V415V NCOA2 chr8 70155972 70155972 Missense_Mutation T T G TCGA-XM-A8RC-01A-11D-A423-09 ENST00000452400 p.Q798P REXO1L1P chr8 85658684 85658684 RNA T T C TCGA-XM-A8RC-01A-11D-A423-09 ENST00000379010 DCLRE1A chr10 113849488 113849488 Silent A A C TCGA-XM-A8RC-01A-11D-A423-09 ENST00000361384 p.P539P RAB27A chr15 55230466 55230466 Silent C C A TCGA-XM-A8RC-01A-11D-A423-09 ENST00000336787 p.P58P DET1 chr15 88512606 88512606 3'UTR A A G TCGA-XM-A8RC-01A-11D-A423-09 ENST00000268148 RSL1D1 chr16 11837140 11837141 3'UTR - - T TCGA-XM-A8RC-01A-11D-A423-09 ENST00000571133 TUBB6 chr18 12308716 12308716 Silent C C T TCGA-XM-A8RC-01A-11D-A423-09 ENST00000317702 p.G29G HPS4 chr22 26453391 26453391 Missense_Mutation C C T TCGA-XM-A8RC-01A-11D-A423-09 ENST00000336873 p.A657T ZFX chrX 24212764 24212764 3'Flank C C G TCGA-XM-A8RC-01A-11D-A423-09 ENST00000304543 LRRC42 chr1 53966339 53966339 Missense_Mutation C C A TCGA-ZB-A963-01A-11D-A428-09 ENST00000319223 p.P324Q MCL1 chr1 150575211 150575215 3'UTR ATAGG ATAGG - TCGA-ZB-A963-01A-11D-A428-09 ENST00000369026 MCL1 chr1 150575216 150575216 3'UTR T T G TCGA-ZB-A963-01A-11D-A428-09 ENST00000369026 AC079610.1 chr2 213000346 213000347 Intron - - T TCGA-ZB-A963-01A-11D-A428-09 ENST00000415387 ATP13A3 chr3 194438897 194438897 Missense_Mutation G G T TCGA-ZB-A963-01A-11D-A428-09 ENST00000256031 p.Q596K SENP5 chr3 196931213 196931213 3'UTR A A - TCGA-ZB-A963-01A-11D-A428-09 ENST00000323460 PLK4 chr4 127889971 127889971 Missense_Mutation C C T TCGA-ZB-A963-01A-11D-A428-09 ENST00000270861 p.T522I ZNF727 chr7 64077891 64077891 Missense_Mutation A A T TCGA-ZB-A963-01A-11D-A428-09 ENST00000456806 p.E281V NRG1 chr8 32749540 32749540 Intron G G A TCGA-ZB-A963-01A-11D-A428-09 ENST00000405005 MUC2 chr11 1097335 1097335 RNA C C T TCGA-ZB-A963-01A-11D-A428-09 ENST00000361558 TBC1D3B chr17 36176518 36176518 5'UTR C C T TCGA-ZB-A963-01A-11D-A428-09 ENST00000611257 CLDN2 chrX 106929731 106929732 3'UTR - - CTCCAC TCGA-ZB-A963-01A-11D-A428-09 ENST00000336803 PERM1 chr1 979327 979327 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000433179 p.T568M LINC01342 chr1 1142929 1142930 RNA - - C TCGA-ZB-A966-01A-11D-A428-09 ENST00000416774 TTLL10 chr1 1176254 1176254 Intron G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000379289 MEGF6 chr1 3493839 3493840 Frame_Shift_Ins - - C TCGA-ZB-A966-01A-11D-A428-09 ENST00000356575 p.A1440Gfs*4 CCDC27 chr1 3755544 3755544 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000294600 p.G178Afs*32 CHD5 chr1 6102276 6102276 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000262450 RPL22 chr1 6197725 6197725 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000234875 p.K15Rfs*5 PLEKHG5 chr1 6475942 6475943 Frame_Shift_Del CA CA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000400915 p.V102Gfs*25 TAS1R1 chr1 6574750 6574750 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000333172 p.F206F CAMTA1 chr1 7767904 7767904 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000303635 SLC45A1 chr1 8325868 8325868 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000289877 p.A181T SLC45A1 chr1 8325956 8325956 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000289877 p.A210V SLC2A7 chr1 9024983 9024983 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000400906 p.P48L PGD chr1 10417441 10417441 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000270776 p.T347T C1orf127 chr1 10947776 10947776 Frame_Shift_Del C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000377004 p.A787Pfs*7 MTOR chr1 11109684 11109684 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000361445 p.T2471M C1orf167 chr1 11776587 11776587 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000433342 p.C787Y TMEM51 chr1 15152538 15152538 5'Flank C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000376008 SPEN chr1 15930454 15930455 Frame_Shift_Ins - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000375759 p.L1407Ffs*11 CLCNKA chr1 16029283 16029283 Missense_Mutation T T G TCGA-ZB-A966-01A-11D-A428-09 ENST00000331433 p.F404C CROCC chr1 16955539 16955539 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000375541 p.S1231S SDHB chr1 17027826 17027826 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000375499 p.P155S MUL1 chr1 20501172 20501172 Frame_Shift_Del C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000264198 p.A193Pfs*29 HP1BP3 chr1 20779845 20779845 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000312239 p.S55Afs*15 EIF4G3 chr1 20980412 20980412 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000264211 p.Q83Nfs*43 ALPL chr1 21577627 21577627 Frame_Shift_Del C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000374832 p.L520* C1QC chr1 22647280 22647280 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000374637 p.G79S LUZP1 chr1 23093916 23093916 Nonsense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000302291 p.R116* SRRM1 chr1 24652976 24652976 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000323848 p.P328P SRRM1 chr1 24672522 24672522 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000323848 CLIC4 chr1 24814125 24814125 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000374379 p.G72R RSRP1 chr1 25246577 25246577 Missense_Mutation C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000243189 p.R129S DHDDS chr1 26442774 26442774 Missense_Mutation T T A TCGA-ZB-A966-01A-11D-A428-09 ENST00000236342 p.V75D ARID1A chr1 26782003 26782003 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000324856 PTPRU chr1 29258663 29258663 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000345512 p.R122C FABP3 chr1 31365705 31365709 3'UTR AAAAA AAAAA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000373713 COL16A1 chr1 31652558 31652559 3'UTR AC AC - TCGA-ZB-A966-01A-11D-A428-09 ENST00000373672 S100PBP chr1 32856671 32856671 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000373475 MAP7D1 chr1 36176710 36176712 In_Frame_Del AGA AGA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000373151 p.K418del SLC2A1 chr1 42929288 42929288 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000426263 p.F298F FAM183A chr1 43156220 43156220 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000335282 p.R104R ATPAF1 chr1 46632867 46632867 3'Flank A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000574428 EFCAB14 chr1 46677040 46677040 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000371933 EFCAB14 chr1 46678207 46678207 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000371933 ZFYVE9 chr1 52295928 52295928 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000287727 p.R1095Q CC2D1B chr1 52364555 52364555 Missense_Mutation C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000371586 p.K22N ECHDC2 chr1 52907889 52907889 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000371522 p.R115W OMA1 chr1 58480868 58480868 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000371226 DNAJC6 chr1 65395019 65395019 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000395325 p.S618S WDR78 chr1 66924743 66924743 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000371026 p.K30Rfs*28 SERBP1 chr1 67413107 67413107 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000370995 ACADM chr1 75762842 75762842 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000370841 FUBP1 chr1 77948271 77948271 3'Flank A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000370768 ADGRL2 chr1 81990552 81990552 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000370717 p.I1263V PRKACB chr1 84179080 84179080 Intron T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000370689 SH3GLB1 chr1 86745949 86745949 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000370558 GTF2B chr1 88853242 88853242 Missense_Mutation T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000370500 p.T308A GFI1 chr1 92475982 92475982 3'UTR G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000294702 FNBP1L chr1 93552547 93552547 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000271234 CDC14A chr1 100443011 100443011 Intron T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000336454 EXTL2 chr1 100872563 100872563 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000370113 CEPT1 chr1 111161214 111161214 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000357172 p.C185Vfs*26 SLC16A1 chr1 112929254 112929254 Missense_Mutation C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000369626 p.G19C HIPK1 chr1 113975517 113975518 3'UTR - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000369558 WDR3 chr1 117941124 117941124 Nonsense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000349139 p.R264* PHGDH chr1 119721211 119721211 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000369409 p.T60T PIAS3 chr1 145853633 145853633 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000393045 p.R339H RBM8A chr1 145926091 145926091 Silent G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000583313 p.P143P ANKRD34A chr1 145961675 145961675 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000606888 p.A29T PDE4DIP chr1 149009694 149009694 Silent C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000369354 p.T1610T ADAMTSL4 chr1 150559787 150559787 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000271643 p.T990T MLLT11 chr1 151067999 151068000 3'UTR - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000368921 ZNF687 chr1 151288685 151288686 Frame_Shift_Del TC TC - TCGA-ZB-A966-01A-11D-A428-09 ENST00000324048 p.R760Pfs*99 ZNF687 chr1 151291739 151291739 3'UTR G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000324048 RIIAD1 chr1 151727603 151727603 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000479191 p.I64V FLG chr1 152302830 152302830 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000368799 p.A4019V FLG chr1 152313441 152313441 Missense_Mutation T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000368799 p.H482R LCE3B chr1 152614012 152614012 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000335633 p.R68C KPRP chr1 152760383 152760383 Frame_Shift_Del C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000606109 p.R267Afs*19 INTS3 chr1 153773052 153773054 In_Frame_Del GAA GAA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000318967 p.E1010del SHC1 chr1 154966414 154966414 Frame_Shift_Del C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000368445 p.V363Wfs*2 SLC50A1 chr1 155138489 155138489 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000368404 THBS3 chr1 155207852 155207852 Frame_Shift_Del C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000368378 p.A9Pfs*19 CLK2 chr1 155263197 155263197 3'UTR G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000368361 ASH1L chr1 155336372 155336372 3'UTR T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000368346 ASH1L chr1 155481317 155481317 Missense_Mutation T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000368346 p.K518R YY1AP1 chr1 155688429 155688430 Intron - - C TCGA-ZB-A966-01A-11D-A428-09 ENST00000295566 SSR2 chr1 156009422 156009422 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000295702 VHLL chr1 156299107 156299107 Missense_Mutation T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000339922 p.E28G RHBG chr1 156381359 156381359 Missense_Mutation T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000537040 p.L229P KIRREL chr1 158095419 158095419 3'UTR G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000359209 ATP1A2 chr1 160123321 160123321 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000361216 p.F98Sfs*72 RP11-404F10.2 chr1 160673396 160673397 5'Flank - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000628340 DEDD chr1 161121106 161121106 3'UTR T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000368006 ADAMTS4 chr1 161190541 161190541 3'UTR A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000367996 NUF2 chr1 163343859 163343859 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000271452 p.N267Mfs*44 LRRC52 chr1 165544882 165544882 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000294818 p.A196T GPR161 chr1 168085631 168085631 Frame_Shift_Del C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000367835 p.G497Afs*13 KIFAP3 chr1 169921492 169921492 3'UTR T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000361580 ANKRD45 chr1 173635838 173635838 Intron A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000333279 CENPL chr1 173807322 173807323 Frame_Shift_Ins - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000345664 p.S122Ffs*29 ZBTB37 chr1 173865195 173865195 5'Flank A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000367701 RC3H1 chr1 173936946 173936947 3'UTR TA TA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000258349 RASAL2 chr1 178474299 178474299 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000462775 ANGPTL1 chr1 178850506 178850506 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000234816 CEP350 chr1 180094406 180094406 Silent C C G TCGA-ZB-A966-01A-11D-A428-09 ENST00000367607 p.V2767V STX6 chr1 181002700 181002700 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000258301 p.S69N ZNF648 chr1 182057466 182057466 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000339948 p.T182M SMG7 chr1 183542292 183542292 Silent G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000347615 p.V544V RGL1 chr1 183884933 183884933 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000360851 p.A316T RGL1 chr1 183888551 183888551 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000360851 p.K345Rfs*12 HMCN1 chr1 186137653 186137653 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000271588 p.N4580D PRG4 chr1 186306934 186306934 Silent A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000445192 p.A405A PRG4 chr1 186307853 186307853 Missense_Mutation A A T TCGA-ZB-A966-01A-11D-A428-09 ENST00000445192 p.T712S TPR chr1 186344489 186344489 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000367478 p.E1101E GLRX2 chr1 193097654 193097654 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000367439 p.V97A MIR181B1 chr1 198858922 198858922 RNA T T A TCGA-ZB-A966-01A-11D-A428-09 ENST00000385240 NR5A2 chr1 200175994 200175994 3'UTR G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000367362 ZNF281 chr1 200406708 200406709 3'UTR - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000294740 IGFN1 chr1 201216043 201216043 Intron G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000295591 IPO9 chr1 201878634 201878636 3'UTR AGA AGA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000361565 RP11-480I12.7 chr1 202873566 202873566 RNA G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000456105 KLHL12 chr1 202892541 202892541 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000367261 p.E567K ATP2B4 chr1 203713229 203713229 Missense_Mutation C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000357681 p.T759N ZC3H11A chr1 203853661 203853661 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000332127 KISS1 chr1 204190634 204190634 Silent G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000367194 p.P89P PPP1R15B chr1 204405952 204405952 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000367188 LRRN2 chr1 204619063 204619063 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000367175 p.P310P TMCC2 chr1 205269327 205269327 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000358024 p.D375D AVPR1B chr1 206116055 206116055 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000367126 p.T279I IL10 chr1 206768308 206768309 3'UTR - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000423557 PLXNA2 chr1 208043117 208043117 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000367033 p.A1321T PLXNA2 chr1 208046029 208046029 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000367033 p.R1115H DIEXF chr1 209851239 209851239 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000491415 p.Y688C LPGAT1 chr1 211748082 211748082 3'Flank T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000366996 LPGAT1 chr1 211748683 211748683 3'Flank A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000366996 NSL1 chr1 212727021 212727021 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000366978 CCDC185 chr1 223395035 223395035 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000366875 p.H520H DNAH14 chr1 225023841 225023841 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000445597 p.K466Rfs*42 ENAH chr1 225495928 225495928 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000366844 ACBD3 chr1 226164828 226164828 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000366812 p.A177V OBSCN chr1 228350923 228350923 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000422127 p.G6133G SIPA1L2 chr1 232398664 232398664 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000262861 PCNXL2 chr1 233160358 233160358 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000258229 p.R1148C MLK4 chr1 233362160 233362160 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000366624 p.D473D TARBP1 chr1 234425721 234425721 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000040877 p.M1132I ARID4B chr1 235182104 235182104 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000264183 p.T939Rfs*2 EDARADD chr1 236483359 236483359 3'Flank T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000334232 HEATR1 chr1 236581267 236581269 Nonsense_Mutation GAG GAG - TCGA-ZB-A966-01A-11D-A428-09 ENST00000366582 p.S903_Q904delins* ZP4 chr1 237890567 237890567 Silent A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000366570 p.P23P CHRM3 chr1 239909144 239909144 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000255380 p.K567Rfs*31 KMO chr1 241590076 241590076 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000366559 p.A388V ZBTB18 chr1 244056272 244056272 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000622512 KIF26B chr1 245686391 245686392 Frame_Shift_Ins - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000407071 p.S1139Ifs*16 TPO chr2 1433518 1433518 Missense_Mutation T T A TCGA-ZB-A966-01A-11D-A428-09 ENST00000329066 p.I87N MYT1L chr2 1910340 1910340 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000399161 p.G573R LINC00299 chr2 8299740 8299740 RNA C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000442956 ROCK2 chr2 11182971 11182972 3'UTR TG TG - TCGA-ZB-A966-01A-11D-A428-09 ENST00000315872 E2F6 chr2 11446441 11446442 3'UTR - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000381525 NT5C1B chr2 18584804 18584804 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000359846 p.R205C PUM2 chr2 20251481 20251481 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000338086 APOB chr2 21001516 21001516 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000233242 GAREML chr2 26187899 26187899 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000401533 p.P756L OTOF chr2 26477462 26477462 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000272371 p.R787H KCNK3 chr2 26727906 26727906 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000302909 p.A175T AGBL5 chr2 27058581 27058581 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000360131 p.R618Q AGBL5 chr2 27070484 27070484 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000360131 EMILIN1 chr2 27083199 27083199 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000380320 p.Q543R CGREF1 chr2 27104459 27104459 Intron G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000260595 SUPT7L chr2 27655585 27655586 Frame_Shift_Del AG AG - TCGA-ZB-A966-01A-11D-A428-09 ENST00000337768 p.S254* EHD3 chr2 31266711 31266711 3'UTR G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000322054 YIPF4 chr2 32305772 32305772 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000238831 BIRC6 chr2 32618225 32618228 3'UTR TTTA TTTA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000421745 RASGRP3 chr2 33524447 33524447 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000402538 p.N237Ifs*5 FAM98A chr2 33585240 33585240 Missense_Mutation C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000238823 p.G365C HEATR5B chr2 37049755 37049755 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000233099 p.N865Tfs*36 PRKD3 chr2 37269503 37269503 Intron A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000234179 DHX57 chr2 38797844 38797844 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000457308 DYNC2LI1 chr2 43794342 43794342 Intron T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000260605 PPM1B chr2 44201237 44201238 Frame_Shift_Del AT AT - TCGA-ZB-A966-01A-11D-A428-09 ENST00000282412 p.H13Qfs*47 PRKCE chr2 46187589 46187589 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000306156 MSH2 chr2 47412449 47412449 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000233146 p.A230Lfs*16 MSH6 chr2 47807218 47807218 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000234420 PSME4 chr2 53936788 53936788 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000404125 p.V245V C2orf73 chr2 54360314 54360314 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000398634 p.T208Qfs*11 SMEK2 chr2 55548689 55548689 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000616407 PNPT1 chr2 55693876 55693876 5'Flank G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000415374 BCL11A chr2 60457823 60457823 3'UTR G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000335712 FBXO48 chr2 68464197 68464197 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000377957 NAGK chr2 71070462 71070462 Intron T T G TCGA-ZB-A966-01A-11D-A428-09 ENST00000244204 DYSF chr2 71598649 71598649 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000258104 p.T1202T TET3 chr2 74047523 74047523 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000409262 p.R536C TET3 chr2 74102025 74102025 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000409262 p.G1748Afs*106 SLC4A5 chr2 74247187 74247187 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000346834 p.T636T SLC4A5 chr2 74285808 74285808 Silent A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000346834 p.H122H GCFC2 chr2 75702125 75702125 Intron T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000321027 TMSB10 chr2 84906575 84906575 3'UTR C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000233143 TCF7L1 chr2 85305401 85305401 Splice_Region C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000282111 p.S329S TGOLN2 chr2 85326631 85326633 In_Frame_Del CTT CTT - TCGA-ZB-A966-01A-11D-A428-09 ENST00000409232 p.K367del ST3GAL5 chr2 85839979 85839979 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000377332 POLR1A chr2 86098703 86098703 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000263857 p.R114W IGKV2D-24 chr2 90005344 90005344 Silent C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000462693 p.T25T UNC50 chr2 98616332 98616332 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000357765 p.F178Sfs*7 EIF5B chr2 99393061 99393061 Missense_Mutation T T G TCGA-ZB-A966-01A-11D-A428-09 ENST00000289371 p.L948R SLC9A2 chr2 102709800 102709800 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000233969 RGPD4 chr2 107827068 107827068 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000408999 p.A19T SEPT10 chr2 109544251 109544251 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000397712 MERTK chr2 111994286 111994286 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000295408 p.S444S MERTK chr2 112028584 112028584 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000295408 p.T907I WDR33 chr2 127709822 127709822 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000322313 p.R1115C WDR33 chr2 127735478 127735478 Intron A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000322313 MAP3K19 chr2 134986785 134986785 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000375845 p.R696H CXCR4 chr2 136114845 136114845 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000241393 ZEB2 chr2 144388511 144388511 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000409487 ZEB2 chr2 144388937 144388937 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000409487 NEB chr2 151497947 151497948 Intron - - TT TCGA-ZB-A966-01A-11D-A428-09 ENST00000172853 CACNB4 chr2 151838665 151838666 3'UTR TT TT - TCGA-ZB-A966-01A-11D-A428-09 ENST00000539935 CACNB4 chr2 151838676 151838677 3'UTR TC TC - TCGA-ZB-A966-01A-11D-A428-09 ENST00000539935 CCDC148 chr2 158220705 158220705 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000283233 p.K420Nfs*15 PKP4 chr2 158680801 158680801 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000389759 RBMS1 chr2 160281383 160281383 Intron T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000348849 DPP4 chr2 161992536 161992536 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000360534 GRB14 chr2 164508778 164508778 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000263915 p.K297Nfs*23 SCN3A chr2 165090930 165090930 Silent A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000360093 p.C1741C XIRP2 chr2 167243448 167243448 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000628543 p.D513Mfs*5 BBS5 chr2 169504807 169504807 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000295240 AC007277.3 chr2 170682484 170682484 RNA G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000428156 RAPGEF4 chr2 172814608 172814609 Intron - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000397081 SP3 chr2 173954940 173954940 Silent A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000310015 p.V524V PRKRA chr2 178436145 178436145 Missense_Mutation C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000325748 p.D262Y FSIP2 chr2 185800311 185800312 Frame_Shift_Ins - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000424728 p.N3671Kfs*2 CCDC150 chr2 196701169 196701169 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000389175 p.G562R FZD7 chr2 202037663 202037663 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000286201 ABI2 chr2 203428160 203428160 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000295851 ZDBF2 chr2 206309704 206309704 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000374423 p.K1728Nfs*5 MDH1B chr2 206765276 206765279 5'UTR GAGA GAGA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000374412 FZD5 chr2 207763173 207763174 3'UTR AT AT - TCGA-ZB-A966-01A-11D-A428-09 ENST00000295417 FZD5 chr2 207766555 207766555 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000295417 PTH2R chr2 208450772 208450772 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000272847 p.A293T ERBB4 chr2 211382420 211382421 3'UTR - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000342788 IKZF2 chr2 213004993 213004993 3'Flank A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000434687 SMARCAL1 chr2 216435469 216435469 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000357276 p.T541Pfs*29 TMBIM1 chr2 218279051 218279054 Frame_Shift_Del AGAC AGAC - TCGA-ZB-A966-01A-11D-A428-09 ENST00000258412 p.V136Tfs*13 IHH chr2 219054584 219054584 3'UTR G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000295731 ASIC4 chr2 219538734 219538735 3'UTR AA AA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000347842 KCNE4 chr2 223054840 223054840 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000281830 IRS1 chr2 226796947 226796948 Frame_Shift_Ins - - CC TCGA-ZB-A966-01A-11D-A428-09 ENST00000305123 p.H598Gfs*39 SP100 chr2 230515769 230515769 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000264052 ITM2C chr2 230876936 230876936 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000326427 p.R177H ALPPL2 chr2 232409710 232409710 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000295453 p.H479H UGT1A3 chr2 233743464 233743464 Intron C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000482026 SH3BP4 chr2 235053911 235053911 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000344528 AGAP1 chr2 235744764 235744764 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000304032 p.V155I COL6A3 chr2 237324103 237324104 3'UTR CA CA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000295550 AC016757.3 chr2 238225194 238225194 RNA G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000470346 ING5 chr2 241709270 241709270 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000313552 p.T55M ATG7 chr3 11556615 11556615 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000354449 CCDC174 chr3 14670049 14670049 Silent T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000383794 p.P356P EFHB chr3 19882600 19882600 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000295824 p.R760W RAB5A chr3 19984415 19984416 3'UTR TT TT - TCGA-ZB-A966-01A-11D-A428-09 ENST00000273047 CMTM6 chr3 32482977 32482977 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000205636 MLH1 chr3 36993656 36993656 Nonsense_Mutation G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000231790 p.E37* SLC22A13 chr3 38265865 38265865 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000311856 p.A2V TGM4 chr3 44893594 44893594 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000296125 p.P150S SETD2 chr3 47101470 47101470 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000409792 p.F1668S KIF9 chr3 47273602 47273602 Frame_Shift_Del C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000265529 p.A106Qfs*21 PLXNB1 chr3 48423603 48423603 Nonsense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000296440 p.R337* ARIH2 chr3 48927442 48927442 Intron T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000356401 RBM5 chr3 50093845 50093845 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000347869 p.R103R TUSC2 chr3 50325031 50325031 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000232496 TUSC2 chr3 50326091 50326091 3'UTR G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000232496 CACNA2D2 chr3 50387585 50387585 Missense_Mutation T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000479441 p.K165E DNAH1 chr3 52386683 52386683 Frame_Shift_Del C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000420323 p.P2946Rfs*3 STAB1 chr3 52509914 52509914 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000321725 p.V800Cfs*113 PBRM1 chr3 52603573 52603573 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000296302 p.K909Nfs*6 ITIH4 chr3 52830427 52830427 Intron T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000266041 ARHGEF3 chr3 56728575 56728576 3'UTR AA AA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000296315 PRICKLE2 chr3 64097664 64097665 3'UTR - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000295902 FOXP1 chr3 70955827 70955828 3'UTR CG CG - TCGA-ZB-A966-01A-11D-A428-09 ENST00000318789 ROBO1 chr3 78661085 78661085 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000464233 p.F755Lfs*28 DCBLD2 chr3 98796268 98796268 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000326840 CEP97 chr3 101765615 101765615 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000341893 TRAT1 chr3 108847165 108847165 Intron A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000295756 CD200R1 chr3 112929093 112929093 Intron C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000471858 BOC chr3 113273210 113273210 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000355385 p.R368H SPICE1 chr3 113468232 113468232 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000295872 p.R354R KIAA2018 chr3 113649518 113649518 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000316407 NAA50 chr3 113721002 113721002 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000240922 ARHGAP31 chr3 119415336 119415336 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000264245 p.E1136G FSTL1 chr3 120396278 120396278 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000295633 POLQ chr3 121489747 121489747 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000264233 p.A1062T GOLGB1 chr3 121730044 121730044 Intron T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000340645 IQCB1 chr3 121781872 121781872 Splice_Region C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000310864 p.A427A ADCY5 chr3 123289861 123289861 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000462833 p.D1141N KLF15 chr3 126352585 126352585 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000296233 p.A113V PLXNA1 chr3 126989637 126989637 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000393409 p.R348R PLXNA1 chr3 127032391 127032391 Frame_Shift_Del C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000393409 p.L1747Cfs*5 RUVBL1 chr3 128098941 128098941 Frame_Shift_Del C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000322623 p.G253Dfs*7 RPN1 chr3 128644943 128644943 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000296255 p.R101H HMCES chr3 129288962 129288962 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000383463 p.R98C COL6A5 chr3 130468805 130468805 Missense_Mutation T T A TCGA-ZB-A966-01A-11D-A428-09 ENST00000312481 p.N2267K MRPL3 chr3 131462744 131462744 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000264995 p.A342A NPHP3 chr3 132721801 132721801 Intron A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000337331 MSL2 chr3 136150760 136150761 3'UTR - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000309993 STAG1 chr3 136502697 136502697 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000383202 p.A253A NME9 chr3 138304922 138304922 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000333911 p.V248I CLSTN2 chr3 140404558 140404558 Missense_Mutation G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000458420 p.K143N PXYLP1 chr3 141293021 141293021 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000286353 p.R420Q XRN1 chr3 142310330 142310331 3'UTR - - AT TCGA-ZB-A966-01A-11D-A428-09 ENST00000264951 ATR chr3 142550186 142550186 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000350721 p.T974T PLS1 chr3 142712736 142712736 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000337777 CHST2 chr3 143121676 143121676 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000309575 p.R287H ZIC4 chr3 147387536 147387536 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000383075 PFN2 chr3 149965646 149965647 3'UTR - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000239940 ERICH6 chr3 150660128 150660128 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000295910 p.L586F AADACL2 chr3 151744136 151744136 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000356517 p.T135T RAP2B chr3 153165693 153165693 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000323534 ARHGEF26 chr3 154122161 154122161 Missense_Mutation G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000356448 p.G57W KCNAB1 chr3 156120637 156120637 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000490337 p.A9V SSR3 chr3 156548838 156548838 Intron A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000265044 KPNA4 chr3 160502041 160502041 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000334256 PPM1L chr3 160842241 160842241 Intron C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000498165 SLITRK3 chr3 165189433 165189433 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000241274 p.N466N EGFEM1P chr3 168821222 168821222 RNA T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000483846 LRRC34 chr3 169796263 169796263 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000446859 p.A339T FNDC3B chr3 172399394 172399394 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000336824 NLGN1 chr3 174282809 174282809 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000457714 USP13 chr3 179752337 179752337 Missense_Mutation T T A TCGA-ZB-A966-01A-11D-A428-09 ENST00000263966 p.F588I TTC14 chr3 180608674 180608674 Intron T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000296015 FXR1 chr3 180977073 180977073 3'UTR T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000357559 DCUN1D1 chr3 182943307 182943308 3'UTR - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000292782 DCUN1D1 chr3 182944148 182944148 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000292782 MCF2L2 chr3 183400352 183400352 Intron T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000328913 MCF2L2 chr3 183400429 183400429 Intron G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000328913 KLHL6 chr3 183492049 183492049 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000341319 p.E582K KLHL24 chr3 183671079 183671079 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000242810 p.V424I ABCC5 chr3 183947469 183947469 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000334444 p.L1090Cfs*26 ALG3 chr3 184244817 184244817 Intron C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000397676 CAMK2N2 chr3 184261269 184261269 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000296238 p.P6L EIF4G1 chr3 184335309 184335310 3'UTR - - G TCGA-ZB-A966-01A-11D-A428-09 ENST00000346169 EPHB3 chr3 184577345 184577345 Missense_Mutation C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000330394 p.P453T MAP3K13 chr3 185473097 185473097 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000265026 p.R589H DNAJB11 chr3 186597164 186597166 In_Frame_Del GGA GGA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000538831 p.E65del P3H2 chr3 189964074 189964074 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000319332 p.R640C MB21D2 chr3 192796835 192796835 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000392452 MB21D2 chr3 192798490 192798491 Frame_Shift_Ins - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000392452 p.L458Tfs*7 UBXN7 chr3 196432139 196432140 Intron - - G TCGA-ZB-A966-01A-11D-A428-09 ENST00000296328 MYL5 chr4 679936 679936 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000400159 p.D70D TMEM175 chr4 953306 953306 Silent G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000264771 p.P193P FGFR3 chr4 1805856 1805856 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000260795 p.P584P CFAP99 chr4 2436927 2436927 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000616117 p.L55L RGS12 chr4 3317545 3317545 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000336727 p.G459S CPZ chr4 8607383 8607383 Frame_Shift_Del C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000360986 p.Q397Rfs*28 WDR1 chr4 10075100 10075100 3'UTR G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000382452 WDR1 chr4 10088307 10088307 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000382452 p.G235S ZNF518B chr4 10444891 10444891 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000326756 p.A480T CPEB2 chr4 15068980 15068980 3'Flank T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000507071 SLIT2 chr4 20567550 20567550 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000504154 p.C961C LGI2 chr4 25002390 25002390 3'UTR G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000382114 SLC34A2 chr4 25673224 25673224 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000382051 p.A396T STIM2 chr4 27021058 27021059 Intron AA AA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000467087 STIM2 chr4 27021553 27021553 Intron G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000467087 PDS5A chr4 39824589 39824589 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000303538 PDS5A chr4 39874341 39874341 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000303538 p.C742Y PHOX2B chr4 41744846 41744846 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000226382 CNGA1 chr4 47937155 47937155 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000358519 p.T447Qfs*8 SLC10A4 chr4 48483977 48483977 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000273861 p.A139V FRYL chr4 48497771 48497771 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000358350 SGCB chr4 52020793 52020793 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000381431 CLOCK chr4 55470787 55470787 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000309964 p.L123* CENPC chr4 67514090 67514090 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000273853 p.K476Nfs*38 UGT2B10 chr4 68822367 68822367 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000265403 p.V322I UGT2A3 chr4 68929864 68929865 Frame_Shift_Ins - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000251566 p.L511Ffs*8 COX18 chr4 73065265 73065265 Frame_Shift_Del C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000295890 p.A195Qfs*13 CXCL5 chr4 73996584 73996584 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000296027 CDKL2 chr4 75614396 75614396 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000429927 p.K74Nfs*5 G3BP2 chr4 75643350 75643350 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000359707 G3BP2 chr4 75644727 75644727 3'UTR G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000359707 CNOT6L chr4 77713612 77713612 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000504123 SEC31A chr4 82864412 82864412 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000355196 p.I462Lfs*16 ATOH1 chr4 93829231 93829231 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000306011 p.E104Sfs*3 SMARCAD1 chr4 94207686 94207686 5'Flank T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000354268 TSPAN5 chr4 98472334 98472334 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000305798 TACR3 chr4 103589831 103589831 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000304883 p.D417N TET2 chr4 105241950 105241954 Intron TTTTC TTTTC - TCGA-ZB-A966-01A-11D-A428-09 ENST00000380013 C4orf32 chr4 112187768 112187768 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000309733 ALPK1 chr4 112441403 112441403 3'UTR A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000177648 SYNPO2 chr4 119027221 119027221 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000429713 p.V284V SPATA5 chr4 123028276 123028276 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000274008 p.I654V FAT4 chr4 125450422 125450423 Frame_Shift_Ins - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000394329 p.A3138Cfs*16 NAA15 chr4 139389045 139389045 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000296543 UCP1 chr4 140563442 140563442 Silent T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000262999 p.T134T USP38 chr4 143185643 143185643 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000307017 p.L65L HHIP chr4 144738373 144738374 3'UTR - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000296575 FGG chr4 154609910 154609910 Intron T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000336098 GUCY1A3 chr4 155730623 155730623 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000296518 PDGFC chr4 156762214 156762214 3'UTR C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000502773 GRIA2 chr4 157365304 157365304 3'Flank C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000264426 AC106860.1 chr4 161003894 161003894 RNA C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000408435 NAF1 chr4 163126968 163126969 3'Flank TA TA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000274054 TKTL2 chr4 163471940 163471940 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000280605 p.R599C TKTL2 chr4 163472620 163472620 Missense_Mutation T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000280605 p.N372S MARCH1 chr4 163528169 163528170 3'UTR - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000274056 TENM3 chr4 182802371 182802371 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000511685 SORBS2 chr4 185593890 185593890 Frame_Shift_Del C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000284776 p.E1044Nfs*65 TLR3 chr4 186079008 186079008 Silent T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000296795 p.L204L TLR3 chr4 186084811 186084811 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000296795 p.R885W PLEKHG4B chr5 163465 163465 Frame_Shift_Del C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000283426 p.P777Rfs*30 TPPP chr5 665187 665187 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000360578 p.R192H LPCAT1 chr5 1477420 1477420 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000283415 p.R295W CTD-2012J19.3 chr5 1593150 1593150 5'Flank C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000605200 FASTKD3 chr5 7867656 7867656 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000264669 p.K143Rfs*36 CCT5 chr5 10260880 10260880 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000280326 p.A321V MYO10 chr5 16668356 16668356 Missense_Mutation A A T TCGA-ZB-A966-01A-11D-A428-09 ENST00000513610 p.I1999N MYO10 chr5 16694496 16694497 Frame_Shift_Ins - - C TCGA-ZB-A966-01A-11D-A428-09 ENST00000513610 p.S1226Lfs*25 BASP1 chr5 17276111 17276111 3'UTR G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000322611 LMBRD2 chr5 36122372 36122372 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000296603 p.N343Mfs*56 NIPBL chr5 36984687 36984687 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000282516 p.R505Efs*35 NIPBL chr5 36985627 36985627 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000282516 p.R816H WDR70 chr5 37752630 37752630 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000265107 EGFLAM chr5 38352284 38352284 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000354891 p.A166A C9 chr5 39341276 39341276 Nonsense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000263408 p.R116* CARD6 chr5 40852992 40852992 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000254691 p.F556Sfs*5 FST chr5 53485187 53485187 Silent A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000256759 p.S304S PLK2 chr5 58457185 58457185 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000274289 p.L335Cfs*68 PDE4D chr5 59988354 59988354 Intron T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000502484 HTR1A chr5 63961439 63961439 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000323865 p.A94V PIK3R1 chr5 68298675 68298675 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000521381 CENPH chr5 69197075 69197075 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000283006 p.N115Tfs*16 BDP1 chr5 71510062 71510062 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000358731 p.I992Yfs*14 HMGCR chr5 75361319 75361319 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000287936 WDR41 chr5 77449807 77449807 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000296679 p.R217H MSH3 chr5 80854257 80854257 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000265081 p.T981A ATP6AP1L chr5 82295496 82295496 5'UTR T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000380167 ADGRV1 chr5 90653661 90653661 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000405460 p.P1363S ADGRV1 chr5 90755043 90755043 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000405460 p.A3813V KIAA0825 chr5 94484867 94484867 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000513200 p.L345S ANKRD32 chr5 94654690 94654690 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000265140 p.K365E ELL2 chr5 95887845 95887845 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000237853 REEP5 chr5 112922177 112922177 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000379638 p.M5T REEP5 chr5 112922334 112922334 5'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000379638 SEMA6A chr5 116446106 116446106 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000343348 DMXL1 chr5 119170958 119170958 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000311085 p.R2056H PRR16 chr5 120686737 120686737 3'UTR T T A TCGA-ZB-A966-01A-11D-A428-09 ENST00000407149 SRFBP1 chr5 122027171 122027171 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000339397 C5orf15 chr5 133956460 133956460 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000231512 UBE2B chr5 134391668 134391668 3'UTR A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000265339 TRPC7 chr5 136251782 136251782 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000513104 p.F482F TRPC7 chr5 136356664 136356664 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000513104 p.A242T HSPA9 chr5 138556932 138556932 Intron T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000297185 IK chr5 140662411 140662411 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000417647 HARS2 chr5 140695609 140695609 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000230771 p.G167G PCDHA5 chr5 140821919 140821919 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000529859 p.A48A PCDHA7 chr5 140835832 140835832 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000525929 p.D483D PCDHA12 chr5 140877359 140877359 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000398631 p.G629G PCDHB6 chr5 141151474 141151474 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000231136 p.A406V PCDHB16 chr5 141185754 141185754 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000609684 PCDHB10 chr5 141193169 141193169 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000239446 p.G206E PCDHGA1 chr5 141332567 141332567 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000517417 p.T628M PCDHGA8 chr5 141394802 141394802 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000398604 p.A663A DIAPH1 chr5 141515147 141515147 3'UTR C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000389054 TCERG1 chr5 146507160 146507160 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000296702 p.K957Rfs*17 ABLIM3 chr5 149247801 149247801 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000309868 p.R524Q ABLIM3 chr5 149247867 149247867 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000309868 p.R546Q CSNK1A1 chr5 149496155 149496155 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000377843 SLC36A1 chr5 151488648 151488648 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000243389 RNF145 chr5 159203632 159203633 5'UTR TC TC - TCGA-ZB-A966-01A-11D-A428-09 ENST00000424310 TENM2 chr5 168124986 168124986 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000518659 p.T715T DOCK2 chr5 169761598 169761598 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000256935 p.V843I CREBRF chr5 173134739 173134739 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000296953 CPEB4 chr5 173958884 173958884 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000265085 EIF4E1B chr5 176646051 176646051 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000318682 NSD1 chr5 177295542 177295542 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000439151 MAML1 chr5 179777085 179777086 3'UTR TG TG - TCGA-ZB-A966-01A-11D-A428-09 ENST00000292599 CNOT6 chr5 180574746 180574746 3'UTR T T A TCGA-ZB-A966-01A-11D-A428-09 ENST00000261951 FLT4 chr5 180628995 180628995 Missense_Mutation A A T TCGA-ZB-A966-01A-11D-A428-09 ENST00000261937 p.N330K EXOC2 chr6 564069 564069 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000230449 p.R585C FOXQ1 chr6 1314357 1314357 3'Flank T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000296839 BLOC1S5 chr6 8015173 8015173 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000397457 MAK chr6 10764140 10764140 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000313243 HIVEP1 chr6 12121950 12121950 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000379388 p.P719S MRS2 chr6 24423718 24423718 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000378386 BTN3A1 chr6 26413475 26413475 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000289361 p.R442Q ZKSCAN4 chr6 28245130 28245130 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000377294 p.T542Lfs*27 OR2J1 chr6 29100952 29100952 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000377171 p.N6Mfs*21 OR11A1 chr6 29427221 29427221 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000377147 p.R141W PPP1R10 chr6 30602371 30602371 Missense_Mutation C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000376511 p.G760C PPP1R10 chr6 30604713 30604713 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000376511 p.T326M TUBB chr6 30724418 30724418 3'UTR A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000327892 DDX39B chr6 31541145 31541145 Intron G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000396172 BAG6 chr6 31641570 31641570 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000375964 p.T813M PPP1R2P1 chr6 32879399 32879399 RNA C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000420261 ZBTB9 chr6 33456356 33456356 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000395064 p.R419H HMGA1 chr6 34246210 34246210 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000311487 FKBP5 chr6 35575443 35575443 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000357266 CPNE5 chr6 36743701 36743701 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000244751 p.R517R C6orf89 chr6 36899594 36899595 Frame_Shift_Ins - - C TCGA-ZB-A966-01A-11D-A428-09 ENST00000373685 p.Q54Afs*10 PIM1 chr6 37175380 37175380 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000373509 MDGA1 chr6 37696816 37696816 5'UTR A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000434837 DNAH8 chr6 38723150 38723150 5'UTR G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000359357 GLP1R chr6 39066205 39066205 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000373256 p.P137P PGC chr6 41744740 41744740 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000373025 p.L43P FRS3 chr6 41770294 41770294 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000259748 FRS3 chr6 41771358 41771358 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000259748 p.T247I PRICKLE4 chr6 41784933 41784933 Splice_Site A A T TCGA-ZB-A966-01A-11D-A428-09 ENST00000359201 p.X41_splice POLH chr6 43604669 43604669 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000372236 p.R313R SLC29A1 chr6 44229751 44229751 Missense_Mutation C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000371708 p.L92M HSP90AB1 chr6 44253710 44253710 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000353801 TDRD6 chr6 46688587 46688587 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000316081 p.D153D TDRD6 chr6 46692413 46692413 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000316081 p.N1430Ifs*5 ADGRF4 chr6 47714027 47714027 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000283303 p.S261N CENPQ chr6 49493064 49493064 3'UTR T T G TCGA-ZB-A966-01A-11D-A428-09 ENST00000335783 PAQR8 chr6 52403893 52403893 Missense_Mutation C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000360726 p.P227H ICK chr6 53005250 53005250 Missense_Mutation T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000350082 p.T600A DST chr6 56607822 56607822 Intron T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000312431 KIAA1586 chr6 57054930 57054930 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000370733 PTP4A1 chr6 63581143 63581143 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000370651 PHF3 chr6 63685353 63685353 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000262043 p.P544L COL9A1 chr6 70252126 70252126 Silent C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000357250 p.G622G KHDC1 chr6 73242222 73242223 Frame_Shift_Del TA TA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000370384 p.Y116Pfs*5 EEF1A1 chr6 73517898 73517898 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000309268 p.A434V EEF1A1 chr6 73518391 73518391 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000309268 p.N331Mfs*14 RP1-234P15.4 chr6 75295771 75295771 3'Flank A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000607221 MYO6 chr6 75890141 75890141 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000369977 p.K917Nfs*10 PHIP chr6 79060724 79060724 Missense_Mutation G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000275034 p.P95H SNHG5 chr6 85677265 85677265 Intron A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000369605 ZNF292 chr6 87257485 87257486 Frame_Shift_Ins - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000369577 p.S1288Ffs*6 ORC3 chr6 87609120 87609120 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000392844 p.R204Gfs*16 GABRR1 chr6 89180427 89180427 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000454853 p.R337R MDN1 chr6 89650176 89650176 Nonsense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000369393 p.R5352* MANEA chr6 95586994 95586995 Intron TA TA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000358812 FUT9 chr6 96210844 96210844 3'UTR C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000302103 SIM1 chr6 100448663 100448663 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000262901 p.G187S SEC63 chr6 107893551 107893552 Frame_Shift_Del TT TT - TCGA-ZB-A966-01A-11D-A428-09 ENST00000369002 p.K535Tfs*24 AK9 chr6 109528988 109528988 Intron A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000424296 CDC40 chr6 110230263 110230263 3'UTR G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000307731 MARCKS chr6 113861087 113861089 3'UTR TTA TTA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000612661 FRK chr6 115941934 115941934 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000606080 RNF146 chr6 127287052 127287052 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000368314 p.A147T Z97352.1 chr6 129747761 129747761 RNA C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000620351 L3MBTL3 chr6 130104574 130104574 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000361794 p.R629G AKAP7 chr6 131160136 131160136 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000431975 p.K79Rfs*21 MYB chr6 135218774 135218774 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000367814 PDE7B chr6 136154128 136154128 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000308191 p.A178T MAP3K5 chr6 136613144 136613144 Silent A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000359015 p.N797N HIVEP2 chr6 142771657 142771657 Nonsense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000012134 p.R1028* SAMD5 chr6 147565387 147565387 3'UTR G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000367474 TAB2 chr6 149411016 149411016 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000367456 NUP43 chr6 149742486 149742486 Missense_Mutation C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000340413 p.G136C ARID1B chr6 157208122 157208123 3'UTR - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000350026 AGPAT4 chr6 161139557 161139557 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000320285 p.R303Gfs*7 LINC00473 chr6 165987616 165987616 RNA A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000584911 PHF10 chr6 169717894 169717894 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000339209 p.R113Q GPER1 chr7 1093500 1093500 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000297469 C7orf50 chr7 1127321 1127321 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000357429 p.A22V FOXK1 chr7 4759501 4759501 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000328914 p.S534S AP5Z1 chr7 4789998 4789998 Intron C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000348624 RADIL chr7 4801896 4801896 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000399583 p.R867C RADIL chr7 4817297 4817297 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000399583 p.A557V AIMP2 chr7 6023336 6023336 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000223029 p.T203M SOSTDC1 chr7 16462150 16462150 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000307068 SP8 chr7 20782844 20782844 3'Flank A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000361443 DNAH11 chr7 21901569 21901569 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000409508 TRA2A chr7 23522269 23522269 Intron A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000297071 HOXA9 chr7 27163347 27163347 3'UTR C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000343483 HOXA10 chr7 27173876 27173876 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000283921 p.P144Rfs*113 NOD1 chr7 30453017 30453017 Nonsense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000222823 p.R134* ELMO1 chr7 36854438 36854438 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000310758 ELMO1 chr7 36894902 36894902 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000310758 p.R518H GLI3 chr7 41965206 41965206 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000395925 p.S1289S HECW1 chr7 43444746 43444746 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000395891 p.R525Q ZMIZ2 chr7 44766256 44766256 Frame_Shift_Del C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000309315 p.I781Sfs*12 C7orf72 chr7 50159176 50159176 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000297001 GBAS chr7 55999424 55999424 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000322090 ZNF716 chr7 57470106 57470106 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000420713 NSUN5 chr7 73304310 73304312 In_Frame_Del TCC TCC - TCGA-ZB-A966-01A-11D-A428-09 ENST00000252594 p.E284del FKBP6 chr7 73328641 73328641 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000252037 p.V42I CLIP2 chr7 74372953 74372953 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000223398 p.A468T GATSL2 chr7 75017711 75017711 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000616305 p.A100T RHBDD2 chr7 75881929 75881929 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000006777 p.T93T RSBN1L chr7 77779389 77779389 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000334955 PCLO chr7 82952575 82952575 Missense_Mutation T T G TCGA-ZB-A966-01A-11D-A428-09 ENST00000333891 p.E2793A ABCB4 chr7 87423983 87423983 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000265723 p.V712I FZD1 chr7 91267201 91267202 3'UTR - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000287934 FAM133B chr7 92561529 92561529 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000445716 PPP1R9A chr7 95295120 95295120 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000340694 NPTX2 chr7 98629792 98629792 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000265634 TRRAP chr7 98912179 98912179 Missense_Mutation C C G TCGA-ZB-A966-01A-11D-A428-09 ENST00000359863 p.S722C ARPC1A chr7 99354060 99354060 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000262942 p.R218C ZNF394 chr7 99493923 99493923 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000337673 p.R431H ZKSCAN1 chr7 100023731 100023731 Missense_Mutation T T A TCGA-ZB-A966-01A-11D-A428-09 ENST00000324306 p.S75R SPDYE3 chr7 100307906 100307906 Missense_Mutation G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000332397 p.Q7H LRCH4 chr7 100578414 100578414 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000310300 p.P278L PCOLCE chr7 100607781 100607781 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000223061 p.C386Y GIGYF1 chr7 100685104 100685104 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000275732 p.S412F SRRT chr7 100881737 100881737 Frame_Shift_Del C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000611405 p.P112Lfs*37 TRIM56 chr7 101088577 101088577 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000306085 p.A424Pfs*108 TRIM56 chr7 101090326 101090326 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000306085 RELN chr7 103515350 103515350 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000428762 p.D2652N DOCK4 chr7 111765135 111765136 Frame_Shift_Ins - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000437633 p.F1326Ifs*8 CAPZA2 chr7 116919070 116919070 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000361183 KCND2 chr7 120733064 120733064 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000331113 p.K426R KCND2 chr7 120748283 120748283 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000331113 CPED1 chr7 121100049 121100049 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000310396 p.T291T WNT16 chr7 121331825 121331825 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000222462 p.G167Afs*17 RNF133 chr7 122698503 122698503 Missense_Mutation A A C TCGA-ZB-A966-01A-11D-A428-09 ENST00000340112 p.V139G LRRC4 chr7 128028180 128028180 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000249363 SND1 chr7 128087028 128087028 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000354725 p.A799T CICP14 chr7 128656268 128656268 RNA A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000629111 IRF5 chr7 128948261 128948263 In_Frame_Del TCT TCT - TCGA-ZB-A966-01A-11D-A428-09 ENST00000249375 p.F397del RP11-286H14.4 chr7 129126549 129126549 RNA C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000467614 PODXL chr7 131510966 131510966 Nonsense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000378555 p.R190* SLC35B4 chr7 134292257 134292257 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000378509 CNOT4 chr7 135362556 135362556 3'UTR T T A TCGA-ZB-A966-01A-11D-A428-09 ENST00000541284 HIPK2 chr7 139572610 139572610 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000406875 PRSS1 chr7 142751940 142751940 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000311737 p.V123M TCAF2 chr7 143727653 143727653 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000441159 p.R916C RP11-61L23.2 chr7 143810864 143810864 3'Flank G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000494978 ZNF425 chr7 149112345 149112345 Intron T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000378061 ZNF783 chr7 149266444 149266444 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000378052 p.T45M SSPO chr7 149791410 149791410 Intron G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000378016 NOS3 chr7 151001906 151001906 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000297494 p.R530W SLC4A2 chr7 151076245 151076245 Intron C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000413384 KMT2C chr7 152136556 152136557 3'UTR - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000262189 HTR5A chr7 155071519 155071519 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000287907 p.G207D INSIG1 chr7 155309416 155309416 3'UTR G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000340368 VIPR2 chr7 159032048 159032048 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000262178 p.L331F DLGAP2 chr8 1702363 1702363 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000421627 KBTBD11 chr8 2003469 2003469 3'UTR G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000320248 TNKS chr8 9777196 9777197 3'UTR - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000310430 RP1L1 chr8 10610040 10610042 In_Frame_Del TCT TCT - TCGA-ZB-A966-01A-11D-A428-09 ENST00000382483 p.E1353del XKR6 chr8 10898710 10898710 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000416569 p.V390M CNOT7 chr8 17229852 17229852 3'UTR A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000361272 SLC7A2 chr8 17544572 17544572 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000494857 p.F168Lfs*9 PSD3 chr8 18530700 18530700 3'UTR T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000440756 PSD3 chr8 18556275 18556275 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000440756 p.D956Tfs*14 CSGALNACT1 chr8 19420363 19420363 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000332246 p.T370M STC1 chr8 23854655 23854655 5'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000290271 DOCK5 chr8 25399913 25399913 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000276440 p.F1571Lfs*19 EBF2 chr8 25844231 25844231 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000520164 PPP2R2A chr8 26370192 26370192 Nonsense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000380737 p.R375* PPP2R2A chr8 26370235 26370235 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000380737 p.R389H INTS9 chr8 28787872 28787875 Frame_Shift_Del TGTT TGTT - TCGA-ZB-A966-01A-11D-A428-09 ENST00000521022 p.K351Rfs*22 NRG1 chr8 32763820 32763820 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000405005 p.S447S ERLIN2 chr8 37754115 37754115 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000276461 ADGRA2 chr8 37843743 37843743 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000412232 IDO2 chr8 39989787 39989787 Nonsense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000389060 p.R206* ZMAT4 chr8 40532033 40532034 3'UTR - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000297737 THAP1 chr8 42837682 42837682 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000254250 SPIDR chr8 47673653 47673653 Intron C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000297423 PRKDC chr8 47893284 47893284 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000314191 p.G1234G PRKDC chr8 47898527 47898527 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000314191 p.R1136H PLAG1 chr8 56163367 56163367 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000316981 CLVS1 chr8 61499736 61499737 3'UTR TT TT - TCGA-ZB-A966-01A-11D-A428-09 ENST00000325897 C8orf46 chr8 66510097 66510097 Splice_Region G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000305454 p.V94V SGK3 chr8 66860090 66860090 3'UTR G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000345714 EYA1 chr8 71356586 71356586 Intron A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000340726 UBE2W chr8 73792791 73792791 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000602593 ZFHX4 chr8 76863491 76863491 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000521891 p.G3259G PEX2 chr8 77000136 77000137 5'UTR AA AA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000357039 SLC26A7 chr8 91340519 91340519 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000276609 p.K333Nfs*20 RUNX1T1 chr8 91960154 91960155 3'UTR - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000265814 RAD54B chr8 94378323 94378324 Frame_Shift_Ins - - C TCGA-ZB-A966-01A-11D-A428-09 ENST00000336148 p.A791Gfs*10 PLEKHF2 chr8 95155648 95155648 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000315367 KCNS2 chr8 98428089 98428089 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000287042 p.R37H FBXO43 chr8 100141950 100141950 Missense_Mutation T T G TCGA-ZB-A966-01A-11D-A428-09 ENST00000428847 p.T102P SPAG1 chr8 100220322 100220322 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000251809 p.R527W DCAF13 chr8 103427259 103427259 Splice_Region T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000612750 DPYS chr8 104427986 104427986 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000351513 p.G363Afs*33 TRPS1 chr8 115411825 115411825 3'Flank A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000220888 TRPS1 chr8 115412545 115412545 3'Flank T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000220888 UTP23 chr8 116770268 116770268 Nonsense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000309822 p.R89* HAS2 chr8 121613251 121613251 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000303924 FAM83A chr8 123207348 123207348 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000518448 p.S322N ASAP1 chr8 130052391 130052391 3'Flank G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000518721 ADCY8 chr8 130780323 130780323 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000286355 ZFAT chr8 134637619 134637619 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000377838 p.P97L COL22A1 chr8 138589432 138589432 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000303045 p.G1568R MROH5 chr8 141496490 141496490 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000621837 p.P31Lfs*6 TSNARE1 chr8 142318600 142318600 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000524325 p.A310T JRK chr8 142665163 142665163 Missense_Mutation T T A TCGA-ZB-A966-01A-11D-A428-09 ENST00000612905 p.D299V LY6K chr8 142703103 142703103 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000292430 p.R77H EEF1D chr8 143589099 143589099 Intron C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000317198 MROH1 chr8 144241401 144241401 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000326134 p.A688T FOXD4 chr9 117904 117904 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000382500 p.G72G BNC2 chr9 16418560 16418560 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000380672 BNC2 chr9 16436641 16436641 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000380672 p.A518V DCAF12 chr9 34088276 34088276 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000361264 DCAF12 chr9 34089568 34089568 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000361264 p.Y349Y VCP chr9 35059650 35059650 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000358901 p.N616Mfs*63 TLN1 chr9 35724313 35724313 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000314888 p.R178Q RECK chr9 36123176 36123176 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000377966 PAX5 chr9 37002796 37002796 Intron C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000358127 ANKRD20A4 chr9 64378771 64378771 Nonsense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000357336 p.R233* ZNF658 chr9 66903376 66903376 5'UTR T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000612867 GDA chr9 72250585 72250585 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000358399 SPATA31D5P chr9 81919520 81919520 RNA C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000527857 UBQLN1 chr9 83660536 83660536 3'UTR A A T TCGA-ZB-A966-01A-11D-A428-09 ENST00000376395 KIF27 chr9 83867874 83867874 Intron A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000297814 CTSL chr9 87728648 87728648 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000340342 p.K154E SEMA4D chr9 89379336 89379336 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000356444 p.V653I IARS chr9 92287490 92287491 Intron - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000375643 ANKRD19P chr9 92813924 92813924 RNA C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000473204 ANKRD19P chr9 92883923 92883923 RNA G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000473204 C9orf89 chr9 93107809 93107809 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000466409 p.A48V WNK2 chr9 93292730 93292730 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000297954 p.D1792D SLC35D2 chr9 96360168 96360168 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000253270 p.S111S GABBR2 chr9 98288739 98288739 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000259455 GRIN3A chr9 101623362 101623362 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000361820 p.A857V TOPORSLP chr9 104276420 104276420 RNA A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000493279 NIPSNAP3A chr9 104751059 104751059 Missense_Mutation A A T TCGA-ZB-A966-01A-11D-A428-09 ENST00000374767 p.N55I ABCA1 chr9 104884481 104884481 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000374736 p.R83H SLC44A1 chr9 105390651 105390651 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000374720 RAD23B chr9 107330975 107330975 3'UTR G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000358015 FAM206A chr9 108934462 108934462 5'UTR G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000322940 PALM2-AKAP2 chr9 110170232 110170232 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000374530 OR2K2 chr9 111327628 111327629 Frame_Shift_Ins - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000374428 p.I298Nfs*? PTBP3 chr9 112218839 112218839 3'Flank T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000374255 SLC46A2 chr9 112889742 112889742 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000374228 p.G314S RGS3 chr9 113506395 113506395 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000350696 p.P329P RABGAP1 chr9 123103987 123103987 3'UTR G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000373647 RABGAP1 chr9 123103990 123103997 3'UTR TGTGTGTA TGTGTGTA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000373647 ZER1 chr9 128731143 128731143 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000291900 LRRC8A chr9 128917106 128917106 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000259324 FAM73B chr9 129042286 129042286 Intron G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000358369 NCS1 chr9 130233798 130233798 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000372398 NCS1 chr9 130233799 130233799 3'UTR T T A TCGA-ZB-A966-01A-11D-A428-09 ENST00000372398 HMCN2 chr9 130392074 130392074 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000624552 p.P3363P ABL1 chr9 130887612 130887612 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000318560 FAM78A chr9 131258144 131258144 3'UTR G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000372271 PRRC2B chr9 131479360 131479360 Missense_Mutation C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000357304 p.L1623M NTNG2 chr9 132226886 132226886 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000393229 p.R299C RALGDS chr9 133097814 133097814 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000372050 SURF6 chr9 133332715 133332715 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000372022 p.R147W ADAMTS13 chr9 133426018 133426018 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000371929 p.D165D VAV2 chr9 133763129 133763129 3'UTR G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000371850 BRD3 chr9 134032853 134032856 3'UTR TTTA TTTA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000303407 OLFM1 chr9 135119801 135119801 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000371793 p.E361K GLT6D1 chr9 135623705 135623706 3'UTR - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000371763 NACC2 chr9 136050269 136050271 In_Frame_Del AGA AGA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000277554 p.F84del SNAPC4 chr9 136395301 136395301 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000298532 p.G156G CCDC183 chr9 136804572 136804574 In_Frame_Del AGA AGA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000338005 p.K248del MAMDC4 chr9 136856590 136856590 Intron T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000317446 LCN12 chr9 136953773 136953773 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000371633 p.G109S ABCA2 chr9 137017218 137017218 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000341511 p.T844M ZMYND11 chr10 254359 254359 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000381591 PFKP chr10 3105214 3105214 Intron T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000381125 NET1 chr10 5457194 5457194 3'UTR A A T TCGA-ZB-A966-01A-11D-A428-09 ENST00000355029 CELF2 chr10 11330231 11330231 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000416382 SEPHS1 chr10 13318448 13318448 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000327347 PIP4K2A chr10 22536965 22536968 3'UTR CCAA CCAA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000376573 MYO3A chr10 26211972 26211972 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000265944 ACBD5 chr10 27235166 27235166 Missense_Mutation G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000375888 p.F74L C10orf126 chr10 28880359 28880359 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000614533 p.A147Qfs*38 RP11-313J2.1 chr10 42335781 42335781 RNA T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000609841 ZNF32 chr10 43646149 43646149 5'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000374433 BMS1P1 chr10 46786794 46786794 RNA T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000580094 RBP3 chr10 47349869 47349869 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000584701 p.R462H FRMPD2 chr10 48232272 48232272 Silent G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000374201 p.S337S WDFY4 chr10 48820291 48820291 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000325239 p.D1855N OGDHL chr10 49737978 49737978 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000374103 p.R829H ANK3 chr10 60080600 60080600 Nonsense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000280772 p.R1457* ANK3 chr10 60083549 60083549 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000280772 p.Q1381Q LRRTM3 chr10 67098048 67098049 3'UTR - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000361320 DNA2 chr10 68422308 68422308 Missense_Mutation A A T TCGA-ZB-A966-01A-11D-A428-09 ENST00000358410 p.F872I TET1 chr10 68645121 68645121 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000373644 p.A798T TET1 chr10 68646890 68646890 Silent A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000373644 p.T1387T SYNPO2L chr10 73645730 73645730 3'UTR G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000394810 ZSWIM8 chr10 73797093 73797093 Intron G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000605216 ZSWIM8 chr10 73800788 73800789 Intron CC CC - TCGA-ZB-A966-01A-11D-A428-09 ENST00000605216 ZNF503 chr10 75398483 75398484 3'UTR - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000372524 RNU6-1266P chr10 77781808 77781808 5'Flank G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000362794 EIF5AL1 chr10 79515901 79515901 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000520547 NUTM2B chr10 79703855 79703855 Missense_Mutation T T A TCGA-ZB-A966-01A-11D-A428-09 ENST00000429828 p.F82L RGR chr10 84257976 84257976 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000359452 p.D242D PTEN chr10 87966828 87966828 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000371953 TNKS2 chr10 91831114 91831114 Missense_Mutation C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000371627 p.P403H EXOC6 chr10 92848609 92848609 Missense_Mutation A A T TCGA-ZB-A966-01A-11D-A428-09 ENST00000260762 p.T26S EXOC6 chr10 93058650 93058650 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000260762 CYP26A1 chr10 93074030 93074030 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000224356 p.C32C SORBS1 chr10 95356972 95356972 Intron C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000361941 ZDHHC16 chr10 97455748 97455750 In_Frame_Del AAG AAG - TCGA-ZB-A966-01A-11D-A428-09 ENST00000370854 p.K306del ABCC2 chr10 99844346 99844346 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000370449 p.P1290S DNMBP chr10 99877215 99877215 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000324109 p.A1557V FAM178A chr10 100930996 100930996 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000238961 p.L787* FAM178A chr10 100963760 100963761 3'UTR - - G TCGA-ZB-A966-01A-11D-A428-09 ENST00000238961 PDZD7 chr10 101030053 101030054 Frame_Shift_Ins - - G TCGA-ZB-A966-01A-11D-A428-09 ENST00000370215 p.R56Pfs*24 PSD chr10 102402915 102402916 3'UTR - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000020673 SH3PXD2A chr10 103600274 103600274 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000369774 COL17A1 chr10 104043833 104043833 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000353479 p.V809A COL17A1 chr10 104059690 104059690 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000353479 p.E391Kfs*12 GSTO2 chr10 104275203 104275203 Intron C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000338595 XPNPEP1 chr10 109870813 109870814 Frame_Shift_Ins - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000502935 p.L538Ffs*5 ADD3 chr10 110133592 110133592 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000356080 p.K701Rfs*8 ADRB1 chr10 114045770 114045770 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000369295 AFAP1L2 chr10 114295017 114295020 3'UTR AAAA AAAA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000304129 CCDC172 chr10 116325336 116325336 Missense_Mutation T T A TCGA-ZB-A966-01A-11D-A428-09 ENST00000333254 p.I38N PDZD8 chr10 117341087 117341087 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000334464 p.P297Hfs*32 EMX2 chr10 117549064 117549065 3'UTR - - G TCGA-ZB-A966-01A-11D-A428-09 ENST00000553456 CACUL1 chr10 118685945 118685946 3'UTR TT TT - TCGA-ZB-A966-01A-11D-A428-09 ENST00000369151 INPP5F chr10 119829085 119829085 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000361976 TACC2 chr10 122083226 122083226 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000334433 p.G242G JAKMIP3 chr10 132168013 132168013 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000298622 CFAP46 chr10 132846093 132846093 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000368586 p.G2134G CFAP46 chr10 132867387 132867387 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000368586 p.D1577D AP2A2 chr11 1011107 1011107 3'UTR C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000448903 CARS chr11 3018452 3018452 Missense_Mutation T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000397111 p.S446G OR51E1 chr11 4652987 4652987 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000396952 p.A156Lfs*3 OR52J3 chr11 5047433 5047433 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000380370 p.R303Q OR52A5 chr11 5132389 5132389 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000307388 p.G85D OR51V1 chr11 5200016 5200016 Missense_Mutation G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000321255 p.L229M ILK chr11 6610841 6610841 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000299421 DCHS1 chr11 6633504 6633504 Missense_Mutation G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000299441 p.P788H CTR9 chr11 10768160 10768160 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000361367 p.I653M BTBD10 chr11 13388121 13388121 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000278174 RRAS2 chr11 14278931 14278931 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000256196 SOX6 chr11 15972132 15972132 3'Flank A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000528429 SOX6 chr11 15972592 15972593 3'Flank - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000528429 OTOG chr11 17573212 17573212 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000399391 p.A751T KCNC1 chr11 17736251 17736251 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000379472 p.C83C MRGPRX3 chr11 18137379 18137379 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000396275 p.N59N MRGPRX3 chr11 18137756 18137756 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000396275 p.L187Yfs*25 RP11-113D6.10 chr11 18210554 18210555 RNA - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000527059 SPTY2D1 chr11 18614820 18614820 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000336349 p.P485Rfs*12 ANO5 chr11 22279553 22279553 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000324559 p.L845* MUC15 chr11 26565880 26565880 5'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000455601 ANO3 chr11 26661564 26661564 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000256737 SLC1A2 chr11 35312269 35312269 Missense_Mutation T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000278379 p.S164G API5 chr11 43343195 43343196 3'Flank TG TG - TCGA-ZB-A966-01A-11D-A428-09 ENST00000531273 PHF21A chr11 45932722 45932722 3'Flank T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000418153 OR8J3 chr11 56137450 56137450 Missense_Mutation T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000301529 p.K90R C11orf31 chr11 57743160 57743160 3'Flank T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000388857 BEST1 chr11 61962956 61962957 Intron CT CT - TCGA-ZB-A966-01A-11D-A428-09 ENST00000378043 BEST1 chr11 61968512 61968512 3'Flank G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000378043 NXF1 chr11 62796074 62796074 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000294172 p.A485T NRXN2 chr11 64690447 64690447 Frame_Shift_Del C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000265459 p.A270Pfs*57 CDC42BPG chr11 64833754 64833754 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000342711 p.R850H MALAT1 chr11 65501842 65501842 3'Flank G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000625158 MUS81 chr11 65865884 65865884 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000308110 p.R527C KLC2 chr11 66266707 66266707 Intron G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000316924 RIN1 chr11 66336385 66336385 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000311320 p.E6E SUV420H1 chr11 68158423 68158423 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000304363 p.A641A MRGPRF chr11 69005837 69005837 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000309099 p.R158H FGF3 chr11 69810679 69810679 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000334134 p.E116K ANO1 chr11 70161263 70161263 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000355303 p.R561W ANAPC15 chr11 72112716 72112716 5'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000227618 ARHGEF17 chr11 73310056 73310056 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000263674 p.T473M PPME1 chr11 74253728 74253728 3'UTR C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000328257 TENM4 chr11 78672292 78672292 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000278550 p.R1845H DLG2 chr11 84273152 84273152 Intron G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000398309 SYTL2 chr11 85726775 85726775 Intron C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000528231 TRIM77 chr11 89711443 89711443 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000398290 p.K151Nfs*8 CHORDC1 chr11 90201434 90201434 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000320585 CEP295 chr11 93691995 93691995 Missense_Mutation G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000325212 p.A500S GPR83 chr11 94401145 94401145 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000243673 p.V35M C11orf97 chr11 94531997 94531998 RNA - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000542198 AMOTL1 chr11 94876236 94876236 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000433060 RP11-693N9.2 chr11 104918116 104918116 RNA C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000531091 CWF19L2 chr11 107457745 107457745 Missense_Mutation C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000282251 p.Q24H CUL5 chr11 108105069 108105069 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000393094 C11orf88 chr11 111516066 111516066 Missense_Mutation C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000375618 p.L99I IL18 chr11 112148674 112148674 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000280357 p.A97T C11orf71 chr11 114391458 114391458 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000325636 AMICA1 chr11 118205888 118205888 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000356289 p.R176R DDX6 chr11 118750170 118750170 3'Flank T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000526070 DDX6 chr11 118750264 118750264 3'Flank A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000526070 BCL9L chr11 118898526 118898527 Frame_Shift_Ins - - G TCGA-ZB-A966-01A-11D-A428-09 ENST00000334801 p.P1464Afs*53 HYOU1 chr11 119046654 119046654 Missense_Mutation C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000617285 p.R915L PVRL1 chr11 119661057 119661058 3'UTR - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000264025 POU2F3 chr11 120305722 120305722 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000543440 p.N236D POU2F3 chr11 120319358 120319358 3'Flank A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000543440 C11orf63 chr11 122904310 122904310 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000227349 p.R244C OR10G8 chr11 124030043 124030043 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000431524 p.T141A SIAE chr11 124639835 124639835 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000263593 p.D333D NRGN chr11 124747100 124747100 3'UTR C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000284292 CHEK1 chr11 125627756 125627756 Missense_Mutation G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000428830 p.G72V ETS1 chr11 128459140 128459141 3'Flank - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000319397 MIR4697 chr11 133900619 133900619 5'Flank C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000582977 GLB1L2 chr11 134367291 134367291 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000339772 p.T280M KDM5A chr12 284130 284130 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000399788 NRIP2 chr12 2828338 2828338 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000337508 p.R191H TSPAN9 chr12 3283735 3283735 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000011898 FGF6 chr12 4445265 4445265 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000228837 p.D103Tfs*26 VWF chr12 6023644 6023644 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000261405 p.T1122T SCNN1A chr12 6347878 6347879 Frame_Shift_Ins - - C TCGA-ZB-A966-01A-11D-A428-09 ENST00000228916 p.P669Afs*62 SCNN1A chr12 6362104 6362104 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000228916 p.T274T NOP2 chr12 6560777 6560777 Frame_Shift_Del C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000322166 p.G453Afs*23 ZNF384 chr12 6688168 6688171 Splice_Region CTCT CTCT - TCGA-ZB-A966-01A-11D-A428-09 ENST00000361959 CD4 chr12 6818469 6818470 Frame_Shift_Ins - - G TCGA-ZB-A966-01A-11D-A428-09 ENST00000011653 p.V405Rfs*37 CLSTN3 chr12 7156624 7156624 Intron T T A TCGA-ZB-A966-01A-11D-A428-09 ENST00000266546 A2ML1 chr12 8857239 8857239 Missense_Mutation T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000299698 p.M975T RP11-22B23.1 chr12 9306277 9306277 RNA G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000539757 KLRD1 chr12 10307944 10307944 5'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000336164 TAS2R14 chr12 10938966 10938967 Frame_Shift_Ins - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000537503 p.M81Nfs*7 ETV6 chr12 11895296 11895300 3'UTR AAAAC AAAAC - TCGA-ZB-A966-01A-11D-A428-09 ENST00000396373 WBP11 chr12 14794624 14794624 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000261167 p.V212M ART4 chr12 14829338 14829338 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000228936 ABCC9 chr12 21844545 21844546 Frame_Shift_Ins - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000261201 p.D1085* ITPR2 chr12 26338387 26338387 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000381340 REP15 chr12 27697587 27697588 3'UTR - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000310791 KLHL42 chr12 27802746 27802746 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000381271 RP11-115F18.1 chr12 40446595 40446595 5'Flank G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000552757 ARID2 chr12 45849627 45849627 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000334344 p.S588N SENP1 chr12 48044383 48044384 3'UTR TA TA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000448372 PFKM chr12 48134267 48134267 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000312352 p.R210H LARP4 chr12 50476476 50476476 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000398473 SP1 chr12 53380236 53380236 5'UTR G G C TCGA-ZB-A966-01A-11D-A428-09 ENST00000327443 AMHR2 chr12 53425826 53425826 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000257863 p.Q253Q HOXC10 chr12 53990238 53990239 3'UTR - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000303460 HOXC6 chr12 54030650 54030650 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000243108 ZNF385A chr12 54369973 54369973 3'UTR G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000338010 OR6C1 chr12 55321352 55321352 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000379668 p.G251G OR6C76 chr12 55427016 55427016 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000328314 p.M255V MMP19 chr12 55837121 55837121 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000322569 p.P481Hfs*13 BAZ2A chr12 56597944 56597944 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000551812 INHBC chr12 57434961 57434961 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000309668 p.Q25Q XPOT chr12 64418975 64418975 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000332707 p.F126Lfs*6 GRIP1 chr12 66392379 66392379 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000359742 p.T798M ZFC3H1 chr12 71656724 71656724 Intron A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000378743 NAP1L1 chr12 76048313 76048313 Intron A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000261182 NAV3 chr12 78211269 78211269 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000397909 LRRIQ1 chr12 85055890 85055890 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000393217 p.K368Rfs*4 DCN chr12 91157110 91157110 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000052754 p.R206H C12orf74 chr12 92706702 92706702 Missense_Mutation T T G TCGA-ZB-A966-01A-11D-A428-09 ENST00000397833 p.L24R USP44 chr12 95518014 95518014 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000258499 LTA4H chr12 96001031 96001031 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000228740 p.P598P SLC25A3 chr12 98595290 98595290 Intron T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000228318 UHRF1BP1L chr12 100048013 100048013 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000279907 p.L1301Wfs*9 TMEM263 chr12 106973241 106973241 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000280756 PRDM4 chr12 107751993 107751993 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000228437 p.G183D CORO1C chr12 108646914 108646914 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000261401 FAM222A chr12 109770395 109770395 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000358906 TCHP chr12 109915513 109915513 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000312777 p.A477A CCDC63 chr12 110853489 110853489 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000308208 p.R32W NAA25 chr12 112042080 112042080 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000261745 p.R800Q HECTD4 chr12 112313054 112313054 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000550722 p.A149A WSB2 chr12 118042842 118042842 Splice_Region G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000315436 p.H186H RAB35 chr12 120098837 120098837 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000229340 p.A151T ORAI1 chr12 121641361 121641361 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000616379 p.Q208Q TCTN2 chr12 123704619 123704619 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000303372 p.R567H ZNF664 chr12 124013342 124013342 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000337815 DHX37 chr12 124980644 124980644 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000308736 p.T195I TMEM132C chr12 128415464 128415464 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000435159 p.G273D TMEM132C chr12 128693940 128693940 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000435159 p.V521M EP400 chr12 131960845 131960845 Missense_Mutation C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000389562 p.L76M DDX51 chr12 132139687 132139687 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000397333 p.P641L MPHOSPH8 chr13 19648468 19648468 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000361479 p.R422K SACS chr13 23329254 23329254 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000382292 PARP4 chr13 24434616 24434616 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000381989 p.E1509K WASF3 chr13 26681249 26681250 Frame_Shift_Ins - - C TCGA-ZB-A966-01A-11D-A428-09 ENST00000335327 p.P308Afs*29 BRCA2 chr13 32394784 32394784 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000380152 p.M3118V NBEA chr13 35155806 35155806 Silent A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000400445 p.V826V FREM2 chr13 38878320 38878320 Missense_Mutation T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000280481 p.V2953A LHFP chr13 39343745 39343745 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000379589 VWA8 chr13 41907585 41907585 Splice_Site C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000379310 p.X161_splice TNFSF11 chr13 42607865 42607866 3'UTR TG TG - TCGA-ZB-A966-01A-11D-A428-09 ENST00000398795 SERP2 chr13 44379665 44379665 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000379179 p.V37M ZC3H13 chr13 45979830 45979830 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000242848 p.R632H LRRC63 chr13 46266772 46266772 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000378805 p.F452Sfs*6 CAB39L chr13 49332047 49332047 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000347776 p.M245T SETDB2 chr13 49482789 49482789 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000354234 p.N415N KPNA3 chr13 49699441 49699441 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000261667 INTS6 chr13 51395331 51395332 Frame_Shift_Del AG AG - TCGA-ZB-A966-01A-11D-A428-09 ENST00000311234 p.S194Cfs*7 ATP7B chr13 51946372 51946372 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000242839 p.T991M PCDH9 chr13 66303095 66303095 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000377865 KLF12 chr13 73690069 73690069 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000377669 SLITRK6 chr13 85794862 85794862 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000400286 p.H551Ifs*7 GPC6 chr13 93545385 93545385 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000377047 p.R95C CLDN10 chr13 95552931 95552931 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000299339 p.V60I CCDC168 chr13 102735418 102735418 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000322527 p.N5093N ARGLU1 chr13 106559508 106559508 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000400198 p.R166H ABHD13 chr13 108232110 108232110 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000375898 IRS2 chr13 109782526 109782526 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000375856 p.S1176S ARHGEF7 chr13 111241264 111241264 Intron G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000375741 TUBGCP3 chr13 112486013 112486013 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000261965 p.R902W ATP11A chr13 112831482 112831482 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000375645 p.N443N PCID2 chr13 113197038 113197038 Intron C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000337344 CUL4A chr13 113233320 113233320 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000375440 p.G219D GRK1 chr13 113723145 113723145 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000335678 p.A353T OR4N2 chr14 19827693 19827693 Missense_Mutation T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000315947 p.L82S METTL17 chr14 20993128 20993128 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000339374 p.R180Q SALL2 chr14 21522737 21522737 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000614342 p.R1000Efs*71 PRMT5 chr14 22926710 22926710 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000324366 p.T185T CMTM5 chr14 23378376 23378376 Missense_Mutation T T G TCGA-ZB-A966-01A-11D-A428-09 ENST00000339180 p.F52V ZFHX2 chr14 23525373 23525374 Frame_Shift_Del AT AT - TCGA-ZB-A966-01A-11D-A428-09 ENST00000419474 p.Y1523* PCK2 chr14 24102860 24102860 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000216780 p.A448T TGM1 chr14 24260670 24260670 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000206765 p.T179T NFATC4 chr14 24366962 24366962 5'Flank G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000250373 NOVA1 chr14 26597511 26597511 5'UTR T C C TCGA-ZB-A966-01A-11D-A428-09 ENST00000539517 FOXG1 chr14 28769175 28769175 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000313071 ARHGAP5 chr14 32093489 32093490 Frame_Shift_Ins - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000345122 p.N943Kfs*10 AKAP6 chr14 32822096 32822096 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000280979 p.S1428L BAZ1A chr14 34862217 34862217 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000360310 p.A74Qfs*12 TTC6 chr14 37817638 37817638 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000267368 p.M218V LRR1 chr14 49598937 49598937 5'UTR C C G TCGA-ZB-A966-01A-11D-A428-09 ENST00000298288 MGAT2 chr14 49621898 49621898 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000305386 p.C210C LINC01588 chr14 50005556 50005556 Intron G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000528300 PELI2 chr14 56298560 56298560 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000267460 NAA30 chr14 57411061 57411063 3'UTR TTT TTT - TCGA-ZB-A966-01A-11D-A428-09 ENST00000556492 DAAM1 chr14 59369250 59369250 3'UTR C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000395125 SYNE2 chr14 64002006 64002006 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000344113 p.S1237S GALNT16 chr14 69339589 69339589 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000337827 p.R386Q ADAM21P1 chr14 70246770 70246770 RNA C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000530196 VRTN chr14 74359521 74359521 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000256362 LTBP2 chr14 74503340 74503340 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000261978 p.V1590Sfs*151 MLH3 chr14 75017177 75017177 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000355774 p.R1423C NRXN3 chr14 79853975 79853975 Intron T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000557594 GALC chr14 87945632 87945632 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000261304 p.R531C FOXN3 chr14 89158729 89158729 3'Flank A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000261302 BCL11B chr14 99170262 99170262 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000357195 BCL11B chr14 99170638 99170638 3'UTR G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000357195 EML1 chr14 99900997 99900997 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000262233 p.F324Lfs*41 SLC25A47 chr14 100328755 100328756 Frame_Shift_Ins - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000361529 p.V121Sfs*52 WARS chr14 100342536 100342536 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000355338 p.R326Gfs*25 WDR25 chr14 100381688 100381688 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000335290 p.C255Y WDR20 chr14 102223501 102223501 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000424963 CEP170B chr14 104886885 104886886 Frame_Shift_Ins - - C TCGA-ZB-A966-01A-11D-A428-09 ENST00000414716 p.H885Pfs*47 AHNAK2 chr14 104952985 104952985 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000333244 p.A822A IGHA2 chr14 105588248 105588248 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000390539 p.A50T IGHG1 chr14 105863208 105863208 Intron G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000618756 IGHV4-55 chr14 106606542 106606542 RNA G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000520889 MAGEL2 chr15 23645934 23645934 Silent T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000532292 p.S603S AC124312.1 chr15 25092253 25092253 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000623624 p.N42Mfs*46 HERC2 chr15 28196253 28196253 Missense_Mutation T T A TCGA-ZB-A966-01A-11D-A428-09 ENST00000261609 p.H2741L RP11-578F21.6 chr15 28741248 28741248 5'Flank C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000568033 FAM189A1 chr15 29137137 29137137 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000261275 p.V230I RP11-632K20.7 chr15 32523020 32523020 RNA C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000561563 FMN1 chr15 33065015 33065015 Nonsense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000559047 p.W701* ACTC1 chr15 34790217 34790217 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000290378 SPRED1 chr15 38352444 38352444 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000299084 BAHD1 chr15 40462212 40462212 Missense_Mutation C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000416165 p.P578Q CHST14 chr15 40472452 40472452 3'UTR G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000306243 RTF1 chr15 41476467 41476467 Missense_Mutation T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000389629 p.F502L MGA chr15 41769853 41769854 3'UTR - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000219905 ADAL chr15 43348917 43348917 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000562188 p.E218Kfs*33 TP53BP1 chr15 43421877 43421877 Silent G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000263801 p.R1355R HYPK chr15 43801748 43801748 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000406925 p.R111H CEP152 chr15 48744246 48744246 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000380950 p.I1277Lfs*20 TCF12 chr15 57288499 57288499 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000267811 CGNL1 chr15 57516888 57516888 Missense_Mutation A A C TCGA-ZB-A966-01A-11D-A428-09 ENST00000281282 p.S838R BNIP2 chr15 59668103 59668104 Intron - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000607373 ICE2 chr15 60453582 60453582 Intron G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000261520 VPS13C chr15 62008708 62008708 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000261517 p.A355A HERC1 chr15 63675038 63675038 Nonsense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000443617 p.R2384* SNX1 chr15 64131873 64131873 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000559844 p.R401H PPIB chr15 64160048 64160048 Intron C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000300026 PARP16 chr15 65258657 65258657 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000261888 TIPIN chr15 66352869 66352869 Missense_Mutation G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000261881 p.P27T ITGA11 chr15 68320285 68320285 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000315757 p.A839V PARP6 chr15 72257390 72257390 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000287196 p.G319G CELF6 chr15 72285390 72285390 3'UTR T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000287202 NEO1 chr15 73176513 73176513 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000261908 p.N377Mfs*14 SCAMP2 chr15 74845522 74845522 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000268099 p.A269V C15orf39 chr15 75207313 75207313 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000360639 p.A422V GOLGA6D chr15 75293764 75293764 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000434739 p.D543D SIN3A chr15 75371193 75371193 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000360439 SIN3A chr15 75414301 75414301 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000360439 p.A126V GOLGA6L10 chr15 82342740 82342745 3'UTR TTTTGT TTTTGT - TCGA-ZB-A966-01A-11D-A428-09 ENST00000610657 C15orf40 chr15 83010343 83010343 Silent T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000304177 p.E44E LINC00052 chr15 87578159 87578159 RNA T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000560153 FANCI chr15 89315319 89315319 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000310775 p.R1285Q IGF1R chr15 98964204 98964204 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000268035 IGF1R chr15 98964227 98964227 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000268035 ASB7 chr15 100649089 100649089 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000332783 MIR6859-4 chr16 12353 12353 3'Flank C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000615957 MRPL28 chr16 368359 368359 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000199706 p.A211V PKD1 chr16 2118301 2118301 Missense_Mutation G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000262304 p.L231M PDPK1 chr16 2603089 2603089 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000342085 ZNF205 chr16 3119490 3119490 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000219091 p.R277H NLRC3 chr16 3564771 3564771 Intron G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000359128 RBFOX1 chr16 7711657 7711657 3'Flank A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000547338 METTL22 chr16 8644562 8644562 Missense_Mutation A A C TCGA-ZB-A966-01A-11D-A428-09 ENST00000381920 p.N339T CLEC16A chr16 11003188 11003188 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000409790 p.V396I SOCS1 chr16 11254416 11254418 3'UTR TAA TAA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000332029 ABCC6 chr16 16221641 16221641 Splice_Region G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000205557 NOMO3 chr16 16245092 16245092 Missense_Mutation G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000399336 p.G143C SMG1 chr16 18926005 18926005 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000446231 p.G13S ITPRIPL2 chr16 19121048 19121048 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000381440 KNOP1 chr16 19714569 19714569 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000219837 p.K156Rfs*57 UBFD1 chr16 23571035 23571035 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000395878 ERN2 chr16 23700665 23700665 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000256797 p.L515Wfs*48 TNRC6A chr16 24806699 24806700 Frame_Shift_Del TT TT - TCGA-ZB-A966-01A-11D-A428-09 ENST00000395799 p.F1486Pfs*2 SBK1 chr16 28322901 28322901 3'UTR G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000341901 PRRT2 chr16 29814594 29814594 Intron C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000358758 ZNF629 chr16 30782327 30782327 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000262525 p.C667C SETD1A chr16 30965996 30965996 Frame_Shift_Del C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000262519 p.G708Vfs*95 ITGAD chr16 31397598 31397598 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000389202 p.R82C TP53TG3D chr16 32254498 32254498 3'UTR T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000380148 NETO2 chr16 47082144 47082144 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000562435 NETO2 chr16 47083509 47083509 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000562435 p.T430T NKD1 chr16 50549486 50549486 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000268459 p.Q41Q CYLD chr16 50791608 50791608 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000311559 p.N722Mfs*13 MT1F chr16 56658023 56658024 5'UTR TC TC - TCGA-ZB-A966-01A-11D-A428-09 ENST00000334350 CNGB1 chr16 57919146 57919146 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000251102 p.R637H CNOT1 chr16 58546719 58546719 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000317147 p.A1261T CES2 chr16 66940644 66940644 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000317091 p.G319G E2F4 chr16 67195890 67195891 In_Frame_Ins - - CAG TCGA-ZB-A966-01A-11D-A428-09 ENST00000379378 p.S319dup NFAT5 chr16 69698179 69698179 3'UTR G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000354436 ZFHX3 chr16 72794754 72794754 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000268489 p.R2643H CHST5 chr16 75531009 75531009 5'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000336257 JPH3 chr16 87696671 87696671 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000284262 PIEZO1 chr16 88716372 88716372 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000301015 p.S2346S PABPN1L chr16 88864289 88864289 Missense_Mutation G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000419291 p.P249T CPNE7 chr16 89587054 89587054 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000268720 p.V368V DBNDD1 chr16 90006103 90006103 3'UTR G G C TCGA-ZB-A966-01A-11D-A428-09 ENST00000002501 WDR81 chr17 1734065 1734065 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000409644 p.P1676P OR3A1 chr17 3292170 3292170 Missense_Mutation C C G TCGA-ZB-A966-01A-11D-A428-09 ENST00000323404 p.R138P OR1E1 chr17 3398275 3398275 Missense_Mutation T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000322608 p.I46V SPNS3 chr17 4486342 4486342 Intron G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000355530 PELP1 chr17 4672716 4672717 Frame_Shift_Ins - - C TCGA-ZB-A966-01A-11D-A428-09 ENST00000574876 p.R759Efs*11 MINK1 chr17 4897701 4897701 3'UTR G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000355280 ZFP3 chr17 5095152 5095153 3'UTR - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000318833 SHBG chr17 7628098 7628098 5'Flank T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000380450 TP53 chr17 7673803 7673803 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000269305 p.R273C DNAH2 chr17 7816692 7816692 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000389173 p.S3284L GUCY2D chr17 8012157 8012157 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000254854 p.R588Q MYH13 chr17 10324234 10324234 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000252172 p.R908W SCO1 chr17 10691887 10691887 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000255390 p.A214T ZNF286A chr17 15716123 15716123 Silent A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000413242 p.S133S UBB chr17 16382470 16382471 Frame_Shift_Ins - - C TCGA-ZB-A966-01A-11D-A428-09 ENST00000302182 p.D191Rfs*20 KRT16P2 chr17 16832346 16832346 RNA G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000414673 SREBF1 chr17 17823539 17823539 Intron C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000261646 LGALS9C chr17 18492773 18492773 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000328114 p.R280C TRIM16L chr17 18734970 18734970 Missense_Mutation A A T TCGA-ZB-A966-01A-11D-A428-09 ENST00000395671 p.E186V EPN2 chr17 19328741 19328741 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000314728 p.V395Cfs*56 SLC47A2 chr17 19678814 19678814 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000325411 p.A561T FAM27L chr17 22298888 22298888 RNA G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000426869 NLK chr17 28043194 28043194 Silent A A T TCGA-ZB-A966-01A-11D-A428-09 ENST00000407008 p.A107A NLK chr17 28122714 28122714 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000407008 p.F192Lfs*30 NLK chr17 28196165 28196165 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000407008 KIAA0100 chr17 28634680 28634680 Silent T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000528896 p.A969A CRYBA1 chr17 29253782 29253782 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000225387 p.A167V TAOK1 chr17 29544126 29544126 3'UTR G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000261716 TAOK1 chr17 29551005 29551005 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000261716 LRRC37BP1 chr17 30633326 30633326 RNA A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000417404 ERBB2 chr17 39724822 39724822 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000269571 p.P802S KRT17 chr17 41619598 41619598 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000311208 p.R432H EIF1 chr17 41691568 41691568 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000469257 ACLY chr17 41867610 41867610 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000352035 DNAJC7 chr17 41994902 41994902 Nonsense_Mutation C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000457167 p.E150* NKIRAS2 chr17 42022417 42022417 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000307641 p.T38M DHX58 chr17 42110863 42110863 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000251642 p.V141I RAB5C chr17 42125766 42125766 3'UTR G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000346213 STAT5B chr17 42217174 42217174 Missense_Mutation C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000293328 p.V456F TUBG2 chr17 42663007 42663007 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000251412 p.T145M GPATCH8 chr17 44405979 44405980 Frame_Shift_Ins - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000591680 p.Q189Tfs*10 KANSL1 chr17 46030148 46030148 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000574590 CDC27 chr17 47157328 47157328 Missense_Mutation T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000066544 p.N178D ITGB3 chr17 47283376 47283376 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000559488 p.R63H NFE2L1 chr17 48050715 48050715 5'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000362042 HOXB5 chr17 48593304 48593304 Missense_Mutation T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000239151 p.S127G XYLT2 chr17 50356606 50356606 Frame_Shift_Del C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000017003 p.G529Afs*78 EPN3 chr17 50536559 50536559 Translation_Start_Site G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000268933 p.M1? CACNA1G chr17 50626503 50626503 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000359106 p.P2298Lfs*16 OR4D2 chr17 58169728 58169728 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000545221 p.R25C LPO chr17 58244040 58244040 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000262290 p.A41A MTMR4 chr17 58490402 58490403 3'UTR - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000323456 RAD51C chr17 58692690 58692690 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000337432 p.S16N MED13 chr17 61943847 61943847 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000397786 MRC2 chr17 62666230 62666230 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000303375 p.Y219Y TANC2 chr17 63405142 63405143 Frame_Shift_Ins - - G TCGA-ZB-A966-01A-11D-A428-09 ENST00000424789 p.K1046Qfs*39 MAP3K3 chr17 63695379 63695380 3'Flank AG AG - TCGA-ZB-A966-01A-11D-A428-09 ENST00000361733 SMURF2 chr17 64545377 64545377 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000262435 AMZ2P1 chr17 64973075 64973075 Intron A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000430983 NOL11 chr17 67738337 67738337 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000253247 p.R584Efs*22 CD300LD chr17 74593233 74593233 5'Flank G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000375352 AFMID chr17 78206032 78206032 Missense_Mutation G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000409257 p.K289N DNAH17 chr17 78526701 78526701 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000389840 p.E1221K CCDC40 chr17 80095271 80095271 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000397545 p.L947L RNF213 chr17 80273338 80273338 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000582970 p.P65P C17orf62 chr17 82444034 82444034 Silent A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000306645 p.S178S THOC1 chr18 260205 260205 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000261600 p.N119Mfs*26 YES1 chr18 722201 722201 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000314574 METTL4 chr18 2538874 2538875 3'UTR - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000574538 LAMA1 chr18 7016491 7016491 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000389658 p.P997S ANKRD12 chr18 9256774 9256775 Frame_Shift_Ins - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000262126 p.N1171Kfs*14 NAPG chr18 10532722 10532722 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000322897 p.N47Mfs*13 ANKRD62 chr18 12122494 12122494 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000587848 p.K480Sfs*5 AFG3L2 chr18 12329725 12329725 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000269143 p.L745Wfs*96 CXADRP3 chr18 14478351 14478351 RNA C C G TCGA-ZB-A966-01A-11D-A428-09 ENST00000581457 ROCK1 chr18 20950931 20950932 3'UTR AA AA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000399799 GREB1L chr18 21508716 21508720 Intron AAAAA AAAAA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000424526 RBBP8 chr18 23026188 23026188 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000327155 p.R881H CDH2 chr18 27951081 27951082 3'UTR TT TT - TCGA-ZB-A966-01A-11D-A428-09 ENST00000269141 CELF4 chr18 37244143 37244144 3'UTR - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000420428 PIK3C3 chr18 42081348 42081348 3'UTR T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000262039 C18orf25 chr18 46264136 46264136 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000615052 ELAC1 chr18 50974517 50974517 Missense_Mutation G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000269466 p.G38V LMAN1 chr18 59330522 59330522 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000251047 SALL3 chr18 78995157 78995157 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000537592 p.A1056T WDR18 chr19 994349 994349 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000585809 SBNO2 chr19 1111068 1111069 Frame_Shift_Del CA CA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000361757 p.V945Gfs*120 DAZAP1 chr19 1435114 1435114 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000233078 REXO1 chr19 1828493 1828493 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000170168 p.R99H MOB3A chr19 2078279 2078279 Silent G G C TCGA-ZB-A966-01A-11D-A428-09 ENST00000357066 p.G94G TMPRSS9 chr19 2421917 2421917 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000332578 p.V706M FZR1 chr19 3532527 3532527 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000395095 p.G375Afs*14 TBXA2R chr19 3595733 3595733 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000375190 p.S329S ZBTB7A chr19 4046574 4046574 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000322357 MIR7-3HG chr19 4769617 4769617 Intron C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000586721 SAFB chr19 5667059 5667059 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000292123 p.R783H MLLT1 chr19 6262253 6262253 Missense_Mutation G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000252674 p.P84H GTF2F1 chr19 6387521 6387521 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000394456 p.T122M ZNF358 chr19 7520876 7520876 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000394341 p.S545N PCP2 chr19 7632458 7632458 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000311069 p.R76C LRRC8E chr19 7900157 7900157 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000306708 p.N545N MAP2K7 chr19 7912753 7912753 3'UTR C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000397979 ZNF559 chr19 9324645 9324647 5'UTR AAA AAA - TCGA-ZB-A966-01A-11D-A428-09 ENST00000393883 RGL3 chr19 11397558 11397558 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000380456 p.A596T ELAVL3 chr19 11453958 11453958 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000359227 CCDC130 chr19 13759037 13759037 Intron G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000221554 ADGRL1 chr19 14150235 14150235 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000340736 BRD4 chr19 15239764 15239764 Missense_Mutation T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000263377 p.K1114E OR10H5 chr19 15794719 15794719 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000308940 p.A224V UNC13A chr19 17648593 17648593 Missense_Mutation T T A TCGA-ZB-A966-01A-11D-A428-09 ENST00000519716 p.T552S IL12RB1 chr19 18069612 18069612 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000593993 p.G375S IL12RB1 chr19 18075758 18075758 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000593993 p.V231I CILP2 chr19 19544102 19544102 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000291495 p.R519R ZNF506 chr19 19795542 19795542 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000443905 p.G116Afs*5 ZNF257 chr19 22052533 22052533 5'UTR T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000594947 ZNF492 chr19 22663844 22663844 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000456783 p.N61Ifs*6 ZNF536 chr19 30548140 30548140 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000355537 p.A841T KIAA0355 chr19 34353925 34353925 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000299505 GPI chr19 34366404 34366404 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000356487 p.T61M LGI4 chr19 35131518 35131518 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000310123 p.V166I MAG chr19 35302581 35302581 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000392213 p.T368T ZNF585B chr19 37185459 37185459 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000532828 p.S693N ZNF540 chr19 37612117 37612117 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000316433 p.F281Lfs*4 WDR87 chr19 37887776 37887776 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000303868 p.K1926Nfs*10 DPF1 chr19 38218978 38218978 Frame_Shift_Del C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000420980 p.E154Rfs*6 CATSPERG chr19 38364895 38364895 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000409235 p.T827M SAMD4B chr19 39369982 39369982 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000314471 p.G177Afs*5 PLEKHG2 chr19 39423078 39423078 Missense_Mutation C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000425673 p.P675H ZNF546 chr19 40014460 40014460 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000347077 p.G397D AXL chr19 41253684 41253684 Missense_Mutation G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000301178 p.R671L CADM4 chr19 43626839 43626839 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000222374 p.P148P PLAUR chr19 43656548 43656548 Missense_Mutation G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000340093 p.L135M PVR chr19 44647471 44647471 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000425690 p.M110V CBLC chr19 44782370 44782370 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000270279 p.P220S CLASRP chr19 45052871 45052871 Frame_Shift_Del C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000221455 p.P95Lfs*81 IRF2BP1 chr19 45883655 45883662 3'UTR GGGGGGTG GGGGGGTG - TCGA-ZB-A966-01A-11D-A428-09 ENST00000302165 CALM3 chr19 46608879 46608879 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000291295 p.R107C KPTN chr19 47480800 47480800 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000338134 p.V187M GLTSCR1 chr19 47703206 47703206 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000396720 PLA2G4C chr19 48062012 48062012 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000599921 p.G415R CCDC114 chr19 48298036 48298036 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000315396 p.P452L GRWD1 chr19 48452759 48452759 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000253237 p.V359I FAM83E chr19 48603780 48603781 Frame_Shift_Ins - - G TCGA-ZB-A966-01A-11D-A428-09 ENST00000263266 p.Q297Pfs*33 PLEKHA4 chr19 48865580 48865580 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000263265 p.A39T TRPM4 chr19 49211257 49211257 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000252826 p.P1210S ALDH16A1 chr19 49468440 49468440 Silent G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000293350 p.V666V MYH14 chr19 50217616 50217616 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000376970 p.T136M EMC10 chr19 50483023 50483023 3'UTR C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000334976 KLK6 chr19 50967185 50967185 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000310157 p.A61T SIGLEC7 chr19 51146807 51146807 Missense_Mutation G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000317643 p.A361S C19orf84 chr19 51389129 51389129 Frame_Shift_Del C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000574814 p.G139Afs*11 ZNF808 chr19 52555172 52555172 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000359798 p.C752C ZNF321P chr19 52929343 52929343 Missense_Mutation C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000391777 p.G88W ERVV-1 chr19 53014872 53014872 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000602168 p.N263Ifs*11 ZNF347 chr19 53140983 53140983 Missense_Mutation A A T TCGA-ZB-A966-01A-11D-A428-09 ENST00000334197 p.H615Q NLRP12 chr19 53805420 53805420 Silent G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000324134 p.A758A MYADM chr19 53873541 53873541 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000336967 p.T4T KIR3DL2 chr19 54866719 54866719 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000326321 p.V454Ffs*24 NCR1 chr19 54906552 54906552 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000291890 p.E34K NLRP7 chr19 54934546 54934546 Frame_Shift_Del C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000340844 p.G805Vfs*9 PTPRH chr19 55186520 55186520 Missense_Mutation G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000376350 p.L863M UBE2S chr19 55401496 55401496 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000264552 p.R203R NLRP8 chr19 55947831 55947831 5'Flank G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000291971 ZNF835 chr19 56663927 56663927 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000537055 p.G424G ZNF419 chr19 57492236 57492236 Intron A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000221735 ZNF419 chr19 57493558 57493558 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000221735 p.Q334R ZNF587 chr19 57859846 57859846 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000339656 p.S478S ZNF587 chr19 57862966 57862966 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000339656 ZNF814 chr19 57873290 57873292 In_Frame_Del CTT CTT - TCGA-ZB-A966-01A-11D-A428-09 ENST00000435989 p.K700del ZBTB45 chr19 58517491 58517491 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000354590 p.K61K TBC1D20 chr20 437391 437391 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000354200 ZNF343 chr20 2483715 2483715 Nonsense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000278772 p.R416* CPXM1 chr20 2796002 2796002 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000380605 p.Y468H LZTS3 chr20 3164590 3164590 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000360342 p.R583H CSRP2BP chr20 18145272 18145273 Frame_Shift_Ins - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000435364 p.R103* SSTR4 chr20 23035780 23035780 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000255008 p.S99S ID1 chr20 31606477 31606477 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000376112 KIF3B chr20 32332147 32332147 3'UTR G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000375712 GGT7 chr20 34850919 34850919 Intron T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000336431 GDF5 chr20 35434601 35434601 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000374369 p.R272W DLGAP4 chr20 36528137 36528138 3'UTR TT TT - TCGA-ZB-A966-01A-11D-A428-09 ENST00000339266 TTI1 chr20 37996822 37996822 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000373447 p.S975S CHD6 chr20 41404785 41404785 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000373233 p.S2652S STK4 chr20 45079635 45079635 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000372806 WFDC2 chr20 45471223 45471226 Intron TCAG TCAG - TCGA-ZB-A966-01A-11D-A428-09 ENST00000372676 EPPIN-WFDC6 chr20 45537438 45537438 3'UTR G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000504988 SLC12A5 chr20 46057647 46057647 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000454036 SLC12A5 chr20 46057936 46057936 3'Flank C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000454036 TSHZ2 chr20 53254709 53254709 Missense_Mutation G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000371497 p.K417N CBLN4 chr20 55997949 55997949 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000064571 GNAS chr20 58903702 58903702 Frame_Shift_Del C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000371085 p.V117Wfs*16 SYCP2 chr20 59864168 59864168 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000357552 MIR1257 chr20 61953596 61953596 RNA C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000408490 LAMA5 chr20 62346181 62346181 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000252999 p.T439T ZBTB46 chr20 63743980 63743980 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000245663 NRIP1 chr21 14964022 14964022 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000318948 C21orf91 chr21 17793396 17793396 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000284881 JAM2 chr21 25693797 25693797 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000480456 p.R95W KRTAP19-2 chr21 30487334 30487334 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000334055 p.Y5Y SON chr21 33553826 33553826 Missense_Mutation T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000356577 p.I1532T MORC3 chr21 36359960 36359960 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000400485 p.R405H RIPPLY3 chr21 37018143 37018143 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000329553 p.E172Rfs*50 DSCR3 chr21 37228235 37228235 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000309117 p.V216M DSCAM chr21 40075067 40075067 Silent G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000400454 p.R1620R ABCG1 chr21 42290066 42290066 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000361802 p.R426H PDE9A chr21 42743845 42743845 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000291539 p.A213V RRP1B chr21 43675152 43675152 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000340648 p.K182Rfs*4 PDXK chr21 43759296 43759296 3'UTR G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000291565 MCM3AP chr21 46277622 46277622 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000291688 p.C588Y IL17RA chr22 17108601 17108601 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000319363 p.A463Rfs*21 GNAZ chr22 23095791 23095791 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000615612 p.R32R SLC35E4 chr22 30636737 30636737 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000343605 p.A98Hfs*31 MORC2 chr22 30932614 30932614 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000397641 p.R893H TIMP3 chr22 32857255 32857255 Nonsense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000266085 p.R71* TIMP3 chr22 32859676 32859676 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000266085 MPST chr22 37024768 37024768 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000341116 p.A185T ELFN2 chr22 37372755 37372755 3'UTR C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000402918 GGA1 chr22 37629509 37629509 Nonsense_Mutation G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000343632 p.G381* TRIOBP chr22 37725506 37725506 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000406386 p.G984S TRIOBP chr22 37773926 37773939 3'UTR ACACACACACACAG ACACACACACACAG - TCGA-ZB-A966-01A-11D-A428-09 ENST00000406386 DMC1 chr22 38519064 38519067 3'UTR TTTT TTTT - TCGA-ZB-A966-01A-11D-A428-09 ENST00000216024 SYNGR1 chr22 39384854 39384854 3'UTR T T A TCGA-ZB-A966-01A-11D-A428-09 ENST00000328933 MGAT3 chr22 39492168 39492168 3'UTR A A T TCGA-ZB-A966-01A-11D-A428-09 ENST00000341184 ENTHD1 chr22 39861909 39861909 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000325157 p.R150C TNRC6B chr22 40335024 40335024 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000454349 SLC25A17 chr22 40792558 40792558 Missense_Mutation T T C TCGA-ZB-A966-01A-11D-A428-09 ENST00000435456 p.T101A EP300 chr22 41168725 41168725 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000263253 p.V1344M TOB2 chr22 41433910 41433910 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000327492 SEPT3 chr22 41987760 41987760 Splice_Site G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000396426 p.X184_splice CELSR1 chr22 46439188 46439188 Splice_Site C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000262738 p.X1469_splice BRD1 chr22 49798081 49798081 Missense_Mutation C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000216267 p.D608Y SHANK3 chr22 50721472 50721472 RNA C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000414786 ARSH chrX 3018558 3018559 Frame_Shift_Ins - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000381130 p.S266Ffs*20 KAL1 chrX 8554027 8554027 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000262648 p.R427C WWC3 chrX 10094248 10094248 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000380861 p.C208C WWC3 chrX 10136662 10136662 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000380861 p.T931T OFD1 chrX 13762375 13762375 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000340096 p.S808Vfs*9 REPS2 chrX 17062502 17062502 Missense_Mutation T T A TCGA-ZB-A966-01A-11D-A428-09 ENST00000357277 p.N393K SCML2 chrX 18239688 18239688 3'UTR T T G TCGA-ZB-A966-01A-11D-A428-09 ENST00000251900 PDHA1 chrX 19344021 19344021 5'UTR G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000422285 SAT1 chrX 23786107 23786108 3'UTR - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000379270 MAGEB10 chrX 27821897 27821897 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000356790 p.G197G NR0B1 chrX 30308387 30308387 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000378970 p.R326Q DMD chrX 32816584 32816584 Missense_Mutation C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000357033 p.K138N MED14 chrX 40713021 40713021 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000324817 p.R225H DDX3X chrX 41348924 41348924 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000399959 RGN chrX 47093059 47093059 3'UTR G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000336169 GRIPAP1 chrX 48983849 48983849 Nonsense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000376423 p.R400* PRAF2 chrX 49073957 49073957 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000553851 p.A11T CCNB3 chrX 50312546 50312546 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000276014 p.R1113W SHROOM4 chrX 50695919 50695919 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000289292 p.A46T HUWE1 chrX 53583748 53583748 Missense_Mutation G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000262854 p.A1777D FGD1 chrX 54445499 54445500 3'UTR - - C TCGA-ZB-A966-01A-11D-A428-09 ENST00000375135 FGD1 chrX 54445505 54445505 3'UTR C C - TCGA-ZB-A966-01A-11D-A428-09 ENST00000375135 ZXDB chrX 57597177 57597177 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000374888 ZXDA chrX 57910513 57910513 5'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000358697 FAM155B chrX 69505339 69505339 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000252338 p.C19C AWAT2 chrX 70042386 70042386 Splice_Region C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000276101 p.G216G KIF4A chrX 70290745 70290745 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000374403 p.T59A GDPD2 chrX 70425022 70425022 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000374382 p.R13H DLG3 chrX 70503228 70503228 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000374360 RGAG4 chrX 72127772 72127772 Intron A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000479991 PABPC1L2A chrX 73078008 73078008 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000373519 TSIX chrX 73827301 73827301 RNA G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000604411 KIAA2022 chrX 74733762 74733762 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000055682 ATRX chrX 77507318 77507318 3'UTR A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000373344 ATRX chrX 77508293 77508294 3'UTR - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000373344 PGK1 chrX 78126042 78126042 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000373316 ZCCHC5 chrX 78656317 78656317 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000321110 ZCCHC5 chrX 78656590 78656590 3'UTR C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000321110 FAM46D chrX 80444260 80444260 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000308293 HDX chrX 84469344 84469344 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000297977 p.D127N ZNF711 chrX 85271615 85271615 Frame_Shift_Del A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000276123 p.K693Nfs*3 FAM133A chrX 93710994 93710994 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000322139 HNRNPH2 chrX 101413124 101413124 Frame_Shift_Del T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000316594 p.L381* TCP11X2 chrX 102463227 102463227 Silent G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000453326 p.S181S RNF128 chrX 106727346 106727346 Missense_Mutation A A G TCGA-ZB-A966-01A-11D-A428-09 ENST00000255499 p.I145V RNF128 chrX 106796534 106796534 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000255499 PSMD10 chrX 108087429 108087430 Intron - - A TCGA-ZB-A966-01A-11D-A428-09 ENST00000217958 IRS4 chrX 108736221 108736221 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000372129 p.A42T NXT2 chrX 109542690 109542690 3'UTR G G T TCGA-ZB-A966-01A-11D-A428-09 ENST00000372106 HTR2C chrX 114908498 114908498 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000276198 RBMXL3 chrX 115191430 115191430 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000424776 p.Y663Y IL13RA1 chrX 118770546 118770546 Intron G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000371666 KIAA1210 chrX 119083092 119083092 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000402510 p.P1626L XIAP chrX 123913835 123913836 3'UTR - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000355640 ZDHHC9 chrX 129805329 129805329 3'UTR T T - TCGA-ZB-A966-01A-11D-A428-09 ENST00000357166 ARHGAP36 chrX 131081794 131081794 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000276211 p.P43P FAM122B chrX 134771098 134771098 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000370790 FAM127B chrX 135052004 135052004 Silent T T G TCGA-ZB-A966-01A-11D-A428-09 ENST00000370775 p.G35G FAM127B chrX 135052064 135052064 Silent G G C TCGA-ZB-A966-01A-11D-A428-09 ENST00000370775 p.P15P FAM127B chrX 135052068 135052068 Missense_Mutation C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000370775 p.G14V FAM127B chrX 135052069 135052069 Missense_Mutation C C A TCGA-ZB-A966-01A-11D-A428-09 ENST00000370775 p.G14W RBMX chrX 136879427 136879430 Missense_Mutation TGTT TGTT - TCGA-ZB-A966-01A-11D-A428-09 ENST00000320676 FGF13 chrX 138857661 138857661 Frame_Shift_Del G G - TCGA-ZB-A966-01A-11D-A428-09 ENST00000436198 p.P23Lfs*19 ATP11C chrX 139728345 139728346 3'UTR - - T TCGA-ZB-A966-01A-11D-A428-09 ENST00000327569 CDR1 chrX 140783623 140783623 Missense_Mutation C C G TCGA-ZB-A966-01A-11D-A428-09 ENST00000370532 p.K248N ZNF185 chrX 152919025 152919026 In_Frame_Ins - - GAG TCGA-ZB-A966-01A-11D-A428-09 ENST00000370268 p.E165dup ZFP92 chrX 153420889 153420889 Missense_Mutation G G A TCGA-ZB-A966-01A-11D-A428-09 ENST00000338647 p.R171H ATP2B3 chrX 153582900 153582900 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000263519 ARHGAP4 chrX 153920650 153920650 Silent C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000350060 p.K219K SLC10A3 chrX 154487412 154487412 3'UTR A A - TCGA-ZB-A966-01A-11D-A428-09 ENST00000263512 MPP1 chrX 154805355 154805355 Missense_Mutation C C T TCGA-ZB-A966-01A-11D-A428-09 ENST00000369534 p.E7K HLX chr1 220881255 220881255 Silent C C G TCGA-4V-A9QU-01A-11D-A423-09 ENST00000366903 p.P218P NBEAL2 chr3 46992496 46992496 Frame_Shift_Del C C - TCGA-4V-A9QU-01A-11D-A423-09 ENST00000450053 p.E354Rfs*11 PCNP chr3 101593336 101593336 3'UTR T T - TCGA-4V-A9QU-01A-11D-A423-09 ENST00000265260 RAPGEF2 chr4 159295754 159295754 Intron T T C TCGA-4V-A9QU-01A-11D-A423-09 ENST00000264431 NUAK1 chr12 106067229 106067229 Missense_Mutation C C T TCGA-4V-A9QU-01A-11D-A423-09 ENST00000261402 p.R520Q DNAAF2 chr14 49625360 49625360 3'UTR A A - TCGA-4V-A9QU-01A-11D-A423-09 ENST00000298292 AHDC1 chr1 27552142 27552142 5'UTR G G A TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000247087 LPPR4 chr1 99306831 99306831 Missense_Mutation G G A TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000370185 p.V705I SFT2D2 chr1 168226124 168226124 Missense_Mutation C C G TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000271375 p.D15E SFT2D2 chr1 168226129 168226160 Splice_Site GCGGCCTGTCCGAGGTGAGTGAGCCCGGGGCC GCGGCCTGTCCGAGGTGAGTGAGCCCGGGGCC - TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000271375 p.X17_splice RASAL2 chr1 178452526 178452526 Missense_Mutation G G A TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000462775 p.R480H LINC01317 chr2 33727186 33727186 Intron G G A TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000366209 DPP4 chr2 161993181 161993181 3'UTR T T C TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000360534 ZNF502 chr3 44722472 44722472 3'UTR A A G TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000296091 GNL3 chr3 52694231 52694231 Missense_Mutation A A G TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000418458 p.I536V GRAMD1C chr3 113939983 113939983 Nonsense_Mutation G G T TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000358160 p.E597* CDV3 chr3 133589115 133589115 3'UTR C C T TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000264993 PARL chr3 183842363 183842363 Missense_Mutation C C A TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000317096 p.S231I NR3C2 chr4 148154610 148154610 Missense_Mutation A A C TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000344721 p.L769R LRRC16A chr6 25279796 25279796 Translation_Start_Site A A G TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000329474 p.M1? GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000573035 p.L424H ZNF767P chr7 149621551 149621551 RNA C C T TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000463567 XKR4 chr8 55357868 55357868 Missense_Mutation G G C TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000327381 p.A333P COL22A1 chr8 138589142 138589143 3'UTR - - A TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000303045 RP11-87H9.2 chr9 40992685 40992685 RNA G G A TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000611606 POLE3 chr9 113409631 113409631 Missense_Mutation G G A TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000374169 p.P84S SPTAN1 chr9 128607650 128607650 Missense_Mutation G G A TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000372731 p.D1365N HRAS chr11 534286 534286 Missense_Mutation C C G TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000311189 p.G13R FAM160A2 chr11 6211833 6211833 Silent G G A TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000449352 p.L864L TENM4 chr11 78889810 78889811 Frame_Shift_Ins - - A TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000278550 p.V354Gfs*28 TRAV7 chr14 21783006 21783006 Missense_Mutation G G A TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000390429 p.R5Q CACNA1H chr16 1200488 1200488 Missense_Mutation G G A TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000348261 p.V346M DNAH3 chr16 21054513 21054513 Missense_Mutation C C T TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000261383 p.D1316N ITGAE chr17 3748047 3748047 Missense_Mutation C C T TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000263087 p.R677Q CSH2 chr17 63872373 63872373 Intron C C T TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000392886 LRRC37A3 chr17 64859745 64859745 Silent C C T TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000319651 p.S1467S LIN37 chr19 35753204 35753204 Missense_Mutation G G A TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000301159 p.R132H YWHAB chr20 44908175 44908175 3'UTR A A - TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000353703 C22orf34 chr22 49441140 49441140 RNA C C T TCGA-XM-AAZ3-01A-11D-A423-09 ENST00000414287 AHCYL1 chr1 110023589 110023589 3'UTR A A - TCGA-XU-AAXY-01A-11D-A428-09 ENST00000369799 MAP2 chr2 209731328 209731328 3'UTR A A - TCGA-XU-AAXY-01A-11D-A428-09 ENST00000360351 MIR3142 chr5 160474443 160474443 RNA C C A TCGA-XU-AAXY-01A-11D-A428-09 ENST00000582487 FAM120A chr9 93565695 93565695 3'UTR A A - TCGA-XU-AAXY-01A-11D-A428-09 ENST00000277165 CNIH2 chr11 66283987 66283987 3'UTR G G - TCGA-XU-AAXY-01A-11D-A428-09 ENST00000311445 ATP12A chr13 24707154 24707154 Silent C C T TCGA-XU-AAXY-01A-11D-A428-09 ENST00000381946 p.D767D OTUD3 chr1 19890429 19890430 Frame_Shift_Ins - - A TCGA-YT-A95D-01A-11D-A428-09 ENST00000375120 p.R90Tfs*22 NEB chr2 151640617 151640617 Missense_Mutation G G A TCGA-YT-A95D-01A-11D-A428-09 ENST00000172853 p.A2808V TTN chr2 178650771 178650771 Missense_Mutation G G T TCGA-YT-A95D-01A-11D-A428-09 ENST00000591111 p.A11723E DPYSL3 chr5 147393670 147393670 3'UTR G G A TCGA-YT-A95D-01A-11D-A428-09 ENST00000398514 LRFN2 chr6 40432577 40432577 Missense_Mutation G G C TCGA-YT-A95D-01A-11D-A428-09 ENST00000338305 p.S179R ZNF451 chr6 57148180 57148181 Frame_Shift_Ins - - A TCGA-YT-A95D-01A-11D-A428-09 ENST00000370706 p.T701Nfs*2 GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-YT-A95D-01A-11D-A428-09 ENST00000573035 p.L424H RP1L1 chr8 10610196 10610197 In_Frame_Ins - - CCC TCGA-YT-A95D-01A-11D-A428-09 ENST00000382483 p.E1300_V1301insG PLAG1 chr8 56166475 56166475 Missense_Mutation A A C TCGA-YT-A95D-01A-11D-A428-09 ENST00000316981 p.F424C ASPN chr9 92456623 92456624 3'UTR - - A TCGA-YT-A95D-01A-11D-A428-09 ENST00000375544 GARNL3 chr9 127387211 127387211 Missense_Mutation G G A TCGA-YT-A95D-01A-11D-A428-09 ENST00000373387 p.A803T GTPBP4 chr10 999088 999088 Missense_Mutation G G A TCGA-YT-A95D-01A-11D-A428-09 ENST00000360803 p.R216H YARS2 chr12 32755650 32755650 Silent G G A TCGA-YT-A95D-01A-11D-A428-09 ENST00000324868 p.T75T KRT78 chr12 52848750 52848750 Frame_Shift_Del T T - TCGA-YT-A95D-01A-11D-A428-09 ENST00000304620 p.R61Gfs*26 KRT78 chr12 52848752 52848752 Missense_Mutation C C A TCGA-YT-A95D-01A-11D-A428-09 ENST00000304620 p.G60V PTPRB chr12 70534874 70534874 Missense_Mutation C C T TCGA-YT-A95D-01A-11D-A428-09 ENST00000261266 p.V1837I CCDC144B chr17 18553339 18553339 RNA T T C TCGA-YT-A95D-01A-11D-A428-09 ENST00000618081 JADE3 chrX 47060238 47060238 3'UTR G G - TCGA-YT-A95D-01A-11D-A428-09 ENST00000611250 LPAR4 chrX 78756743 78756743 3'UTR G G A TCGA-YT-A95D-01A-11D-A428-09 ENST00000435339 LPAR4 chrX 78756744 78756744 3'UTR C C G TCGA-YT-A95D-01A-11D-A428-09 ENST00000435339 NXF3 chrX 103093085 103093085 5'UTR T T C TCGA-YT-A95D-01A-11D-A428-09 ENST00000395065 OCRL chrX 129558724 129558724 Silent C C A TCGA-YT-A95D-01A-11D-A428-09 ENST00000371113 p.P177P FAM3A chrX 154512886 154512886 Missense_Mutation C C T TCGA-YT-A95D-01A-11D-A428-09 ENST00000359889 p.V22M PCDHA9 chr5 140850186 140850186 Missense_Mutation C C T TCGA-X7-A8DD-01A-11D-A423-09 ENST00000532602 p.A564V PTPRD chr9 8317920 8317920 Missense_Mutation C C T TCGA-X7-A8DD-01A-11D-A423-09 ENST00000356435 p.R1898H ACAD10 chr12 111744793 111744793 Missense_Mutation C C T TCGA-X7-A8DD-01A-11D-A423-09 ENST00000313698 p.A622V DPP8 chr15 65445705 65445705 3'UTR A A - TCGA-X7-A8DD-01A-11D-A423-09 ENST00000341861 TBC1D3I chr17 36254377 36254377 Silent T T C TCGA-X7-A8DD-01A-11D-A423-09 ENST00000621034 p.A409A KIR2DL1 chr19 54775291 54775291 Missense_Mutation C C A TCGA-X7-A8DD-01A-11D-A423-09 ENST00000336077 p.A166D GPCPD1 chr20 5546788 5546789 3'UTR - - T TCGA-X7-A8DD-01A-11D-A423-09 ENST00000379019 FAM120C chrX 54072566 54072566 3'UTR A A - TCGA-X7-A8DD-01A-11D-A423-09 ENST00000375180 OGT chrX 71574637 71574638 3'UTR - - T TCGA-X7-A8DD-01A-11D-A423-09 ENST00000373719 INPP5F chr10 119829085 119829085 3'UTR T T - TCGA-ZB-A96B-01A-11D-A428-09 ENST00000361976 GOLGA6L22 chr15 22468443 22468443 3'UTR G G - TCGA-ZB-A96B-01A-11D-A428-09 ENST00000622895 LSM12 chr17 44034682 44034682 3'UTR A A - TCGA-ZB-A96B-01A-11D-A428-09 ENST00000293406 SUMO2 chr17 75167961 75167961 3'UTR T T - TCGA-ZB-A96B-01A-11D-A428-09 ENST00000420826 CELF4 chr18 37244143 37244144 3'UTR - - T TCGA-ZB-A96B-01A-11D-A428-09 ENST00000420428 CACNG8 chr19 53963064 53963064 5'UTR C C - TCGA-ZB-A96B-01A-11D-A428-09 ENST00000270458 TARDBP chr1 11024277 11024277 3'UTR T T - TCGA-XU-A92Z-01A-11D-A423-09 ENST00000240185 DNAJC8 chr1 28209998 28209998 Missense_Mutation C C A TCGA-XU-A92Z-01A-11D-A423-09 ENST00000263697 p.A125S NRAS chr1 114713908 114713908 Missense_Mutation T T C TCGA-XU-A92Z-01A-11D-A423-09 ENST00000369535 p.Q61R ATP1A2 chr1 160128725 160128725 Missense_Mutation C C T TCGA-XU-A92Z-01A-11D-A423-09 ENST00000361216 p.T364M HMCN1 chr1 186190100 186190100 3'UTR T T G TCGA-XU-A92Z-01A-11D-A423-09 ENST00000271588 PUM2 chr2 20251364 20251364 3'UTR T T C TCGA-XU-A92Z-01A-11D-A423-09 ENST00000338086 ADCY3 chr2 24820792 24820792 Missense_Mutation C C T TCGA-XU-A92Z-01A-11D-A423-09 ENST00000260600 p.D1062N ANXA4 chr2 69781516 69781516 Splice_Region A A T TCGA-XU-A92Z-01A-11D-A423-09 ENST00000394295 AL078621.1 chr2 113596691 113596692 3'Flank - - CAGCACCAC TCGA-XU-A92Z-01A-11D-A423-09 ENST00000613451 FSTL1 chr3 120410688 120410689 Intron - - T TCGA-XU-A92Z-01A-11D-A423-09 ENST00000295633 RHO chr3 129534021 129534021 3'UTR G G A TCGA-XU-A92Z-01A-11D-A423-09 ENST00000296271 SLC23A1 chr5 139380866 139380866 Missense_Mutation C C T TCGA-XU-A92Z-01A-11D-A423-09 ENST00000348729 p.S110N CH17-140K24.8 chr5 141235808 141235808 Intron C C T TCGA-XU-A92Z-01A-11D-A423-09 ENST00000624396 ATXN1 chr6 16304170 16304171 3'UTR - - T TCGA-XU-A92Z-01A-11D-A423-09 ENST00000244769 POU3F2 chr6 98837503 98837503 3'UTR C C A TCGA-XU-A92Z-01A-11D-A423-09 ENST00000328345 TCP1 chr6 159789619 159789619 5'UTR C C T TCGA-XU-A92Z-01A-11D-A423-09 ENST00000321394 ERVW-1 chr7 92469075 92469075 Missense_Mutation C C T TCGA-XU-A92Z-01A-11D-A423-09 ENST00000493463 p.G436E EEF1D chr8 143579721 143579721 3'UTR C C A TCGA-XU-A92Z-01A-11D-A423-09 ENST00000317198 CPSF1 chr8 144399354 144399354 Silent C C T TCGA-XU-A92Z-01A-11D-A423-09 ENST00000616140 p.P438P GBA2 chr9 35748564 35748564 Missense_Mutation A A T TCGA-XU-A92Z-01A-11D-A423-09 ENST00000378103 p.S47R GFI1B chr9 132987356 132987356 Missense_Mutation A A C TCGA-XU-A92Z-01A-11D-A423-09 ENST00000339463 p.N59H NRG3 chr10 82232742 82232742 Intron G G T TCGA-XU-A92Z-01A-11D-A423-09 ENST00000404547 MALAT1 chr11 65502293 65502294 3'UTR - - T TCGA-XU-A92Z-01A-11D-A423-09 ENST00000625158 MBD6 chr12 57529702 57529702 3'UTR T T C TCGA-XU-A92Z-01A-11D-A423-09 ENST00000355673 GALNT9 chr12 132199212 132199212 Missense_Mutation G G A TCGA-XU-A92Z-01A-11D-A423-09 ENST00000397325 p.R121W CDX2 chr13 27962259 27962259 3'UTR T T A TCGA-XU-A92Z-01A-11D-A423-09 ENST00000381020 CDX2 chr13 27962260 27962260 3'UTR C C A TCGA-XU-A92Z-01A-11D-A423-09 ENST00000381020 RFX7 chr15 56092283 56092284 3'UTR - - T TCGA-XU-A92Z-01A-11D-A423-09 ENST00000559447 KCTD19 chr16 67293988 67293988 Missense_Mutation G G T TCGA-XU-A92Z-01A-11D-A423-09 ENST00000304372 p.R592S TBC1D3P5 chr17 27429850 27429850 RNA G G A TCGA-XU-A92Z-01A-11D-A423-09 ENST00000586223 LOXHD1 chr18 46618245 46618245 Missense_Mutation G G A TCGA-XU-A92Z-01A-11D-A423-09 ENST00000536736 p.A186V SOCS6 chr18 70329940 70329940 3'UTR C C A TCGA-XU-A92Z-01A-11D-A423-09 ENST00000397942 EVI5L chr19 7848990 7848990 Missense_Mutation G G A TCGA-XU-A92Z-01A-11D-A423-09 ENST00000270530 p.D133N MUC16 chr19 8977832 8977832 Missense_Mutation C C T TCGA-XU-A92Z-01A-11D-A423-09 ENST00000397910 p.V1103I ANGPTL6 chr19 10094899 10094899 Missense_Mutation G G C TCGA-XU-A92Z-01A-11D-A423-09 ENST00000253109 p.R208G SMARCA4 chr19 11030730 11030730 Missense_Mutation G G T TCGA-XU-A92Z-01A-11D-A423-09 ENST00000344626 p.G1128V ZNF714 chr19 21117547 21117547 Frame_Shift_Del A A - TCGA-XU-A92Z-01A-11D-A423-09 ENST00000456283 p.N295Tfs*11 ZNF544 chr19 58262128 58262128 Missense_Mutation G G A TCGA-XU-A92Z-01A-11D-A423-09 ENST00000269829 p.V508I NF2 chr22 29654690 29654690 Nonsense_Mutation G G T TCGA-XU-A92Z-01A-11D-A423-09 ENST00000338641 p.G161* C22orf24 chr22 31934359 31934359 RNA G G T TCGA-XU-A92Z-01A-11D-A423-09 ENST00000623735 A4GALT chr22 42693038 42693038 Missense_Mutation G G T TCGA-XU-A92Z-01A-11D-A423-09 ENST00000249005 p.P305Q USP9X chrX 41235701 41235702 3'UTR - - T TCGA-XU-A92Z-01A-11D-A423-09 ENST00000324545 ZCCHC11 chr1 52463751 52463751 Intron G G C TCGA-3G-AB19-01A-21D-A423-09 ENST00000371544 TM2D1 chr1 61725104 61725104 Missense_Mutation G G C TCGA-3G-AB19-01A-21D-A423-09 ENST00000294613 p.P6R KIF3C chr2 25981588 25981588 Silent G G C TCGA-3G-AB19-01A-21D-A423-09 ENST00000264712 p.T110T ADGRF3 chr2 26311009 26311009 Missense_Mutation G G T TCGA-3G-AB19-01A-21D-A423-09 ENST00000311519 p.P907T GALNT14 chr2 31138117 31138117 5'UTR C C T TCGA-3G-AB19-01A-21D-A423-09 ENST00000349752 NRXN1 chr2 50620062 50620062 Missense_Mutation C C A TCGA-3G-AB19-01A-21D-A423-09 ENST00000406316 p.G427V LRP1B chr2 140232877 140232877 3'UTR G G A TCGA-3G-AB19-01A-21D-A423-09 ENST00000389484 HECW2 chr2 196307951 196307951 Missense_Mutation C C T TCGA-3G-AB19-01A-21D-A423-09 ENST00000260983 p.E857K KCTD6 chr3 58501688 58501689 3'UTR - - T TCGA-3G-AB19-01A-21D-A423-09 ENST00000355076 BDP1 chr5 71467418 71467418 Missense_Mutation G G A TCGA-3G-AB19-01A-21D-A423-09 ENST00000358731 p.E284K KIF4B chr5 155015387 155015387 Missense_Mutation G G A TCGA-3G-AB19-01A-21D-A423-09 ENST00000435029 p.A510T EHMT2 chr6 31882786 31882786 Splice_Site C C A TCGA-3G-AB19-01A-21D-A423-09 ENST00000375537 p.X1037_splice CREB5 chr7 28825831 28825831 3'UTR T T C TCGA-3G-AB19-01A-21D-A423-09 ENST00000357727 SEPT7 chr7 35904427 35904427 3'UTR T T - TCGA-3G-AB19-01A-21D-A423-09 ENST00000350320 ANLN chr7 36422661 36422661 Silent A A G TCGA-3G-AB19-01A-21D-A423-09 ENST00000265748 p.E776E GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-3G-AB19-01A-21D-A423-09 ENST00000573035 p.L424H ZNF789 chr7 99487173 99487173 Silent C C G TCGA-3G-AB19-01A-21D-A423-09 ENST00000331410 p.A321A RIMS2 chr8 103936590 103936590 Silent A A G TCGA-3G-AB19-01A-21D-A423-09 ENST00000262231 p.T644T WDFY4 chr10 48943439 48943439 Missense_Mutation A A T TCGA-3G-AB19-01A-21D-A423-09 ENST00000325239 p.Y2580F HRAS chr11 533553 533553 Missense_Mutation T T C TCGA-3G-AB19-01A-21D-A423-09 ENST00000311189 p.K117R ART5 chr11 3639824 3639827 Frame_Shift_Del AGAG AGAG - TCGA-3G-AB19-01A-21D-A423-09 ENST00000359918 p.S201* TEAD4 chr12 3011046 3011046 Missense_Mutation G G A TCGA-3G-AB19-01A-21D-A423-09 ENST00000359864 p.G90E PPTC7 chr12 110551910 110551910 Silent T T A TCGA-3G-AB19-01A-21D-A423-09 ENST00000354300 p.S94S MAB21L1 chr13 35476853 35476853 5'UTR C C T TCGA-3G-AB19-01A-21D-A423-09 ENST00000379919 LRRC63 chr13 46276592 46276592 Missense_Mutation C C T TCGA-3G-AB19-01A-21D-A423-09 ENST00000595396 p.T518I MTHFD1 chr14 64448253 64448261 In_Frame_Del AAGAAACAA AAGAAACAA - TCGA-3G-AB19-01A-21D-A423-09 ENST00000216605 p.K739_Q741del SLC12A1 chr15 48259278 48259278 Silent C C T TCGA-3G-AB19-01A-21D-A423-09 ENST00000380993 p.N707N GOLGA6L17P chr15 82524111 82524111 RNA C C T TCGA-3G-AB19-01A-21D-A423-09 ENST00000614358 C16orf62 chr16 19573137 19573137 Missense_Mutation C C T TCGA-3G-AB19-01A-21D-A423-09 ENST00000417362 p.R102C ATMIN chr16 81046884 81046884 3'UTR T T G TCGA-3G-AB19-01A-21D-A423-09 ENST00000299575 PQLC1 chr18 79950752 79950753 In_Frame_Ins - - CAG TCGA-3G-AB19-01A-21D-A423-09 ENST00000397778 p.L58dup NTSR1 chr20 62758357 62758357 Splice_Site G G A TCGA-3G-AB19-01A-21D-A423-09 ENST00000370501 p.X336_splice AL022578.1 chrX 47836319 47836319 Missense_Mutation A A C TCGA-3G-AB19-01A-21D-A423-09 ENST00000624399 p.H155Q ALAS2 chrX 55020339 55020339 Silent G G T TCGA-3G-AB19-01A-21D-A423-09 ENST00000330807 p.T268T PABPC5 chrX 91436714 91436714 Missense_Mutation G G T TCGA-3G-AB19-01A-21D-A423-09 ENST00000312600 p.R379S RGAG1 chrX 110455893 110455893 3'UTR C C T TCGA-3G-AB19-01A-21D-A423-09 ENST00000465301 AVPR2 chrX 153906260 153906260 Missense_Mutation C C T TCGA-3G-AB19-01A-21D-A423-09 ENST00000337474 p.R252W LBH chr2 30257791 30257791 3'UTR T T - TCGA-5U-AB0E-01A-11D-A423-09 ENST00000395323 R3HDM1 chr2 135724988 135724988 3'UTR T T - TCGA-5U-AB0E-01A-11D-A423-09 ENST00000264160 KCNJ3 chr2 154855495 154855495 3'UTR G G A TCGA-5U-AB0E-01A-11D-A423-09 ENST00000295101 PLEKHA3 chr2 178504113 178504114 3'UTR - - T TCGA-5U-AB0E-01A-11D-A423-09 ENST00000234453 CERKL chr2 181548858 181548858 Splice_Site C C T TCGA-5U-AB0E-01A-11D-A423-09 ENST00000339098 p.X325_splice IKZF2 chr2 213006896 213006896 3'UTR T T C TCGA-5U-AB0E-01A-11D-A423-09 ENST00000434687 SPEG chr2 219462360 219462360 Frame_Shift_Del G G - TCGA-5U-AB0E-01A-11D-A423-09 ENST00000312358 p.E895Sfs*9 ANKMY1 chr2 240524026 240524026 Missense_Mutation C C T TCGA-5U-AB0E-01A-11D-A423-09 ENST00000272972 p.C475Y NR1I2 chr3 119815728 119815728 Missense_Mutation C C T TCGA-5U-AB0E-01A-11D-A423-09 ENST00000393716 p.R353C GAK chr4 876536 876536 Missense_Mutation A A T TCGA-5U-AB0E-01A-11D-A423-09 ENST00000314167 p.F683Y PHACTR1 chr6 13287190 13287190 3'UTR T T - TCGA-5U-AB0E-01A-11D-A423-09 ENST00000332995 GRM4 chr6 34133414 34133414 Frame_Shift_Del G G - TCGA-5U-AB0E-01A-11D-A423-09 ENST00000538487 p.P28Lfs*13 DAAM2 chr6 39896931 39896931 Missense_Mutation C C T TCGA-5U-AB0E-01A-11D-A423-09 ENST00000274867 p.R821W HOXA1 chr7 27095283 27095283 Silent G G A TCGA-5U-AB0E-01A-11D-A423-09 ENST00000343060 p.V210V SEC61G chr7 54752301 54752301 3'UTR A A - TCGA-5U-AB0E-01A-11D-A423-09 ENST00000352861 SPDYE10P chr7 73109975 73109975 RNA G G A TCGA-5U-AB0E-01A-11D-A423-09 ENST00000576332 SLC13A1 chr7 123128879 123128879 Missense_Mutation C C T TCGA-5U-AB0E-01A-11D-A423-09 ENST00000194130 p.G367R TRPS1 chr8 115412231 115412231 3'Flank T T C TCGA-5U-AB0E-01A-11D-A423-09 ENST00000220888 ANP32B chr9 98015503 98015503 3'UTR A A - TCGA-5U-AB0E-01A-11D-A423-09 ENST00000339399 CCDC6 chr10 59791492 59791492 3'UTR G G A TCGA-5U-AB0E-01A-11D-A423-09 ENST00000263102 CCDC6 chr10 59791493 59791493 3'UTR C C T TCGA-5U-AB0E-01A-11D-A423-09 ENST00000263102 SYTL2 chr11 85726471 85726471 Intron A A G TCGA-5U-AB0E-01A-11D-A423-09 ENST00000528231 FBXL14 chr12 1593567 1593567 Missense_Mutation C C A TCGA-5U-AB0E-01A-11D-A423-09 ENST00000339235 p.G167V RPP25 chr15 74956844 74956844 5'UTR G G A TCGA-5U-AB0E-01A-11D-A423-09 ENST00000322177 CHD2 chr15 92985637 92985637 Missense_Mutation A A G TCGA-5U-AB0E-01A-11D-A423-09 ENST00000394196 p.D1126G SDK2 chr17 73386444 73386444 Splice_Site C C A TCGA-5U-AB0E-01A-11D-A423-09 ENST00000392650 p.X1500_splice SLC16A3 chr17 82237567 82237567 Missense_Mutation T T A TCGA-5U-AB0E-01A-11D-A423-09 ENST00000392339 p.L266Q SARS2 chr19 38918459 38918459 Missense_Mutation A A T TCGA-5U-AB0E-01A-11D-A423-09 ENST00000221431 p.D293E ADCK4 chr19 40692322 40692322 Missense_Mutation C C T TCGA-5U-AB0E-01A-11D-A423-09 ENST00000324464 p.A450T KLK8 chr19 51000630 51000630 Intron C C T TCGA-5U-AB0E-01A-11D-A423-09 ENST00000600767 AC016629.3 chr19 58599380 58599380 5'Flank C C T TCGA-5U-AB0E-01A-11D-A423-09 ENST00000596427 GS1-309P15.2 chrX 27462658 27462658 RNA C C T TCGA-5U-AB0E-01A-11D-A423-09 ENST00000412172 CNST chr1 246647558 246647558 Missense_Mutation T T C TCGA-5G-A9ZZ-01A-31D-A423-09 ENST00000366513 p.S453P CD47 chr3 108043441 108043442 3'Flank - - A TCGA-5G-A9ZZ-01A-31D-A423-09 ENST00000361309 ZKSCAN8 chr6 28148592 28148592 Missense_Mutation C C T TCGA-5G-A9ZZ-01A-31D-A423-09 ENST00000330236 p.T62I ZNF311 chr6 29003897 29003897 Intron C C T TCGA-5G-A9ZZ-01A-31D-A423-09 ENST00000377179 WIPI2 chr7 5231065 5231065 3'UTR A A - TCGA-5G-A9ZZ-01A-31D-A423-09 ENST00000288828 KMT2E chr7 105113694 105113694 3'UTR T T - TCGA-5G-A9ZZ-01A-31D-A423-09 ENST00000257745 RAD23B chr9 107330362 107330362 3'UTR T T - TCGA-5G-A9ZZ-01A-31D-A423-09 ENST00000358015 PTCHD3 chr10 27414318 27414318 5'UTR C C T TCGA-5G-A9ZZ-01A-31D-A423-09 ENST00000438700 COL17A1 chr10 104085820 104085821 5'UTR - - T TCGA-5G-A9ZZ-01A-31D-A423-09 ENST00000353479 ADRB1 chr10 114045948 114045948 3'UTR G G A TCGA-5G-A9ZZ-01A-31D-A423-09 ENST00000369295 LRP5 chr11 68448980 68448980 Silent G G A TCGA-5G-A9ZZ-01A-31D-A423-09 ENST00000294304 p.A1586A NCAPD2 chr12 6531059 6531059 Missense_Mutation A A G TCGA-5G-A9ZZ-01A-31D-A423-09 ENST00000315579 p.D1368G CDCA3 chr12 6850524 6850524 Missense_Mutation C C A TCGA-5G-A9ZZ-01A-31D-A423-09 ENST00000535406 p.D65Y H2AFJ chr12 14776473 14776473 3'Flank C C T TCGA-5G-A9ZZ-01A-31D-A423-09 ENST00000389078 PDZRN4 chr12 41506607 41506607 Missense_Mutation C C G TCGA-5G-A9ZZ-01A-31D-A423-09 ENST00000402685 p.A332G POTEM chr14 18973108 18973108 Silent G G A TCGA-5G-A9ZZ-01A-31D-A423-09 ENST00000547889 p.E237E EVL chr14 100097512 100097512 Missense_Mutation T T C TCGA-5G-A9ZZ-01A-31D-A423-09 ENST00000402714 p.L69P AATF chr17 37056669 37056669 3'UTR G G A TCGA-5G-A9ZZ-01A-31D-A423-09 ENST00000619387 SERPINB13 chr18 63587381 63587381 5'UTR C C T TCGA-5G-A9ZZ-01A-31D-A423-09 ENST00000344731 NHS chrX 17726882 17726882 Missense_Mutation C C A TCGA-5G-A9ZZ-01A-31D-A423-09 ENST00000380060 p.Q905K SYTL5 chrX 38120387 38120387 Silent A A G TCGA-5G-A9ZZ-01A-31D-A423-09 ENST00000297875 p.Q542Q TGFBR3 chr1 91682985 91682985 3'UTR T T G TCGA-3G-AB0Q-01A-11D-A423-09 ENST00000212355 DNAJC27 chr2 24951527 24951527 Missense_Mutation A A G TCGA-3G-AB0Q-01A-11D-A423-09 ENST00000264711 p.C186R SF3B1 chr2 197408439 197408439 Silent G G A TCGA-3G-AB0Q-01A-11D-A423-09 ENST00000335508 p.S349S RAP2B chr3 153164064 153164064 3'UTR T T - TCGA-3G-AB0Q-01A-11D-A423-09 ENST00000323534 GABRB2 chr5 161288771 161288771 3'UTR T T - TCGA-3G-AB0Q-01A-11D-A423-09 ENST00000274547 HMGA1 chr6 34245778 34245778 3'UTR C C G TCGA-3G-AB0Q-01A-11D-A423-09 ENST00000311487 ITGB8 chr7 20414252 20414252 3'UTR C C T TCGA-3G-AB0Q-01A-11D-A423-09 ENST00000222573 GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-3G-AB0Q-01A-11D-A423-09 ENST00000573035 p.L424H STRIP2 chr7 129458390 129458390 Missense_Mutation C C A TCGA-3G-AB0Q-01A-11D-A423-09 ENST00000249344 p.A405E SPATA31A1 chr9 39361445 39361445 Missense_Mutation G G A TCGA-3G-AB0Q-01A-11D-A423-09 ENST00000625870 p.R1227H C10orf90 chr10 126461426 126461426 Missense_Mutation G G A TCGA-3G-AB0Q-01A-11D-A423-09 ENST00000284694 p.T565M RDH5 chr12 55721790 55721790 Missense_Mutation A A G TCGA-3G-AB0Q-01A-11D-A423-09 ENST00000257895 p.M138V ABCC4 chr13 95043767 95043767 Missense_Mutation T T C TCGA-3G-AB0Q-01A-11D-A423-09 ENST00000376887 p.K1217R GPHN chr14 66508171 66508171 5'UTR A A G TCGA-3G-AB0Q-01A-11D-A423-09 ENST00000315266 CHD3 chr17 7895142 7895142 Nonsense_Mutation C C T TCGA-3G-AB0Q-01A-11D-A423-09 ENST00000330494 p.R499* SNORD3A chr17 19188031 19188031 RNA G G - TCGA-3G-AB0Q-01A-11D-A423-09 ENST00000584923 FOXN1 chr17 28524539 28524539 Missense_Mutation G G A TCGA-3G-AB0Q-01A-11D-A423-09 ENST00000226247 p.D54N CLTC chr17 59666526 59666526 Missense_Mutation G G C TCGA-3G-AB0Q-01A-11D-A423-09 ENST00000269122 p.R610P MRPS7 chr17 75261926 75261926 Missense_Mutation C C G TCGA-3G-AB0Q-01A-11D-A423-09 ENST00000245539 p.A9G OR1I1 chr19 15087524 15087524 Missense_Mutation C C A TCGA-3G-AB0Q-01A-11D-A423-09 ENST00000209540 p.N153K RPL18 chr19 48616816 48616816 Silent C C T TCGA-3G-AB0Q-01A-11D-A423-09 ENST00000549920 p.K69K RBM39 chr20 35707162 35707162 Missense_Mutation G G T TCGA-3G-AB0Q-01A-11D-A423-09 ENST00000253363 p.A422E PDXP chr22 37666057 37666057 3'UTR C C G TCGA-3G-AB0Q-01A-11D-A423-09 ENST00000215904 PLXNB2 chr22 50283941 50283942 In_Frame_Ins - - CGG TCGA-3G-AB0Q-01A-11D-A423-09 ENST00000359337 p.R771dup FLNA chrX 154362745 154362746 Frame_Shift_Ins - - T TCGA-3G-AB0Q-01A-11D-A423-09 ENST00000369850 p.V774Sfs*48 MSH4 chr1 75876955 75876955 Missense_Mutation A A G TCGA-5V-A9RR-01A-11D-A423-09 ENST00000263187 p.N442S PRG4 chr1 186306395 186306395 Silent T T C TCGA-5V-A9RR-01A-11D-A423-09 ENST00000445192 p.L226L ADAMTS9 chr3 64516489 64516489 3'UTR T T G TCGA-5V-A9RR-01A-11D-A423-09 ENST00000498707 SEL1L3 chr4 25779141 25779141 Nonsense_Mutation C C T TCGA-5V-A9RR-01A-11D-A423-09 ENST00000399878 p.W840* ADAMTS3 chr4 72312227 72312227 Intron C C A TCGA-5V-A9RR-01A-11D-A423-09 ENST00000286657 PGRMC2 chr4 128270377 128270377 3'UTR C C T TCGA-5V-A9RR-01A-11D-A423-09 ENST00000296425 UBLCP1 chr5 159270610 159270610 Missense_Mutation C C G TCGA-5V-A9RR-01A-11D-A423-09 ENST00000296786 p.L139V ZSCAN12 chr6 28391213 28391213 Silent G G A TCGA-5V-A9RR-01A-11D-A423-09 ENST00000361028 p.H359H POM121 chr7 72942166 72942166 Missense_Mutation C C T TCGA-5V-A9RR-01A-11D-A423-09 ENST00000434423 p.P725S GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-5V-A9RR-01A-11D-A423-09 ENST00000573035 p.L424H FSCN3 chr7 127600309 127600309 Silent C C G TCGA-5V-A9RR-01A-11D-A423-09 ENST00000265825 p.A469A CSMD1 chr8 3998058 3998058 Silent G G A TCGA-5V-A9RR-01A-11D-A423-09 ENST00000520002 p.S221S NTRK2 chr9 84670916 84670916 Silent G G A TCGA-5V-A9RR-01A-11D-A423-09 ENST00000323115 p.P56P COL17A1 chr10 104036610 104036610 Silent T T C TCGA-5V-A9RR-01A-11D-A423-09 ENST00000353479 p.L1100L OTOGL chr12 80358721 80358721 Missense_Mutation A A G TCGA-5V-A9RR-01A-11D-A423-09 ENST00000547103 p.M2037V BCL7A chr12 122060628 122060628 3'UTR T T G TCGA-5V-A9RR-01A-11D-A423-09 ENST00000261822 RBM25 chr14 73121197 73121197 3'UTR T T - TCGA-5V-A9RR-01A-11D-A423-09 ENST00000261973 LTBP2 chr14 74585885 74585885 Missense_Mutation A A C TCGA-5V-A9RR-01A-11D-A423-09 ENST00000261978 p.S267A SMPD3 chr16 68360645 68360645 3'UTR A A G TCGA-5V-A9RR-01A-11D-A423-09 ENST00000219334 TSHZ1 chr18 75288003 75288003 Missense_Mutation G G A TCGA-5V-A9RR-01A-11D-A423-09 ENST00000580243 p.D866N CACNA1A chr19 13230090 13230090 Silent G G A TCGA-5V-A9RR-01A-11D-A423-09 ENST00000360228 p.P1840P CD34 chr1 207889753 207889753 Intron C C A TCGA-ZB-A96R-01A-11D-A428-09 ENST00000310833 SLC6A6 chr3 14485317 14485317 3'UTR T T - TCGA-ZB-A96R-01A-11D-A428-09 ENST00000622186 IGDCC4 chr15 65382095 65382095 3'UTR A A - TCGA-ZB-A96R-01A-11D-A428-09 ENST00000352385 SPIRE1 chr18 12449301 12449302 3'UTR - - T TCGA-ZB-A96R-01A-11D-A428-09 ENST00000409402 BCR chr22 23263153 23263155 Intron GGA GGA - TCGA-ZB-A96R-01A-11D-A428-09 ENST00000305877 TNRC6B chr22 40323310 40323311 3'UTR - - T TCGA-ZB-A96R-01A-11D-A428-09 ENST00000454349 CROCCP3 chr1 16485636 16485636 RNA C C T TCGA-XU-AAY0-01A-11D-A428-09 ENST00000263511 AIM1L chr1 26345290 26345290 Silent G G T TCGA-XU-AAY0-01A-11D-A428-09 ENST00000308182 p.L456L GBP1 chr1 89053183 89053183 3'UTR T T - TCGA-XU-AAY0-01A-11D-A428-09 ENST00000370473 RSBN1 chr1 113761877 113761877 3'UTR A A - TCGA-XU-AAY0-01A-11D-A428-09 ENST00000261441 NRXN1 chr2 50623319 50623319 Missense_Mutation G G A TCGA-XU-AAY0-01A-11D-A428-09 ENST00000406316 p.R377C AC008836.1 chr5 61557291 61557291 RNA G G C TCGA-XU-AAY0-01A-11D-A428-09 ENST00000411268 H2AFY chr5 135334913 135334913 3'UTR T T - TCGA-XU-AAY0-01A-11D-A428-09 ENST00000510038 RREB1 chr6 7248680 7248680 Silent C C T TCGA-XU-AAY0-01A-11D-A428-09 ENST00000349384 p.S1592S VEGFA chr6 43786439 43786440 3'Flank - - A TCGA-XU-AAY0-01A-11D-A428-09 ENST00000523873 ARFGEF3 chr6 138337238 138337238 3'UTR G G A TCGA-XU-AAY0-01A-11D-A428-09 ENST00000251691 GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-XU-AAY0-01A-11D-A428-09 ENST00000573035 p.L424H UBE2W chr8 73793825 73793825 3'UTR A A T TCGA-XU-AAY0-01A-11D-A428-09 ENST00000602593 KIAA1462 chr10 30028463 30028463 Missense_Mutation T T C TCGA-XU-AAY0-01A-11D-A428-09 ENST00000375377 p.Q562R MICALCL chr11 12359092 12359092 3'UTR T T C TCGA-XU-AAY0-01A-11D-A428-09 ENST00000256186 LARP4 chr12 50477993 50477993 3'UTR A A G TCGA-XU-AAY0-01A-11D-A428-09 ENST00000398473 ACSS3 chr12 81109603 81109603 Missense_Mutation C C T TCGA-XU-AAY0-01A-11D-A428-09 ENST00000548058 p.R119C GOLGA6L3 chr15 85245235 85245235 RNA C C T TCGA-XU-AAY0-01A-11D-A428-09 ENST00000507199 ZFHX3 chr16 72782896 72782896 3'UTR T T - TCGA-XU-AAY0-01A-11D-A428-09 ENST00000268489 DTNA chr18 34888528 34888529 3'Flank - - T TCGA-XU-AAY0-01A-11D-A428-09 ENST00000399113 GNB1 chr1 1785804 1785804 3'UTR T T - TCGA-ZB-A96D-01A-11D-A428-09 ENST00000378609 PUM1 chr1 30932849 30932849 3'UTR T T - TCGA-ZB-A96D-01A-11D-A428-09 ENST00000257075 RBMS3 chr3 29899747 29899747 Nonsense_Mutation C C T TCGA-ZB-A96D-01A-11D-A428-09 ENST00000383767 p.Q311* REXO1L1P chr8 85660865 85660867 RNA ATT ATT - TCGA-ZB-A96D-01A-11D-A428-09 ENST00000379010 MUC2 chr11 1097399 1097399 RNA C C T TCGA-ZB-A96D-01A-11D-A428-09 ENST00000361558 DAK chr11 61339414 61339414 Silent C C T TCGA-ZB-A96D-01A-11D-A428-09 ENST00000394900 p.C155C DYRK2 chr12 67660362 67660362 3'UTR A A - TCGA-ZB-A96D-01A-11D-A428-09 ENST00000344096 MORF4L1 chr15 78897488 78897489 3'UTR - - T TCGA-ZB-A96D-01A-11D-A428-09 ENST00000331268 GPRC5C chr17 74432141 74432141 Missense_Mutation G G A TCGA-ZB-A96D-01A-11D-A428-09 ENST00000392627 p.G35R ZC3H4 chr19 47066612 47066612 Missense_Mutation T T C TCGA-ZB-A96D-01A-11D-A428-09 ENST00000253048 p.N1219S TMSB4X chrX 12977148 12977149 3'Flank - - T TCGA-ZB-A96D-01A-11D-A428-09 ENST00000380633 MTMR1 chrX 150762690 150762690 Silent G G A TCGA-ZB-A96D-01A-11D-A428-09 ENST00000370390 p.S653S SDAD1 chr4 75957849 75957849 Missense_Mutation T T C TCGA-XM-A8R9-01A-31D-A423-09 ENST00000356260 p.I526V BDP1 chr5 71486534 71486535 In_Frame_Ins - - TTT TCGA-XM-A8R9-01A-31D-A423-09 ENST00000358731 p.V374_L375insF MIR6859-3 chr15 101972609 101972609 5'Flank G G A TCGA-XM-A8R9-01A-31D-A423-09 ENST00000621186 PPM1E chr17 58982991 58982991 3'UTR A A - TCGA-XM-A8R9-01A-31D-A423-09 ENST00000308249 PLXNB2 chr22 50281497 50281497 Splice_Region C C T TCGA-XM-A8R9-01A-31D-A423-09 ENST00000359337 p.V1175V FAM120C chrX 54072565 54072566 3'UTR - - A TCGA-XM-A8R9-01A-31D-A423-09 ENST00000375180 COL4A6 chrX 108165440 108165440 Silent G G T TCGA-XM-A8R9-01A-31D-A423-09 ENST00000372216 p.G1247G ZNF449 chrX 135347089 135347089 5'UTR A A T TCGA-XM-A8R9-01A-31D-A423-09 ENST00000339249 UTP11L chr1 38022773 38022773 Silent T T G TCGA-3G-AB0T-01A-11D-A423-09 ENST00000373014 p.V214V AL078621.1 chr2 113595432 113595432 5'Flank G G A TCGA-3G-AB0T-01A-11D-A423-09 ENST00000613451 TRIM2 chr4 153335811 153335811 3'UTR C C T TCGA-3G-AB0T-01A-11D-A423-09 ENST00000437508 IRX4 chr5 1879669 1879669 Missense_Mutation T T A TCGA-3G-AB0T-01A-11D-A423-09 ENST00000231357 p.T191S STK10 chr5 172093781 172093781 Silent G G A TCGA-3G-AB0T-01A-11D-A423-09 ENST00000176763 p.V395V HIST1H2BN chr6 27838340 27838340 5'Flank G G A TCGA-3G-AB0T-01A-11D-A423-09 ENST00000396980 PRIM2 chr6 57390206 57390206 Intron A A T TCGA-3G-AB0T-01A-11D-A423-09 ENST00000615550 DENND2A chr7 140601639 140601639 Silent G G A TCGA-3G-AB0T-01A-11D-A423-09 ENST00000275884 p.G253G S1PR3 chr9 89003147 89003147 3'UTR G G A TCGA-3G-AB0T-01A-11D-A423-09 ENST00000358157 SEPHS1 chr10 13318741 13318741 3'UTR A A - TCGA-3G-AB0T-01A-11D-A423-09 ENST00000327347 RAB6A chr11 73676483 73676483 3'UTR A A - TCGA-3G-AB0T-01A-11D-A423-09 ENST00000336083 GOLGA6L17P chr15 82523921 82523921 RNA G G A TCGA-3G-AB0T-01A-11D-A423-09 ENST00000614358 CDH11 chr16 64947456 64947456 3'UTR G G A TCGA-3G-AB0T-01A-11D-A423-09 ENST00000268603 SLC5A3 chr21 34105035 34105035 3'UTR T T G TCGA-3G-AB0T-01A-11D-A423-09 ENST00000381151 AL022578.1 chrX 47836752 47836752 Missense_Mutation T T A TCGA-3G-AB0T-01A-11D-A423-09 ENST00000624399 p.D11V ARHGEF9 chrX 63637883 63637884 3'UTR TG TG - TCGA-3G-AB0T-01A-11D-A423-09 ENST00000253401 NAP1L3 chrX 93673495 93673495 5'UTR G G C TCGA-3G-AB0T-01A-11D-A423-09 ENST00000373079 FBXO42 chr1 16250475 16250476 3'UTR AT AT - TCGA-3S-AAYX-01A-11D-A423-09 ENST00000375592 GPR139 chr16 20032067 20032067 Frame_Shift_Del G G - TCGA-3S-AAYX-01A-11D-A423-09 ENST00000570682 p.R244Afs*4 UBFD1 chr16 23574306 23574306 3'UTR T T - TCGA-3S-AAYX-01A-11D-A423-09 ENST00000395878 C17orf96 chr17 38673453 38673453 Missense_Mutation G G T TCGA-3S-AAYX-01A-11D-A423-09 ENST00000621654 p.P348Q PLCG1 chr20 41165014 41165014 Frame_Shift_Del G G - TCGA-3S-AAYX-01A-11D-A423-09 ENST00000373271 p.D435Tfs*45 TBC1D8B chrX 106875108 106875108 3'UTR A A - TCGA-3S-AAYX-01A-11D-A423-09 ENST00000357242 SMAP2 chr1 40406765 40406765 Missense_Mutation G G T TCGA-XU-AAXZ-01A-11D-A428-09 ENST00000372718 p.V45L ITGA10 chr1 145900879 145900879 Missense_Mutation C C A TCGA-XU-AAXZ-01A-11D-A428-09 ENST00000369304 p.A568S MAP3K1 chr5 56883605 56883605 Missense_Mutation A A G TCGA-XU-AAXZ-01A-11D-A428-09 ENST00000399503 p.I1249V SSR1 chr6 7287925 7287925 3'UTR A A - TCGA-XU-AAXZ-01A-11D-A428-09 ENST00000244763 RP1L1 chr8 10610196 10610197 In_Frame_Ins - - CCC TCGA-XU-AAXZ-01A-11D-A428-09 ENST00000382483 p.E1300_V1301insG ARNTL chr11 13277862 13277864 5'UTR CCG CCG - TCGA-XU-AAXZ-01A-11D-A428-09 ENST00000403290 CCDC67 chr11 93364190 93364191 Frame_Shift_Ins - - G TCGA-XU-AAXZ-01A-11D-A428-09 ENST00000298050 p.L110Rfs*20 ACACB chr12 109185594 109185594 Missense_Mutation C C T TCGA-XU-AAXZ-01A-11D-A428-09 ENST00000338432 p.P612S MBD2 chr18 54202987 54202987 Intron T T C TCGA-XU-AAXZ-01A-11D-A428-09 ENST00000256429 BCOR chrX 40051808 40051809 3'UTR - - T TCGA-XU-AAXZ-01A-11D-A428-09 ENST00000378444 KIAA2022 chrX 74738858 74738859 3'UTR AC AC - TCGA-XU-AAXZ-01A-11D-A428-09 ENST00000055682 CEP170 chr1 243124879 243124880 3'UTR - - T TCGA-4V-A9QJ-01A-11D-A423-09 ENST00000366542 DOCK4 chr7 111727358 111727359 3'Flank - - T TCGA-4V-A9QJ-01A-11D-A423-09 ENST00000437633 PLAG1 chr8 56163681 56163682 3'UTR AC AC - TCGA-4V-A9QJ-01A-11D-A423-09 ENST00000316981 UHRF2 chr9 6500640 6500640 Missense_Mutation T T G TCGA-4V-A9QJ-01A-11D-A423-09 ENST00000276893 p.H698Q NFIB chr9 14084165 14084165 3'UTR G G C TCGA-4V-A9QJ-01A-11D-A423-09 ENST00000380959 S1PR3 chr9 89004403 89004405 3'UTR AAT AAT - TCGA-4V-A9QJ-01A-11D-A423-09 ENST00000358157 MUC2 chr11 1097335 1097335 RNA C C T TCGA-4V-A9QJ-01A-11D-A423-09 ENST00000361558 GAS2 chr11 22749191 22749191 Missense_Mutation C C G TCGA-4V-A9QJ-01A-11D-A423-09 ENST00000278187 p.P182R NOVA1 chr14 26446911 26446911 3'UTR G G C TCGA-4V-A9QJ-01A-11D-A423-09 ENST00000539517 NRXN3 chr14 79862489 79862489 3'Flank A A - TCGA-4V-A9QJ-01A-11D-A423-09 ENST00000557594 IRX5 chr16 54934044 54934044 3'UTR A A - TCGA-4V-A9QJ-01A-11D-A423-09 ENST00000394636 TP53 chr17 7674950 7674950 Missense_Mutation A A C TCGA-4V-A9QJ-01A-11D-A423-09 ENST00000269305 p.L194R DNAH9 chr17 11854089 11854089 Silent C C A TCGA-4V-A9QJ-01A-11D-A423-09 ENST00000262442 p.P3198P ELAVL1 chr19 7959111 7959112 3'Flank - - T TCGA-4V-A9QJ-01A-11D-A423-09 ENST00000351593 ROMO1 chr20 35700980 35700983 3'UTR AGTC AGTC - TCGA-4V-A9QJ-01A-11D-A423-09 ENST00000336695 NCBP2L chrX 107794595 107794595 Silent C C T TCGA-4V-A9QJ-01A-11D-A423-09 ENST00000509000 p.R125R OPRD1 chr1 28863005 28863005 Missense_Mutation G G A TCGA-XU-A92V-01A-11D-A423-09 ENST00000234961 p.V281I NBPF9 chr1 149072811 149072811 Missense_Mutation C C A TCGA-XU-A92V-01A-11D-A423-09 ENST00000613595 p.D405Y ZBED6 chr1 203799632 203799632 Missense_Mutation G G A TCGA-XU-A92V-01A-11D-A423-09 ENST00000550078 p.V704M GGPS1 chr1 235343984 235343984 3'UTR C C G TCGA-XU-A92V-01A-11D-A423-09 ENST00000282841 CCDC142 chr2 74481300 74481300 Missense_Mutation A A C TCGA-XU-A92V-01A-11D-A423-09 ENST00000393965 p.L394R NCAPH chr2 96373462 96373462 3'UTR A A G TCGA-XU-A92V-01A-11D-A423-09 ENST00000240423 FIGN chr2 163609625 163609625 Missense_Mutation A A T TCGA-XU-A92V-01A-11D-A423-09 ENST00000333129 p.I736N HJURP chr2 233841215 233841215 Missense_Mutation G G A TCGA-XU-A92V-01A-11D-A423-09 ENST00000411486 p.S522L HJURP chr2 233841599 233841599 Missense_Mutation G G C TCGA-XU-A92V-01A-11D-A423-09 ENST00000411486 p.A394G HJURP chr2 233841931 233841931 Missense_Mutation G G C TCGA-XU-A92V-01A-11D-A423-09 ENST00000411486 p.I283M HJURP chr2 233842035 233842035 Missense_Mutation G G A TCGA-XU-A92V-01A-11D-A423-09 ENST00000411486 p.P249S HJURP chr2 233842189 233842189 Missense_Mutation G G C TCGA-XU-A92V-01A-11D-A423-09 ENST00000411486 p.I197M PPARGC1A chr4 23813117 23813117 Missense_Mutation T T C TCGA-XU-A92V-01A-11D-A423-09 ENST00000264867 p.Y601C ZNF192P1 chr6 28166534 28166534 RNA C C G TCGA-XU-A92V-01A-11D-A423-09 ENST00000440790 HLA-DMA chr6 32953008 32953008 Missense_Mutation G G A TCGA-XU-A92V-01A-11D-A423-09 ENST00000374843 p.A10V RFX6 chr6 116925544 116925544 Missense_Mutation G G C TCGA-XU-A92V-01A-11D-A423-09 ENST00000332958 p.K590N MPLKIP chr7 40134358 40134358 Silent G G A TCGA-XU-A92V-01A-11D-A423-09 ENST00000306984 p.G70G COBL chr7 51219793 51219793 Missense_Mutation C C T TCGA-XU-A92V-01A-11D-A423-09 ENST00000265136 p.V65I GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-XU-A92V-01A-11D-A423-09 ENST00000573035 p.L424H DMTF1 chr7 87195752 87195752 3'UTR G G C TCGA-XU-A92V-01A-11D-A423-09 ENST00000331242 DGKI chr7 137645527 137645527 Missense_Mutation C C T TCGA-XU-A92V-01A-11D-A423-09 ENST00000288490 p.R250H VPS37A chr8 17295640 17295640 3'UTR A A - TCGA-XU-A92V-01A-11D-A423-09 ENST00000324849 SARDH chr9 133718972 133718972 Missense_Mutation C C A TCGA-XU-A92V-01A-11D-A423-09 ENST00000371872 p.G329V TCF7L2 chr10 112950558 112950558 5'UTR C C - TCGA-XU-A92V-01A-11D-A423-09 ENST00000355995 DMBT1 chr10 122631176 122631176 Missense_Mutation G G T TCGA-XU-A92V-01A-11D-A423-09 ENST00000338354 p.D1952Y C11orf45 chr11 128902502 128902503 3'UTR - - GTCTGCAT TCGA-XU-A92V-01A-11D-A423-09 ENST00000310799 PRR13 chr12 53443759 53443759 Missense_Mutation C C T TCGA-XU-A92V-01A-11D-A423-09 ENST00000429243 p.H130Y ACACB chr12 109199452 109199452 Missense_Mutation A A C TCGA-XU-A92V-01A-11D-A423-09 ENST00000338432 p.D893A SLITRK1 chr13 83880774 83880774 Missense_Mutation G G T TCGA-XU-A92V-01A-11D-A423-09 ENST00000377084 p.T245N ARHGEF40 chr14 21074425 21074425 Missense_Mutation A A G TCGA-XU-A92V-01A-11D-A423-09 ENST00000298694 p.N232S AC023310.1 chr15 20572994 20572994 3'Flank A A G TCGA-XU-A92V-01A-11D-A423-09 ENST00000408427 GOLGA6L9 chr15 82436020 82436020 Missense_Mutation G G C TCGA-XU-A92V-01A-11D-A423-09 ENST00000618348 p.A373P N4BP1 chr16 48560974 48560974 Missense_Mutation T T C TCGA-XU-A92V-01A-11D-A423-09 ENST00000262384 p.N557D ATXN1L chr16 71856905 71856905 3'UTR T T A TCGA-XU-A92V-01A-11D-A423-09 ENST00000427980 SAT2 chr17 7627753 7627753 5'UTR G G - TCGA-XU-A92V-01A-11D-A423-09 ENST00000269298 C17orf59 chr17 8188418 8188418 3'UTR A A C TCGA-XU-A92V-01A-11D-A423-09 ENST00000389017 ONECUT3 chr19 1754837 1754837 Nonsense_Mutation C C A TCGA-XU-A92V-01A-11D-A423-09 ENST00000382349 p.S392* IER2 chr19 13154355 13154359 3'UTR ACTTG ACTTG - TCGA-XU-A92V-01A-11D-A423-09 ENST00000292433 FCAR chr19 54885464 54885464 Silent C C T TCGA-XU-A92V-01A-11D-A423-09 ENST00000355524 p.C100C NLRP5 chr19 56028165 56028165 Silent C C T TCGA-XU-A92V-01A-11D-A423-09 ENST00000390649 p.D644D PMEPA1 chr20 57652246 57652246 Missense_Mutation C C T TCGA-XU-A92V-01A-11D-A423-09 ENST00000341744 p.R224H CSF2RB chr22 36938203 36938203 Missense_Mutation C C T TCGA-XU-A92V-01A-11D-A423-09 ENST00000403662 p.R799C ZXDA chrX 57910513 57910513 5'UTR A A - TCGA-XU-A92V-01A-11D-A423-09 ENST00000358697 KIAA2022 chrX 74738858 74738859 3'UTR AC AC - TCGA-XU-A92V-01A-11D-A423-09 ENST00000055682 ADGRG4 chrX 136346168 136346168 Missense_Mutation G G A TCGA-XU-A92V-01A-11D-A423-09 ENST00000370652 p.G821D LINC00869 chr1 149661303 149661303 Splice_Region G G A TCGA-X7-A8DJ-01A-11D-A423-09 ENST00000610578 TNN chr1 175077809 175077809 Missense_Mutation T T A TCGA-X7-A8DJ-01A-11D-A423-09 ENST00000239462 p.C131S GRM7 chr3 7740357 7740357 Missense_Mutation G G C TCGA-X7-A8DJ-01A-11D-A423-09 ENST00000357716 p.S900T ROPN1 chr3 123980261 123980261 Intron T T G TCGA-X7-A8DJ-01A-11D-A423-09 ENST00000184183 LFNG chr7 2525718 2525718 Missense_Mutation G G C TCGA-X7-A8DJ-01A-11D-A423-09 ENST00000222725 p.A257P GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-X7-A8DJ-01A-11D-A423-09 ENST00000573035 p.L424H CYP11B2 chr8 142914761 142914761 Missense_Mutation A A G TCGA-X7-A8DJ-01A-11D-A423-09 ENST00000323110 p.I248T TRIM3 chr11 6456104 6456104 Missense_Mutation C C T TCGA-X7-A8DJ-01A-11D-A423-09 ENST00000345851 p.V501M SNAI1 chr20 49988448 49988448 3'UTR A A - TCGA-X7-A8DJ-01A-11D-A423-09 ENST00000244050 PEX10 chr1 2406488 2406488 Missense_Mutation C C T TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000447513 p.S303N HIPK1 chr1 113975517 113975518 3'UTR - - T TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000369558 ECM1 chr1 150513387 150513387 Nonsense_Mutation G G T TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000369047 p.E515* LYSMD1 chr1 151160546 151160546 3'UTR G G T TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000368908 MEX3A chr1 156074422 156074422 3'UTR G G T TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000532414 SERPINE2 chr2 224001713 224001713 Missense_Mutation C C A TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000258405 p.G63V ST6GAL1 chr3 187078105 187078105 3'UTR C C T TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000169298 WDR17 chr4 176149904 176149904 Silent A A C TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000280190 p.V689V TENM3 chr4 182775131 182775131 Missense_Mutation A A G TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000511685 p.N1761S DEFB112 chr6 50043738 50043738 Missense_Mutation C C T TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000322246 p.R60Q IGF2R chr6 160064488 160064488 Missense_Mutation G G A TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000356956 p.R1325H GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000573035 p.L424H ADAM18 chr8 39729917 39729917 Nonsense_Mutation G G T TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000265707 p.E733* ZBTB10 chr8 80499576 80499576 Missense_Mutation G G A TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000430430 p.R352Q CA9 chr9 35673945 35673945 5'UTR C C T TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000378357 CNTNAP3P2 chr9 67201162 67201162 RNA G G A TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000617175 MAN1B1 chr9 137103533 137103533 Intron T T G TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000371589 YME1L1 chr10 27145571 27145571 Missense_Mutation T T A TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000326799 p.D120V PAOX chr10 133380180 133380180 Silent C C T TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000278060 p.S121S HRAS chr11 533552 533552 Missense_Mutation C C A TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000311189 p.K117N MADD chr11 47290159 47290159 Missense_Mutation G G T TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000311027 p.R1005L PYGM chr11 64754791 64754791 Missense_Mutation C C T TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000164139 p.V301M C12orf5 chr12 4353864 4353864 3'UTR G G - TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000179259 FBRSL1 chr12 132552602 132552602 Intron G G C TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000434748 PHF2P2 chr13 19049996 19049996 RNA G G C TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000444553 CTSG chr14 24573777 24573777 Missense_Mutation C C T TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000216336 p.V210M FOS chr14 75280183 75280183 Intron C C - TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000303562 IGHV3-21 chr14 106235207 106235207 Missense_Mutation T T C TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000390607 p.I70V CHRNA7 chr15 32168037 32168037 Missense_Mutation G G A TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000306901 p.R363H DNM1P47 chr15 101758074 101758074 RNA G G C TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000561463 PPM1E chr17 58982991 58982991 3'UTR A A - TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000308249 MIB1 chr18 21838373 21838373 Missense_Mutation G G A TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000261537 p.R613H ABCA7 chr19 1043092 1043092 Nonsense_Mutation C C T TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000263094 p.R211* KIAA0355 chr19 34354677 34354678 3'UTR - - A TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000299505 VPS16 chr20 2864259 2864259 Missense_Mutation G G T TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000380445 p.K564N ATRX chrX 77505810 77505810 3'UTR A A C TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000373344 NRK chrX 105912733 105912733 Missense_Mutation T T C TCGA-ZL-A9V6-01A-11D-A428-09 ENST00000243300 p.I776T NBPF14 chr1 148533964 148533964 Missense_Mutation C C T TCGA-4V-A9QS-01A-11D-A423-09 ENST00000619423 p.E2874K UHMK1 chr1 162500105 162500105 Missense_Mutation G G T TCGA-4V-A9QS-01A-11D-A423-09 ENST00000489294 p.R140L ANGPTL1 chr1 178852778 178852778 Missense_Mutation C C A TCGA-4V-A9QS-01A-11D-A423-09 ENST00000234816 p.R398L OR2T1 chr1 248406455 248406455 Missense_Mutation A A G TCGA-4V-A9QS-01A-11D-A423-09 ENST00000366474 p.Y154C YPEL5 chr2 30159236 30159237 3'UTR - - T TCGA-4V-A9QS-01A-11D-A423-09 ENST00000261353 ARL11 chr13 49631405 49631407 3'UTR AAT AAT - TCGA-4V-A9QS-01A-11D-A423-09 ENST00000282026 EID1 chr15 48878171 48878171 5'UTR T T C TCGA-4V-A9QS-01A-11D-A423-09 ENST00000530028 MIR6859-3 chr15 101972964 101972964 5'Flank G G A TCGA-4V-A9QS-01A-11D-A423-09 ENST00000621186 ESX1 chrX 104250409 104250409 Missense_Mutation G G C TCGA-4V-A9QS-01A-11D-A423-09 ENST00000372588 p.P347R BTG2 chr1 203308867 203308870 3'UTR CCTT CCTT - TCGA-XM-A8RG-01A-11D-A423-09 ENST00000290551 TTN chr2 178719765 178719765 Missense_Mutation C C A TCGA-XM-A8RG-01A-11D-A423-09 ENST00000591111 p.E7592D SCN5A chr3 38581203 38581203 Missense_Mutation G G A TCGA-XM-A8RG-01A-11D-A423-09 ENST00000333535 p.R986W RHOA chr3 49362616 49362616 Silent T T G TCGA-XM-A8RG-01A-11D-A423-09 ENST00000418115 p.P96P GFPT2 chr5 180301342 180301348 3'UTR TAAACAA TAAACAA - TCGA-XM-A8RG-01A-11D-A423-09 ENST00000253778 HIST1H3F chr6 26250315 26250315 Silent G G A TCGA-XM-A8RG-01A-11D-A423-09 ENST00000618052 p.C97C NOTCH4 chr6 32218073 32218073 Missense_Mutation C C G TCGA-XM-A8RG-01A-11D-A423-09 ENST00000375023 p.E516Q MARCKS chr6 113861074 113861075 3'UTR - - T TCGA-XM-A8RG-01A-11D-A423-09 ENST00000612661 GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-XM-A8RG-01A-11D-A423-09 ENST00000573035 p.L424H NEFM chr8 24917299 24917299 Missense_Mutation G G T TCGA-XM-A8RG-01A-11D-A423-09 ENST00000221166 p.V482F FER1L6 chr8 124094930 124094930 Silent C C A TCGA-XM-A8RG-01A-11D-A423-09 ENST00000399018 p.L1529L HRAS chr11 533877 533877 Missense_Mutation C C A TCGA-XM-A8RG-01A-11D-A423-09 ENST00000311189 p.G60V TRPM5 chr11 2422173 2422173 Missense_Mutation C C T TCGA-XM-A8RG-01A-11D-A423-09 ENST00000155858 p.R89H COLCA2 chr11 111293943 111293943 5'Flank T T C TCGA-XM-A8RG-01A-11D-A423-09 ENST00000610738 COLCA2 chr11 111308291 111308291 Missense_Mutation G G A TCGA-XM-A8RG-01A-11D-A423-09 ENST00000398035 p.A107T HSP90B1 chr12 103930458 103930458 5'UTR G G - TCGA-XM-A8RG-01A-11D-A423-09 ENST00000299767 RNF6 chr13 26215568 26215568 Missense_Mutation G G A TCGA-XM-A8RG-01A-11D-A423-09 ENST00000346166 p.S105L NHLRC3 chr13 39049048 39049048 3'UTR T T - TCGA-XM-A8RG-01A-11D-A423-09 ENST00000379600 GOLGA6L6 chr15 20534646 20534646 Silent C C T TCGA-XM-A8RG-01A-11D-A423-09 ENST00000619213 p.R596R EDC3 chr15 74675133 74675133 5'UTR C C A TCGA-XM-A8RG-01A-11D-A423-09 ENST00000315127 BTBD1 chr15 83017538 83017538 3'UTR T T C TCGA-XM-A8RG-01A-11D-A423-09 ENST00000261721 JPH3 chr16 87690269 87690269 Missense_Mutation C C T TCGA-XM-A8RG-01A-11D-A423-09 ENST00000284262 p.R637W HEXIM1 chr17 45149094 45149095 5'UTR - - T TCGA-XM-A8RG-01A-11D-A423-09 ENST00000332499 WDR18 chr19 991253 991253 Missense_Mutation C C G TCGA-XM-A8RG-01A-11D-A423-09 ENST00000585809 p.S278C PPP2R1A chr19 52212768 52212768 Missense_Mutation C C G TCGA-XM-A8RG-01A-11D-A423-09 ENST00000322088 p.L196V COLGALT2 chr1 183944309 183944309 Silent C C T TCGA-ZB-A96M-01A-11D-A428-09 ENST00000361927 p.E428E PIK3C2B chr1 204441544 204441544 Missense_Mutation G G A TCGA-ZB-A96M-01A-11D-A428-09 ENST00000367187 p.S1059F KIDINS220 chr2 8731234 8731234 Missense_Mutation T T C TCGA-ZB-A96M-01A-11D-A428-09 ENST00000256707 p.N1601S ADGRA3 chr4 22515732 22515732 Missense_Mutation G G C TCGA-ZB-A96M-01A-11D-A428-09 ENST00000334304 p.P18R GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-ZB-A96M-01A-11D-A428-09 ENST00000573035 p.L424H PCLO chr7 83162452 83162452 Missense_Mutation C C G TCGA-ZB-A96M-01A-11D-A428-09 ENST00000333891 p.Q47H MKI67 chr10 128107733 128107733 Silent A A G TCGA-ZB-A96M-01A-11D-A428-09 ENST00000368654 p.T1369T MUC2 chr11 1097336 1097336 RNA G G A TCGA-ZB-A96M-01A-11D-A428-09 ENST00000361558 PAX6 chr11 31789092 31789092 3'Flank C C T TCGA-ZB-A96M-01A-11D-A428-09 ENST00000241001 DAGLA chr11 61720723 61720723 Missense_Mutation C C T TCGA-ZB-A96M-01A-11D-A428-09 ENST00000257215 p.P47L HTR3A chr11 113977545 113977545 Intron C C T TCGA-ZB-A96M-01A-11D-A428-09 ENST00000504030 DYRK2 chr12 67657916 67657916 Missense_Mutation G G T TCGA-ZB-A96M-01A-11D-A428-09 ENST00000344096 p.D337Y SNORD3B-2 chr17 19064102 19064102 RNA C C T TCGA-ZB-A96M-01A-11D-A428-09 ENST00000571722 DNAH17 chr17 78459920 78459920 Missense_Mutation C C T TCGA-ZB-A96M-01A-11D-A428-09 ENST00000389840 p.A3173T ZNF649 chr19 51890666 51890667 Frame_Shift_Del CA CA - TCGA-ZB-A96M-01A-11D-A428-09 ENST00000354957 p.V490Gfs*8 ZNF776 chr19 57753861 57753861 Missense_Mutation T T G TCGA-ZB-A96M-01A-11D-A428-09 ENST00000317178 p.F244C ATP5E chr20 59028741 59028741 3'UTR T T - TCGA-ZB-A96M-01A-11D-A428-09 ENST00000243997 SPOCD1 chr1 31791016 31791016 Missense_Mutation G G A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000360482 p.P1080S NRD1 chr1 51810405 51810405 Splice_Site C C T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000354831 p.X662_splice SNX7 chr1 98661885 98661885 Missense_Mutation G G A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000306121 p.E52K PALMD chr1 99646264 99646264 5'UTR G G A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000263174 PPIAL4D chr1 145241772 145241772 Missense_Mutation T T C TCGA-5U-AB0D-01A-11D-A423-09 ENST00000544708 p.K118R ADAMTSL4 chr1 150553430 150553430 Missense_Mutation C C T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000271643 p.R147W OR10Z1 chr1 158606755 158606755 Missense_Mutation C C T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000361284 p.S106L RABGAP1L chr1 174701113 174701113 Intron C C G TCGA-5U-AB0D-01A-11D-A423-09 ENST00000251507 ADAM17 chr2 9521295 9521295 Missense_Mutation G G C TCGA-5U-AB0D-01A-11D-A423-09 ENST00000310823 p.Q289E GMCL1 chr2 69839503 69839503 Missense_Mutation G G T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000282570 p.S144I ANO7 chr2 241210474 241210474 Missense_Mutation C C T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000274979 p.R543C SCAP chr3 47413951 47413951 Missense_Mutation C C T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000265565 p.R1248H IGF2BP2 chr3 185825019 185825019 5'UTR C C G TCGA-5U-AB0D-01A-11D-A423-09 ENST00000382199 MUC4 chr3 195782077 195782077 Missense_Mutation G G A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000463781 p.P3168L MUC4 chr3 195782119 195782119 Missense_Mutation G G T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000463781 p.P3154H EVC2 chr4 5640792 5640792 Missense_Mutation A A G TCGA-5U-AB0D-01A-11D-A423-09 ENST00000344408 p.C398R SORCS2 chr4 7531593 7531593 Silent C C T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000507866 p.I204I GNPDA2 chr4 44717278 44717278 Missense_Mutation G G T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000295448 p.P82T C4orf45 chr4 159035062 159035062 Missense_Mutation G G T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000434826 p.T12N PDE4D chr5 58973679 58973679 3'UTR C C T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000340635 RIOK2 chr5 97167748 97167748 Missense_Mutation G G T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000283109 p.D372E PCDHA10 chr5 140858030 140858030 Missense_Mutation C C T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000307360 p.T661M PCDHB7 chr5 141172766 141172766 5'UTR C C T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000231137 PCDHGA5 chr5 141365039 141365039 Missense_Mutation G G A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000518069 p.D237N SOX4 chr6 21595742 21595743 Frame_Shift_Ins - CGAC CGAC TCGA-5U-AB0D-01A-11D-A423-09 ENST00000244745 p.L405Rfs*12 SLC17A4 chr6 25776619 25776619 Missense_Mutation T T C TCGA-5U-AB0D-01A-11D-A423-09 ENST00000377905 p.F338L HIST1H3J chr6 27890654 27890654 Missense_Mutation C C T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000359303 p.V47M ADGRG6 chr6 142419834 142419834 Missense_Mutation G G A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000230173 p.D1017N PHF10 chr6 169721004 169721004 Splice_Site C C - TCGA-5U-AB0D-01A-11D-A423-09 ENST00000339209 p.X65_splice ZNF479 chr7 57126618 57126618 Missense_Mutation T T A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000319636 p.E47V ZNF716 chr7 57468890 57468890 Silent T T C TCGA-5U-AB0D-01A-11D-A423-09 ENST00000420713 p.N143N ZNF727 chr7 64078275 64078275 Missense_Mutation C C T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000456806 p.S409L SLC26A4 chr7 107717487 107717487 3'UTR C C T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000265715 SQLE chr8 124999651 124999651 Frame_Shift_Del C C - TCGA-5U-AB0D-01A-11D-A423-09 ENST00000265896 p.P85Lfs*25 TOP1MT chr8 143331321 143331321 Silent G G A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000329245 p.H47H PRUNE2 chr9 76710483 76710483 Silent G G A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000376718 p.S597S XXyac-YM21GA2.4 chr9 87859315 87859315 5'Flank C C T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000447524 ZNF189 chr9 101408171 101408171 Missense_Mutation A A G TCGA-5U-AB0D-01A-11D-A423-09 ENST00000339664 p.N135D TMEM38B chr9 105721564 105721564 Missense_Mutation C C A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000374692 p.D99E PTGES chr9 129739848 129739848 Silent G G A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000340607 p.N74N TAF3 chr10 7977259 7977259 Missense_Mutation G G A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000344293 p.A751T PCGF5 chr10 91280556 91280556 3'UTR C C T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000336126 SEC31B chr10 100487616 100487616 Silent T T C TCGA-5U-AB0D-01A-11D-A423-09 ENST00000370345 p.*1180* CALY chr10 133329011 133329011 Splice_Site T T A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000252939 TRIM6 chr11 5603519 5603519 Silent G G A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000278302 p.R69R TSPAN18 chr11 44909870 44909870 Missense_Mutation G G A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000340160 p.V77I ACP2 chr11 47244838 47244838 Nonsense_Mutation C C T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000256997 p.W223* DAGLA chr11 61744950 61744950 3'UTR G G A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000257215 PC chr11 66852592 66852592 Missense_Mutation G G A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000393955 p.R558W SYTL2 chr11 85707499 85707499 Missense_Mutation C C T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000528231 p.G678D LRCOL1 chr12 132604751 132604751 Silent G G C TCGA-5U-AB0D-01A-11D-A423-09 ENST00000376608 p.L62L UBR1 chr15 42988946 42988946 Silent G G T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000290650 p.I1290I GOLGA6L17P chr15 82523985 82523985 RNA T T C TCGA-5U-AB0D-01A-11D-A423-09 ENST00000614358 POLR3K chr16 47504 47504 Missense_Mutation G G A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000293860 p.R85C FBXL16 chr16 693739 693739 3'UTR A A G TCGA-5U-AB0D-01A-11D-A423-09 ENST00000324361 RPS2 chr16 1962129 1962129 Missense_Mutation C C T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000343262 p.R284Q ITGAL chr16 30519916 30519916 Missense_Mutation C C A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000356798 p.S1096R NF1 chr17 31358571 31358571 Missense_Mutation G G A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000358273 p.V2688M ASIC2 chr17 33291926 33291926 Intron C C T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000359872 FZD2 chr17 44559167 44559167 Silent G G A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000315323 p.S493S SCRN2 chr17 47840850 47840868 Splice_Region AGAGGCGGGCCTCTCCATA AGAGGCGGGCCTCTCCATA - TCGA-5U-AB0D-01A-11D-A423-09 ENST00000290216 KIAA0195 chr17 75489649 75489649 Missense_Mutation T T C TCGA-5U-AB0D-01A-11D-A423-09 ENST00000314256 p.L314P UNC13D chr17 75842455 75842455 Missense_Mutation C C T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000207549 p.V183I EVPL chr17 76007080 76007080 3'UTR C C - TCGA-5U-AB0D-01A-11D-A423-09 ENST00000301607 ANKRD30B chr18 14791488 14791488 Missense_Mutation G G A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000358984 p.E608K KIAA1328 chr18 37067373 37067373 Missense_Mutation C C A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000280020 p.P354T CDH19 chr18 66505004 66505004 Missense_Mutation A A T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000262150 p.D709E FBXO15 chr18 74073663 74073663 Missense_Mutation G G A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000419743 p.P444L CTB-133G6.1 chr19 7375862 7375862 Missense_Mutation C C T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000576789 p.P140S PLA2G4C chr19 48090372 48090372 Missense_Mutation T T C TCGA-5U-AB0D-01A-11D-A423-09 ENST00000599921 p.Y252C KCNA7 chr19 49070132 49070132 Silent G G A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000221444 p.D434D ZNF432 chr19 52034554 52034554 Silent G G A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000221315 p.C375C RBCK1 chr20 410537 410537 Intron C C T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000356286 CDC25B chr20 3802948 3802948 Silent C C T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000245960 p.D411D CD93 chr20 23080166 23080166 3'UTR G G A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000246006 AGPAT3 chr21 43984564 43984564 3'UTR G G C TCGA-5U-AB0D-01A-11D-A423-09 ENST00000291572 FAM230A chr22 20354407 20354407 3'Flank C C T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000610338 FAM47A chrX 34131429 34131429 Missense_Mutation C C T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000346193 p.E284K HYPM chrX 37991309 37991309 3'UTR C C T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000341016 PQBP1 chrX 48902969 48902969 Missense_Mutation A A T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000218224 p.K228M SHROOM4 chrX 50595117 50595117 Intron G G A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000289292 ALAS2 chrX 55015598 55015598 Missense_Mutation T T A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000330807 p.D383V OGT chrX 71568035 71568035 Missense_Mutation G G A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000373719 p.C962Y FRMPD3 chrX 107564900 107564900 Missense_Mutation C C T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000276185 p.S410L HTATSF1 chrX 136511560 136511560 Missense_Mutation C C A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000218364 p.D605E MECP2 chrX 154032246 154032246 Missense_Mutation G G A TCGA-5U-AB0D-01A-11D-A423-09 ENST00000303391 p.S113F VBP1 chrX 155220288 155220288 Missense_Mutation C C T TCGA-5U-AB0D-01A-11D-A423-09 ENST00000286428 p.L67F PLEKHN1 chr1 972388 972388 Silent G G A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000379409 p.P374P PRDM16 chr1 3433691 3433691 Missense_Mutation G G T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000270722 p.M1237I C1orf127 chr1 10948259 10948259 Missense_Mutation G G A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000377004 p.R626C PRAMEF2 chr1 12859185 12859185 Frame_Shift_Del G G - TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000240189 p.W59Cfs*11 PAX7 chr1 18744870 18744870 Missense_Mutation C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000420770 p.L487F SFPQ chr1 35191399 35191399 Missense_Mutation T T C TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000357214 p.Y320C AGO1 chr1 35923576 35923576 3'UTR C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000373204 VAV3 chr1 107669393 107669393 Intron C C G TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000370056 FAM72C chr1 143964920 143964920 Missense_Mutation T T C TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000584486 p.N97S ECM1 chr1 150511634 150511634 Missense_Mutation G G C TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000369047 p.E296Q USH2A chr1 215743270 215743270 Silent G G A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000307340 p.L3819L HIST3H2A chr1 228457783 228457783 Missense_Mutation C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000366695 p.R12H SIPA1L2 chr1 232465049 232465049 Missense_Mutation C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000262861 p.E871K AL078621.1 chr2 113596691 113596692 3'Flank - - CAGCACCAC TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000613451 UBXN4 chr2 135784871 135784871 3'UTR A A - TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000272638 SP3 chr2 173955569 173955569 Missense_Mutation G G A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000310015 p.R315W CHL1 chr3 398386 398386 Splice_Site G G C TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000397491 p.X1069_splice LRRC3B chr3 26710658 26710658 3'UTR G G A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000396641 CLASP2 chr3 33535340 33535340 Missense_Mutation C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000480013 p.R1014H DNAH1 chr3 52399554 52399554 Missense_Mutation G G C TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000420323 p.E4151Q ABI3BP chr3 100850696 100850696 Missense_Mutation T T G TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000284322 p.T422P MED28 chr4 17614683 17614683 Missense_Mutation C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000237380 p.S10F TXK chr4 48112434 48112434 Missense_Mutation T T A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000264316 p.I85F PDCL2 chr4 55562473 55562473 Nonsense_Mutation T T A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000295645 p.K168* BANK1 chr4 101829956 101829956 Silent G G A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000322953 p.L73L IRF1 chr5 132486815 132486816 Frame_Shift_Ins - - A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000245414 p.K132* PCDHB7 chr5 141175049 141175049 Silent C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000231137 p.S738S MCUR1 chr6 13806962 13806962 Missense_Mutation G G T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000379170 p.F166L HIST1H2BB chr6 26043614 26043614 Missense_Mutation G G A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000615966 p.S15F SKIV2L chr6 31959092 31959092 5'UTR C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000375394 SGK1 chr6 134170338 134170338 Missense_Mutation G G A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000237305 p.A409V TNFAIP3 chr6 137871246 137871249 Frame_Shift_Del CCTC CCTC - TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000237289 p.P7Rfs*5 MLLT4 chr6 167918873 167918873 Missense_Mutation G G A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000447894 p.D943N ACTB chr7 5530563 5530563 5'UTR G G A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000331789 USP42 chr7 6149660 6149660 Silent C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000306177 p.S488S TOMM7 chr7 22813066 22813066 3'UTR T T C TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000358435 LSMEM1 chr7 112487051 112487051 Missense_Mutation G G T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000312849 p.V86F CHRM2 chr7 137015159 137015159 Silent T T C TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000320658 p.L98L REXO1L1P chr8 85661094 85661094 RNA G G A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000379010 ERICH5 chr8 98089192 98089192 Missense_Mutation C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000318528 p.R59C SLC45A4 chr8 141212282 141212282 Missense_Mutation C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000517878 p.R739K ARC chr8 142611203 142611203 3'UTR C C A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000356613 PTPRD chr9 8528717 8528717 Missense_Mutation G G A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000356435 p.R139C OSTF1 chr9 75146773 75146773 3'UTR C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000346234 DAPK1 chr9 87605043 87605043 Missense_Mutation C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000358077 p.S51F GAPVD1 chr9 125321454 125321454 Missense_Mutation G G A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000394104 p.D542N CUBN chr10 16915099 16915099 Silent G G A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000377833 p.V2428V ZNF25 chr10 37952660 37952660 Missense_Mutation G G A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000302609 p.H280Y DCLRE1A chr10 113835280 113835280 Missense_Mutation C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000361384 p.E999K CYB5R2 chr11 7669088 7669088 Intron G G A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000299498 PLCB3 chr11 64263742 64263742 Missense_Mutation C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000279230 p.P836L CCDC87 chr11 66591444 66591444 Silent C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000333861 p.S524S RNF169 chr11 74836327 74836327 Missense_Mutation C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000299563 p.S575L MMP13 chr11 102948009 102948009 Missense_Mutation C C A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000260302 p.G365C SLC2A14 chr12 7829905 7829905 Missense_Mutation C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000396589 p.R148H C12orf10 chr12 53306998 53306998 Missense_Mutation G G A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000267103 p.R327Q USP30 chr12 109071643 109071643 Missense_Mutation C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000257548 p.S171L HECTD4 chr12 112266957 112266957 Missense_Mutation C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000550722 p.G639S CLIP1 chr12 122279037 122279037 Silent C C G TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000540338 p.L1252L STARD13 chr13 33110880 33110880 Missense_Mutation G G C TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000336934 p.R879G NAA16 chr13 41311567 41311567 Silent C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000379406 p.L13L GPR180 chr13 94619251 94619251 Frame_Shift_Del C C - TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000376958 p.H203Tfs*2 COL4A1 chr13 110178094 110178094 Missense_Mutation G G T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000375820 p.Q866K MYH7 chr14 23433616 23433616 Silent C C A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000355349 p.V39V POLE2 chr14 49654046 49654046 Silent G G A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000216367 p.I385I SYNE2 chr14 64212834 64212834 Frame_Shift_Del A A - TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000344113 p.N6296Ifs*15 KLC1 chr14 103669590 103669590 Missense_Mutation C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000348520 p.H293Y HERC2P3 chr15 20439108 20439108 RNA C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000426501 GOLGA6L17P chr15 82523984 82523984 RNA G G A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000614358 SEC14L5 chr16 5007390 5007390 Silent C C G TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000251170 p.L492L NOMO1 chr16 14895585 14895585 Silent C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000287667 p.D1203D DNAH3 chr16 21125228 21125228 Missense_Mutation C C G TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000261383 p.E451Q GTF3C1 chr16 27545430 27545430 Missense_Mutation C C G TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000356183 p.E105D CYLD chr16 50786923 50786923 Missense_Mutation C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000311559 p.S673L AP1G1 chr16 71731776 71731776 3'UTR G G A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000299980 PLCG2 chr16 81931537 81931537 Silent C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000564138 p.F874F OSGIN1 chr16 83951187 83951187 Missense_Mutation G G T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000343939 p.Q39H MYH1 chr17 10508495 10508495 Missense_Mutation C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000226207 p.V589M MYO15A chr17 18133368 18133368 Silent C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000205890 p.V1488V CYB561 chr17 63434580 63434580 Missense_Mutation G G A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000360793 p.A193V RNF213 chr17 80344773 80344773 Silent G G C TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000582970 p.L2146L FZR1 chr19 3532526 3532526 Missense_Mutation C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000395095 p.S373L PIAS4 chr19 4028762 4028762 Missense_Mutation C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000262971 p.P239S FBN3 chr19 8126348 8126348 Splice_Site C C G TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000270509 p.X852_splice WDR62 chr19 36067435 36067435 Missense_Mutation G G A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000270301 p.E231K ZNF420 chr19 37128363 37128363 Missense_Mutation C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000337995 p.R458C NLRP12 chr19 53811258 53811258 Missense_Mutation C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000324134 p.R134H BMP2 chr20 6778338 6778338 Missense_Mutation C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000378827 p.S147L B4GALT5 chr20 49634378 49634378 3'UTR A A - TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000371711 ZNF217 chr20 53567845 53567845 3'UTR T T - TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000302342 TEX33 chr22 37001876 37001876 Missense_Mutation A A T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000381821 p.F150L CACNA1I chr22 39679825 39679825 Missense_Mutation C C T TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000402142 p.S1833F XIST chrX 73851281 73851281 RNA T T A TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000429829 NKAP chrX 119943251 119943251 Missense_Mutation C C G TCGA-ZC-AAA7-01A-11D-A428-09 ENST00000371410 p.D119H LRRC7 chr1 70023163 70023163 Missense_Mutation G G A TCGA-ZB-A965-01A-11D-A428-09 ENST00000035383 p.R490H ADAM30 chr1 119894416 119894416 Missense_Mutation G G A TCGA-ZB-A965-01A-11D-A428-09 ENST00000369400 p.R641W FCGR3A chr1 161542973 161542973 3'UTR G G C TCGA-ZB-A965-01A-11D-A428-09 ENST00000367967 RGL1 chr1 183926989 183926989 3'UTR C C T TCGA-ZB-A965-01A-11D-A428-09 ENST00000360851 DESI2 chr1 244705940 244705940 3'UTR A A - TCGA-ZB-A965-01A-11D-A428-09 ENST00000302550 FAR2P4 chr2 131288924 131288924 RNA G G A TCGA-ZB-A965-01A-11D-A428-09 ENST00000416266 BRPF1 chr3 9744318 9744318 Silent G G T TCGA-ZB-A965-01A-11D-A428-09 ENST00000457855 p.P904P CTNNB1 chr3 41239226 41239226 Missense_Mutation C C T TCGA-ZB-A965-01A-11D-A428-09 ENST00000349496 p.P744S PHOX2B chr4 41745847 41745847 Missense_Mutation T T C TCGA-ZB-A965-01A-11D-A428-09 ENST00000226382 p.N302S METTL14 chr4 118705695 118705695 Missense_Mutation A A G TCGA-ZB-A965-01A-11D-A428-09 ENST00000388822 p.I314V KLHL2 chr4 165322885 165322889 3'UTR TTAAA TTAAA - TCGA-ZB-A965-01A-11D-A428-09 ENST00000226725 FAT2 chr5 151566031 151566031 Silent G G A TCGA-ZB-A965-01A-11D-A428-09 ENST00000261800 p.G967G FOXC1 chr6 1612977 1612981 3'UTR TTTTG TTTTG - TCGA-ZB-A965-01A-11D-A428-09 ENST00000380874 PTPRK chr6 128000079 128000080 Intron - - A TCGA-ZB-A965-01A-11D-A428-09 ENST00000368215 HECA chr6 139177218 139177218 3'UTR A A G TCGA-ZB-A965-01A-11D-A428-09 ENST00000367658 SYNE1 chr6 152413488 152413488 Missense_Mutation C C G TCGA-ZB-A965-01A-11D-A428-09 ENST00000367255 p.E2032Q GET4 chr7 895395 895397 In_Frame_Del CGA CGA - TCGA-ZB-A965-01A-11D-A428-09 ENST00000265857 p.D320del AGR2 chr7 16792671 16792672 3'UTR - - T TCGA-ZB-A965-01A-11D-A428-09 ENST00000419304 GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-ZB-A965-01A-11D-A428-09 ENST00000573035 p.L424H BRAF chr7 140783127 140783127 Frame_Shift_Del G G - TCGA-ZB-A965-01A-11D-A428-09 ENST00000288602 p.P403Lfs*8 RB1CC1 chr8 52623205 52623205 3'UTR T T - TCGA-ZB-A965-01A-11D-A428-09 ENST00000025008 PLIN2 chr9 19120932 19120932 Silent G G T TCGA-ZB-A965-01A-11D-A428-09 ENST00000276914 p.T181T RHOBTB1 chr10 60888926 60888932 Frame_Shift_Del ACTCTGG ACTCTGG - TCGA-ZB-A965-01A-11D-A428-09 ENST00000337910 p.P246Vfs*50 FAM53B chr10 124618760 124618760 3'Flank C C T TCGA-ZB-A965-01A-11D-A428-09 ENST00000337318 HRAS chr11 534285 534285 Missense_Mutation C C A TCGA-ZB-A965-01A-11D-A428-09 ENST00000311189 p.G13V MRGPRX4 chr11 18173540 18173540 Missense_Mutation G G A TCGA-ZB-A965-01A-11D-A428-09 ENST00000314254 p.R95H DYNC2H1 chr11 103148531 103148531 Nonsense_Mutation G G T TCGA-ZB-A965-01A-11D-A428-09 ENST00000375735 p.E954* CD3E chr11 118313813 118313813 Missense_Mutation G G T TCGA-ZB-A965-01A-11D-A428-09 ENST00000361763 p.K153N PPP1CC chr12 110742937 110742937 5'Flank G G A TCGA-ZB-A965-01A-11D-A428-09 ENST00000335007 NFATC4 chr14 24370258 24370258 Missense_Mutation G G A TCGA-ZB-A965-01A-11D-A428-09 ENST00000250373 p.R287H ADAM21P1 chr14 70245933 70245933 RNA A A C TCGA-ZB-A965-01A-11D-A428-09 ENST00000530196 C16orf52 chr16 22083632 22083632 3'UTR G G T TCGA-ZB-A965-01A-11D-A428-09 ENST00000542527 CYB5B chr16 69466079 69466079 3'UTR T T - TCGA-ZB-A965-01A-11D-A428-09 ENST00000512062 ARHGAP23 chr17 38466725 38466725 Nonsense_Mutation C C T TCGA-ZB-A965-01A-11D-A428-09 ENST00000622683 p.R348* SCN4A chr17 63966230 63966230 Missense_Mutation C C T TCGA-ZB-A965-01A-11D-A428-09 ENST00000435607 p.G372S MUC16 chr19 8953071 8953071 Nonsense_Mutation G G C TCGA-ZB-A965-01A-11D-A428-09 ENST00000397910 p.S7900* MIR1270 chr19 20398055 20398055 3'Flank G G A TCGA-ZB-A965-01A-11D-A428-09 ENST00000459320 SEPW1 chr19 47778747 47778747 5'UTR C C T TCGA-ZB-A965-01A-11D-A428-09 ENST00000593892 MAFB chr20 40686950 40686950 3'UTR T T - TCGA-ZB-A965-01A-11D-A428-09 ENST00000373313 CDH22 chr20 46241162 46241162 Silent G G A TCGA-ZB-A965-01A-11D-A428-09 ENST00000372262 p.G117G LZTR1 chr22 20983085 20983085 Missense_Mutation A A G TCGA-ZB-A965-01A-11D-A428-09 ENST00000215739 p.N87D TCF20 chr22 42212135 42212135 Missense_Mutation T T G TCGA-ZB-A965-01A-11D-A428-09 ENST00000359486 p.E1057D NR0B1 chrX 30308351 30308351 Missense_Mutation G G A TCGA-ZB-A965-01A-11D-A428-09 ENST00000378970 p.T338M AMER1 chrX 64191923 64191923 Missense_Mutation G G T TCGA-ZB-A965-01A-11D-A428-09 ENST00000330258 p.T455N EPAS1 chr2 46384768 46384768 3'UTR A A G TCGA-3G-AB14-01A-11D-A423-09 ENST00000263734 SCN2A chr2 165390713 165390713 3'UTR T T - TCGA-3G-AB14-01A-11D-A423-09 ENST00000283256 WHSC1 chr4 1944230 1944230 Intron C C T TCGA-3G-AB14-01A-11D-A423-09 ENST00000382891 FRAS1 chr4 78267382 78267382 Missense_Mutation G G C TCGA-3G-AB14-01A-11D-A423-09 ENST00000325942 p.G311R SEPT7 chr7 35904427 35904427 3'UTR T T - TCGA-3G-AB14-01A-11D-A423-09 ENST00000350320 SDHAF3 chr7 97117729 97117729 Silent G G A TCGA-3G-AB14-01A-11D-A423-09 ENST00000432641 p.P2P NPTX2 chr7 98629441 98629441 3'UTR T T - TCGA-3G-AB14-01A-11D-A423-09 ENST00000265634 PLAG1 chr8 56163406 56163406 3'UTR T T C TCGA-3G-AB14-01A-11D-A423-09 ENST00000316981 STAU2 chr8 73421407 73421407 Missense_Mutation C C T TCGA-3G-AB14-01A-11D-A423-09 ENST00000524300 p.A560T ANK3 chr10 60172930 60172930 Silent C C T TCGA-3G-AB14-01A-11D-A423-09 ENST00000280772 p.Q784Q KIAA1598 chr10 116885355 116885356 3'UTR - - T TCGA-3G-AB14-01A-11D-A423-09 ENST00000355371 HNRNPKP3 chr11 43261749 43261749 RNA A A G TCGA-3G-AB14-01A-11D-A423-09 ENST00000511537 ALG9 chr11 111837510 111837510 Missense_Mutation T T C TCGA-3G-AB14-01A-11D-A423-09 ENST00000614444 p.K470R XPO4 chr13 20800298 20800298 Missense_Mutation C C T TCGA-3G-AB14-01A-11D-A423-09 ENST00000255305 p.G669R POTEM chr14 18977190 18977190 Intron C C T TCGA-3G-AB14-01A-11D-A423-09 ENST00000547889 TIMM9 chr14 58427161 58427161 5'UTR A A T TCGA-3G-AB14-01A-11D-A423-09 ENST00000395159 PPP4R4 chr14 94275380 94275380 Missense_Mutation C C T TCGA-3G-AB14-01A-11D-A423-09 ENST00000304338 p.S819L RBBP6 chr16 24570169 24570175 Frame_Shift_Del TTGAGTC TTGAGTC - TCGA-3G-AB14-01A-11D-A423-09 ENST00000319715 p.E1161Lfs*3 TP53 chr17 7674220 7674220 Missense_Mutation C C A TCGA-3G-AB14-01A-11D-A423-09 ENST00000269305 p.R248L ZMYM3 chrX 71248292 71248292 Nonsense_Mutation G G T TCGA-3G-AB14-01A-11D-A423-09 ENST00000314425 p.C615* NAP1L3 chrX 93673357 93673357 5'UTR A A - TCGA-3G-AB14-01A-11D-A423-09 ENST00000373079 ZNF638 chr2 71368500 71368500 Missense_Mutation A A G TCGA-5K-AAAP-01A-11D-A423-09 ENST00000264447 p.D705G MARCH7 chr2 159759301 159759301 Missense_Mutation T T G TCGA-5K-AAAP-01A-11D-A423-09 ENST00000259050 p.I620S ATG9A chr2 219226889 219226889 Silent G G T TCGA-5K-AAAP-01A-11D-A423-09 ENST00000361242 p.I64I PARP15 chr3 122632178 122632178 Missense_Mutation G G T TCGA-5K-AAAP-01A-11D-A423-09 ENST00000464300 p.D511Y MMRN1 chr4 89934860 89934860 Nonsense_Mutation C C T TCGA-5K-AAAP-01A-11D-A423-09 ENST00000264790 p.Q394* FOXF2 chr6 1395203 1395204 3'UTR TG TG - TCGA-5K-AAAP-01A-11D-A423-09 ENST00000259806 WBSCR17 chr7 71415962 71415962 Missense_Mutation G G T TCGA-5K-AAAP-01A-11D-A423-09 ENST00000333538 p.Q221H GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-5K-AAAP-01A-11D-A423-09 ENST00000573035 p.L424H TRBC2 chr7 142801066 142801066 Silent C C T TCGA-5K-AAAP-01A-11D-A423-09 ENST00000610566 p.P145P HAS2 chr8 121613251 121613251 3'UTR T T - TCGA-5K-AAAP-01A-11D-A423-09 ENST00000303924 ZNF7 chr8 144838054 144838054 Intron G G A TCGA-5K-AAAP-01A-11D-A423-09 ENST00000528372 PCSK5 chr9 76338286 76338286 Missense_Mutation G G T TCGA-5K-AAAP-01A-11D-A423-09 ENST00000545128 p.G1575V RSU1 chr10 16817407 16817407 5'UTR G G - TCGA-5K-AAAP-01A-11D-A423-09 ENST00000345264 ALOX5 chr10 45444231 45444231 Missense_Mutation G G A TCGA-5K-AAAP-01A-11D-A423-09 ENST00000374391 p.R597H ABTB2 chr11 34356916 34356916 Missense_Mutation A A G TCGA-5K-AAAP-01A-11D-A423-09 ENST00000435224 p.I223T SYT7 chr11 61524458 61524458 Missense_Mutation C C T TCGA-5K-AAAP-01A-11D-A423-09 ENST00000263846 p.D233N OR6C65 chr12 55400766 55400766 Silent C C T TCGA-5K-AAAP-01A-11D-A423-09 ENST00000379665 p.L80L NBEA chr13 35164506 35164506 Silent A A C TCGA-5K-AAAP-01A-11D-A423-09 ENST00000400445 p.P1410P CYSLTR2 chr13 48707251 48707251 Missense_Mutation G G A TCGA-5K-AAAP-01A-11D-A423-09 ENST00000282018 p.R145Q MGAT2 chr14 49623271 49623271 3'UTR T T - TCGA-5K-AAAP-01A-11D-A423-09 ENST00000305386 SLC39A9 chr14 69461640 69461640 3'Flank T T - TCGA-5K-AAAP-01A-11D-A423-09 ENST00000336643 IGHV3-72 chr14 106790845 106790845 Missense_Mutation C C T TCGA-5K-AAAP-01A-11D-A423-09 ENST00000433072 p.R69H GOLGA6L9 chr15 82436429 82436430 3'UTR - - A TCGA-5K-AAAP-01A-11D-A423-09 ENST00000618348 CLEC4G chr19 7729154 7729154 3'UTR G G A TCGA-5K-AAAP-01A-11D-A423-09 ENST00000328853 PPFIA3 chr19 49138281 49138282 Frame_Shift_Ins - - A TCGA-5K-AAAP-01A-11D-A423-09 ENST00000334186 p.D644Efs*40 JAG1 chr20 10645179 10645179 Missense_Mutation A A C TCGA-5K-AAAP-01A-11D-A423-09 ENST00000254958 p.C731G PUM1 chr1 30932849 30932849 3'UTR T T - TCGA-XM-A8RE-01A-11D-A423-09 ENST00000257075 ELOVL6 chr4 110049888 110049888 3'UTR T T - TCGA-XM-A8RE-01A-11D-A423-09 ENST00000302274 ATP10B chr5 160644148 160644148 Silent G G A TCGA-XM-A8RE-01A-11D-A423-09 ENST00000327245 p.V286V FAM175B chr10 124835590 124835591 3'UTR - - A TCGA-XM-A8RE-01A-11D-A423-09 ENST00000298492 LINC01001 chr11 127380 127381 RNA - - GAGGCC TCGA-XM-A8RE-01A-11D-A423-09 ENST00000526704 LINC01001 chr11 127612 127612 RNA G G T TCGA-XM-A8RE-01A-11D-A423-09 ENST00000526704 GOLGA6L17P chr15 82524070 82524090 RNA GTGAACAGGAGGAGAGGCTGT GTGAACAGGAGGAGAGGCTGT - TCGA-XM-A8RE-01A-11D-A423-09 ENST00000614358 HNRNPH1 chr5 179614348 179614348 3'UTR A A - TCGA-X7-A8DI-01A-11D-A423-09 ENST00000356731 NPIPB6 chr16 28362874 28362875 5'UTR - - AA TCGA-X7-A8DI-01A-11D-A423-09 ENST00000532254 CDH20 chr18 61539090 61539090 Missense_Mutation C C A TCGA-X7-A8DI-01A-11D-A423-09 ENST00000262717 p.P492Q PARM1 chr4 75048945 75048946 3'UTR AC AC - TCGA-XM-A8RH-01A-11D-A423-09 ENST00000307428 UBL3 chr13 29765621 29765621 3'UTR T T - TCGA-XM-A8RH-01A-11D-A423-09 ENST00000380680 DLGAP4 chr20 36528137 36528137 3'UTR T T - TCGA-XM-A8RH-01A-11D-A423-09 ENST00000339266 ATXN7L2 chr1 109488868 109488868 Missense_Mutation C C T TCGA-YT-A95F-01A-11D-A428-09 ENST00000369870 p.R269W NES chr1 156671021 156671021 Missense_Mutation G G A TCGA-YT-A95F-01A-11D-A428-09 ENST00000368223 p.P1056L RGL1 chr1 183927816 183927817 3'UTR - - T TCGA-YT-A95F-01A-11D-A428-09 ENST00000360851 SATB2 chr2 199271472 199271472 3'UTR T T - TCGA-YT-A95F-01A-11D-A428-09 ENST00000260926 CGGBP1 chr3 88055323 88055323 3'UTR T T - TCGA-YT-A95F-01A-11D-A428-09 ENST00000309534 LEF1 chr4 108047598 108047598 3'UTR C C G TCGA-YT-A95F-01A-11D-A428-09 ENST00000265165 SLC30A5 chr5 69104133 69104133 Intron T T - TCGA-YT-A95F-01A-11D-A428-09 ENST00000396591 FNIP1 chr5 131670546 131670546 Missense_Mutation C C T TCGA-YT-A95F-01A-11D-A428-09 ENST00000510461 p.V1009M CLK4 chr5 178627012 178627012 5'UTR G G C TCGA-YT-A95F-01A-11D-A428-09 ENST00000316308 FYN chr6 111674602 111674602 Silent G G T TCGA-YT-A95F-01A-11D-A428-09 ENST00000354650 p.A434A HEBP2 chr6 138405170 138405170 Missense_Mutation A A G TCGA-YT-A95F-01A-11D-A428-09 ENST00000607197 p.Y43C GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-YT-A95F-01A-11D-A428-09 ENST00000573035 p.L424H LAMB1 chr7 107951271 107951271 Missense_Mutation C C T TCGA-YT-A95F-01A-11D-A428-09 ENST00000222399 p.E1116K SVEP1 chr9 110496932 110496932 Splice_Region G G A TCGA-YT-A95F-01A-11D-A428-09 ENST00000374469 p.D561D SOHLH1 chr9 135694391 135694391 Nonsense_Mutation C C T TCGA-YT-A95F-01A-11D-A428-09 ENST00000298466 p.W314* ENKUR chr10 25015873 25015873 Missense_Mutation G G A TCGA-YT-A95F-01A-11D-A428-09 ENST00000331161 p.P22S RGR chr10 84247725 84247725 Missense_Mutation G G C TCGA-YT-A95F-01A-11D-A428-09 ENST00000359452 p.A72P OPALIN chr10 96346065 96346065 Missense_Mutation G G T TCGA-YT-A95F-01A-11D-A428-09 ENST00000371172 p.A101D KDM5A chr12 285280 285280 3'UTR T T C TCGA-YT-A95F-01A-11D-A428-09 ENST00000399788 SCYL2 chr12 100298100 100298100 Silent T T C TCGA-YT-A95F-01A-11D-A428-09 ENST00000360820 p.N135N STRN3 chr14 31014652 31014652 Intron G G T TCGA-YT-A95F-01A-11D-A428-09 ENST00000357479 UBR1 chr15 42945266 42945266 3'UTR A A G TCGA-YT-A95F-01A-11D-A428-09 ENST00000290650 DNM1P47 chr15 101759790 101759790 RNA G G C TCGA-YT-A95F-01A-11D-A428-09 ENST00000561463 NDE1 chr16 15643308 15643308 5'UTR C C T TCGA-YT-A95F-01A-11D-A428-09 ENST00000396355 PRKCB chr16 24219899 24219899 Intron G G A TCGA-YT-A95F-01A-11D-A428-09 ENST00000321728 RAI1 chr17 17803830 17803830 Nonsense_Mutation C C A TCGA-YT-A95F-01A-11D-A428-09 ENST00000353383 p.Y1880* IQSEC2 chrX 53243354 53243354 Missense_Mutation C C T TCGA-YT-A95F-01A-11D-A428-09 ENST00000396435 p.R956H TBC1D8B chrX 106820879 106820879 Missense_Mutation G G A TCGA-YT-A95F-01A-11D-A428-09 ENST00000357242 p.A82T RHD chr1 25329037 25329037 3'UTR C C T TCGA-ZB-A969-01A-11D-A428-09 ENST00000328664 PDE4B chr1 65918784 65918785 Frame_Shift_Ins - - AA TCGA-ZB-A969-01A-11D-A428-09 ENST00000329654 p.P78Sfs*3 PDE4B chr1 65918785 65918785 Silent G G A TCGA-ZB-A969-01A-11D-A428-09 ENST00000329654 p.L77L COL11A1 chr1 102877779 102877779 3'UTR T T C TCGA-ZB-A969-01A-11D-A428-09 ENST00000370096 FAM46C chr1 117623944 117623944 Missense_Mutation C C T TCGA-ZB-A969-01A-11D-A428-09 ENST00000369448 p.P359L ADIPOR1 chr1 202940981 202940982 3'UTR - - A TCGA-ZB-A969-01A-11D-A428-09 ENST00000340990 LBX2 chr2 74499416 74499416 Missense_Mutation G G C TCGA-ZB-A969-01A-11D-A428-09 ENST00000377566 p.P41R NR4A2 chr2 156328463 156328463 Missense_Mutation C C T TCGA-ZB-A969-01A-11D-A428-09 ENST00000339562 p.R312Q CNTN4 chr3 3034722 3034722 Missense_Mutation G G T TCGA-ZB-A969-01A-11D-A428-09 ENST00000397461 p.S625I ITIH4 chr3 52824559 52824559 Nonsense_Mutation C C A TCGA-ZB-A969-01A-11D-A428-09 ENST00000266041 p.E295* DTX3L chr3 122569937 122569944 Frame_Shift_Del TTTCACTG TTTCACTG - TCGA-ZB-A969-01A-11D-A428-09 ENST00000296161 p.T618Kfs*8 SLC7A14 chr3 170467228 170467228 Missense_Mutation C C T TCGA-ZB-A969-01A-11D-A428-09 ENST00000231706 p.E715K WHSC1 chr4 1978831 1978832 Frame_Shift_Ins - - C TCGA-ZB-A969-01A-11D-A428-09 ENST00000382891 p.E1344Rfs*91 RP11-364P22.2 chr4 157638014 157638014 RNA C C T TCGA-ZB-A969-01A-11D-A428-09 ENST00000507296 DNAH5 chr5 13916451 13916451 Missense_Mutation G G A TCGA-ZB-A969-01A-11D-A428-09 ENST00000265104 p.S365F DACT2 chr6 168307905 168307905 Missense_Mutation G G C TCGA-ZB-A969-01A-11D-A428-09 ENST00000366795 p.R618G ELFN1 chr7 1746235 1746235 Missense_Mutation G G T TCGA-ZB-A969-01A-11D-A428-09 ENST00000424383 p.D547Y DPY19L1 chr7 34939335 34939335 Silent A A G TCGA-ZB-A969-01A-11D-A428-09 ENST00000310974 p.V562V GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-ZB-A969-01A-11D-A428-09 ENST00000573035 p.L424H FAM122A chr9 68781747 68781747 3'UTR T T - TCGA-ZB-A969-01A-11D-A428-09 ENST00000394264 MAMDC4 chr9 136853707 136853707 Intron C C T TCGA-ZB-A969-01A-11D-A428-09 ENST00000317446 OR4C16 chr11 55572219 55572219 Missense_Mutation G G A TCGA-ZB-A969-01A-11D-A428-09 ENST00000314634 p.R31H MAP4K2 chr11 64796340 64796340 Missense_Mutation G G A TCGA-ZB-A969-01A-11D-A428-09 ENST00000294066 p.R562W TBCEL chr11 121087076 121087076 Missense_Mutation G G A TCGA-ZB-A969-01A-11D-A428-09 ENST00000422003 p.V419M SLC38A2 chr12 46359934 46359935 3'UTR AT AT - TCGA-ZB-A969-01A-11D-A428-09 ENST00000256689 MPHOSPH9 chr12 123221806 123221809 Frame_Shift_Del TTGT TTGT - TCGA-ZB-A969-01A-11D-A428-09 ENST00000606320 p.Q146Yfs*12 TMEM132D chr12 129700612 129700612 Missense_Mutation C C T TCGA-ZB-A969-01A-11D-A428-09 ENST00000422113 p.A56T TSC22D1 chr13 44433866 44433866 3'UTR A A - TCGA-ZB-A969-01A-11D-A428-09 ENST00000458659 TSC22D1 chr13 44433867 44433867 3'UTR A A T TCGA-ZB-A969-01A-11D-A428-09 ENST00000458659 ITGBL1 chr13 101575503 101575503 Silent C C T TCGA-ZB-A969-01A-11D-A428-09 ENST00000376180 p.D181D AKAP5 chr14 64470738 64470738 3'Flank A A G TCGA-ZB-A969-01A-11D-A428-09 ENST00000320636 STAC2 chr17 39210647 39210647 3'UTR G G - TCGA-ZB-A969-01A-11D-A428-09 ENST00000333461 MSL1 chr17 40131332 40131332 Intron A A - TCGA-ZB-A969-01A-11D-A428-09 ENST00000398532 SAFB2 chr19 5591750 5591750 Missense_Mutation G G C TCGA-ZB-A969-01A-11D-A428-09 ENST00000252542 p.Q798E DUS3L chr19 5787662 5787662 Missense_Mutation A A G TCGA-ZB-A969-01A-11D-A428-09 ENST00000309061 p.L380P ZNF569 chr19 37413057 37413057 Missense_Mutation A A G TCGA-ZB-A969-01A-11D-A428-09 ENST00000316950 p.I534T ZNF574 chr19 42080604 42080604 Silent C C G TCGA-ZB-A969-01A-11D-A428-09 ENST00000359044 p.R666R ZNF211 chr19 57641341 57641341 Silent T T C TCGA-ZB-A969-01A-11D-A428-09 ENST00000347302 p.Y285Y ACSS1 chr20 25023585 25023595 Frame_Shift_Del CCACCACGCGC CCACCACGCGC - TCGA-ZB-A969-01A-11D-A428-09 ENST00000323482 p.R227Afs*7 BACH1 chr21 29326887 29326887 Missense_Mutation G G A TCGA-ZB-A969-01A-11D-A428-09 ENST00000286800 p.D355N BACH1 chr21 29326920 29326920 Missense_Mutation G G A TCGA-ZB-A969-01A-11D-A428-09 ENST00000286800 p.D366N BACH1 chr21 29326953 29326953 Nonsense_Mutation G G T TCGA-ZB-A969-01A-11D-A428-09 ENST00000286800 p.E377* BACH1 chr21 29326992 29326992 Missense_Mutation G G C TCGA-ZB-A969-01A-11D-A428-09 ENST00000286800 p.E390Q BACH1 chr21 29327268 29327268 Missense_Mutation G G C TCGA-ZB-A969-01A-11D-A428-09 ENST00000286800 p.D482H BACH1 chr21 29327292 29327292 Missense_Mutation G G C TCGA-ZB-A969-01A-11D-A428-09 ENST00000286800 p.E490Q BACH1 chr21 29327328 29327328 Missense_Mutation G G A TCGA-ZB-A969-01A-11D-A428-09 ENST00000286800 p.D502N BACH1 chr21 29327343 29327343 Missense_Mutation G G C TCGA-ZB-A969-01A-11D-A428-09 ENST00000286800 p.D507H BACH1 chr21 29327361 29327361 Missense_Mutation G G A TCGA-ZB-A969-01A-11D-A428-09 ENST00000286800 p.E513K USP41 chr22 20363627 20363627 Silent G G A TCGA-ZB-A969-01A-11D-A428-09 ENST00000454608 p.H357H DMC1 chr22 38519063 38519064 3'UTR - - T TCGA-ZB-A969-01A-11D-A428-09 ENST00000216024 SYNGR1 chr22 39385288 39385288 3'UTR C C A TCGA-ZB-A969-01A-11D-A428-09 ENST00000328933 NLGN4X chrX 6029360 6029360 Missense_Mutation C C A TCGA-ZB-A969-01A-11D-A428-09 ENST00000275857 p.G182V STARD8 chrX 68724005 68724005 Silent G G A TCGA-ZB-A969-01A-11D-A428-09 ENST00000252336 p.P946P RGAG1 chrX 110455621 110455621 3'UTR A A G TCGA-ZB-A969-01A-11D-A428-09 ENST00000465301 GPR119 chrX 130385433 130385433 Missense_Mutation G G T TCGA-ZB-A969-01A-11D-A428-09 ENST00000276218 p.F5L SCNN1D chr1 1286896 1286896 Missense_Mutation C C T TCGA-ZB-A96A-01A-11D-A428-09 ENST00000338555 p.P183L TBC1D1 chr4 38138461 38138461 3'UTR A A - TCGA-ZB-A96A-01A-11D-A428-09 ENST00000261439 MGARP chr4 139266508 139266508 3'UTR T T - TCGA-ZB-A96A-01A-11D-A428-09 ENST00000398955 RNF182 chr6 13978132 13978132 3'UTR C C T TCGA-ZB-A96A-01A-11D-A428-09 ENST00000488300 TRIM15 chr6 30163548 30163549 5'UTR - - TCTCTCTCTTTCTCTCTCTCTG TCGA-ZB-A96A-01A-11D-A428-09 ENST00000376694 GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-ZB-A96A-01A-11D-A428-09 ENST00000573035 p.L424H ACY3 chr11 67644760 67644760 Missense_Mutation C C A TCGA-ZB-A96A-01A-11D-A428-09 ENST00000255082 p.Q248H AQP11 chr11 77609530 77609530 3'UTR A A - TCGA-ZB-A96A-01A-11D-A428-09 ENST00000313578 DNM1P47 chr15 101760553 101760553 RNA G G C TCGA-ZB-A96A-01A-11D-A428-09 ENST00000561463 SETD1A chr16 30961361 30961361 Missense_Mutation G G T TCGA-ZB-A96A-01A-11D-A428-09 ENST00000262519 p.C114F ZNF559-ZNF177 chr19 9379055 9379055 Missense_Mutation A A G TCGA-ZB-A96A-01A-11D-A428-09 ENST00000434737 p.M43V ITM2A chrX 79362943 79362943 Frame_Shift_Del T T - TCGA-ZB-A96A-01A-11D-A428-09 ENST00000373298 p.K147Rfs*3 ITM2A chrX 79362948 79362948 Missense_Mutation A A C TCGA-ZB-A96A-01A-11D-A428-09 ENST00000373298 p.F145L CUL4B chrX 120524770 120524770 3'Flank T T - TCGA-ZB-A96A-01A-11D-A428-09 ENST00000404115 CD247 chr1 167435070 167435070 Intron T T - TCGA-XU-AAXX-01A-11D-A428-09 ENST00000362089 RXRA chr9 134440092 134440092 3'Flank A A - TCGA-XU-AAXX-01A-11D-A428-09 ENST00000481739 C9orf47 chr9 88995566 88995566 3'UTR A A - TCGA-XU-AAXW-01A-11D-A428-09 ENST00000334490 POTEM chr14 18977267 18977268 Intron - - T TCGA-XU-AAXW-01A-11D-A428-09 ENST00000547889 ARPP19 chr15 52549359 52549359 3'UTR A A - TCGA-XU-AAXW-01A-11D-A428-09 ENST00000249822 GOLGA6A chr15 74071220 74071220 Missense_Mutation G G A TCGA-XU-AAXW-01A-11D-A428-09 ENST00000290438 p.H620Y ZNF217 chr20 53567845 53567845 3'UTR T T - TCGA-XU-AAXW-01A-11D-A428-09 ENST00000302342 MOB3C chr1 46609235 46609236 3'UTR CA CA - TCGA-XM-A8RB-01A-11D-A423-09 ENST00000319928 RSBN1 chr1 113763942 113763942 3'UTR A A - TCGA-XM-A8RB-01A-11D-A423-09 ENST00000261441 PIM1 chr6 37175380 37175380 3'UTR T T - TCGA-XM-A8RB-01A-11D-A423-09 ENST00000373509 HOXA3 chr7 27107111 27107111 3'UTR T T - TCGA-XM-A8RB-01A-11D-A423-09 ENST00000317201 TRIM56 chr7 101090325 101090326 3'UTR - - A TCGA-XM-A8RB-01A-11D-A423-09 ENST00000306085 ZNF705D chr8 12113436 12113436 3'Flank G G A TCGA-XM-A8RB-01A-11D-A423-09 ENST00000400078 KIAA1875 chr8 144113606 144113606 Intron G G T TCGA-XM-A8RB-01A-11D-A423-09 ENST00000323662 SORBS1 chr10 95312090 95312091 3'Flank - - A TCGA-XM-A8RB-01A-11D-A423-09 ENST00000361941 CHD2 chr15 92949144 92949145 Intron - - T TCGA-XM-A8RB-01A-11D-A423-09 ENST00000394196 PCNT chr21 46326423 46326423 Nonsense_Mutation C C A TCGA-XM-A8RB-01A-11D-A423-09 ENST00000359568 p.S34* NRK chrX 105957274 105957275 3'UTR - - T TCGA-XM-A8RB-01A-11D-A423-09 ENST00000243300 PPP1R10 chr6 30600458 30600458 3'UTR A A - TCGA-XU-A932-01A-11D-A423-09 ENST00000376511 CAMK1D chr10 12829237 12829237 3'UTR A A - TCGA-XU-A932-01A-11D-A423-09 ENST00000619168 AC023310.1 chr15 20573025 20573025 3'Flank A A - TCGA-XU-A932-01A-11D-A423-09 ENST00000408427 SLC4A7 chr3 27376712 27376712 3'UTR G G A TCGA-X7-A8DF-01A-11D-A423-09 ENST00000295736 ERGIC1 chr5 172915017 172915017 Intron C C G TCGA-X7-A8DF-01A-11D-A423-09 ENST00000393784 THOC3 chr5 175968055 175968055 Frame_Shift_Del G G - TCGA-X7-A8DF-01A-11D-A423-09 ENST00000265097 p.L52Wfs*19 GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-X7-A8DF-01A-11D-A423-09 ENST00000573035 p.L424H RASA4B chr7 102485138 102485138 Missense_Mutation C C T TCGA-X7-A8DF-01A-11D-A423-09 ENST00000465829 p.R709Q PAFAH1B1 chr17 2683811 2683811 3'UTR G G C TCGA-X7-A8DF-01A-11D-A423-09 ENST00000397195 NCOA3 chr20 47655774 47655774 3'Flank A A - TCGA-X7-A8DF-01A-11D-A423-09 ENST00000371998 OMA1 chr1 58480868 58480868 3'UTR T T - TCGA-X7-A8D8-01A-11D-A423-09 ENST00000371226 LRP1B chr2 140993995 140993995 Missense_Mutation A A T TCGA-X7-A8D8-01A-11D-A423-09 ENST00000389484 p.F882I AGAP1 chr2 235709180 235709180 Missense_Mutation T T A TCGA-X7-A8D8-01A-11D-A423-09 ENST00000304032 p.D55E HES6 chr2 238238792 238238792 3'UTR C C T TCGA-X7-A8D8-01A-11D-A423-09 ENST00000272937 HDAC4 chr2 239095037 239095037 Missense_Mutation G G T TCGA-X7-A8D8-01A-11D-A423-09 ENST00000345617 p.F746L CSRNP1 chr3 39145081 39145081 Missense_Mutation C C G TCGA-X7-A8D8-01A-11D-A423-09 ENST00000273153 p.E127D CCK chr3 42263459 42263459 Missense_Mutation G G T TCGA-X7-A8D8-01A-11D-A423-09 ENST00000334681 p.L58M STAG1 chr3 136349276 136349276 Silent T T C TCGA-X7-A8D8-01A-11D-A423-09 ENST00000383202 p.S1051S MED28 chr4 17624016 17624016 3'UTR T T - TCGA-X7-A8D8-01A-11D-A423-09 ENST00000237380 DCAF4L1 chr4 41983256 41983256 3'UTR T T - TCGA-X7-A8D8-01A-11D-A423-09 ENST00000333141 TAS2R1 chr5 9629960 9629960 Missense_Mutation C C A TCGA-X7-A8D8-01A-11D-A423-09 ENST00000382492 p.G25C NIPBL chr5 37065058 37065058 3'UTR C C T TCGA-X7-A8D8-01A-11D-A423-09 ENST00000282516 PIK3R1 chr5 68301442 68301442 3'UTR A A G TCGA-X7-A8D8-01A-11D-A423-09 ENST00000521381 PCDHGA6 chr5 141374164 141374164 Silent G G T TCGA-X7-A8D8-01A-11D-A423-09 ENST00000517434 p.A27A REV3L chr6 111389106 111389106 Missense_Mutation C C T TCGA-X7-A8D8-01A-11D-A423-09 ENST00000358835 p.D288N GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-X7-A8D8-01A-11D-A423-09 ENST00000573035 p.L424H SRRT chr7 100875579 100875579 5'UTR T T C TCGA-X7-A8D8-01A-11D-A423-09 ENST00000611405 CSMD1 chr8 2974624 2974624 Missense_Mutation G G A TCGA-X7-A8D8-01A-11D-A423-09 ENST00000520002 p.A2857V FAM86B1 chr8 12194067 12194067 Missense_Mutation C C T TCGA-X7-A8D8-01A-11D-A423-09 ENST00000448228 p.A2T OXR1 chr8 106751201 106751201 3'Flank T T C TCGA-X7-A8D8-01A-11D-A423-09 ENST00000442977 MTAP chr9 21865655 21865655 3'UTR C C G TCGA-X7-A8D8-01A-11D-A423-09 ENST00000380172 ZDHHC6 chr10 112445212 112445212 Silent G G A TCGA-X7-A8D8-01A-11D-A423-09 ENST00000369405 p.A75A NCAM1 chr11 113232192 113232192 Silent T T C TCGA-X7-A8D8-01A-11D-A423-09 ENST00000316851 p.P421P PSMD9 chr12 121888920 121888920 Missense_Mutation G G T TCGA-X7-A8D8-01A-11D-A423-09 ENST00000541212 p.D22Y MAPK1IP1L chr14 55064767 55064767 3'UTR C C A TCGA-X7-A8D8-01A-11D-A423-09 ENST00000395468 GSC chr14 94769786 94769786 Missense_Mutation C C A TCGA-X7-A8D8-01A-11D-A423-09 ENST00000238558 p.R77L ZNF689 chr16 30604133 30604133 3'UTR T T C TCGA-X7-A8D8-01A-11D-A423-09 ENST00000287461 CTD-2014E2.5 chr16 31569246 31569246 5'Flank T T A TCGA-X7-A8D8-01A-11D-A423-09 ENST00000565692 EPG5 chr18 45857989 45857989 Missense_Mutation C C T TCGA-X7-A8D8-01A-11D-A423-09 ENST00000282041 p.D2436N JUNB chr19 12793243 12793248 3'UTR GTGTTT GTGTTT - TCGA-X7-A8D8-01A-11D-A423-09 ENST00000302754 FGF5 chr4 80288997 80288997 3'UTR T T - TCGA-YT-A95E-01A-11D-A428-09 ENST00000312465 RBAK-RBAKDN chr7 5073075 5073075 3'UTR G G C TCGA-YT-A95E-01A-11D-A428-09 ENST00000396904 ASPN chr9 92456624 92456624 3'UTR A A - TCGA-YT-A95E-01A-11D-A428-09 ENST00000375544 BRD3 chr9 134032841 134032841 3'UTR T T - TCGA-YT-A95E-01A-11D-A428-09 ENST00000303407 HNRNPC chr14 21210545 21210546 3'Flank - - T TCGA-YT-A95E-01A-11D-A428-09 ENST00000420743 DNM1P47 chr15 101760553 101760553 RNA G G C TCGA-YT-A95E-01A-11D-A428-09 ENST00000561463 DPEP1 chr16 89630419 89630419 Silent C C T TCGA-YT-A95E-01A-11D-A428-09 ENST00000261615 p.S3S KCNH4 chr17 42166343 42166343 Silent G G A TCGA-YT-A95E-01A-11D-A428-09 ENST00000264661 p.S598S CCL25 chr19 8057907 8057907 Missense_Mutation A A G TCGA-YT-A95E-01A-11D-A428-09 ENST00000390669 p.I144M HELZ2 chr20 63560263 63560263 Missense_Mutation G G A TCGA-YT-A95E-01A-11D-A428-09 ENST00000467148 p.T2522M ADAMTS4 chr1 161190513 161190513 3'UTR A A - TCGA-ZB-A96F-01A-11D-A428-09 ENST00000367996 OR14I1 chr1 248681464 248681464 Missense_Mutation G G A TCGA-ZB-A96F-01A-11D-A428-09 ENST00000342623 p.P281S SF3B1 chr2 197402110 197402110 Missense_Mutation T T C TCGA-ZB-A96F-01A-11D-A428-09 ENST00000335508 p.K700E KEL chr7 142962292 142962292 5'UTR G G A TCGA-ZB-A96F-01A-11D-A428-09 ENST00000355265 ZNF746 chr7 149472892 149472892 3'UTR C C A TCGA-ZB-A96F-01A-11D-A428-09 ENST00000340622 TONSL chr8 144438553 144438553 Missense_Mutation C C T TCGA-ZB-A96F-01A-11D-A428-09 ENST00000409379 p.R524Q C9orf43 chr9 113421129 113421129 Silent G G A TCGA-ZB-A96F-01A-11D-A428-09 ENST00000288462 p.T124T ACTN3 chr11 66562141 66562141 Silent C C T TCGA-ZB-A96F-01A-11D-A428-09 ENST00000513398 p.F765F RIMBP2 chr12 130451252 130451252 Silent G G A TCGA-ZB-A96F-01A-11D-A428-09 ENST00000261655 p.S132S BRCA2 chr13 32346895 32346895 Missense_Mutation C C T TCGA-ZB-A96F-01A-11D-A428-09 ENST00000380152 p.R2336C AC023310.1 chr15 20575660 20575660 3'Flank G G T TCGA-ZB-A96F-01A-11D-A428-09 ENST00000408427 ARID3B chr15 74591255 74591255 Missense_Mutation C C G TCGA-ZB-A96F-01A-11D-A428-09 ENST00000622429 p.P329R SLC12A3 chr16 56884151 56884151 Missense_Mutation T T A TCGA-ZB-A96F-01A-11D-A428-09 ENST00000563236 p.I591N JPH3 chr16 87690269 87690269 Missense_Mutation C C T TCGA-ZB-A96F-01A-11D-A428-09 ENST00000284262 p.R637W NLK chr17 28195809 28195809 3'UTR T T - TCGA-ZB-A96F-01A-11D-A428-09 ENST00000407008 NPLOC4 chr17 81629799 81629799 Missense_Mutation G G A TCGA-ZB-A96F-01A-11D-A428-09 ENST00000331134 p.R8C SPTBN4 chr19 40523556 40523556 Silent C C G TCGA-ZB-A96F-01A-11D-A428-09 ENST00000352632 p.A1258A SLC38A5 chrX 48467884 48467884 Missense_Mutation G G A TCGA-ZB-A96F-01A-11D-A428-09 ENST00000595796 p.S14L CROCCP2 chr1 16619162 16619162 RNA A A T TCGA-4V-A9QW-01A-11D-A423-09 ENST00000412962 RP11-848G14.5 chr5 69633691 69633691 RNA T T G TCGA-4V-A9QW-01A-11D-A423-09 ENST00000515156 PPP1R10 chr6 30600458 30600458 3'UTR A A - TCGA-4V-A9QW-01A-11D-A423-09 ENST00000376511 SNHG5 chr6 85677366 85677366 Intron A A G TCGA-4V-A9QW-01A-11D-A423-09 ENST00000369605 MUC2 chr11 1097377 1097377 RNA T T C TCGA-4V-A9QW-01A-11D-A423-09 ENST00000361558 IGF2BP1 chr17 49045986 49045986 Missense_Mutation G G A TCGA-4V-A9QW-01A-11D-A423-09 ENST00000290341 p.A498T VPS4B chr18 63390627 63390627 3'UTR A A - TCGA-4V-A9QW-01A-11D-A423-09 ENST00000238497 IGLV3-27 chr22 22668577 22668577 Missense_Mutation C C T TCGA-4V-A9QW-01A-11D-A423-09 ENST00000390304 p.A37V SERBP1 chr1 67413107 67413107 3'UTR T T - TCGA-ZC-AAAA-01A-11D-A428-09 ENST00000370995 RSBN1 chr1 113763942 113763942 3'UTR A A - TCGA-ZC-AAAA-01A-11D-A428-09 ENST00000261441 UBE2K chr4 39778574 39778574 3'UTR A A - TCGA-ZC-AAAA-01A-11D-A428-09 ENST00000261427 G3BP1 chr5 151805218 151805219 3'UTR - - T TCGA-ZC-AAAA-01A-11D-A428-09 ENST00000356245 MEGF9 chr9 120604403 120604404 3'UTR - - T TCGA-ZC-AAAA-01A-11D-A428-09 ENST00000373930 ZFHX3 chr16 72786399 72786399 3'UTR G G T TCGA-ZC-AAAA-01A-11D-A428-09 ENST00000268489 PER1 chr17 8149611 8149611 Nonsense_Mutation G G T TCGA-ZC-AAAA-01A-11D-A428-09 ENST00000317276 p.S235* GIT1 chr17 29574128 29574129 3'UTR - - A TCGA-ZC-AAAA-01A-11D-A428-09 ENST00000225394 TSIX chrX 73827758 73827758 RNA C C T TCGA-ZC-AAAA-01A-11D-A428-09 ENST00000604411 NBPF14 chr1 148536242 148536242 Missense_Mutation A A T TCGA-ZB-A96P-01A-11D-A428-09 ENST00000619423 p.L2791M PRKCE chr2 46187716 46187716 3'UTR A A - TCGA-ZB-A96P-01A-11D-A428-09 ENST00000306156 FAM95B1 chr9 40327019 40327020 RNA TG TG - TCGA-ZB-A96P-01A-11D-A428-09 ENST00000592873 ZFHX3 chr16 72782895 72782896 3'UTR - - T TCGA-ZB-A96P-01A-11D-A428-09 ENST00000268489 TNFAIP1 chr17 28345298 28345299 3'UTR - - A TCGA-ZB-A96P-01A-11D-A428-09 ENST00000226225 BCL11A chr2 60458275 60458275 3'UTR T T - TCGA-4V-A9QI-01A-11D-A423-09 ENST00000335712 NACAD chr7 45083851 45083851 Missense_Mutation G G A TCGA-4V-A9QI-01A-11D-A423-09 ENST00000490531 p.P777S ZNF629 chr16 30781463 30781463 3'UTR T T - TCGA-4V-A9QI-01A-11D-A423-09 ENST00000262525 AGPAT3 chr21 43984694 43984694 3'UTR G G T TCGA-4V-A9QI-01A-11D-A423-09 ENST00000291572 C1orf61 chr1 156420415 156420415 Intron T T C TCGA-XU-A92Q-01A-11D-A423-09 ENST00000368243 ACTR2 chr2 65268673 65268673 Missense_Mutation G G A TCGA-XU-A92Q-01A-11D-A423-09 ENST00000260641 p.R375Q TTN chr2 178572917 178572917 Missense_Mutation T T A TCGA-XU-A92Q-01A-11D-A423-09 ENST00000591111 p.E22764D WNT5A chr3 55468651 55468652 3'UTR TA TA - TCGA-XU-A92Q-01A-11D-A423-09 ENST00000264634 MECOM chr3 169381476 169381476 Missense_Mutation A A G TCGA-XU-A92Q-01A-11D-A423-09 ENST00000494292 p.M29T KLHL24 chr3 183682679 183682679 3'Flank A A G TCGA-XU-A92Q-01A-11D-A423-09 ENST00000242810 FOXC1 chr6 1612185 1612185 3'UTR A A - TCGA-XU-A92Q-01A-11D-A423-09 ENST00000380874 KIF13A chr6 17764508 17764508 Missense_Mutation C C A TCGA-XU-A92Q-01A-11D-A423-09 ENST00000259711 p.A1674S BVES chr6 105115725 105115725 Missense_Mutation G G A TCGA-XU-A92Q-01A-11D-A423-09 ENST00000314641 p.H307Y RALA chr7 39707602 39707602 3'UTR T T - TCGA-XU-A92Q-01A-11D-A423-09 ENST00000005257 GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-XU-A92Q-01A-11D-A423-09 ENST00000573035 p.L424H AHCYL2 chr7 129409490 129409490 Missense_Mutation G G A TCGA-XU-A92Q-01A-11D-A423-09 ENST00000325006 p.R437Q NOL6 chr9 33472351 33472351 Missense_Mutation C C T TCGA-XU-A92Q-01A-11D-A423-09 ENST00000297990 p.R39H ZNF462 chr9 106928404 106928404 Frame_Shift_Del G G - TCGA-XU-A92Q-01A-11D-A423-09 ENST00000277225 p.V1498* CNTRL chr9 121143994 121143994 Missense_Mutation A A T TCGA-XU-A92Q-01A-11D-A423-09 ENST00000238341 p.K988M LRSAM1 chr9 127473900 127473900 Missense_Mutation A A G TCGA-XU-A92Q-01A-11D-A423-09 ENST00000300417 p.D240G PPP2R4 chr9 129140025 129140026 Intron - - AAGGAGCTGACAGGAAGGC TCGA-XU-A92Q-01A-11D-A423-09 ENST00000337738 SURF4 chr9 133363521 133363521 Missense_Mutation G G A TCGA-XU-A92Q-01A-11D-A423-09 ENST00000371989 p.S261F HRAS chr11 533544 533544 Missense_Mutation A A G TCGA-XU-A92Q-01A-11D-A423-09 ENST00000311189 p.L120P IGF2 chr11 2146334 2146334 Intron G G A TCGA-XU-A92Q-01A-11D-A423-09 ENST00000300632 RCE1 chr11 66846304 66846304 3'UTR A A G TCGA-XU-A92Q-01A-11D-A423-09 ENST00000309657 OR8G2P chr11 124225053 124225053 RNA G G C TCGA-XU-A92Q-01A-11D-A423-09 ENST00000412796 KCNMB4 chr12 70366842 70366842 Silent C C G TCGA-XU-A92Q-01A-11D-A423-09 ENST00000258111 p.G36G UTP20 chr12 101383194 101383194 Missense_Mutation G G A TCGA-XU-A92Q-01A-11D-A423-09 ENST00000261637 p.E2604K CHGA chr14 92931453 92931453 Missense_Mutation G G T TCGA-XU-A92Q-01A-11D-A423-09 ENST00000216492 p.A187S ZKSCAN2 chr16 25246623 25246623 Intron G G A TCGA-XU-A92Q-01A-11D-A423-09 ENST00000328086 LIG3 chr17 34992020 34992020 Missense_Mutation C C T TCGA-XU-A92Q-01A-11D-A423-09 ENST00000378526 p.S424L H3F3B chr17 75778119 75778119 3'UTR T T - TCGA-XU-A92Q-01A-11D-A423-09 ENST00000254810 MUC16 chr19 8894916 8894916 Missense_Mutation A A G TCGA-XU-A92Q-01A-11D-A423-09 ENST00000397910 p.Y13272H CLPTM1 chr19 44992718 44992718 Missense_Mutation G G A TCGA-XU-A92Q-01A-11D-A423-09 ENST00000337392 p.V611M FAM83D chr20 38947895 38947895 Missense_Mutation T T C TCGA-XU-A92Q-01A-11D-A423-09 ENST00000619850 p.I224T CAPN6 chrX 111251702 111251702 Missense_Mutation C T T TCGA-XU-A92Q-01A-11D-A423-09 ENST00000324068 p.G247D HMCN1 chr1 186082930 186082930 Silent T T C TCGA-X7-A8M1-01A-11D-A423-09 ENST00000271588 p.S2951S DYSF chr2 71511866 71511866 Silent G G A TCGA-X7-A8M1-01A-11D-A423-09 ENST00000258104 p.P134P RWDD4 chr4 183655935 183655935 Silent A A T TCGA-X7-A8M1-01A-11D-A423-09 ENST00000326397 p.I17I GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-X7-A8M1-01A-11D-A423-09 ENST00000573035 p.L424H PCLO chr7 82949666 82949666 Missense_Mutation A A T TCGA-X7-A8M1-01A-11D-A423-09 ENST00000333891 p.V3641E COL26A1 chr7 101557809 101557809 3'UTR C C T TCGA-X7-A8M1-01A-11D-A423-09 ENST00000313669 ATP12A chr13 24700829 24700829 Silent C C A TCGA-X7-A8M1-01A-11D-A423-09 ENST00000381946 p.S596S LHFP chr13 39343554 39343555 3'UTR - - A TCGA-X7-A8M1-01A-11D-A423-09 ENST00000379589 IGHD chr14 105845572 105845572 Missense_Mutation G G A TCGA-X7-A8M1-01A-11D-A423-09 ENST00000390556 p.T36M MYO1E chr15 59231789 59231789 Splice_Region G G A TCGA-X7-A8M1-01A-11D-A423-09 ENST00000288235 p.H141H MYH13 chr17 10345214 10345214 Silent C C T TCGA-X7-A8M1-01A-11D-A423-09 ENST00000252172 p.E524E CTD-2303H24.2 chr17 18512614 18512614 RNA G G A TCGA-X7-A8M1-01A-11D-A423-09 ENST00000425211 ELAVL3 chr19 11453973 11453973 3'UTR G G T TCGA-X7-A8M1-01A-11D-A423-09 ENST00000359227 ZNF675 chr19 23652987 23652987 3'UTR T C C TCGA-X7-A8M1-01A-11D-A423-09 ENST00000359788 DDX26B chrX 135579812 135579812 Missense_Mutation A A G TCGA-X7-A8M1-01A-11D-A423-09 ENST00000370752 p.H678R CROCCP3 chr1 16485618 16485618 RNA G G A TCGA-XU-A92X-01A-11D-A423-09 ENST00000263511 SDC1 chr2 20202724 20202724 3'UTR G G A TCGA-XU-A92X-01A-11D-A423-09 ENST00000254351 TCERG1 chr5 146511047 146511047 3'UTR T T - TCGA-XU-A92X-01A-11D-A423-09 ENST00000296702 CLIP2 chr7 74404521 74404522 3'UTR AC AC - TCGA-XU-A92X-01A-11D-A423-09 ENST00000223398 RUNX1T1 chr8 91959488 91959488 3'UTR G G A TCGA-XU-A92X-01A-11D-A423-09 ENST00000265814 NR4A3 chr9 99822046 99822046 5'UTR G G A TCGA-XU-A92X-01A-11D-A423-09 ENST00000395097 WDFY4 chr10 48736114 48736114 Intron G G A TCGA-XU-A92X-01A-11D-A423-09 ENST00000325239 OVOL1 chr11 65796031 65796032 3'UTR TA TA - TCGA-XU-A92X-01A-11D-A423-09 ENST00000335987 SRPR chr11 126268744 126268744 Missense_Mutation C C T TCGA-XU-A92X-01A-11D-A423-09 ENST00000332118 p.V21I IPO5 chr13 98016743 98016743 Silent T T C TCGA-XU-A92X-01A-11D-A423-09 ENST00000357602 p.V836V MED6 chr14 70584904 70584904 Missense_Mutation G G A TCGA-XU-A92X-01A-11D-A423-09 ENST00000256379 p.T217I STARD5 chr15 81322465 81322465 Silent T T C TCGA-XU-A92X-01A-11D-A423-09 ENST00000302824 p.L75L MUM1 chr19 1371064 1371064 Missense_Mutation G G T TCGA-XU-A92X-01A-11D-A423-09 ENST00000591806 p.V659L ZNF790 chr19 36819952 36819952 Missense_Mutation T T C TCGA-XU-A92X-01A-11D-A423-09 ENST00000356725 p.Q131R HRNR chr1 152215268 152215268 Missense_Mutation T T G TCGA-X7-A8DE-01A-11D-A423-09 ENST00000368801 p.S2121R RHOBTB3 chr5 95793485 95793485 3'UTR A A - TCGA-X7-A8DE-01A-11D-A423-09 ENST00000379982 ABCA2 chr9 137011302 137011302 Missense_Mutation T T A TCGA-X7-A8DE-01A-11D-A423-09 ENST00000341511 p.K1936M CELF2 chr10 11333891 11333891 3'UTR A A - TCGA-X7-A8DE-01A-11D-A423-09 ENST00000416382 PAPSS2 chr10 87747519 87747520 3'UTR - - A TCGA-X7-A8DE-01A-11D-A423-09 ENST00000361175 ONECUT2 chr18 57477318 57477318 3'UTR A A - TCGA-X7-A8DE-01A-11D-A423-09 ENST00000491143 AL078621.1 chr2 113596691 113596692 3'Flank - - CAGCACCAC TCGA-X7-A8M6-01A-11D-A423-09 ENST00000613451 PTP4A1 chr6 63582192 63582193 3'UTR - - T TCGA-X7-A8M6-01A-11D-A423-09 ENST00000370651 ADGRB3 chr6 69014058 69014058 Silent C C T TCGA-X7-A8M6-01A-11D-A423-09 ENST00000370598 p.S650S MC1R chr16 89914802 89914802 5'Flank C C T TCGA-X7-A8M6-01A-11D-A423-09 ENST00000555147 MARCH10 chr17 62711242 62711242 Missense_Mutation C C G TCGA-X7-A8M6-01A-11D-A423-09 ENST00000311269 p.E773Q POM121L7 chr22 21121643 21121643 3'Flank G G A TCGA-X7-A8M6-01A-11D-A423-09 ENST00000329949 RP11-395E19.2 chr9 66976914 66976914 5'Flank T T C TCGA-XU-A92W-01A-11D-A423-09 ENST00000616253 SPTBN5 chr15 41875513 41875513 Missense_Mutation C C T TCGA-XU-A92W-01A-11D-A423-09 ENST00000320955 p.R1411H BCAS3 chr17 61070116 61070116 Intron C C T TCGA-XU-A92W-01A-11D-A423-09 ENST00000390652 SPATA2 chr20 49903896 49903897 3'UTR - - AGAT TCGA-XU-A92W-01A-11D-A423-09 ENST00000289431 VWA5B1 chr1 20314487 20314487 Missense_Mutation C C T TCGA-XM-AAZ2-01A-11D-A423-09 ENST00000375079 p.T153M FNBP1L chr1 93552547 93552547 3'UTR T T - TCGA-XM-AAZ2-01A-11D-A423-09 ENST00000271234 WDR77 chr1 111448728 111448728 Silent G G A TCGA-XM-AAZ2-01A-11D-A423-09 ENST00000235090 p.P64P CLASP1 chr2 121407492 121407492 Missense_Mutation A A G TCGA-XM-AAZ2-01A-11D-A423-09 ENST00000263710 p.L883P NR1I2 chr3 119815778 119815778 Silent C C T TCGA-XM-AAZ2-01A-11D-A423-09 ENST00000393716 p.F369F PEX5L chr3 179801685 179801685 3'UTR A A C TCGA-XM-AAZ2-01A-11D-A423-09 ENST00000467460 ADAM29 chr4 174976753 174976753 Nonsense_Mutation G G T TCGA-XM-AAZ2-01A-11D-A423-09 ENST00000359240 p.E410* MCC chr5 113049221 113049221 Missense_Mutation G G A TCGA-XM-AAZ2-01A-11D-A423-09 ENST00000302475 p.R653W SCAF8 chr6 154832268 154832268 Missense_Mutation C C G TCGA-XM-AAZ2-01A-11D-A423-09 ENST00000367178 p.L897V GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-XM-AAZ2-01A-11D-A423-09 ENST00000573035 p.L424H SEC61A2 chr10 12169343 12169343 3'Flank G G A TCGA-XM-AAZ2-01A-11D-A423-09 ENST00000298428 BMS1P7 chr10 48050295 48050295 RNA T T C TCGA-XM-AAZ2-01A-11D-A423-09 ENST00000602440 HMX3 chr10 123136110 123136111 Frame_Shift_Ins - - C TCGA-XM-AAZ2-01A-11D-A423-09 ENST00000357878 p.P24Tfs*24 OR5M9 chr11 56463090 56463090 Silent G G A TCGA-XM-AAZ2-01A-11D-A423-09 ENST00000279791 p.A104A CREBZF chr11 85662340 85662340 3'UTR A A G TCGA-XM-AAZ2-01A-11D-A423-09 ENST00000490820 CTSC chr11 88294167 88294167 Missense_Mutation C C T TCGA-XM-AAZ2-01A-11D-A423-09 ENST00000227266 p.G411S COL4A1 chr13 110169756 110169756 Missense_Mutation G G A TCGA-XM-AAZ2-01A-11D-A423-09 ENST00000375820 p.P1250L DAAM1 chr14 59369064 59369064 3'UTR G G A TCGA-XM-AAZ2-01A-11D-A423-09 ENST00000395125 VEZF1 chr17 57973745 57973745 3'Flank T T - TCGA-XM-AAZ2-01A-11D-A423-09 ENST00000581208 GYS1 chr19 48974681 48974681 Missense_Mutation T T C TCGA-XM-AAZ2-01A-11D-A423-09 ENST00000323798 p.D454G ZNF217 chr20 53567845 53567845 3'UTR T T - TCGA-XM-AAZ2-01A-11D-A423-09 ENST00000302342 KB-1592A4.15 chr22 21116078 21116078 RNA G G A TCGA-XM-AAZ2-01A-11D-A423-09 ENST00000420508 PLXNB2 chr22 50282749 50282749 Silent G G C TCGA-XM-AAZ2-01A-11D-A423-09 ENST00000359337 p.P983P CA5B chrX 15772563 15772563 Missense_Mutation C G G TCGA-XM-AAZ2-01A-11D-A423-09 ENST00000318636 p.I136M MTMR8 chrX 64268911 64268926 Frame_Shift_Del TATTCAGGTCTCCATT TATTCAGGTCTCCATT - TCGA-XM-AAZ2-01A-11D-A423-09 ENST00000374852 p.N576Pfs*2 ST6GALNAC3 chr1 76629732 76629732 3'UTR T T C TCGA-ZB-A96L-01A-11D-A428-09 ENST00000328299 SLC16A1 chr1 112913773 112913773 3'UTR A A G TCGA-ZB-A96L-01A-11D-A428-09 ENST00000369626 SLC27A3 chr1 153777833 153777833 Missense_Mutation C C T TCGA-ZB-A96L-01A-11D-A428-09 ENST00000368661 p.T417M TPM3 chr1 154170658 154170658 Missense_Mutation T T G TCGA-ZB-A96L-01A-11D-A428-09 ENST00000368530 p.K232N PTPRVP chr1 202169393 202169393 RNA G G T TCGA-ZB-A96L-01A-11D-A428-09 ENST00000490225 ID2 chr2 8683811 8683812 3'UTR - - A TCGA-ZB-A96L-01A-11D-A428-09 ENST00000234091 FAM178B chr2 96929203 96929203 Splice_Region C C A TCGA-ZB-A96L-01A-11D-A428-09 ENST00000417561 AL078621.1 chr2 113596691 113596692 3'Flank - - CAGCACCAC TCGA-ZB-A96L-01A-11D-A428-09 ENST00000613451 CCDC148 chr2 158456422 158456422 Silent A A C TCGA-ZB-A96L-01A-11D-A428-09 ENST00000283233 p.A6A RBMS1 chr2 160274460 160274460 3'UTR T T - TCGA-ZB-A96L-01A-11D-A428-09 ENST00000348849 TTN chr2 178682739 178682739 Missense_Mutation G G A TCGA-ZB-A96L-01A-11D-A428-09 ENST00000591111 p.R10701W DNER chr2 229358367 229358367 3'UTR T T A TCGA-ZB-A96L-01A-11D-A428-09 ENST00000341772 DPPA2 chr3 109312624 109312624 Silent G G A TCGA-ZB-A96L-01A-11D-A428-09 ENST00000478945 p.D34D SLC9C1 chr3 112221157 112221157 Silent T T C TCGA-ZB-A96L-01A-11D-A428-09 ENST00000305815 p.A547A CCDC37 chr3 126414198 126414198 Intron C C T TCGA-ZB-A96L-01A-11D-A428-09 ENST00000352312 MRPL47 chr3 179598680 179598722 Frame_Shift_Del CTAACCGCTCTGGACTTGGCATTGGCAATCTCTGCCGCTTGGC CTAACCGCTCTGGACTTGGCATTGGCAATCTCTGCCGCTTGGC - TCGA-ZB-A96L-01A-11D-A428-09 ENST00000476781 p.A119Ifs*3 MFAP3L chr4 169990486 169990486 3'UTR T T C TCGA-ZB-A96L-01A-11D-A428-09 ENST00000361618 LRRC1 chr6 53902649 53902649 Missense_Mutation A A G TCGA-ZB-A96L-01A-11D-A428-09 ENST00000370888 p.I270V AHR chr7 17345703 17345703 3'UTR A A G TCGA-ZB-A96L-01A-11D-A428-09 ENST00000242057 GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-ZB-A96L-01A-11D-A428-09 ENST00000573035 p.L424H RDH10 chr8 73324444 73324444 3'UTR T T - TCGA-ZB-A96L-01A-11D-A428-09 ENST00000240285 OBP2B chr9 133205341 133205341 3'UTR G G A TCGA-ZB-A96L-01A-11D-A428-09 ENST00000372034 ERLIN1 chr10 100151999 100151999 3'UTR C C A TCGA-ZB-A96L-01A-11D-A428-09 ENST00000407654 POLL chr10 101587779 101587779 Intron C C T TCGA-ZB-A96L-01A-11D-A428-09 ENST00000299206 NFKB2 chr10 102396263 102396263 Missense_Mutation G G T TCGA-ZB-A96L-01A-11D-A428-09 ENST00000369966 p.G11V OR51E1 chr11 4654221 4654221 3'UTR A A - TCGA-ZB-A96L-01A-11D-A428-09 ENST00000396952 CATSPER1 chr11 66025262 66025262 Missense_Mutation C C T TCGA-ZB-A96L-01A-11D-A428-09 ENST00000312106 p.R373H AC215219.2 chr12 18149 18149 5'Flank T T C TCGA-ZB-A96L-01A-11D-A428-09 ENST00000611710 FGD4 chr12 32582237 32582237 Missense_Mutation G G C TCGA-ZB-A96L-01A-11D-A428-09 ENST00000427716 p.D124H NACA chr12 56718884 56718884 Intron G G - TCGA-ZB-A96L-01A-11D-A428-09 ENST00000356769 HSP90B1 chr12 103947825 103947825 3'UTR T T - TCGA-ZB-A96L-01A-11D-A428-09 ENST00000299767 HECTD4 chr12 112314528 112314528 Silent G G A TCGA-ZB-A96L-01A-11D-A428-09 ENST00000550722 p.F94F GCN1L1 chr12 120137605 120137605 Missense_Mutation G G T TCGA-ZB-A96L-01A-11D-A428-09 ENST00000300648 p.F2201L HCAR2 chr12 122702696 122702696 Missense_Mutation C C G TCGA-ZB-A96L-01A-11D-A428-09 ENST00000328880 p.E196D NEDD4 chr15 55841961 55841961 Missense_Mutation T T C TCGA-ZB-A96L-01A-11D-A428-09 ENST00000508342 p.Y1023C LIPC chr15 58541938 58541938 Missense_Mutation G G A TCGA-ZB-A96L-01A-11D-A428-09 ENST00000299022 p.E143K DNM1P47 chr15 101757971 101757971 RNA G G C TCGA-ZB-A96L-01A-11D-A428-09 ENST00000561463 SMG1P1 chr16 22459391 22459391 RNA C C T TCGA-ZB-A96L-01A-11D-A428-09 ENST00000337787 FBRS chr16 30670553 30670553 3'UTR G G T TCGA-ZB-A96L-01A-11D-A428-09 ENST00000287468 ARMC5 chr16 31462302 31462302 Missense_Mutation C C G TCGA-ZB-A96L-01A-11D-A428-09 ENST00000268314 p.A252G EXOSC6 chr16 70251018 70251018 3'UTR G G T TCGA-ZB-A96L-01A-11D-A428-09 ENST00000435634 KLHDC4 chr16 87709428 87709428 Silent C C T TCGA-ZB-A96L-01A-11D-A428-09 ENST00000270583 p.G428G MBTD1 chr17 51225064 51225064 Missense_Mutation G G C TCGA-ZB-A96L-01A-11D-A428-09 ENST00000415868 p.P33R INO80C chr18 35468542 35468542 3'UTR G G A TCGA-ZB-A96L-01A-11D-A428-09 ENST00000334598 CYP2B6 chr19 41004159 41004159 Frame_Shift_Del A A - TCGA-ZB-A96L-01A-11D-A428-09 ENST00000324071 p.Y111Mfs*3 ZNF814 chr19 57874858 57874858 Missense_Mutation C C T TCGA-ZB-A96L-01A-11D-A428-09 ENST00000435989 p.D178N APOBEC3F chr22 39045485 39045485 Missense_Mutation G G T TCGA-ZB-A96L-01A-11D-A428-09 ENST00000308521 p.W170L ESPN chr1 6460454 6460454 3'UTR C C A TCGA-3S-A8YW-01A-11D-A423-09 ENST00000377828 PKN2 chr1 88784664 88784664 Silent C C T TCGA-3S-A8YW-01A-11D-A423-09 ENST00000370521 p.G337G TXNIP chr1 145992950 145992950 3'UTR A A T TCGA-3S-A8YW-01A-11D-A423-09 ENST00000582401 ZNF687 chr1 151281678 151281678 5'Flank A A G TCGA-3S-A8YW-01A-11D-A423-09 ENST00000324048 C1orf189 chr1 154199416 154199416 3'UTR T T G TCGA-3S-A8YW-01A-11D-A423-09 ENST00000368525 TNR chr1 175403607 175403607 Missense_Mutation T T C TCGA-3S-A8YW-01A-11D-A423-09 ENST00000263525 p.D170G ZC3H11A chr1 203802722 203802724 5'UTR TTG TTG - TCGA-3S-A8YW-01A-11D-A423-09 ENST00000332127 ENAH chr1 225495928 225495928 3'UTR A A - TCGA-3S-A8YW-01A-11D-A423-09 ENST00000366844 IQSEC1 chr3 12902797 12902797 Silent C C T TCGA-3S-A8YW-01A-11D-A423-09 ENST00000273221 p.A941A CCDC51 chr3 48432837 48432837 Silent C C G TCGA-3S-A8YW-01A-11D-A423-09 ENST00000395694 p.L269L KPNA4 chr3 160568465 160568465 5'Flank G G C TCGA-3S-A8YW-01A-11D-A423-09 ENST00000334256 FAM200B chr4 15688187 15688187 Missense_Mutation G G C TCGA-3S-A8YW-01A-11D-A423-09 ENST00000422728 p.E404Q CAMK2D chr4 113452673 113452674 3'Flank - - T TCGA-3S-A8YW-01A-11D-A423-09 ENST00000342666 MAD2L1 chr4 120065813 120065813 Missense_Mutation C C T TCGA-3S-A8YW-01A-11D-A423-09 ENST00000296509 p.G27S GALNTL6 chr4 173021575 173021575 Missense_Mutation C C T TCGA-3S-A8YW-01A-11D-A423-09 ENST00000506823 p.L530F EFHC1 chr6 52479684 52479684 Silent T T C TCGA-3S-A8YW-01A-11D-A423-09 ENST00000371068 p.L513L TBX18 chr6 84744268 84744268 Missense_Mutation G G A TCGA-3S-A8YW-01A-11D-A423-09 ENST00000369663 p.R333C GJB7 chr6 87284697 87284697 Silent G G C TCGA-3S-A8YW-01A-11D-A423-09 ENST00000296882 p.S72S REV3L chr6 111405532 111405532 Missense_Mutation T T C TCGA-3S-A8YW-01A-11D-A423-09 ENST00000358835 p.N168S GET4 chr7 887470 887470 Missense_Mutation G G T TCGA-3S-A8YW-01A-11D-A423-09 ENST00000265857 p.K139N RSPH10B chr7 5943926 5943926 Missense_Mutation C C T TCGA-3S-A8YW-01A-11D-A423-09 ENST00000337579 p.A532T MPP6 chr7 24687613 24687613 Nonstop_Mutation G G C TCGA-3S-A8YW-01A-11D-A423-09 ENST00000222644 p.*541Sext*1 MSR1 chr8 16168848 16168848 Silent C C T TCGA-3S-A8YW-01A-11D-A423-09 ENST00000262101 p.T80T GEM chr8 94250346 94250346 Silent G G T TCGA-3S-A8YW-01A-11D-A423-09 ENST00000297596 p.L285L CDKN2A chr9 21974778 21974781 Frame_Shift_Del GCCA - - TCGA-3S-A8YW-01A-11D-A423-09 ENST00000304494 p.L16Pfs*9 ROR2 chr9 91722973 91722973 3'UTR A A - TCGA-3S-A8YW-01A-11D-A423-09 ENST00000375708 ERP44 chr9 100022183 100022183 Silent G T T TCGA-3S-A8YW-01A-11D-A423-09 ENST00000262455 p.L110L SLC2A6 chr9 133475454 133475454 Silent C C T TCGA-3S-A8YW-01A-11D-A423-09 ENST00000371899 p.T240T FAM69B chr9 136722176 136722176 Missense_Mutation G G C TCGA-3S-A8YW-01A-11D-A423-09 ENST00000371692 p.E120Q ARMC4 chr10 27944834 27944834 Silent G G A TCGA-3S-A8YW-01A-11D-A423-09 ENST00000305242 p.T505T KCNQ1 chr11 2521497 2521497 Intron A A G TCGA-3S-A8YW-01A-11D-A423-09 ENST00000155840 KIF18A chr11 28084655 28084655 Missense_Mutation G G A TCGA-3S-A8YW-01A-11D-A423-09 ENST00000263181 p.R351W ACTN3 chr11 66560022 66560022 Silent C C T TCGA-3S-A8YW-01A-11D-A423-09 ENST00000513398 p.C494C NTF3 chr12 5494632 5494632 Missense_Mutation G G A TCGA-3S-A8YW-01A-11D-A423-09 ENST00000331010 p.A140T NANOGP1 chr12 7899038 7899038 RNA C C T TCGA-3S-A8YW-01A-11D-A423-09 ENST00000607111 RIMKLB chr12 8774210 8774210 3'UTR A T T TCGA-3S-A8YW-01A-11D-A423-09 ENST00000357529 R3HDM2 chr12 57253776 57253776 3'UTR T T - TCGA-3S-A8YW-01A-11D-A423-09 ENST00000347140 TDG chr12 103987330 103987330 3'UTR C C T TCGA-3S-A8YW-01A-11D-A423-09 ENST00000392872 TPCN1 chr12 113296029 113296029 Missense_Mutation G G A TCGA-3S-A8YW-01A-11D-A423-09 ENST00000335509 p.A802T TPCN1 chr12 113296030 113296030 Missense_Mutation C C T TCGA-3S-A8YW-01A-11D-A423-09 ENST00000335509 p.A802V DNAH10 chr12 123923808 123923808 Missense_Mutation T T A TCGA-3S-A8YW-01A-11D-A423-09 ENST00000409039 p.I3733N FAM179B chr14 44964373 44964373 Missense_Mutation G G T TCGA-3S-A8YW-01A-11D-A423-09 ENST00000361577 p.S651I ZBTB42 chr14 104803078 104803078 3'UTR G G T TCGA-3S-A8YW-01A-11D-A423-09 ENST00000342537 ATP10A chr15 25679436 25679436 Missense_Mutation G G A TCGA-3S-A8YW-01A-11D-A423-09 ENST00000356865 p.R1469C OCA2 chr15 28018538 28018538 Silent G G A TCGA-3S-A8YW-01A-11D-A423-09 ENST00000354638 p.H222H TP53 chr17 7673778 7673778 Frame_Shift_Del T - - TCGA-3S-A8YW-01A-11D-A423-09 ENST00000269305 p.D281Afs*64 Metazoa_SRP chr17 20339951 20339951 5'Flank G G A TCGA-3S-A8YW-01A-11D-A423-09 ENST00000618956 ERBB2 chr17 39725174 39725174 Silent C C T TCGA-3S-A8YW-01A-11D-A423-09 ENST00000269571 p.D873D KRT222 chr17 40657564 40657564 Intron C C T TCGA-3S-A8YW-01A-11D-A423-09 ENST00000394052 COASY chr17 42564432 42564432 Intron C C T TCGA-3S-A8YW-01A-11D-A423-09 ENST00000393818 TEX14 chr17 58585990 58585990 Missense_Mutation C C T TCGA-3S-A8YW-01A-11D-A423-09 ENST00000240361 p.A967T RALBP1 chr18 9536115 9536115 3'UTR C C T TCGA-3S-A8YW-01A-11D-A423-09 ENST00000019317 RNF138 chr18 32126779 32126779 Silent A A G TCGA-3S-A8YW-01A-11D-A423-09 ENST00000261593 p.Q216Q ZNF730 chr19 23146516 23146516 Missense_Mutation G G A TCGA-3S-A8YW-01A-11D-A423-09 ENST00000597761 p.R491Q FFAR3 chr19 35358977 35358977 Silent C C T TCGA-3S-A8YW-01A-11D-A423-09 ENST00000327809 p.L29L RYR1 chr19 38585020 38585020 Silent C C T TCGA-3S-A8YW-01A-11D-A423-09 ENST00000359596 p.D4908D ESF1 chr20 13772564 13772564 Missense_Mutation C C T TCGA-3S-A8YW-01A-11D-A423-09 ENST00000202816 p.G401R LAMA5 chr20 62320841 62320841 Silent G G A TCGA-3S-A8YW-01A-11D-A423-09 ENST00000252999 p.G2182G PI4KAP2 chr22 21492040 21492040 5'Flank C C - TCGA-3S-A8YW-01A-11D-A423-09 ENST00000480319 TMSB4X chrX 12977073 12977073 3'UTR G G A TCGA-3S-A8YW-01A-11D-A423-09 ENST00000380633 DMD chrX 31968512 31968512 Missense_Mutation T T G TCGA-3S-A8YW-01A-11D-A423-09 ENST00000357033 p.E2147D RP11-413G15.1 chr1 83446589 83446590 RNA - - A TCGA-X7-A8DB-01A-11D-A423-09 ENST00000446227 CELSR3 chr3 48650486 48650486 Frame_Shift_Del C C - TCGA-X7-A8DB-01A-11D-A423-09 ENST00000164024 p.A2156Pfs*38 ZNF384 chr12 6688168 6688169 Splice_Region CT CT - TCGA-X7-A8DB-01A-11D-A423-09 ENST00000361959 TDG chr12 103988376 103988376 3'UTR A A G TCGA-X7-A8DB-01A-11D-A423-09 ENST00000392872 FAM230B chr22 21184007 21184007 RNA C C G TCGA-X7-A8DB-01A-11D-A423-09 ENST00000451257 NRAS chr1 114713909 114713909 Missense_Mutation G G T TCGA-XU-A92O-01A-11D-A423-09 ENST00000369535 p.Q61K PDE4DIP chr1 149031979 149031979 Silent C C T TCGA-XU-A92O-01A-11D-A423-09 ENST00000369354 p.A2345A SPTA1 chr1 158672138 158672138 Missense_Mutation C C T TCGA-XU-A92O-01A-11D-A423-09 ENST00000368147 p.R470H LY9 chr1 160799814 160799814 Silent C C T TCGA-XU-A92O-01A-11D-A423-09 ENST00000263285 p.S62S OR14A16 chr1 247814845 247814845 Missense_Mutation C C A TCGA-XU-A92O-01A-11D-A423-09 ENST00000357627 p.K295N MCFD2 chr2 46901915 46901915 3'UTR T T C TCGA-XU-A92O-01A-11D-A423-09 ENST00000319466 ALMS1 chr2 73453458 73453458 Missense_Mutation G G A TCGA-XU-A92O-01A-11D-A423-09 ENST00000613296 p.V2311I SETD5 chr3 9464763 9464763 Intron T T C TCGA-XU-A92O-01A-11D-A423-09 ENST00000402198 ZBBX chr3 167328010 167328010 Missense_Mutation A A G TCGA-XU-A92O-01A-11D-A423-09 ENST00000392766 p.V265A BMPR1B chr4 95114785 95114785 Missense_Mutation G G T TCGA-XU-A92O-01A-11D-A423-09 ENST00000264568 p.G70V CTNND2 chr5 11110950 11110950 Missense_Mutation C C A TCGA-XU-A92O-01A-11D-A423-09 ENST00000304623 p.D791Y TRIO chr5 14389328 14389328 Missense_Mutation C C A TCGA-XU-A92O-01A-11D-A423-09 ENST00000344204 p.P1330T BRD2 chr6 32975471 32975471 Missense_Mutation T T A TCGA-XU-A92O-01A-11D-A423-09 ENST00000374825 p.C141S WIPI2 chr7 5231065 5231065 3'UTR A A - TCGA-XU-A92O-01A-11D-A423-09 ENST00000288828 GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-XU-A92O-01A-11D-A423-09 ENST00000573035 p.L424H TMEM215 chr9 32785533 32785533 3'UTR G G A TCGA-XU-A92O-01A-11D-A423-09 ENST00000342743 FRA10AC1 chr10 93669829 93669829 Silent T T C TCGA-XU-A92O-01A-11D-A423-09 ENST00000359204 p.L315L PTDSS2 chr11 489643 489643 Missense_Mutation C C T TCGA-XU-A92O-01A-11D-A423-09 ENST00000308020 p.P342L SLC39A13 chr11 47413451 47413451 Missense_Mutation T T C TCGA-XU-A92O-01A-11D-A423-09 ENST00000362021 p.C197R RASGRP2 chr11 64740216 64740216 Intron C C T TCGA-XU-A92O-01A-11D-A423-09 ENST00000354024 KIRREL3 chr11 126446783 126446783 Silent G G T TCGA-XU-A92O-01A-11D-A423-09 ENST00000525144 p.V367V TBK1 chr12 64464462 64464462 Splice_Region G G A TCGA-XU-A92O-01A-11D-A423-09 ENST00000331710 p.V119V CLIP1 chr12 122377435 122377435 Missense_Mutation G G A TCGA-XU-A92O-01A-11D-A423-09 ENST00000540338 p.S204L PPP4R4 chr14 94240690 94240690 Missense_Mutation A A G TCGA-XU-A92O-01A-11D-A423-09 ENST00000304338 p.I291V PFN1 chr17 4945677 4945678 3'UTR - - A TCGA-XU-A92O-01A-11D-A423-09 ENST00000225655 SDK2 chr17 73398080 73398080 Silent C C T TCGA-XU-A92O-01A-11D-A423-09 ENST00000392650 p.V1103V H3F3B chr17 75777961 75777961 3'UTR A A C TCGA-XU-A92O-01A-11D-A423-09 ENST00000254810 ZNF519 chr18 14106163 14106163 Missense_Mutation T T C TCGA-XU-A92O-01A-11D-A423-09 ENST00000590202 p.K126R AMH chr19 2250394 2250394 Missense_Mutation G G A TCGA-XU-A92O-01A-11D-A423-09 ENST00000221496 p.G157D MYO9B chr19 17184925 17184925 Missense_Mutation A A G TCGA-XU-A92O-01A-11D-A423-09 ENST00000594824 p.T812A TPTE chr21 10602105 10602105 Silent C C T TCGA-XU-A92O-01A-11D-A423-09 ENST00000618007 p.D468D IGSF1 chrX 131275559 131275559 Missense_Mutation G G A TCGA-XU-A92O-01A-11D-A423-09 ENST00000361420 p.R1035C F8 chrX 154931192 154931192 Missense_Mutation C A A TCGA-XU-A92O-01A-11D-A423-09 ENST00000360256 p.M866I NBPF25P chr1 145578886 145578886 RNA T T C TCGA-4X-A9FC-01A-11D-A423-09 ENST00000619932 KIAA2026 chr9 5919250 5919250 3'UTR T T - TCGA-4X-A9FC-01A-11D-A423-09 ENST00000399933 ESX1 chrX 104250434 104250434 Missense_Mutation C C G TCGA-4X-A9FC-01A-11D-A423-09 ENST00000372588 p.V339L COL11A1 chr1 103074658 103074658 Missense_Mutation G G A TCGA-XU-A92Y-01A-11D-A423-09 ENST00000370096 p.T204M PKLR chr1 155295302 155295302 Missense_Mutation C C T TCGA-XU-A92Y-01A-11D-A423-09 ENST00000342741 p.G170S RGS16 chr1 182599559 182599559 3'UTR G G A TCGA-XU-A92Y-01A-11D-A423-09 ENST00000367558 TMEM127 chr2 96251537 96251538 3'UTR - - A TCGA-XU-A92Y-01A-11D-A423-09 ENST00000258439 LRRC1 chr6 53923433 53923433 3'UTR G G T TCGA-XU-A92Y-01A-11D-A423-09 ENST00000370888 CNKSR3 chr6 154442218 154442218 Missense_Mutation T T C TCGA-XU-A92Y-01A-11D-A423-09 ENST00000607772 p.N97D PEG10 chr7 94664504 94664504 Silent G G A TCGA-XU-A92Y-01A-11D-A423-09 ENST00000482108 p.S316S PTCH1 chr9 95443749 95443749 3'UTR T T - TCGA-XU-A92Y-01A-11D-A423-09 ENST00000331920 RNLS chr10 88274945 88274946 3'UTR - - C TCGA-XU-A92Y-01A-11D-A423-09 ENST00000371947 NRAP chr10 113614944 113614944 Splice_Region C C T TCGA-XU-A92Y-01A-11D-A423-09 ENST00000359988 p.T1027T FAM111B chr11 59125857 59125857 Missense_Mutation T T C TCGA-XU-A92Y-01A-11D-A423-09 ENST00000343597 p.I587T CCDC65 chr12 48923757 48923757 3'Flank T T C TCGA-XU-A92Y-01A-11D-A423-09 ENST00000320516 CCDC43 chr17 44679031 44679031 Missense_Mutation T T C TCGA-XU-A92Y-01A-11D-A423-09 ENST00000315286 p.N167S LGALS3BP chr17 78973208 78973208 Missense_Mutation G G C TCGA-XU-A92Y-01A-11D-A423-09 ENST00000262776 p.H131D GPS1 chr17 82054781 82054781 Missense_Mutation G G A TCGA-XU-A92Y-01A-11D-A423-09 ENST00000306823 p.V198I TNRC6B chr22 40324290 40324291 3'UTR - - T TCGA-XU-A92Y-01A-11D-A423-09 ENST00000454349 CDC25A chr3 48158363 48158363 3'UTR T T - TCGA-X7-A8DC-01A-11D-A423-09 ENST00000302506 FNDC3B chr3 172399394 172399394 3'UTR A A - TCGA-X7-A8DC-01A-11D-A423-09 ENST00000336824 LPP chr3 188878766 188878766 3'UTR A A T TCGA-X7-A8DC-01A-11D-A423-09 ENST00000617246 LZTS1 chr8 20249436 20249436 3'UTR G G A TCGA-X7-A8DC-01A-11D-A423-09 ENST00000265801 ZNF503 chr10 75398027 75398027 3'UTR T T - TCGA-X7-A8DC-01A-11D-A423-09 ENST00000372524 OR2D2 chr11 6892431 6892431 Missense_Mutation C C T TCGA-X7-A8DC-01A-11D-A423-09 ENST00000299459 p.E24K DDX10 chr11 108723005 108723005 Missense_Mutation G G T TCGA-X7-A8DC-01A-11D-A423-09 ENST00000322536 p.G503V XAB2 chr19 7622598 7622598 Missense_Mutation G G A TCGA-X7-A8DC-01A-11D-A423-09 ENST00000358368 p.R479C JUND chr19 18279968 18279969 3'UTR AC AC - TCGA-X7-A8DC-01A-11D-A423-09 ENST00000252818 MROH9 chr1 171016329 171016329 Missense_Mutation T T C TCGA-ZT-A8OM-01A-11D-A428-09 ENST00000367759 p.M634T TPR chr1 186343920 186343920 Silent A A T TCGA-ZT-A8OM-01A-11D-A428-09 ENST00000367478 p.I1196I AKT3 chr1 243503102 243503102 3'UTR A A - TCGA-ZT-A8OM-01A-11D-A428-09 ENST00000263826 LRRTM1 chr2 80301916 80301917 3'UTR - - A TCGA-ZT-A8OM-01A-11D-A428-09 ENST00000295057 ATF2 chr2 175074496 175074496 3'UTR A A - TCGA-ZT-A8OM-01A-11D-A428-09 ENST00000264110 NIT2 chr3 100355352 100355352 3'UTR T T - TCGA-ZT-A8OM-01A-11D-A428-09 ENST00000394140 MME chr3 155115031 155115031 Silent G G A TCGA-ZT-A8OM-01A-11D-A428-09 ENST00000360490 p.E78E LPAL2 chr6 160467591 160467591 RNA C C G TCGA-ZT-A8OM-01A-11D-A428-09 ENST00000454031 MUC2 chr11 1097354 1097354 RNA T T A TCGA-ZT-A8OM-01A-11D-A428-09 ENST00000361558 CAPRIN1 chr11 34097294 34097294 Missense_Mutation C C T TCGA-ZT-A8OM-01A-11D-A428-09 ENST00000341394 p.R667W STAT6 chr12 57105323 57105323 Missense_Mutation T T G TCGA-ZT-A8OM-01A-11D-A428-09 ENST00000300134 p.K277Q AC090825.1 chr15 99790533 99790533 5'Flank A A - TCGA-ZT-A8OM-01A-11D-A428-09 ENST00000408584 NBPF14 chr1 148533964 148533964 Missense_Mutation C C T TCGA-3Q-A9WF-01A-11D-A423-09 ENST00000619423 p.E2874K TCERG1 chr5 146511047 146511047 3'UTR T T - TCGA-3Q-A9WF-01A-11D-A423-09 ENST00000296702 RECK chr9 36123176 36123176 3'UTR T T - TCGA-3Q-A9WF-01A-11D-A423-09 ENST00000377966 RAG1 chr11 36579547 36579547 3'UTR T T - TCGA-3Q-A9WF-01A-11D-A423-09 ENST00000299440 CIT chr12 119686134 119686135 3'UTR - - T TCGA-3Q-A9WF-01A-11D-A423-09 ENST00000261833 POSTN chr13 37563178 37563179 3'UTR - - A TCGA-3Q-A9WF-01A-11D-A423-09 ENST00000379747 GOLGA6L9 chr15 82434428 82434428 Silent C C T TCGA-3Q-A9WF-01A-11D-A423-09 ENST00000618348 p.D276D SMG1P3 chr16 21473225 21473225 RNA T T C TCGA-3Q-A9WF-01A-11D-A423-09 ENST00000522480 PSG8 chr19 42753318 42753318 3'Flank C C T TCGA-3Q-A9WF-01A-11D-A423-09 ENST00000306511 H6PD chr1 9264369 9264369 Missense_Mutation C C T TCGA-X7-A8M5-01A-11D-A423-09 ENST00000377403 p.L626F CSMD2 chr1 33698785 33698785 Missense_Mutation C C T TCGA-X7-A8M5-01A-11D-A423-09 ENST00000241312 p.R1258Q ATF3 chr1 212619301 212619301 Intron C C - TCGA-X7-A8M5-01A-11D-A423-09 ENST00000341491 TTN chr2 178553114 178553114 Missense_Mutation T T G TCGA-X7-A8M5-01A-11D-A423-09 ENST00000591111 p.K28288T TTN chr2 178740884 178740884 Missense_Mutation T T C TCGA-X7-A8M5-01A-11D-A423-09 ENST00000591111 p.I3800V TTN chr2 178740886 178740886 Missense_Mutation G G A TCGA-X7-A8M5-01A-11D-A423-09 ENST00000591111 p.S3799F KIF9 chr3 47244904 47244904 Silent A A G TCGA-X7-A8M5-01A-11D-A423-09 ENST00000265529 p.D467D DAG1 chr3 49534188 49534188 3'UTR T T - TCGA-X7-A8M5-01A-11D-A423-09 ENST00000308775 SH3TC1 chr4 8227590 8227590 Silent G G A TCGA-X7-A8M5-01A-11D-A423-09 ENST00000245105 p.L632L RBPJ chr4 26320632 26320634 Intron CTC CTC - TCGA-X7-A8M5-01A-11D-A423-09 ENST00000342295 UBE2D3 chr4 102797151 102797151 3'Flank T T - TCGA-X7-A8M5-01A-11D-A423-09 ENST00000321805 FGG chr4 154610067 154610067 Missense_Mutation C C G TCGA-X7-A8M5-01A-11D-A423-09 ENST00000336098 p.D178H DHX16 chr6 30665579 30665579 Missense_Mutation C C T TCGA-X7-A8M5-01A-11D-A423-09 ENST00000376442 p.R274Q TTBK1 chr6 43269958 43269958 Intron C C - TCGA-X7-A8M5-01A-11D-A423-09 ENST00000259750 EEF1A1 chr6 73517668 73517668 3'UTR T T G TCGA-X7-A8M5-01A-11D-A423-09 ENST00000309268 PRDM1 chr6 106104993 106104993 Missense_Mutation A A G TCGA-X7-A8M5-01A-11D-A423-09 ENST00000369096 p.K278R GTF2IRD2P1 chr7 73280076 73280076 RNA C C T TCGA-X7-A8M5-01A-11D-A423-09 ENST00000449689 GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-X7-A8M5-01A-11D-A423-09 ENST00000573035 p.L424H TNPO3 chr7 128970207 128970207 Missense_Mutation G G C TCGA-X7-A8M5-01A-11D-A423-09 ENST00000265388 p.P847A GOT1L1 chr8 37937730 37937730 Missense_Mutation A A G TCGA-X7-A8M5-01A-11D-A423-09 ENST00000307599 p.V106A SNTG1 chr8 50402304 50402304 Missense_Mutation A A T TCGA-X7-A8M5-01A-11D-A423-09 ENST00000518864 p.Q41L RDH10 chr8 73324444 73324444 3'UTR T T - TCGA-X7-A8M5-01A-11D-A423-09 ENST00000240285 AGO2 chr8 140562527 140562527 Silent T T C TCGA-X7-A8M5-01A-11D-A423-09 ENST00000220592 p.S148S IFNK chr9 27524945 27524945 Silent A A G TCGA-X7-A8M5-01A-11D-A423-09 ENST00000276943 p.L203L ABCC2 chr10 99819198 99819198 Missense_Mutation C C T TCGA-X7-A8M5-01A-11D-A423-09 ENST00000370449 p.A850V IFITM10 chr11 1747841 1747841 Silent C C T TCGA-X7-A8M5-01A-11D-A423-09 ENST00000340134 p.A121A TMPRSS13 chr11 117918643 117918643 Silent G G T TCGA-X7-A8M5-01A-11D-A423-09 ENST00000524993 p.R73R SCYL2 chr12 100338658 100338658 Missense_Mutation C C T TCGA-X7-A8M5-01A-11D-A423-09 ENST00000360820 p.S759F RIPK3 chr14 24338427 24338427 Silent G G A TCGA-X7-A8M5-01A-11D-A423-09 ENST00000216274 p.V204V PSEN1 chr14 73173566 73173566 Splice_Region A A C TCGA-X7-A8M5-01A-11D-A423-09 ENST00000324501 p.L113L DNM1P35 chr15 75738096 75738096 Intron G G A TCGA-X7-A8M5-01A-11D-A423-09 ENST00000501931 DNM1P35 chr15 75738097 75738097 Intron C C G TCGA-X7-A8M5-01A-11D-A423-09 ENST00000501931 CRYM chr16 21278242 21278242 Missense_Mutation C C T TCGA-X7-A8M5-01A-11D-A423-09 ENST00000219599 p.V4I SLC22A31 chr16 89199457 89199457 5'UTR T T G TCGA-X7-A8M5-01A-11D-A423-09 ENST00000614943 RAB34 chr17 28717686 28717686 Intron C C A TCGA-X7-A8M5-01A-11D-A423-09 ENST00000301043 RHOT1 chr17 32224943 32224943 3'UTR G G A TCGA-X7-A8M5-01A-11D-A423-09 ENST00000333942 H3F3B chr17 75779149 75779149 Missense_Mutation C C A TCGA-X7-A8M5-01A-11D-A423-09 ENST00000254810 p.R9L OR7D4 chr19 9214745 9214745 Silent G G A TCGA-X7-A8M5-01A-11D-A423-09 ENST00000308682 p.F31F FOSB chr19 45475136 45475136 3'UTR C C T TCGA-X7-A8M5-01A-11D-A423-09 ENST00000353609 EPB41L1 chr20 36173762 36173762 Splice_Site A A G TCGA-X7-A8M5-01A-11D-A423-09 ENST00000338074 ATP6V1E1 chr22 17613248 17613248 Missense_Mutation C C T TCGA-X7-A8M5-01A-11D-A423-09 ENST00000253413 p.E58K KIAA2022 chrX 74740638 74740638 Missense_Mutation C C T TCGA-X7-A8M5-01A-11D-A423-09 ENST00000055682 p.D1307N KIAA2022 chrX 74741710 74741710 Silent C C A TCGA-X7-A8M5-01A-11D-A423-09 ENST00000055682 p.L949L COX7B chrX 77905318 77905318 3'UTR A A T TCGA-X7-A8M5-01A-11D-A423-09 ENST00000481445 DCAF12L2 chrX 126165337 126165337 Missense_Mutation C C A TCGA-X7-A8M5-01A-11D-A423-09 ENST00000360028 p.W196C GRIK3 chr1 36841917 36841917 Missense_Mutation C C T TCGA-4X-A9FD-01A-11D-A423-09 ENST00000373091 p.R450Q TRIT1 chr1 39841495 39841495 3'UTR A A - TCGA-4X-A9FD-01A-11D-A423-09 ENST00000316891 RAD54L chr1 46259984 46259984 Silent T T C TCGA-4X-A9FD-01A-11D-A423-09 ENST00000371975 p.L98L TAL1 chr1 47219366 47219366 3'UTR G G A TCGA-4X-A9FD-01A-11D-A423-09 ENST00000294339 TNR chr1 175406247 175406247 Silent G G A TCGA-4X-A9FD-01A-11D-A423-09 ENST00000263525 p.N156N FMOD chr1 203347594 203347594 Missense_Mutation A A G TCGA-4X-A9FD-01A-11D-A423-09 ENST00000354955 p.I226T GALNT14 chr2 30924223 30924223 Missense_Mutation G G C TCGA-4X-A9FD-01A-11D-A423-09 ENST00000349752 p.Q426E SEC62 chr3 169966616 169966616 5'Flank G G C TCGA-4X-A9FD-01A-11D-A423-09 ENST00000337002 DMXL1 chr5 119244513 119244514 Frame_Shift_Del AG AG - TCGA-4X-A9FD-01A-11D-A423-09 ENST00000311085 p.K2932Nfs*5 DOCK2 chr5 170050371 170050371 Missense_Mutation A A T TCGA-4X-A9FD-01A-11D-A423-09 ENST00000256935 p.D1396V ZNF318 chr6 43340376 43340376 Missense_Mutation G G T TCGA-4X-A9FD-01A-11D-A423-09 ENST00000361428 p.P1208T LINC00326 chr6 133106194 133106194 RNA C C T TCGA-4X-A9FD-01A-11D-A423-09 ENST00000457339 GTF2IP1 chr7 75210558 75210561 RNA TCTT TCTT - TCGA-4X-A9FD-01A-11D-A423-09 ENST00000622829 KPNA7 chr7 99207462 99207462 Missense_Mutation G G A TCGA-4X-A9FD-01A-11D-A423-09 ENST00000327442 p.P2L KAT6A chr8 41941201 41941201 Missense_Mutation C C A TCGA-4X-A9FD-01A-11D-A423-09 ENST00000265713 p.A894S RHPN1 chr8 143382617 143382617 Missense_Mutation C C T TCGA-4X-A9FD-01A-11D-A423-09 ENST00000620174 p.P685L SLC44A1 chr9 105362936 105362936 Missense_Mutation T T G TCGA-4X-A9FD-01A-11D-A423-09 ENST00000374720 p.F339C MUC5B chr11 1250181 1250181 Missense_Mutation C C T TCGA-4X-A9FD-01A-11D-A423-09 ENST00000529681 p.T4434I C11orf86 chr11 66976180 66976181 Frame_Shift_Ins - - T TCGA-4X-A9FD-01A-11D-A423-09 ENST00000308963 p.R94Kfs*92 EIF4B chr12 53006463 53006463 5'UTR G G A TCGA-4X-A9FD-01A-11D-A423-09 ENST00000262056 TSC22D1 chr13 44434026 44434026 3'UTR C C T TCGA-4X-A9FD-01A-11D-A423-09 ENST00000458659 PARP16 chr15 65259130 65259130 3'UTR C C G TCGA-4X-A9FD-01A-11D-A423-09 ENST00000261888 DNM1P47 chr15 101763886 101763886 RNA G G C TCGA-4X-A9FD-01A-11D-A423-09 ENST00000561463 NLRC5 chr16 57061479 57061479 Missense_Mutation G G T TCGA-4X-A9FD-01A-11D-A423-09 ENST00000262510 p.V1340L CNTNAP4 chr16 76539737 76539737 Missense_Mutation A A G TCGA-4X-A9FD-01A-11D-A423-09 ENST00000611870 p.Y1080C ATP2C2 chr16 84459447 84459447 Intron G G A TCGA-4X-A9FD-01A-11D-A423-09 ENST00000262429 FOXF1 chr16 86510859 86510859 Missense_Mutation G G T TCGA-4X-A9FD-01A-11D-A423-09 ENST00000262426 p.R97L URI1 chr19 29985243 29985243 Missense_Mutation A A G TCGA-4X-A9FD-01A-11D-A423-09 ENST00000392271 p.Y58C BPIFB1 chr20 33288862 33288862 Silent C C T TCGA-4X-A9FD-01A-11D-A423-09 ENST00000253354 p.T79T PHKA2 chrX 18948820 18948820 Missense_Mutation C C T TCGA-4X-A9FD-01A-11D-A423-09 ENST00000379942 p.R154H KIAA2022 chrX 74738824 74738824 3'UTR G G A TCGA-4X-A9FD-01A-11D-A423-09 ENST00000055682 FLRT1 chr11 64118607 64118607 3'UTR C C T TCGA-X7-A8D7-01A-11D-A423-09 ENST00000246841 AC100757.1 chr15 22427394 22427394 3'Flank C C T TCGA-X7-A8D7-01A-11D-A423-09 ENST00000408073 MST1P2 chr1 16646853 16646853 RNA G G T TCGA-ZB-A96K-01A-11D-A428-09 ENST00000457982 EPAS1 chr2 46384536 46384536 Missense_Mutation C C T TCGA-ZB-A96K-01A-11D-A428-09 ENST00000263734 p.S830L NRXN1 chr2 49921003 49921003 3'UTR A A - TCGA-ZB-A96K-01A-11D-A428-09 ENST00000406316 REV1 chr2 99404457 99404457 Missense_Mutation G G A TCGA-ZB-A96K-01A-11D-A428-09 ENST00000258428 p.P1011L ANKRD28 chr3 15669000 15669000 3'UTR G G A TCGA-ZB-A96K-01A-11D-A428-09 ENST00000399451 FAT4 chr4 125449274 125449274 Missense_Mutation A A T TCGA-ZB-A96K-01A-11D-A428-09 ENST00000394329 p.Q2753L GPLD1 chr6 24466715 24466716 Nonsense_Mutation - - T TCGA-ZB-A96K-01A-11D-A428-09 ENST00000230036 p.Y262* VEGFA chr6 43786440 43786440 3'Flank A A - TCGA-ZB-A96K-01A-11D-A428-09 ENST00000523873 GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-ZB-A96K-01A-11D-A428-09 ENST00000573035 p.L424H YTHDF3 chr8 63211772 63211772 3'UTR G G T TCGA-ZB-A96K-01A-11D-A428-09 ENST00000539294 ELAVL2 chr9 23690408 23690408 3'Flank T T - TCGA-ZB-A96K-01A-11D-A428-09 ENST00000380117 GRID1 chr10 85602447 85602447 Silent C C T TCGA-ZB-A96K-01A-11D-A428-09 ENST00000327946 p.P952P CCND2 chr12 4300355 4300355 3'UTR T T - TCGA-ZB-A96K-01A-11D-A428-09 ENST00000261254 MPP5 chr14 67301407 67301407 Missense_Mutation C C G TCGA-ZB-A96K-01A-11D-A428-09 ENST00000261681 p.P199A RLTPR chr16 67657416 67657416 Silent T T A TCGA-ZB-A96K-01A-11D-A428-09 ENST00000334583 p.L1402L PAFAH1B1 chr17 2638277 2638277 5'UTR A A C TCGA-ZB-A96K-01A-11D-A428-09 ENST00000397195 SEPT9 chr17 77402372 77402372 Silent C C T TCGA-ZB-A96K-01A-11D-A428-09 ENST00000427177 p.F130F TPM4 chr19 16088083 16088083 Silent G G A TCGA-ZB-A96K-01A-11D-A428-09 ENST00000300933 p.A147A GPCPD1 chr20 5546788 5546789 3'UTR - - T TCGA-ZB-A96K-01A-11D-A428-09 ENST00000379019 KCTD17 chr22 37056352 37056352 Missense_Mutation G G A TCGA-ZB-A96K-01A-11D-A428-09 ENST00000403888 p.G118S FAM69A chr1 92843310 92843311 3'UTR - - T TCGA-ZB-A96O-01A-11D-A428-09 ENST00000370310 POM121 chr7 72942166 72942166 Missense_Mutation C C T TCGA-ZB-A96O-01A-11D-A428-09 ENST00000434423 p.P725S CLIP2 chr7 74404521 74404522 3'UTR AC AC - TCGA-ZB-A96O-01A-11D-A428-09 ENST00000223398 KIF4A chrX 70290422 70290422 Intron T T - TCGA-ZB-A96O-01A-11D-A428-09 ENST00000374403 SPEN chr1 15930726 15930726 Missense_Mutation A A C TCGA-ZB-A964-01A-11D-A428-09 ENST00000375759 p.K1496Q EBNA1BP2 chr1 43172465 43172465 5'Flank T T C TCGA-ZB-A964-01A-11D-A428-09 ENST00000236051 BLZF1 chr1 169380534 169380534 Missense_Mutation G G A TCGA-ZB-A964-01A-11D-A428-09 ENST00000329281 p.R241H DNAJC27 chr2 24971882 24971882 Missense_Mutation C C A TCGA-ZB-A964-01A-11D-A428-09 ENST00000264711 p.R8L HNMT chr2 138014711 138014711 3'UTR A A G TCGA-ZB-A964-01A-11D-A428-09 ENST00000280097 GPD2 chr2 156579700 156579700 Missense_Mutation T T G TCGA-ZB-A964-01A-11D-A428-09 ENST00000310454 p.V657G HNRNPCP2 chr2 189923350 189923350 RNA T T C TCGA-ZB-A964-01A-11D-A428-09 ENST00000399515 RP11-71H17.7 chr3 124719578 124719578 5'Flank T T C TCGA-ZB-A964-01A-11D-A428-09 ENST00000568966 TLR2 chr4 153705218 153705218 Missense_Mutation C C T TCGA-ZB-A964-01A-11D-A428-09 ENST00000260010 p.R771W VARS chr6 31792766 31792766 Missense_Mutation G G A TCGA-ZB-A964-01A-11D-A428-09 ENST00000375663 p.H218Y SOBP chr6 107659532 107659532 3'UTR T T - TCGA-ZB-A964-01A-11D-A428-09 ENST00000317357 HECW1 chr7 43118232 43118232 Intron A A - TCGA-ZB-A964-01A-11D-A428-09 ENST00000395891 GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-ZB-A964-01A-11D-A428-09 ENST00000573035 p.L424H OPLAH chr8 144056472 144056472 Missense_Mutation G G T TCGA-ZB-A964-01A-11D-A428-09 ENST00000618853 p.D632E HRAS chr11 533552 533552 Missense_Mutation C C G TCGA-ZB-A964-01A-11D-A428-09 ENST00000311189 p.K117N NPAT chr11 108172290 108172290 Silent A A T TCGA-ZB-A964-01A-11D-A428-09 ENST00000278612 p.T898T PCSK7 chr11 117218501 117218501 Missense_Mutation G G A TCGA-ZB-A964-01A-11D-A428-09 ENST00000320934 p.P500L WNK1 chr12 885368 885368 Missense_Mutation G G A TCGA-ZB-A964-01A-11D-A428-09 ENST00000315939 p.V1522M PUS1 chr12 131941880 131941880 Missense_Mutation T T C TCGA-ZB-A964-01A-11D-A428-09 ENST00000376649 p.I378T C15orf54 chr15 39254337 39254337 RNA T T - TCGA-ZB-A964-01A-11D-A428-09 ENST00000625107 TBC1D3K chr17 37924421 37924421 5'UTR C C T TCGA-ZB-A964-01A-11D-A428-09 ENST00000620247 APPBP2 chr17 60446921 60446921 3'UTR A A - TCGA-ZB-A964-01A-11D-A428-09 ENST00000083182 JUND chr19 18282099 18282099 5'Flank C C T TCGA-ZB-A964-01A-11D-A428-09 ENST00000252818 MIIP chr1 12022321 12022321 Missense_Mutation C C T TCGA-XU-A933-01A-11D-A423-09 ENST00000235332 p.A114V CDA chr1 20604996 20604996 Missense_Mutation G G T TCGA-XU-A933-01A-11D-A423-09 ENST00000375071 p.V75F NFIA chr1 61082774 61082774 5'UTR C C A TCGA-XU-A933-01A-11D-A423-09 ENST00000403491 RP11-413G15.1 chr1 83446589 83446590 RNA - - A TCGA-XU-A933-01A-11D-A423-09 ENST00000446227 HIST2H2AB chr1 149887508 149887529 Missense_Mutation GTGTCAAGCCTCTTAATTACTT GTGTCAAGCCTCTTAATTACTT - TCGA-XU-A933-01A-11D-A423-09 ENST00000331128 UBAP2L chr1 154259027 154259027 Silent A A C TCGA-XU-A933-01A-11D-A423-09 ENST00000361546 p.P831P BRINP3 chr1 190480535 190480535 5'Flank T T C TCGA-XU-A933-01A-11D-A423-09 ENST00000367462 RGS1 chr1 192579141 192579141 Missense_Mutation A A G TCGA-XU-A933-01A-11D-A423-09 ENST00000367459 p.N150S FBXO28 chr1 224157485 224157518 Frame_Shift_Del TTCTGAGCTTCGCACCAAAGTGCAAGAACAGCAA TTCTGAGCTTCGCACCAAAGTGCAAGAACAGCAA - TCGA-XU-A933-01A-11D-A423-09 ENST00000366862 p.S283Nfs*11 CCSAP chr1 229342924 229342924 5'UTR G G A TCGA-XU-A933-01A-11D-A423-09 ENST00000284617 OR2W3 chr1 247896153 247896153 Silent C C T TCGA-XU-A933-01A-11D-A423-09 ENST00000360358 p.C189C ODC1 chr2 10444536 10444536 Missense_Mutation C C A TCGA-XU-A933-01A-11D-A423-09 ENST00000234111 p.D72Y KLHL29 chr2 23696399 23696400 Frame_Shift_Ins - - CCTCGTCT TCGA-XU-A933-01A-11D-A423-09 ENST00000486442 p.R668Sfs*5 APLF chr2 68526142 68526142 Missense_Mutation A A G TCGA-XU-A933-01A-11D-A423-09 ENST00000303795 p.Q235R SCN1A chr2 166012239 166012239 Missense_Mutation G G A TCGA-XU-A933-01A-11D-A423-09 ENST00000303395 p.T1250M ATF2 chr2 175074496 175074496 3'UTR A A - TCGA-XU-A933-01A-11D-A423-09 ENST00000264110 TTN chr2 178696106 178696106 Silent G G A TCGA-XU-A933-01A-11D-A423-09 ENST00000591111 p.D10005D HECW2 chr2 196317321 196317321 Missense_Mutation C C T TCGA-XU-A933-01A-11D-A423-09 ENST00000260983 p.R796H SPEG chr2 219467200 219467200 Missense_Mutation G G A TCGA-XU-A933-01A-11D-A423-09 ENST00000312358 p.V970M HDLBP chr2 241253433 241253433 Missense_Mutation T T C TCGA-XU-A933-01A-11D-A423-09 ENST00000391975 p.N418S LRRFIP2 chr3 37053607 37053607 3'UTR G G A TCGA-XU-A933-01A-11D-A423-09 ENST00000336686 ALG1L2 chr3 130091370 130091370 Missense_Mutation C C T TCGA-XU-A933-01A-11D-A423-09 ENST00000425059 p.R44C ARAP2 chr4 36067817 36067817 3'UTR T T A TCGA-XU-A933-01A-11D-A423-09 ENST00000303965 ARAP2 chr4 36067818 36067818 3'UTR G G A TCGA-XU-A933-01A-11D-A423-09 ENST00000303965 KIT chr4 54727444 54727444 Missense_Mutation T T G TCGA-XU-A933-01A-11D-A423-09 ENST00000288135 p.V559G CTNND2 chr5 11384985 11385000 Frame_Shift_Del GCCGAGCCGCCGCGCT GCCGAGCCGCCGCGCT - TCGA-XU-A933-01A-11D-A423-09 ENST00000304623 p.Q281Pfs*46 ADGRV1 chr5 90763352 90763352 Silent G G C TCGA-XU-A933-01A-11D-A423-09 ENST00000405460 p.V4056V SNCAIP chr5 122423479 122423479 Missense_Mutation G G A TCGA-XU-A933-01A-11D-A423-09 ENST00000261368 p.A248T SLC18B1 chr6 132774306 132774306 Missense_Mutation C C T TCGA-XU-A933-01A-11D-A423-09 ENST00000275227 p.R302K BPGM chr7 134646920 134646920 5'UTR C C G TCGA-XU-A933-01A-11D-A423-09 ENST00000344924 MCMDC2 chr8 66878585 66878585 Missense_Mutation A A G TCGA-XU-A933-01A-11D-A423-09 ENST00000422365 p.I165V POP1 chr8 98157696 98157696 Missense_Mutation G G A TCGA-XU-A933-01A-11D-A423-09 ENST00000349693 p.G834S MUC5B chr11 1231491 1231491 Silent C C T TCGA-XU-A933-01A-11D-A423-09 ENST00000529681 p.L537L CARD17 chr11 105099397 105099397 Missense_Mutation G G T TCGA-XU-A933-01A-11D-A423-09 ENST00000375707 p.T100N AC215219.2 chr12 14669 14669 3'Flank G G A TCGA-XU-A933-01A-11D-A423-09 ENST00000611710 ETV6 chr12 11895390 11895390 3'UTR A A T TCGA-XU-A933-01A-11D-A423-09 ENST00000396373 TRIM13 chr13 50016565 50016565 3'UTR C C G TCGA-XU-A933-01A-11D-A423-09 ENST00000378182 CHD8 chr14 21400057 21400057 Frame_Shift_Del C C - TCGA-XU-A933-01A-11D-A423-09 ENST00000399982 p.V1581Yfs*7 HEATR5A chr14 31296059 31296059 Silent A A G TCGA-XU-A933-01A-11D-A423-09 ENST00000543095 p.D1823D CRIP2 chr14 105473498 105473498 5'Flank A A C TCGA-XU-A933-01A-11D-A423-09 ENST00000329146 ATP10A chr15 25725955 25725955 Silent T T G TCGA-XU-A933-01A-11D-A423-09 ENST00000356865 p.A325A IGDCC3 chr15 65328813 65328813 3'UTR C C A TCGA-XU-A933-01A-11D-A423-09 ENST00000327987 ALPK3 chr15 84862718 84862718 Nonsense_Mutation C C T TCGA-XU-A933-01A-11D-A423-09 ENST00000258888 p.R1607* BRD7 chr16 50323665 50323665 Nonsense_Mutation A A C TCGA-XU-A933-01A-11D-A423-09 ENST00000394688 p.Y455* FOXN1 chr17 28524018 28524018 Missense_Mutation A A G TCGA-XU-A933-01A-11D-A423-09 ENST00000226247 p.T17A RP11-51L5.5 chr17 62289361 62289361 RNA C C T TCGA-XU-A933-01A-11D-A423-09 ENST00000602493 QRICH2 chr17 76277270 76277270 Frame_Shift_Del G G - TCGA-XU-A933-01A-11D-A423-09 ENST00000262765 p.R1554Gfs*35 DNAH17 chr17 78459879 78459879 Silent C C T TCGA-XU-A933-01A-11D-A423-09 ENST00000389840 p.A3186A CARD14 chr17 80208313 80208313 Missense_Mutation A A G TCGA-XU-A933-01A-11D-A423-09 ENST00000344227 p.K995E MUC16 chr19 8905999 8905999 Missense_Mutation G G T TCGA-XU-A933-01A-11D-A423-09 ENST00000397910 p.L12688I MYBL2 chr20 43702645 43702645 Silent C C T TCGA-XU-A933-01A-11D-A423-09 ENST00000217026 p.T369T CASS4 chr20 56453034 56453034 Missense_Mutation G G A TCGA-XU-A933-01A-11D-A423-09 ENST00000360314 p.E620K CASS4 chr20 56453036 56453036 Missense_Mutation A A T TCGA-XU-A933-01A-11D-A423-09 ENST00000360314 p.E620D PIK3IP1 chr22 31281951 31281951 3'UTR G G A TCGA-XU-A933-01A-11D-A423-09 ENST00000215912 MID1 chrX 10459705 10459705 Missense_Mutation A A G TCGA-XU-A933-01A-11D-A423-09 ENST00000317552 p.V463A PAGE5 chrX 55224049 55224049 3'UTR T T A TCGA-XU-A933-01A-11D-A423-09 ENST00000289619 FXYD6P3 chrX 73875596 73875596 RNA C C T TCGA-XU-A933-01A-11D-A423-09 ENST00000495569 FAM46D chrX 80444759 80444759 3'UTR C C T TCGA-XU-A933-01A-11D-A423-09 ENST00000308293 ARMCX2 chrX 101656471 101656471 Missense_Mutation C C T TCGA-XU-A933-01A-11D-A423-09 ENST00000328766 p.R373H IDS chrX 149482996 149482996 Missense_Mutation C C T TCGA-XU-A933-01A-11D-A423-09 ENST00000340855 p.R468Q NRAS chr1 114707685 114707685 3'UTR A A - TCGA-XM-A8RD-01A-11D-A423-09 ENST00000369535 TSPAN5 chr4 98472334 98472334 3'UTR T T - TCGA-XM-A8RD-01A-11D-A423-09 ENST00000305798 SLC6A19 chr5 1221263 1221263 Missense_Mutation G G T TCGA-XM-A8RD-01A-11D-A423-09 ENST00000304460 p.V551L AGR2 chr7 16792671 16792672 3'UTR - - T TCGA-XM-A8RD-01A-11D-A423-09 ENST00000419304 FAM74A1 chr9 39371290 39371290 RNA C C T TCGA-XM-A8RD-01A-11D-A423-09 ENST00000465257 NR4A3 chr9 99866560 99866561 3'Flank - - T TCGA-XM-A8RD-01A-11D-A423-09 ENST00000395097 DNM1P47 chr15 101760306 101760306 RNA G G A TCGA-XM-A8RD-01A-11D-A423-09 ENST00000561463 SAFB chr19 5667344 5667344 Intron A A G TCGA-XM-A8RD-01A-11D-A423-09 ENST00000292123 TMC2 chr20 2537300 2537300 Silent C C T TCGA-XM-A8RD-01A-11D-A423-09 ENST00000358864 p.S22S UCKL1 chr20 63956359 63956359 Frame_Shift_Del G G - TCGA-XM-A8RD-01A-11D-A423-09 ENST00000354216 p.P5Rfs*113 CSMD2 chr1 33698825 33698825 Missense_Mutation G G A TCGA-XU-A92R-01A-11D-A423-09 ENST00000241312 p.R1245W RAD54L chr1 46260848 46260848 Missense_Mutation T T G TCGA-XU-A92R-01A-11D-A423-09 ENST00000371975 p.L200R APOB chr2 21004650 21004650 Silent A A G TCGA-XU-A92R-01A-11D-A423-09 ENST00000233242 p.D3938D GPC1 chr2 240463430 240463430 Silent C C G TCGA-XU-A92R-01A-11D-A423-09 ENST00000264039 p.P267P GFM1 chr3 158682040 158682040 Nonsense_Mutation T T A TCGA-XU-A92R-01A-11D-A423-09 ENST00000486715 p.Y549* PCDHA13 chr5 140882988 140882988 Silent G G A TCGA-XU-A92R-01A-11D-A423-09 ENST00000289272 p.P240P FAM50B chr6 3851059 3851059 3'UTR G G T TCGA-XU-A92R-01A-11D-A423-09 ENST00000380272 NUP153 chr6 17615673 17615689 3'UTR TCTAATCTATACAGAAT TCTAATCTATACAGAAT - TCGA-XU-A92R-01A-11D-A423-09 ENST00000262077 GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-XU-A92R-01A-11D-A423-09 ENST00000573035 p.L424H ZBED6CL chr7 150331062 150331062 Nonsense_Mutation C C T TCGA-XU-A92R-01A-11D-A423-09 ENST00000343855 p.R220* RAB3IP chr12 69801709 69801709 Missense_Mutation G G A TCGA-XU-A92R-01A-11D-A423-09 ENST00000550536 p.C389Y ELF1 chr13 40941070 40941070 Silent C C T TCGA-XU-A92R-01A-11D-A423-09 ENST00000239882 p.R369R TRIM9 chr14 51094834 51094834 Missense_Mutation T T G TCGA-XU-A92R-01A-11D-A423-09 ENST00000298355 p.N36H GTF3C1 chr16 27511773 27511773 Missense_Mutation T T C TCGA-XU-A92R-01A-11D-A423-09 ENST00000356183 p.M368V DNAH9 chr17 11797629 11797629 Missense_Mutation C C A TCGA-XU-A92R-01A-11D-A423-09 ENST00000262442 p.S2752R CATSPERD chr19 5772821 5772821 Silent C C T TCGA-XU-A92R-01A-11D-A423-09 ENST00000381624 p.D599D TLDC2 chr20 36879137 36879137 Missense_Mutation C C T TCGA-XU-A92R-01A-11D-A423-09 ENST00000217320 p.R96W PPARA chr22 46236260 46236260 3'UTR A A - TCGA-XU-A92R-01A-11D-A423-09 ENST00000262735 CENPI chrX 101132430 101132430 Missense_Mutation T T G TCGA-XU-A92R-01A-11D-A423-09 ENST00000372927 p.F482V NAA10 chrX 153933958 153933958 Missense_Mutation T T C TCGA-XU-A92R-01A-11D-A423-09 ENST00000464845 p.Y55C PPAP2B chr1 56578895 56578895 Missense_Mutation A A C TCGA-XH-A853-01A-11D-A423-09 ENST00000371250 p.L41R ARL4C chr2 234494798 234494799 3'UTR - - T TCGA-XH-A853-01A-11D-A423-09 ENST00000390645 ISL1 chr5 51394216 51394216 3'UTR C C T TCGA-XH-A853-01A-11D-A423-09 ENST00000230658 ABL1 chr9 130887570 130887570 3'UTR C C A TCGA-XH-A853-01A-11D-A423-09 ENST00000318560 RNA5SP311 chr10 46809223 46809223 5'Flank T T - TCGA-XH-A853-01A-11D-A423-09 ENST00000411290 H2AFJ chr12 14775536 14775537 3'UTR - - T TCGA-XH-A853-01A-11D-A423-09 ENST00000389078 NUPL1 chr13 25335976 25335976 Intron A A - TCGA-XH-A853-01A-11D-A423-09 ENST00000381736 ACAN chr15 88856731 88856731 Silent G G A TCGA-XH-A853-01A-11D-A423-09 ENST00000439576 p.E1382E DNM1P47 chr15 101761263 101761263 RNA C C T TCGA-XH-A853-01A-11D-A423-09 ENST00000561463 DNM1P47 chr15 101763947 101763947 RNA G G A TCGA-XH-A853-01A-11D-A423-09 ENST00000561463 RP11-231C14.4 chr16 29485390 29485391 In_Frame_Ins - - GCTGAGGGTGGA TCGA-XH-A853-01A-11D-A423-09 ENST00000550665 p.P359_A362dup APPBP2 chr17 60446921 60446921 3'UTR A A - TCGA-XH-A853-01A-11D-A423-09 ENST00000083182 TNRC6B chr22 40335023 40335024 3'UTR - - T TCGA-XH-A853-01A-11D-A423-09 ENST00000454349 GNB1 chr1 1785804 1785804 3'UTR T T - TCGA-X7-A8D6-01A-11D-A423-09 ENST00000378609 EPHA8 chr1 22603371 22603371 3'UTR G G - TCGA-X7-A8D6-01A-11D-A423-09 ENST00000166244 SCN8A chr12 51808514 51808514 3'UTR A A - TCGA-X7-A8D6-01A-11D-A423-09 ENST00000354534 SLC39A9 chr14 69461639 69461640 3'Flank - - T TCGA-X7-A8D6-01A-11D-A423-09 ENST00000336643 CBX8 chr17 79794863 79794863 Frame_Shift_Del G G - TCGA-X7-A8D6-01A-11D-A423-09 ENST00000269385 p.S315Afs*41 LILRB5 chr19 54251321 54251321 Intron C C T TCGA-X7-A8D6-01A-11D-A423-09 ENST00000449561 RBAK chr7 5064656 5064656 Silent T T G TCGA-YT-A95G-01A-11D-A428-09 ENST00000353796 p.L400L REEP4 chr8 22138074 22138075 3'UTR AC AC - TCGA-YT-A95G-01A-11D-A428-09 ENST00000306306 TH chr11 2164311 2164311 Silent G G A TCGA-YT-A95G-01A-11D-A428-09 ENST00000381178 p.P503P AC215219.2 chr12 17089 17089 3'Flank T T C TCGA-YT-A95G-01A-11D-A428-09 ENST00000611710 SOX5 chr12 23665513 23665513 Missense_Mutation G G A TCGA-YT-A95G-01A-11D-A428-09 ENST00000451604 p.R288W GOLGA8J chr15 30087936 30087936 Intron T T G TCGA-YT-A95G-01A-11D-A428-09 ENST00000567927 PPIP5K1 chr15 43533698 43533699 3'UTR AT AT - TCGA-YT-A95G-01A-11D-A428-09 ENST00000396923 CYP1A2 chr15 74754840 74754840 Missense_Mutation G G T TCGA-YT-A95G-01A-11D-A428-09 ENST00000343932 p.A435S MSL1 chr17 40131332 40131332 Intron A A - TCGA-YT-A95G-01A-11D-A428-09 ENST00000398532 MKNK2 chr19 2037631 2037632 3'UTR - - T TCGA-YT-A95G-01A-11D-A428-09 ENST00000250896 TMEM189 chr20 50124877 50124877 3'UTR G G A TCGA-YT-A95G-01A-11D-A428-09 ENST00000371652 OSBPL11 chr3 125529995 125529995 3'UTR T T - TCGA-ZB-A96G-01A-11D-A428-09 ENST00000296220 FGF12 chr3 192142495 192142496 3'Flank - - T TCGA-ZB-A96G-01A-11D-A428-09 ENST00000454309 RPLP0P2 chr11 61637716 61637720 RNA AAAAG AAAAG - TCGA-ZB-A96G-01A-11D-A428-09 ENST00000496593 GOLGA6L6 chr15 20534646 20534646 Silent C C T TCGA-ZB-A96G-01A-11D-A428-09 ENST00000619213 p.R596R GOLGA6L17P chr15 82523900 82523900 RNA A A G TCGA-ZB-A96G-01A-11D-A428-09 ENST00000614358 GOLGA6L17P chr15 82523901 82523901 RNA C C T TCGA-ZB-A96G-01A-11D-A428-09 ENST00000614358 ABAT chr16 8784459 8784460 3'UTR - - A TCGA-ZB-A96G-01A-11D-A428-09 ENST00000268251 CNTN2 chr1 205058238 205058238 Frame_Shift_Del G G - TCGA-X7-A8M8-01A-11D-A423-09 ENST00000331830 p.G93Afs*6 C1orf198 chr1 230838516 230838516 3'UTR A A T TCGA-X7-A8M8-01A-11D-A423-09 ENST00000366663 SPDYE10P chr7 73110016 73110016 RNA A A G TCGA-X7-A8M8-01A-11D-A423-09 ENST00000576332 ACTN1 chr14 68886970 68886970 Intron T T - TCGA-X7-A8M8-01A-11D-A423-09 ENST00000193403 DNM1P47 chr15 101752750 101752750 RNA T T C TCGA-X7-A8M8-01A-11D-A423-09 ENST00000561463 DNAH9 chr17 11822454 11822454 Frame_Shift_Del C C - TCGA-X7-A8M8-01A-11D-A423-09 ENST00000262442 p.P2957Lfs*6 MIR6859-1 chr1 16996 16996 3'Flank T T C TCGA-XU-A931-01A-11D-A423-09 ENST00000619216 VANGL2 chr1 160425487 160425487 3'UTR T T - TCGA-XU-A931-01A-11D-A423-09 ENST00000368061 AL078621.1 chr2 113596691 113596692 3'Flank - - CAGCACCAC TCGA-XU-A931-01A-11D-A423-09 ENST00000613451 MREG chr2 216013243 216013243 Missense_Mutation G G A TCGA-XU-A931-01A-11D-A423-09 ENST00000263268 p.P29S DCHS2 chr4 154315901 154315901 Missense_Mutation C C T TCGA-XU-A931-01A-11D-A423-09 ENST00000623607 p.A1248T ICE1 chr5 5460687 5460687 Missense_Mutation A A C TCGA-XU-A931-01A-11D-A423-09 ENST00000296564 p.E451D HMGCS1 chr5 43290093 43290093 3'UTR A A - TCGA-XU-A931-01A-11D-A423-09 ENST00000325110 TENM2 chr5 167952626 167952626 Missense_Mutation C C G TCGA-XU-A931-01A-11D-A423-09 ENST00000518659 p.P251A RALA chr7 39696753 39696753 Missense_Mutation T T C TCGA-XU-A931-01A-11D-A423-09 ENST00000005257 p.L131S TRPS1 chr8 115411179 115411179 3'Flank C C G TCGA-XU-A931-01A-11D-A423-09 ENST00000220888 ZNF252P chr8 144976916 144976916 RNA G G A TCGA-XU-A931-01A-11D-A423-09 ENST00000426361 NOL6 chr9 33462794 33462794 Missense_Mutation C C T TCGA-XU-A931-01A-11D-A423-09 ENST00000297990 p.R1104H P4HA1 chr10 73100621 73100621 5'Flank C C A TCGA-XU-A931-01A-11D-A423-09 ENST00000307116 OPALIN chr10 96349798 96349798 Missense_Mutation G G A TCGA-XU-A931-01A-11D-A423-09 ENST00000371172 p.A34V MARK2 chr11 63909586 63909587 3'UTR - - A TCGA-XU-A931-01A-11D-A423-09 ENST00000402010 TULP3 chr12 2934473 2934473 Missense_Mutation C C T TCGA-XU-A931-01A-11D-A423-09 ENST00000448120 p.T279I SCN8A chr12 51808514 51808514 3'UTR A A - TCGA-XU-A931-01A-11D-A423-09 ENST00000354534 KRT17P5 chr17 18422907 18422907 RNA G G C TCGA-XU-A931-01A-11D-A423-09 ENST00000444070 C19orf44 chr19 16520113 16520114 3'UTR AG AG - TCGA-XU-A931-01A-11D-A423-09 ENST00000221671 PI4KAP2 chr22 21492040 21492040 5'Flank C C - TCGA-XU-A931-01A-11D-A423-09 ENST00000480319 FAM83F chr22 40029796 40029796 3'UTR C C A TCGA-XU-A931-01A-11D-A423-09 ENST00000333407 FAM47A chrX 34130724 34130724 Missense_Mutation A A G TCGA-XU-A931-01A-11D-A423-09 ENST00000346193 p.S519P FAM73A chr1 77866352 77866352 Silent T T C TCGA-ZB-A961-01A-11D-A428-09 ENST00000370791 p.S508S NBPF8 chr1 145292462 145292462 Missense_Mutation T T A TCGA-ZB-A961-01A-11D-A428-09 ENST00000392971 p.K5100I NBPF25P chr1 145573667 145573667 RNA G G C TCGA-ZB-A961-01A-11D-A428-09 ENST00000619932 RAB29 chr1 205770760 205770760 Missense_Mutation T T C TCGA-ZB-A961-01A-11D-A428-09 ENST00000235932 p.E158G MAP4K4 chr2 101892198 101892198 3'Flank T T - TCGA-ZB-A961-01A-11D-A428-09 ENST00000347699 SCN1A chr2 166046936 166046936 Missense_Mutation A A G TCGA-ZB-A961-01A-11D-A428-09 ENST00000303395 p.V404A RBM45 chr2 178129479 178129479 3'UTR T T - TCGA-ZB-A961-01A-11D-A428-09 ENST00000616198 CCDC141 chr2 178878101 178878101 Missense_Mutation C C G TCGA-ZB-A961-01A-11D-A428-09 ENST00000420890 p.E588Q SPHKAP chr2 227991103 227991103 Missense_Mutation C C T TCGA-ZB-A961-01A-11D-A428-09 ENST00000392056 p.C1619Y ARPC4 chr3 9792909 9792909 5'UTR C C T TCGA-ZB-A961-01A-11D-A428-09 ENST00000397261 PROS1 chr3 93877020 93877020 Missense_Mutation C C G TCGA-ZB-A961-01A-11D-A428-09 ENST00000394236 p.V606L PLCXD2 chr3 111675285 111675301 Frame_Shift_Del GGGACCATCTGCTCCCC GGGACCATCTGCTCCCC - TCGA-ZB-A961-01A-11D-A428-09 ENST00000477665 p.G14Qfs*39 SOX2 chr3 181713439 181713439 3'UTR A A - TCGA-ZB-A961-01A-11D-A428-09 ENST00000325404 PPARGC1A chr4 23795054 23795055 3'UTR AG AG - TCGA-ZB-A961-01A-11D-A428-09 ENST00000264867 LRRC66 chr4 52017374 52017374 Silent C C G TCGA-ZB-A961-01A-11D-A428-09 ENST00000343457 p.T80T NDUFS6 chr5 1814545 1814545 Intron G G A TCGA-ZB-A961-01A-11D-A428-09 ENST00000274137 STXBP5 chr6 147382953 147382953 Silent G G A TCGA-ZB-A961-01A-11D-A428-09 ENST00000321680 p.A1123A CLIP2 chr7 74389214 74389214 Missense_Mutation C C G TCGA-ZB-A961-01A-11D-A428-09 ENST00000223398 p.S892W RB1CC1 chr8 52656758 52656772 In_Frame_Del ATTTGTTGGTTTTCC ATTTGTTGGTTTTCC - TCGA-ZB-A961-01A-11D-A428-09 ENST00000025008 p.E1020_I1024del RB1CC1 chr8 52656773 52656773 Missense_Mutation T T C TCGA-ZB-A961-01A-11D-A428-09 ENST00000025008 p.K1019R IMPA1 chr8 81681551 81681551 Missense_Mutation G G C TCGA-ZB-A961-01A-11D-A428-09 ENST00000256108 p.P4A TRPM3 chr9 71121184 71121184 Silent A A T TCGA-ZB-A961-01A-11D-A428-09 ENST00000377110 p.L57L DMBT1P1 chr10 122786028 122786028 RNA C C A TCGA-ZB-A961-01A-11D-A428-09 ENST00000439464 BIRC3 chr11 102328091 102328091 Silent C C A TCGA-ZB-A961-01A-11D-A428-09 ENST00000263464 p.I331I KHNYN chr14 24431942 24431942 Silent C C G TCGA-ZB-A961-01A-11D-A428-09 ENST00000251343 p.P227P CD276 chr15 73702395 73702395 Nonsense_Mutation C C T TCGA-ZB-A961-01A-11D-A428-09 ENST00000318443 p.Q74* CHD9 chr16 53226470 53226470 Missense_Mutation T T G TCGA-ZB-A961-01A-11D-A428-09 ENST00000398510 p.N667K RP11-434D2.7 chr17 20502471 20502471 3'Flank A A G TCGA-ZB-A961-01A-11D-A428-09 ENST00000587907 ACOX1 chr17 75951442 75951442 Silent A A C TCGA-ZB-A961-01A-11D-A428-09 ENST00000301608 p.G360G PIK3C3 chr18 41995966 41995966 Missense_Mutation C C A TCGA-ZB-A961-01A-11D-A428-09 ENST00000262039 p.P288H KIR2DL3 chr19 54738539 54738539 5'UTR C C T TCGA-ZB-A961-01A-11D-A428-09 ENST00000342376 TTI1 chr20 38013724 38013724 Silent C C T TCGA-ZB-A961-01A-11D-A428-09 ENST00000373447 p.E31E KRTAP12-3 chr21 44658289 44658289 3'UTR C C T TCGA-ZB-A961-01A-11D-A428-09 ENST00000397907 SSTR3 chr22 37206815 37206815 Missense_Mutation C C T TCGA-ZB-A961-01A-11D-A428-09 ENST00000610913 p.R330Q NFAM1 chr22 42383918 42383918 3'UTR C C T TCGA-ZB-A961-01A-11D-A428-09 ENST00000329021 SH3KBP1 chrX 19535693 19535693 3'UTR T T - TCGA-ZB-A961-01A-11D-A428-09 ENST00000397821 MAGEB18 chrX 26139676 26139676 Missense_Mutation G G A TCGA-ZB-A961-01A-11D-A428-09 ENST00000325250 p.D231N PSMA5 chr1 109415354 109415354 Missense_Mutation T T C TCGA-4V-A9QR-01A-11D-A423-09 ENST00000271308 p.T36A AHCYL1 chr1 110023589 110023589 3'UTR A A - TCGA-4V-A9QR-01A-11D-A423-09 ENST00000369799 MAGI1 chr3 65354958 65354958 3'Flank C C T TCGA-4V-A9QR-01A-11D-A423-09 ENST00000402939 U2SURP chr3 143054971 143054971 Missense_Mutation C C T TCGA-4V-A9QR-01A-11D-A423-09 ENST00000473835 p.P935S SPOCK3 chr4 167234105 167234105 Silent G G T TCGA-4V-A9QR-01A-11D-A423-09 ENST00000357154 p.A23A GPR63 chr6 96798085 96798086 3'UTR - - A TCGA-4V-A9QR-01A-11D-A423-09 ENST00000229955 WASH1 chr9 15126 15126 Missense_Mutation G G C TCGA-4V-A9QR-01A-11D-A423-09 ENST00000442898 p.H407D ENTPD2 chr9 137051065 137051065 Frame_Shift_Del C C - TCGA-4V-A9QR-01A-11D-A423-09 ENST00000355097 p.G204Vfs*171 HSPA14 chr10 14867170 14867170 Missense_Mutation A A G TCGA-4V-A9QR-01A-11D-A423-09 ENST00000378372 p.I361V PTEN chr10 87965537 87965537 3'UTR T T - TCGA-4V-A9QR-01A-11D-A423-09 ENST00000371953 HTR7 chr10 90749123 90749123 Silent G G A TCGA-4V-A9QR-01A-11D-A423-09 ENST00000336152 p.T337T CYP2C18 chr10 94683930 94683930 Silent G G A TCGA-4V-A9QR-01A-11D-A423-09 ENST00000285979 p.P37P FAM178A chr10 100913113 100913113 Translation_Start_Site G G T TCGA-4V-A9QR-01A-11D-A423-09 ENST00000238961 p.M1? TRPM5 chr11 2417747 2417747 Missense_Mutation A A G TCGA-4V-A9QR-01A-11D-A423-09 ENST00000155858 p.I330T UBE3B chr12 109524030 109524030 Missense_Mutation G G T TCGA-4V-A9QR-01A-11D-A423-09 ENST00000342494 p.G806V BCL7A chr12 122060894 122060894 3'UTR A A - TCGA-4V-A9QR-01A-11D-A423-09 ENST00000261822 POSTN chr13 37569800 37569800 Missense_Mutation C C T TCGA-4V-A9QR-01A-11D-A423-09 ENST00000379747 p.R764K FSCB chr14 44505028 44505028 Missense_Mutation C C T TCGA-4V-A9QR-01A-11D-A423-09 ENST00000340446 p.A654T SMEK1 chr14 91458082 91458082 3'UTR A A - TCGA-4V-A9QR-01A-11D-A423-09 ENST00000554943 TGM5 chr15 43260064 43260064 Missense_Mutation G G T TCGA-4V-A9QR-01A-11D-A423-09 ENST00000220420 p.P142T RLBP1 chr15 89218599 89218599 Missense_Mutation G G A TCGA-4V-A9QR-01A-11D-A423-09 ENST00000268125 p.P36L OSGIN1 chr16 83951187 83951187 Missense_Mutation G G T TCGA-4V-A9QR-01A-11D-A423-09 ENST00000343939 p.Q39H TIMM22 chr17 997292 997292 Silent C C T TCGA-4V-A9QR-01A-11D-A423-09 ENST00000327158 p.I50I WDR81 chr17 1725275 1725275 Missense_Mutation G G A TCGA-4V-A9QR-01A-11D-A423-09 ENST00000409644 p.E106K SLC25A11 chr17 4939840 4939840 Missense_Mutation T T C TCGA-4V-A9QR-01A-11D-A423-09 ENST00000225665 p.K24R FBF1 chr17 75913975 75913975 Silent G G T TCGA-4V-A9QR-01A-11D-A423-09 ENST00000586717 p.R1008R CLIP3 chr19 36026214 36026214 Missense_Mutation G G T TCGA-4V-A9QR-01A-11D-A423-09 ENST00000360535 p.A205D NLRP5 chr19 56053660 56053660 Missense_Mutation G G A TCGA-4V-A9QR-01A-11D-A423-09 ENST00000390649 p.A1051T TPST2 chr22 26541059 26541059 Missense_Mutation G G T TCGA-4V-A9QR-01A-11D-A423-09 ENST00000338754 p.S191Y CXorf23 chrX 19965098 19965098 Missense_Mutation C C G TCGA-4V-A9QR-01A-11D-A423-09 ENST00000379682 p.R407T