Hugo_Symbol Chromosome Start_Position End_Position Variant_Classification Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 Tumor_Sample_Barcode transcript_name amino_acid_change UROD chr1 45013931 45013931 Missense_Mutation T T G TCGA-61-2095-01A-01W-0722-08 ENST00000246337 p.V166G SCP2 chr1 52988121 52988121 Missense_Mutation C C T TCGA-61-2095-01A-01W-0722-08 ENST00000371514 p.P356S CYP2J2 chr1 59901078 59901078 Missense_Mutation G G A TCGA-61-2095-01A-01W-0722-08 ENST00000371204 p.T406M STRIP1 chr1 110043801 110043801 Missense_Mutation C C A TCGA-61-2095-01A-01W-0722-08 ENST00000369795 p.P411T NRAS chr1 114713908 114713908 Missense_Mutation T T C TCGA-61-2095-01A-01W-0722-08 ENST00000369535 p.Q61R NOTCH2 chr1 119916066 119916066 Missense_Mutation G G A TCGA-61-2095-01A-01W-0722-08 ENST00000256646 p.P2219L NBPF25P chr1 145578882 145578886 RNA GAGTT GAGTT - TCGA-61-2095-01A-01W-0722-08 ENST00000619932 RFX5 chr1 151342291 151342291 Silent C C T TCGA-61-2095-01A-01W-0722-08 ENST00000290524 p.K582K MEF2D chr1 156468118 156468118 Missense_Mutation A A C TCGA-61-2095-01A-01W-0722-08 ENST00000348159 p.S477A IGSF8 chr1 160094119 160094119 Silent G G A TCGA-61-2095-01A-01W-0722-08 ENST00000314485 p.R165R ZNF648 chr1 182056504 182056504 Nonsense_Mutation C C A TCGA-61-2095-01A-01W-0722-08 ENST00000339948 p.G503* NMNAT2 chr1 183284010 183284010 Missense_Mutation G G A TCGA-61-2095-01A-01W-0722-08 ENST00000287713 p.R187W PHLDA3 chr1 201468579 201468579 Frame_Shift_Del G G - TCGA-61-2095-01A-01W-0722-08 ENST00000367309 p.H70Tfs*7 MFSD4 chr1 205584013 205584013 Missense_Mutation G G C TCGA-61-2095-01A-01W-0722-08 ENST00000367147 p.C250S TMEM63A chr1 225866660 225866661 Frame_Shift_Ins - - GA TCGA-61-2095-01A-01W-0722-08 ENST00000366835 p.T197Sfs*31 DHX57 chr2 38837865 38837865 Missense_Mutation C C G TCGA-61-2095-01A-01W-0722-08 ENST00000457308 p.E836D SOCS5 chr2 46759115 46759115 Silent C C T TCGA-61-2095-01A-01W-0722-08 ENST00000306503 p.S195S DYSF chr2 71611469 71611469 Missense_Mutation T T A TCGA-61-2095-01A-01W-0722-08 ENST00000258104 p.L1337Q CNGA3 chr2 98396316 98396316 Silent C C T TCGA-61-2095-01A-01W-0722-08 ENST00000272602 p.V382V WDSUB1 chr2 159283047 159283047 Frame_Shift_Del A A - TCGA-61-2095-01A-01W-0722-08 ENST00000359774 p.L8* SP5 chr2 170717388 170717388 Missense_Mutation A G G TCGA-61-2095-01A-01W-0722-08 ENST00000375281 p.D394G ITGA6 chr2 172474124 172474124 Missense_Mutation G G T TCGA-61-2095-01A-01W-0722-08 ENST00000442250 p.R321I WIPF1 chr2 174571692 174571692 Missense_Mutation G G T TCGA-61-2095-01A-01W-0722-08 ENST00000359761 p.D371E TTN chr2 178535512 178535512 Silent G G A TCGA-61-2095-01A-01W-0722-08 ENST00000591111 p.V32060V TTN chr2 178567808 178567808 Silent C C T TCGA-61-2095-01A-01W-0722-08 ENST00000591111 p.Q24467Q ANKAR chr2 189705152 189705152 Missense_Mutation A A G TCGA-61-2095-01A-01W-0722-08 ENST00000313581 p.Y613C MYO1B chr2 191369572 191369572 Missense_Mutation A A T TCGA-61-2095-01A-01W-0722-08 ENST00000304164 p.N355Y ZDBF2 chr2 206308152 206308152 Missense_Mutation G G T TCGA-61-2095-01A-01W-0722-08 ENST00000374423 p.Q1208H FN1 chr2 215361625 215361625 Missense_Mutation T T C TCGA-61-2095-01A-01W-0722-08 ENST00000359671 p.N2364S SGPP2 chr2 222474589 222474589 Missense_Mutation G G A TCGA-61-2095-01A-01W-0722-08 ENST00000321276 p.V81M XIRP1 chr3 39188131 39188131 Missense_Mutation T T G TCGA-61-2095-01A-01W-0722-08 ENST00000340369 p.K439Q LAMB2 chr3 49124272 49124272 Silent G G A TCGA-61-2095-01A-01W-0722-08 ENST00000305544 p.C1114C SUCLG2 chr3 67529100 67529100 Missense_Mutation G G T TCGA-61-2095-01A-01W-0722-08 ENST00000307227 p.H105N EPHA6 chr3 97592695 97592695 Missense_Mutation C C T TCGA-61-2095-01A-01W-0722-08 ENST00000389672 p.P824S KIAA2018 chr3 113657908 113657908 Silent C C T TCGA-61-2095-01A-01W-0722-08 ENST00000316407 p.A1258A WDR53 chr3 196561118 196561118 Missense_Mutation T T C TCGA-61-2095-01A-01W-0722-08 ENST00000332629 p.I120V PPARGC1A chr4 23814561 23814561 Missense_Mutation T T A TCGA-61-2095-01A-01W-0722-08 ENST00000264867 p.N308Y UNC5C chr4 95185120 95185121 Frame_Shift_Ins - - T TCGA-61-2095-01A-01W-0722-08 ENST00000453304 p.T738Nfs*23 ANKRD37 chr4 185396876 185396876 5'UTR C C T TCGA-61-2095-01A-01W-0722-08 ENST00000335174 ZFR chr5 32415087 32415087 Silent G G A TCGA-61-2095-01A-01W-0722-08 ENST00000265069 p.T222T GZMK chr5 55024719 55024719 Missense_Mutation G G A TCGA-61-2095-01A-01W-0722-08 ENST00000231009 p.A42T PAPD4 chr5 79685297 79685298 3'UTR - - G TCGA-61-2095-01A-01W-0722-08 ENST00000296783 DDX46 chr5 134785550 134785550 Silent G G A TCGA-61-2095-01A-01W-0722-08 ENST00000354283 p.V476V PHYKPL chr5 178224716 178224716 Frame_Shift_Del G G - TCGA-61-2095-01A-01W-0722-08 ENST00000308158 p.H143Tfs*2 ZNF879 chr5 179027487 179027487 Silent C C T TCGA-61-2095-01A-01W-0722-08 ENST00000444149 p.F16F DNAH8 chr6 38924070 38924070 Missense_Mutation C C T TCGA-61-2095-01A-01W-0722-08 ENST00000359357 p.L3407F KHDRBS2 chr6 62285975 62285975 5'UTR C C T TCGA-61-2095-01A-01W-0722-08 ENST00000281156 CEP85L chr6 118501830 118501830 Intron G G C TCGA-61-2095-01A-01W-0722-08 ENST00000368491 SYNE1 chr6 152239684 152239684 Missense_Mutation G G A TCGA-61-2095-01A-01W-0722-08 ENST00000367255 p.S6639F PCLO chr7 82954538 82954538 Nonsense_Mutation C C A TCGA-61-2095-01A-01W-0722-08 ENST00000333891 p.E2139* COL1A2 chr7 94425151 94425151 Missense_Mutation C C T TCGA-61-2095-01A-01W-0722-08 ENST00000297268 p.P903L ZAN chr7 100773372 100773372 Missense_Mutation G G A TCGA-61-2095-01A-01W-0722-08 ENST00000613979 p.C1838Y MYL10 chr7 101616267 101616267 Frame_Shift_Del G G - TCGA-61-2095-01A-01W-0722-08 ENST00000223167 p.F163Sfs*22 KMT2E chr7 105106765 105106765 Missense_Mutation A A T TCGA-61-2095-01A-01W-0722-08 ENST00000257745 p.H947L AC009264.1 chr7 137164272 137164272 Intron G G A TCGA-61-2095-01A-01W-0722-08 ENST00000439694 TAS2R41 chr7 143478308 143478308 Missense_Mutation C C G TCGA-61-2095-01A-01W-0722-08 ENST00000408916 p.L146V SSPO chr7 149780408 149780408 Missense_Mutation C C T TCGA-61-2095-01A-01W-0722-08 ENST00000378016 p.H524Y FAM83H chr8 143726016 143726016 Missense_Mutation C C T TCGA-61-2095-01A-01W-0722-08 ENST00000388913 p.G1149R NOL6 chr9 33468784 33468785 Nonsense_Mutation - - C TCGA-61-2095-01A-01W-0722-08 ENST00000297990 p.Y372* SPATA31A6 chr9 42188956 42188956 Missense_Mutation G G A TCGA-61-2095-01A-01W-0722-08 ENST00000332857 p.R1085K FKBP15 chr9 113166072 113166072 3'UTR G C C TCGA-61-2095-01A-01W-0722-08 ENST00000238256 CDK5RAP2 chr9 120437380 120437380 Silent C C G TCGA-61-2095-01A-01W-0722-08 ENST00000349780 p.V1290V UPF2 chr10 11964022 11964022 Missense_Mutation G G C TCGA-61-2095-01A-01W-0722-08 ENST00000356352 p.T724S MCM10 chr10 13186183 13186183 Missense_Mutation A A T TCGA-61-2095-01A-01W-0722-08 ENST00000484800 p.H374L KAT6B chr10 75030888 75030888 Nonsense_Mutation C C T TCGA-61-2095-01A-01W-0722-08 ENST00000287239 p.Q2022* SLC22A18 chr11 2925177 2925177 Missense_Mutation A A T TCGA-61-2095-01A-01W-0722-08 ENST00000312221 p.R419W TRIM68 chr11 4605179 4605179 Missense_Mutation C C A TCGA-61-2095-01A-01W-0722-08 ENST00000300747 p.C109F RAG1 chr11 36574161 36574161 Missense_Mutation A A C TCGA-61-2095-01A-01W-0722-08 ENST00000299440 p.H286P DDB2 chr11 47215076 47215076 5'UTR T T G TCGA-61-2095-01A-01W-0722-08 ENST00000256996 HTR3B chr11 113909375 113909375 Missense_Mutation A A G TCGA-61-2095-01A-01W-0722-08 ENST00000260191 p.K45E UBASH3B chr11 122789288 122789289 Frame_Shift_Ins - - T TCGA-61-2095-01A-01W-0722-08 ENST00000284273 p.S321* NAV3 chr12 78119724 78119724 Silent G G A TCGA-61-2095-01A-01W-0722-08 ENST00000397909 p.S1176S TCHP chr12 109914512 109914512 Missense_Mutation T T C TCGA-61-2095-01A-01W-0722-08 ENST00000312777 p.L402P NOS1 chr12 117272428 117272428 Missense_Mutation C C G TCGA-61-2095-01A-01W-0722-08 ENST00000317775 p.G599A PSMD9 chr12 121916383 121916383 3'UTR G G A TCGA-61-2095-01A-01W-0722-08 ENST00000541212 ATP8A2 chr13 25578874 25578874 Silent C C T TCGA-61-2095-01A-01W-0722-08 ENST00000381655 p.C614C EXOSC8 chr13 37004522 37004522 Missense_Mutation G G C TCGA-61-2095-01A-01W-0722-08 ENST00000389704 p.A67P RAB2B chr14 21468714 21468714 Nonsense_Mutation G G T TCGA-61-2095-01A-01W-0722-08 ENST00000397762 p.Y75* MYH6 chr14 23396718 23396718 Silent G G A TCGA-61-2095-01A-01W-0722-08 ENST00000356287 p.N756N NPAP1 chr15 24676105 24676105 Missense_Mutation G G A TCGA-61-2095-01A-01W-0722-08 ENST00000329468 p.A80T MAP2K5 chr15 67703392 67703392 Missense_Mutation G G T TCGA-61-2095-01A-01W-0722-08 ENST00000178640 p.G343V GLCE chr15 69268664 69268664 Missense_Mutation T T A TCGA-61-2095-01A-01W-0722-08 ENST00000261858 p.M425K NRG4 chr15 75961840 75961840 Missense_Mutation T T G TCGA-61-2095-01A-01W-0722-08 ENST00000394907 p.Y80S AKAP13 chr15 85581012 85581012 Frame_Shift_Del A A - TCGA-61-2095-01A-01W-0722-08 ENST00000394518 p.N982Ifs*27 ADCY9 chr16 3966849 3966849 Silent C C T TCGA-61-2095-01A-01W-0722-08 ENST00000294016 p.L996L TMC5 chr16 19440183 19440183 Missense_Mutation G G T TCGA-61-2095-01A-01W-0722-08 ENST00000396229 p.G49C IL21R chr16 27449052 27449052 Silent A A C TCGA-61-2095-01A-01W-0722-08 ENST00000337929 p.G462G SLC5A2 chr16 31487411 31487411 Intron G G T TCGA-61-2095-01A-01W-0722-08 ENST00000330498 HSD17B2 chr16 82098331 82098331 Nonsense_Mutation T T G TCGA-61-2095-01A-01W-0722-08 ENST00000199936 p.Y353* RILP chr17 1648388 1648388 Silent T T C TCGA-61-2095-01A-01W-0722-08 ENST00000301336 p.K261K RHOT1 chr17 32175355 32175355 Missense_Mutation T T A TCGA-61-2095-01A-01W-0722-08 ENST00000333942 p.I72K HOXB4 chr17 48576959 48576959 Silent C C T TCGA-61-2095-01A-01W-0722-08 ENST00000332503 p.Q173Q CYTH1 chr17 78698344 78698344 Missense_Mutation T T A TCGA-61-2095-01A-01W-0722-08 ENST00000361101 p.I246F TRAPPC8 chr18 31913430 31913430 Missense_Mutation G A A TCGA-61-2095-01A-01W-0722-08 ENST00000283351 p.S237L CCDC178 chr18 32974622 32974622 Silent G G A TCGA-61-2095-01A-01W-0722-08 ENST00000383096 p.V816V SERPINB4 chr18 63641801 63641801 Missense_Mutation C C T TCGA-61-2095-01A-01W-0722-08 ENST00000341074 p.A104T MUC16 chr19 8937516 8937516 Missense_Mutation C C T TCGA-61-2095-01A-01W-0722-08 ENST00000397910 p.E11147K ZNF44 chr19 12248629 12248629 3'UTR C C T TCGA-61-2095-01A-01W-0722-08 ENST00000393337 ZNF420 chr19 37127642 37127644 In_Frame_Del TAC TAC - TCGA-61-2095-01A-01W-0722-08 ENST00000337995 p.T218del ZNF585A chr19 37151853 37151859 Frame_Shift_Del TCTGTGA TCTGTGA - TCGA-61-2095-01A-01W-0722-08 ENST00000292841 p.H680Qfs*52 ZNF585A chr19 37151861 37151861 Missense_Mutation G G A TCGA-61-2095-01A-01W-0722-08 ENST00000292841 p.H680Y DYRK1B chr19 39825946 39825946 Silent T T A TCGA-61-2095-01A-01W-0722-08 ENST00000323039 p.P553P EXOSC5 chr19 41389873 41389873 Missense_Mutation C C A TCGA-61-2095-01A-01W-0722-08 ENST00000221233 p.M139I ERCC2 chr19 45351379 45351379 3'UTR C C A TCGA-61-2095-01A-01W-0722-08 ENST00000391945 FCGRT chr19 49513807 49513807 Intron C C A TCGA-61-2095-01A-01W-0722-08 ENST00000221466 SIGLEC12 chr19 51499608 51499608 Missense_Mutation G G A TCGA-61-2095-01A-01W-0722-08 ENST00000291707 p.T306M PABPC1L chr20 44938103 44938103 Missense_Mutation T T C TCGA-61-2095-01A-01W-0722-08 ENST00000217073 p.L563P MYT1 chr20 64239882 64239882 Silent C C G TCGA-61-2095-01A-01W-0722-08 ENST00000328439 p.A1072A EP300 chr22 41117407 41117407 Silent C C A TCGA-61-2095-01A-01W-0722-08 ENST00000263253 p.A105A EP300 chr22 41177405 41177405 Silent G G A TCGA-61-2095-01A-01W-0722-08 ENST00000263253 p.Q1898Q RBBP7 chrX 16852825 16852825 Missense_Mutation G G T TCGA-61-2095-01A-01W-0722-08 ENST00000380087 p.A270E RS1 chrX 18656710 18656710 Nonsense_Mutation G G A TCGA-61-2095-01A-01W-0722-08 ENST00000379984 p.Q43* EIF1AX chrX 20138624 20138624 Splice_Site T T G TCGA-61-2095-01A-01W-0722-08 ENST00000379607 p.X6_splice RAB33A chrX 130172249 130172249 Missense_Mutation G G T TCGA-61-2095-01A-01W-0722-08 ENST00000257017 p.D63Y FAM50A chrX 154449711 154449711 Silent C C T TCGA-61-2095-01A-01W-0722-08 ENST00000393600 p.I252I GAB3 chrX 154712302 154712302 Missense_Mutation G G T TCGA-61-2095-01A-01W-0722-08 ENST00000369575 p.S331R GBP1 chr1 89053183 89053183 3'UTR T T - TCGA-36-2539-01A-01D-1526-09 ENST00000370473 KIAA0907 chr1 155925650 155925650 Missense_Mutation G G C TCGA-36-2539-01A-01D-1526-09 ENST00000368321 p.P292R BATF3 chr1 212686826 212686826 Missense_Mutation G G A TCGA-36-2539-01A-01D-1526-09 ENST00000243440 p.R117W PSEN2 chr1 226891748 226891748 Missense_Mutation G G A TCGA-36-2539-01A-01D-1526-09 ENST00000366783 p.D326N ABCG8 chr2 43852785 43852785 Missense_Mutation T T C TCGA-36-2539-01A-01D-1526-09 ENST00000272286 p.L294S GGCX chr2 85550561 85550578 In_Frame_Del CGAAAGACATAGAGCTTT CGAAAGACATAGAGCTTT - TCGA-36-2539-01A-01D-1526-09 ENST00000233838 p.K688_R693del LY75-CD302 chr2 159780174 159780174 Silent C C T TCGA-36-2539-01A-01D-1526-09 ENST00000504764 p.A1741A GTF3C3 chr2 196789254 196789254 Missense_Mutation C C A TCGA-36-2539-01A-01D-1526-09 ENST00000263956 p.L281F RAPH1 chr2 203440145 203440145 Silent C C T TCGA-36-2539-01A-01D-1526-09 ENST00000319170 p.K1015K CTLA4 chr2 203871438 203871438 Missense_Mutation G G A TCGA-36-2539-01A-01D-1526-09 ENST00000302823 p.G173E ERBB4 chr2 211386874 211386874 Missense_Mutation T T C TCGA-36-2539-01A-01D-1526-09 ENST00000342788 p.M1154V CASR chr3 122262055 122262055 Missense_Mutation G G C TCGA-36-2539-01A-01D-1526-09 ENST00000490131 p.R340S RP11-333E13.4 chr4 40043577 40043577 RNA G G A TCGA-36-2539-01A-01D-1526-09 ENST00000381811 UBA6 chr4 67633426 67633427 Frame_Shift_Ins - - T TCGA-36-2539-01A-01D-1526-09 ENST00000322244 p.L688Vfs*3 FBXW7 chr4 152337804 152337804 Missense_Mutation C C G TCGA-36-2539-01A-01D-1526-09 ENST00000281708 p.E287Q DNAH5 chr5 13788762 13788762 Missense_Mutation A A C TCGA-36-2539-01A-01D-1526-09 ENST00000265104 p.I2867M C5orf42 chr5 37157815 37157815 Splice_Site C C A TCGA-36-2539-01A-01D-1526-09 ENST00000425232 p.X2605_splice PSD2 chr5 139814197 139814197 Silent A A T TCGA-36-2539-01A-01D-1526-09 ENST00000274710 p.S283S PCDHB1 chr5 141053126 141053126 Silent C C G TCGA-36-2539-01A-01D-1526-09 ENST00000306549 p.V552V PCDHB5 chr5 141137830 141137830 3'UTR G G A TCGA-36-2539-01A-01D-1526-09 ENST00000231134 FAT2 chr5 151507561 151507561 Missense_Mutation G G T TCGA-36-2539-01A-01D-1526-09 ENST00000261800 p.P4037H LYRM4 chr6 5260727 5260727 Missense_Mutation C C A TCGA-36-2539-01A-01D-1526-09 ENST00000330636 p.A3S OR2B6 chr6 27957564 27957564 Silent G G T TCGA-36-2539-01A-01D-1526-09 ENST00000244623 p.G108G DPCR1 chr6 30951776 30951776 Intron T T A TCGA-36-2539-01A-01D-1526-09 ENST00000304311 MDFI chr6 41646187 41646187 Missense_Mutation G G T TCGA-36-2539-01A-01D-1526-09 ENST00000230321 p.E46D GLTSCR1L chr6 42828836 42828836 Missense_Mutation T T C TCGA-36-2539-01A-01D-1526-09 ENST00000314073 p.V168A CDC40 chr6 110180566 110180566 Missense_Mutation C C A TCGA-36-2539-01A-01D-1526-09 ENST00000307731 p.T41N NFE2L3 chr7 26185354 26185354 Silent T T C TCGA-36-2539-01A-01D-1526-09 ENST00000056233 p.D552D HOXA3 chr7 27110704 27110704 5'UTR T T A TCGA-36-2539-01A-01D-1526-09 ENST00000317201 DDC chr7 50543981 50543981 Silent G G A TCGA-36-2539-01A-01D-1526-09 ENST00000357936 p.P35P BLK chr8 11561270 11561270 Intron G G C TCGA-36-2539-01A-01D-1526-09 ENST00000259089 PDP1 chr8 93922489 93922489 Missense_Mutation G G C TCGA-36-2539-01A-01D-1526-09 ENST00000297598 p.D144H GML chr8 142846706 142846706 3'UTR G G C TCGA-36-2539-01A-01D-1526-09 ENST00000220940 KDM4C chr9 7174764 7174764 3'UTR G G C TCGA-36-2539-01A-01D-1526-09 ENST00000381309 GALT chr9 34648151 34648151 Missense_Mutation A A G TCGA-36-2539-01A-01D-1526-09 ENST00000378842 p.N182D SLC27A4 chr9 128360553 128360553 3'UTR A A G TCGA-36-2539-01A-01D-1526-09 ENST00000300456 CRAT chr9 129107894 129107894 Missense_Mutation C C T TCGA-36-2539-01A-01D-1526-09 ENST00000318080 p.D71N CNNM2 chr10 102919743 102919743 Silent C C T TCGA-36-2539-01A-01D-1526-09 ENST00000369878 p.T421T NLRP14 chr11 7062502 7062502 Missense_Mutation G G T TCGA-36-2539-01A-01D-1526-09 ENST00000299481 p.G992W RTN4RL2 chr11 57467709 57467709 Silent G G T TCGA-36-2539-01A-01D-1526-09 ENST00000335099 p.V44V DDB1 chr11 61316354 61316354 Silent T T C TCGA-36-2539-01A-01D-1526-09 ENST00000301764 p.E447E CATSPER1 chr11 66025749 66025749 Missense_Mutation G G C TCGA-36-2539-01A-01D-1526-09 ENST00000312106 p.Q211E SERPINH1 chr11 75566808 75566808 Missense_Mutation C C A TCGA-36-2539-01A-01D-1526-09 ENST00000358171 p.H153Q ZPR1 chr11 116784404 116784404 Nonsense_Mutation C C A TCGA-36-2539-01A-01D-1526-09 ENST00000227322 p.E289* DSCAML1 chr11 117431628 117431628 Silent G G T TCGA-36-2539-01A-01D-1526-09 ENST00000321322 p.R1820R C11orf63 chr11 122885957 122885957 Missense_Mutation T T G TCGA-36-2539-01A-01D-1526-09 ENST00000227349 p.H36Q PANX3 chr11 124617382 124617382 Missense_Mutation A A T TCGA-36-2539-01A-01D-1526-09 ENST00000284288 p.S145C ARHGAP32 chr11 128969476 128969476 Nonsense_Mutation G G A TCGA-36-2539-01A-01D-1526-09 ENST00000310343 p.Q1899* PHC1 chr12 8933265 8933265 Missense_Mutation A A G TCGA-36-2539-01A-01D-1526-09 ENST00000543824 p.H603R HIP1R chr12 122860155 122860155 Missense_Mutation G G A TCGA-36-2539-01A-01D-1526-09 ENST00000253083 p.R835Q THTPA chr14 23556924 23556924 Missense_Mutation G G A TCGA-36-2539-01A-01D-1526-09 ENST00000288014 p.R56Q PLEKHG3 chr14 64732829 64732829 Nonsense_Mutation G G T TCGA-36-2539-01A-01D-1526-09 ENST00000394691 p.E425* SIPA1L1 chr14 71739151 71739151 Missense_Mutation A A T TCGA-36-2539-01A-01D-1526-09 ENST00000555818 p.D1802V RBM25 chr14 73103212 73103212 Silent C C G TCGA-36-2539-01A-01D-1526-09 ENST00000261973 p.G296G FLRT2 chr14 85622562 85622562 Missense_Mutation G G A TCGA-36-2539-01A-01D-1526-09 ENST00000330753 p.V350I BTBD7 chr14 93242087 93242087 3'UTR A A - TCGA-36-2539-01A-01D-1526-09 ENST00000334746 PACS2 chr14 105394703 105394703 3'UTR C C T TCGA-36-2539-01A-01D-1526-09 ENST00000325438 MESDC2 chr15 80982146 80982146 Missense_Mutation G G A TCGA-36-2539-01A-01D-1526-09 ENST00000261758 p.H84Y BCO1 chr16 81287315 81287315 Silent C C G TCGA-36-2539-01A-01D-1526-09 ENST00000258168 p.L441L TP53 chr17 7674894 7674894 Nonsense_Mutation G G A TCGA-36-2539-01A-01D-1526-09 ENST00000269305 p.R213* MYH2 chr17 10521260 10521260 3'UTR T T C TCGA-36-2539-01A-01D-1526-09 ENST00000245503 MPO chr17 58279977 58279977 Missense_Mutation T T G TCGA-36-2539-01A-01D-1526-09 ENST00000225275 p.M96L UBE2O chr17 76400171 76400171 Missense_Mutation C C A TCGA-36-2539-01A-01D-1526-09 ENST00000319380 p.Q377H SLC14A2 chr18 45663904 45663904 Nonsense_Mutation A A T TCGA-36-2539-01A-01D-1526-09 ENST00000255226 p.K491* PTPRS chr19 5274304 5274304 Silent G G A TCGA-36-2539-01A-01D-1526-09 ENST00000357368 p.G44G KRI1 chr19 10553084 10553085 3'UTR - - A TCGA-36-2539-01A-01D-1526-09 ENST00000312962 GCDH chr19 12897739 12897739 Frame_Shift_Del T T - TCGA-36-2539-01A-01D-1526-09 ENST00000222214 p.N373Kfs*28 FCGBP chr19 39867050 39867050 Missense_Mutation C C A TCGA-36-2539-01A-01D-1526-09 ENST00000616721 p.C4007F CPT1C chr19 49704756 49704756 Missense_Mutation C C T TCGA-36-2539-01A-01D-1526-09 ENST00000323446 p.P247L ADNP chr20 50893831 50893831 Missense_Mutation C C G TCGA-36-2539-01A-01D-1526-09 ENST00000349014 p.V295L TIAM1 chr21 31120436 31120436 Missense_Mutation T T A TCGA-36-2539-01A-01D-1526-09 ENST00000286827 p.S1570C CRYZL1 chr21 33602273 33602273 Nonsense_Mutation C C A TCGA-36-2539-01A-01D-1526-09 ENST00000381554 p.E180* SLC37A1 chr21 42564707 42564707 Splice_Site G G A TCGA-36-2539-01A-01D-1526-09 ENST00000352133 p.X379_splice NF2 chr22 29694751 29694751 Splice_Site G G C TCGA-36-2539-01A-01D-1526-09 ENST00000338641 p.X580_splice LIMK2 chr22 31212351 31212351 5'UTR C C G TCGA-36-2539-01A-01D-1526-09 ENST00000331728 MOV10L1 chr22 50149530 50149549 Intron TGAGCGTGGCTTTGCCAGTG TGAGCGTGGCTTTGCCAGTG - TCGA-36-2539-01A-01D-1526-09 ENST00000262794 Z83819.1 chrX 100887938 100887938 5'Flank C C A TCGA-36-2539-01A-01D-1526-09 ENST00000616672 PIH1D3 chrX 107222771 107222771 Missense_Mutation T T C TCGA-36-2539-01A-01D-1526-09 ENST00000336387 p.V120A SLC25A43 chrX 119410200 119410200 Silent G G A TCGA-36-2539-01A-01D-1526-09 ENST00000217909 p.P176P PNCK chrX 153671439 153671439 Intron C C A TCGA-36-2539-01A-01D-1526-09 ENST00000340888 OR4F5 chr1 69668 69668 Missense_Mutation T T C TCGA-29-1770-01A-01W-0633-09 ENST00000335137 p.I193T PADI4 chr1 17338082 17338082 Silent G A A TCGA-29-1770-01A-01W-0633-09 ENST00000375448 p.L151L MAP3K6 chr1 27364341 27364341 Silent C C G TCGA-29-1770-01A-01W-0633-09 ENST00000357582 p.R186R CDCA8 chr1 37700464 37700464 Missense_Mutation G G T TCGA-29-1770-01A-01W-0633-09 ENST00000327331 p.M122I COL9A2 chr1 40311539 40311539 Silent C C A TCGA-29-1770-01A-01W-0633-09 ENST00000372748 p.P160P DAB1 chr1 57011198 57011198 Missense_Mutation C C A TCGA-29-1770-01A-01W-0633-09 ENST00000371231 p.D540Y FPGT chr1 74205577 74205582 In_Frame_Del GGAACT GGAACT - TCGA-29-1770-01A-01W-0633-09 ENST00000370898 p.E524_L525del FPGT chr1 74205586 74205601 Frame_Shift_Del CTCTGGTAACAAGACA CTCTGGTAACAAGACA - TCGA-29-1770-01A-01W-0633-09 ENST00000370898 p.S527Vfs*2 STRIP1 chr1 110049197 110049201 Frame_Shift_Del CTGCT CTGCT - TCGA-29-1770-01A-01W-0633-09 ENST00000369795 p.L583Afs*6 CHIAP2 chr1 111282324 111282324 RNA T T A TCGA-29-1770-01A-01W-0633-09 ENST00000369743 NBPF15 chr1 144427921 144427921 Silent T T C TCGA-29-1770-01A-01W-0633-09 ENST00000488031 p.S370S AQP10 chr1 154324399 154324399 Silent T T A TCGA-29-1770-01A-01W-0633-09 ENST00000324978 p.A275A SLC30A10 chr1 219918686 219918686 Intron C C T TCGA-29-1770-01A-01W-0633-09 ENST00000366926 NLRP3 chr1 247424324 247424324 Missense_Mutation C C T TCGA-29-1770-01A-01W-0633-09 ENST00000336119 p.P294L AUP1 chr2 74527487 74527487 Silent G G A TCGA-29-1770-01A-01W-0633-09 ENST00000377526 p.V315V TTN chr2 178571336 178571336 Silent T T C TCGA-29-1770-01A-01W-0633-09 ENST00000591111 p.P23291P XPC chr3 14158329 14158329 Missense_Mutation C C G TCGA-29-1770-01A-01W-0633-09 ENST00000285021 p.E518D TMPPE chr3 33094165 33094165 Missense_Mutation C C T TCGA-29-1770-01A-01W-0633-09 ENST00000342462 p.A11T ZNF662 chr3 42914507 42914507 Missense_Mutation G G T TCGA-29-1770-01A-01W-0633-09 ENST00000440367 p.G145V ATRIP chr3 48460349 48460349 Missense_Mutation A A T TCGA-29-1770-01A-01W-0633-09 ENST00000320211 p.Q432L FILIP1L chr3 99850714 99850714 Missense_Mutation C C T TCGA-29-1770-01A-01W-0633-09 ENST00000354552 p.R321H SIDT1 chr3 113607063 113607063 Missense_Mutation A A T TCGA-29-1770-01A-01W-0633-09 ENST00000264852 p.Q476L SIDT1 chr3 113607064 113607064 Silent G G A TCGA-29-1770-01A-01W-0633-09 ENST00000264852 p.Q476Q GTF2E1 chr3 120750753 120750753 Missense_Mutation G G C TCGA-29-1770-01A-01W-0633-09 ENST00000283875 p.K67N PIK3CB chr3 138759334 138759334 Missense_Mutation T T A TCGA-29-1770-01A-01W-0633-09 ENST00000289153 p.S4C U2SURP chr3 143010845 143010845 Missense_Mutation T T C TCGA-29-1770-01A-01W-0633-09 ENST00000473835 p.S26P AADAC chr3 151827896 151827896 Silent T T G TCGA-29-1770-01A-01W-0633-09 ENST00000232892 p.A308A GHSR chr3 172447605 172447605 Intron C C T TCGA-29-1770-01A-01W-0633-09 ENST00000241256 CHRD chr3 184388939 184388939 Missense_Mutation C C A TCGA-29-1770-01A-01W-0633-09 ENST00000204604 p.S919Y MAP3K13 chr3 185447904 185447904 Nonsense_Mutation G G T TCGA-29-1770-01A-01W-0633-09 ENST00000265026 p.E323* FRAS1 chr4 78496949 78496950 In_Frame_Ins - - ATG TCGA-29-1770-01A-01W-0633-09 ENST00000512123 p.D3036dup ARHGEF38 chr4 105679073 105679073 3'UTR C C A TCGA-29-1770-01A-01W-0633-09 ENST00000420470 GRIA2 chr4 157361616 157361616 Intron T T C TCGA-29-1770-01A-01W-0633-09 ENST00000264426 C5orf17 chr5 23980758 23980758 RNA C C G TCGA-29-1770-01A-01W-0633-09 ENST00000512559 HIST1H2BB chr6 26043250 26043250 3'Flank T T C TCGA-29-1770-01A-01W-0633-09 ENST00000615966 CLPSL1 chr6 35781102 35781102 5'UTR C C T TCGA-29-1770-01A-01W-0633-09 ENST00000373861 TBC1D22B chr6 37284411 37284411 Missense_Mutation G G A TCGA-29-1770-01A-01W-0633-09 ENST00000373491 p.E250K PTCHD4 chr6 48008865 48008865 Missense_Mutation A A T TCGA-29-1770-01A-01W-0633-09 ENST00000339488 p.F226I TFAP2B chr6 50843112 50843112 Missense_Mutation C C T TCGA-29-1770-01A-01W-0633-09 ENST00000393655 p.T368M KIAA1919 chr6 111265902 111265903 Frame_Shift_Ins - - G TCGA-29-1770-01A-01W-0633-09 ENST00000368847 p.D116Gfs*26 PMS2 chr7 5978623 5978623 Missense_Mutation C C A TCGA-29-1770-01A-01W-0633-09 ENST00000265849 p.G750C PDE1C chr7 31753264 31753264 3'UTR C C T TCGA-29-1770-01A-01W-0633-09 ENST00000321453 KIAA1324L chr7 86893061 86893061 Nonsense_Mutation T T A TCGA-29-1770-01A-01W-0633-09 ENST00000450689 p.K909* PARP12 chr7 140037780 140037781 Frame_Shift_Ins - - A TCGA-29-1770-01A-01W-0633-09 ENST00000263549 p.S420Ffs*2 RGS20 chr8 53958398 53958398 Missense_Mutation G G C TCGA-29-1770-01A-01W-0633-09 ENST00000297313 p.M369I E2F5 chr8 85209235 85209235 Nonsense_Mutation A A T TCGA-29-1770-01A-01W-0633-09 ENST00000416274 p.K237* CSMD3 chr8 112247070 112247070 Missense_Mutation C C T TCGA-29-1770-01A-01W-0633-09 ENST00000297405 p.R3391H ATAD2 chr8 123344913 123344913 Missense_Mutation C C G TCGA-29-1770-01A-01W-0633-09 ENST00000287394 p.D897H RFX3 chr9 3225132 3225132 Silent G G A TCGA-29-1770-01A-01W-0633-09 ENST00000382004 p.L720L C9orf106 chr9 129322152 129322152 RNA C - - TCGA-29-1770-01A-01W-0633-09 ENST00000316786 TUBAL3 chr10 5394169 5394169 Missense_Mutation G G T TCGA-29-1770-01A-01W-0633-09 ENST00000380419 p.S230Y OR8I2 chr11 56094147 56094147 Silent C C T TCGA-29-1770-01A-01W-0633-09 ENST00000302124 p.V280V TNKS1BP1 chr11 57300908 57300908 Missense_Mutation G G A TCGA-29-1770-01A-01W-0633-09 ENST00000358252 p.P1702L STIP1 chr11 64195852 64195852 Intron A A G TCGA-29-1770-01A-01W-0633-09 ENST00000305218 XRRA1 chr11 74845206 74845206 Missense_Mutation C C A TCGA-29-1770-01A-01W-0633-09 ENST00000340360 p.K590N ZC3H12C chr11 110164645 110164645 Silent C C G TCGA-29-1770-01A-01W-0633-09 ENST00000278590 p.S520S USP2 chr11 119373156 119373156 Missense_Mutation C C T TCGA-29-1770-01A-01W-0633-09 ENST00000260187 p.G109R LRMP chr12 25104375 25104375 Nonsense_Mutation C C G TCGA-29-1770-01A-01W-0633-09 ENST00000354454 p.S354* UHRF1BP1L chr12 100098513 100098513 Missense_Mutation C C T TCGA-29-1770-01A-01W-0633-09 ENST00000279907 p.E123K ACIN1 chr14 23079922 23079922 Silent G G A TCGA-29-1770-01A-01W-0633-09 ENST00000262710 p.L529L ESR2 chr14 64268795 64268795 Missense_Mutation C C A TCGA-29-1770-01A-01W-0633-09 ENST00000341099 p.G218C COX8C chr14 93348082 93348082 Missense_Mutation T T C TCGA-29-1770-01A-01W-0633-09 ENST00000342144 p.Y61H PPP4R4 chr14 94246454 94246454 Missense_Mutation A A T TCGA-29-1770-01A-01W-0633-09 ENST00000304338 p.K509I SYNE3 chr14 95455472 95455472 Missense_Mutation T T C TCGA-29-1770-01A-01W-0633-09 ENST00000334258 p.R348G BDKRB2 chr14 96240803 96240803 Silent C C T TCGA-29-1770-01A-01W-0633-09 ENST00000554311 p.L159L SNORD115-18 chr15 25203293 25203293 RNA G G A TCGA-29-1770-01A-01W-0633-09 ENST00000363293 MYO9A chr15 71878076 71878076 Missense_Mutation C C T TCGA-29-1770-01A-01W-0633-09 ENST00000356056 p.M1965I KIAA1024 chr15 79463141 79463141 Silent G G A TCGA-29-1770-01A-01W-0633-09 ENST00000305428 p.Q791Q TICRR chr15 89624805 89624805 Missense_Mutation T T C TCGA-29-1770-01A-01W-0633-09 ENST00000268138 p.S1499P IFT140 chr16 1583335 1583335 Missense_Mutation C C G TCGA-29-1770-01A-01W-0633-09 ENST00000426508 p.G471R TP53 chr17 7674872 7674872 Missense_Mutation T T C TCGA-29-1770-01A-01W-0633-09 ENST00000269305 p.Y220C ARHGEF15 chr17 8315428 8315428 Silent G G T TCGA-29-1770-01A-01W-0633-09 ENST00000361926 p.V425V ATPAF2 chr17 18018499 18018499 3'UTR G G T TCGA-29-1770-01A-01W-0633-09 ENST00000474627 PSMC3IP chr17 42573155 42573155 Silent C C G TCGA-29-1770-01A-01W-0633-09 ENST00000393795 p.L183L CACNA1G chr17 50626248 50626248 Missense_Mutation A A C TCGA-29-1770-01A-01W-0633-09 ENST00000359106 p.T2211P MUC16 chr19 8964233 8964233 Silent T T C TCGA-29-1770-01A-01W-0633-09 ENST00000397910 p.Q4179Q FARSA chr19 12924149 12924149 Splice_Site A A T TCGA-29-1770-01A-01W-0633-09 ENST00000314606 p.X463_splice IFNL1 chr19 39298618 39298618 3'UTR G G C TCGA-29-1770-01A-01W-0633-09 ENST00000333625 SIGLEC8 chr19 51455490 51455490 Missense_Mutation T T A TCGA-29-1770-01A-01W-0633-09 ENST00000321424 p.T327S MIR519E chr19 53679964 53679964 RNA G G A TCGA-29-1770-01A-01W-0633-09 ENST00000385075 MIR519E chr19 53679965 53679965 RNA G G A TCGA-29-1770-01A-01W-0633-09 ENST00000385075 ZNF304 chr19 57356985 57356985 Silent T T C TCGA-29-1770-01A-01W-0633-09 ENST00000282286 p.F372F NOP56 chr20 2655502 2655502 Silent G G A TCGA-29-1770-01A-01W-0633-09 ENST00000329276 p.R249R SLC23A2 chr20 4867860 4867860 Silent T T C TCGA-29-1770-01A-01W-0633-09 ENST00000338244 p.E422E NOL4L chr20 32456191 32456191 Missense_Mutation G G A TCGA-29-1770-01A-01W-0633-09 ENST00000359676 p.S105F BPIFB3 chr20 33073592 33073603 Nonstop_Mutation CCGTGGCATCCT CCGTGGCATCCT - TCGA-29-1770-01A-01W-0633-09 ENST00000375494 p.TVAS*473R ZNF334 chr20 46501953 46501953 Silent T T C TCGA-29-1770-01A-01W-0633-09 ENST00000347606 p.E462E ZNF831 chr20 59195929 59195929 Missense_Mutation A A G TCGA-29-1770-01A-01W-0633-09 ENST00000371030 p.K1267E HIRA chr22 19383653 19383653 Frame_Shift_Del A A - TCGA-29-1770-01A-01W-0633-09 ENST00000263208 p.I461Tfs*6 ZNF74 chr22 20406183 20406183 Missense_Mutation G G A TCGA-29-1770-01A-01W-0633-09 ENST00000400451 p.G384S SEZ6L chr22 26292634 26292634 Missense_Mutation G G A TCGA-29-1770-01A-01W-0633-09 ENST00000248933 p.R108H NHP2L1 chr22 41675157 41675157 Missense_Mutation C C T TCGA-29-1770-01A-01W-0633-09 ENST00000215956 p.V55M RRP7A chr22 42510702 42510702 3'UTR C C T TCGA-29-1770-01A-01W-0633-09 ENST00000323013 PARVB chr22 44147898 44147898 Frame_Shift_Del G G - TCGA-29-1770-01A-01W-0633-09 ENST00000338758 p.D251Ifs*6 RGAG4 chrX 72129952 72129953 Frame_Shift_Ins - - G TCGA-29-1770-01A-01W-0633-09 ENST00000479991 p.Q530Pfs*83 NXF4 chrX 102550186 102550186 Splice_Site G G A TCGA-29-1770-01A-01W-0633-09 ENST00000360035 BCORL1 chrX 130015474 130015474 Missense_Mutation C C T TCGA-29-1770-01A-01W-0633-09 ENST00000218147 p.P901L MAGEA6 chrX 152766627 152766627 3'UTR A A G TCGA-29-1770-01A-01W-0633-09 ENST00000329342 PAX7 chr1 18634395 18634395 Missense_Mutation G G C TCGA-23-1022-01A-02W-0486-08 ENST00000420770 p.V60L HSPG2 chr1 21879055 21879055 Missense_Mutation T T C TCGA-23-1022-01A-02W-0486-08 ENST00000374695 p.M804V WDTC1 chr1 27306339 27306339 Missense_Mutation G G A TCGA-23-1022-01A-02W-0486-08 ENST00000319394 p.D664N COL16A1 chr1 31686111 31686111 Missense_Mutation C C T TCGA-23-1022-01A-02W-0486-08 ENST00000373672 p.A622T ZSCAN20 chr1 33493531 33493531 Missense_Mutation A A G TCGA-23-1022-01A-02W-0486-08 ENST00000361328 p.T597A POMGNT1 chr1 46194356 46194358 In_Frame_Del CGG CGG - TCGA-23-1022-01A-02W-0486-08 ENST00000371984 p.R267del LRRC39 chr1 100152512 100152512 Silent G G A TCGA-23-1022-01A-02W-0486-08 ENST00000342895 p.F275F GAPDHP74 chr1 119434518 119434518 RNA G G T TCGA-23-1022-01A-02W-0486-08 ENST00000449411 HSD3BP5 chr1 119608957 119608957 RNA T T A TCGA-23-1022-01A-02W-0486-08 ENST00000434856 GJA8 chr1 147909124 147909124 Missense_Mutation A A G TCGA-23-1022-01A-02W-0486-08 ENST00000369235 p.K390R BOLA1 chr1 149900116 149900116 Missense_Mutation G G C TCGA-23-1022-01A-02W-0486-08 ENST00000369150 p.L19F SHC1 chr1 154970267 154970267 Missense_Mutation G G A TCGA-23-1022-01A-02W-0486-08 ENST00000368445 p.A87V LMNA chr1 156134932 156134932 Missense_Mutation T T G TCGA-23-1022-01A-02W-0486-08 ENST00000368300 p.V256G SPTA1 chr1 158613735 158613735 Silent A A C TCGA-23-1022-01A-02W-0486-08 ENST00000368147 p.A2325A MNDA chr1 158849225 158849225 Missense_Mutation G G A TCGA-23-1022-01A-02W-0486-08 ENST00000368141 p.M404I PYHIN1 chr1 158943977 158943977 Missense_Mutation A A T TCGA-23-1022-01A-02W-0486-08 ENST00000368140 p.Q397L ARHGAP30 chr1 161048692 161048692 Missense_Mutation G G C TCGA-23-1022-01A-02W-0486-08 ENST00000368013 p.Q777E SLC9C2 chr1 173535916 173535916 Missense_Mutation C C G TCGA-23-1022-01A-02W-0486-08 ENST00000367714 p.M563I PPFIA4 chr1 203068464 203068464 Missense_Mutation T T A TCGA-23-1022-01A-02W-0486-08 ENST00000447715 p.W1032R KCNH1 chr1 210684052 210684052 Silent C C T TCGA-23-1022-01A-02W-0486-08 ENST00000271751 p.P733P USH2A chr1 215888613 215888613 Missense_Mutation T T C TCGA-23-1022-01A-02W-0486-08 ENST00000307340 p.H2679R OBSCN chr1 228315869 228315869 Silent G G A TCGA-23-1022-01A-02W-0486-08 ENST00000422127 p.G4345G RYR2 chr1 237674823 237674823 Missense_Mutation C C G TCGA-23-1022-01A-02W-0486-08 ENST00000366574 p.A2936G ADCY3 chr2 24828144 24828144 Nonsense_Mutation G G T TCGA-23-1022-01A-02W-0486-08 ENST00000260600 p.Y730* LTBP1 chr2 33315269 33315269 Missense_Mutation G G A TCGA-23-1022-01A-02W-0486-08 ENST00000404816 p.D1244N AC007318.5 chr2 65205914 65205914 RNA T T A TCGA-23-1022-01A-02W-0486-08 ENST00000467568 HK2 chr2 74854449 74854449 Missense_Mutation G G T TCGA-23-1022-01A-02W-0486-08 ENST00000290573 p.G74W NPAS2 chr2 100948278 100948278 Missense_Mutation A A G TCGA-23-1022-01A-02W-0486-08 ENST00000335681 p.Q136R LIMS1 chr2 108659668 108659668 Silent T T C TCGA-23-1022-01A-02W-0486-08 ENST00000332345 p.A20A LIMS1 chr2 108659669 108659669 Nonsense_Mutation G G T TCGA-23-1022-01A-02W-0486-08 ENST00000332345 p.E21* PSD4 chr2 113186238 113186238 Missense_Mutation C C G TCGA-23-1022-01A-02W-0486-08 ENST00000245796 p.H537Q UGGT1 chr2 128129048 128129048 Missense_Mutation A A G TCGA-23-1022-01A-02W-0486-08 ENST00000259253 p.N416D TTN chr2 178601137 178601137 Silent G G T TCGA-23-1022-01A-02W-0486-08 ENST00000591111 p.G16948G ASNSD1 chr2 189666860 189666860 Missense_Mutation C C A TCGA-23-1022-01A-02W-0486-08 ENST00000260952 p.P243H HECW2 chr2 196433245 196433245 Missense_Mutation C C T TCGA-23-1022-01A-02W-0486-08 ENST00000260983 p.S60N PTPRN chr2 219298041 219298041 Silent C C G TCGA-23-1022-01A-02W-0486-08 ENST00000295718 p.V577V GPR55 chr2 230910275 230910275 Missense_Mutation C C G TCGA-23-1022-01A-02W-0486-08 ENST00000392039 p.A230P SCLY chr2 238083252 238083252 Missense_Mutation A A T TCGA-23-1022-01A-02W-0486-08 ENST00000254663 p.Y269F PTPRG chr3 61562323 61562323 Missense_Mutation G G T TCGA-23-1022-01A-02W-0486-08 ENST00000474889 p.L12F PROS1 chr3 93879197 93879197 Missense_Mutation A A C TCGA-23-1022-01A-02W-0486-08 ENST00000394236 p.V537G RP11-325B23.2 chr3 98238545 98238545 Intron G G C TCGA-23-1022-01A-02W-0486-08 ENST00000508616 ADGRG7 chr3 100694946 100694946 Missense_Mutation C C T TCGA-23-1022-01A-02W-0486-08 ENST00000273352 p.P780L PDCL3P4 chr3 101713117 101713117 RNA A A G TCGA-23-1022-01A-02W-0486-08 ENST00000489621 KALRN chr3 124269167 124269167 Frame_Shift_Del G G - TCGA-23-1022-01A-02W-0486-08 ENST00000240874 p.Q293Sfs*34 ZXDC chr3 126472222 126472222 Missense_Mutation A A G TCGA-23-1022-01A-02W-0486-08 ENST00000389709 p.S331P EFCAB12 chr3 129421781 129421781 Silent G G A TCGA-23-1022-01A-02W-0486-08 ENST00000326085 p.P24P COPB2 chr3 139358262 139358262 Missense_Mutation C C T TCGA-23-1022-01A-02W-0486-08 ENST00000333188 p.G855R KLHL6 chr3 183492502 183492502 Missense_Mutation T T C TCGA-23-1022-01A-02W-0486-08 ENST00000341319 p.Y519C EIF4G1 chr3 184324937 184324937 Silent G G T TCGA-23-1022-01A-02W-0486-08 ENST00000346169 p.R893R ADGRL3 chr4 61733140 61733140 Missense_Mutation T T A TCGA-23-1022-01A-02W-0486-08 ENST00000514591 p.S261T EXOC5P1 chr4 62818567 62818567 RNA G G A TCGA-23-1022-01A-02W-0486-08 ENST00000510543 PPBP chr4 73987961 73987961 Missense_Mutation C C A TCGA-23-1022-01A-02W-0486-08 ENST00000296028 p.G48V BMP3 chr4 81045871 81045871 Silent A A G TCGA-23-1022-01A-02W-0486-08 ENST00000282701 p.G150G HELQ chr4 83416791 83416791 Silent G G C TCGA-23-1022-01A-02W-0486-08 ENST00000295488 p.L1046L PTPN13 chr4 86734742 86734742 Missense_Mutation C C T TCGA-23-1022-01A-02W-0486-08 ENST00000411767 p.T673I HPGDS chr4 94317938 94317938 Frame_Shift_Del A A - TCGA-23-1022-01A-02W-0486-08 ENST00000295256 p.L54Wfs*12 FAT1 chr4 186619524 186619524 Silent C T T TCGA-23-1022-01A-02W-0486-08 ENST00000441802 p.R2354R ENC1 chr5 74635447 74635447 Missense_Mutation C C G TCGA-23-1022-01A-02W-0486-08 ENST00000302351 p.G347R APC chr5 112838953 112838953 Missense_Mutation G G A TCGA-23-1022-01A-02W-0486-08 ENST00000257430 p.G1120E APC chr5 112841608 112841608 Nonsense_Mutation C C G TCGA-23-1022-01A-02W-0486-08 ENST00000257430 p.S2005* ADAMTS19 chr5 129701577 129701577 Silent G G A TCGA-23-1022-01A-02W-0486-08 ENST00000274487 p.A1042A PCDHB7 chr5 141174572 141174572 Silent G G A TCGA-23-1022-01A-02W-0486-08 ENST00000231137 p.A579A PCDHB15 chr5 141247144 141247144 Missense_Mutation G G C TCGA-23-1022-01A-02W-0486-08 ENST00000231173 p.E522D PCDH1 chr5 141863811 141863811 Silent C C G TCGA-23-1022-01A-02W-0486-08 ENST00000394536 p.G840G ADRB2 chr5 148827882 148827882 Frame_Shift_Del G G - TCGA-23-1022-01A-02W-0486-08 ENST00000305988 p.N352Mfs*91 SH3TC2 chr5 149012654 149012654 Missense_Mutation T T A TCGA-23-1022-01A-02W-0486-08 ENST00000515425 p.E1045V GABRG2 chr5 162097805 162097805 Silent C C A TCGA-23-1022-01A-02W-0486-08 ENST00000361925 p.T165T RASGEF1C chr5 180119376 180119376 Missense_Mutation C C T TCGA-23-1022-01A-02W-0486-08 ENST00000361132 p.G293S TNF chr6 31577286 31577286 Missense_Mutation C C T TCGA-23-1022-01A-02W-0486-08 ENST00000449264 p.L151F COL11A2 chr6 33186670 33186670 Missense_Mutation G G T TCGA-23-1022-01A-02W-0486-08 ENST00000374708 p.P252Q ABCC10 chr6 43433040 43433040 Nonsense_Mutation C C T TCGA-23-1022-01A-02W-0486-08 ENST00000372530 p.Q354* DEFB114 chr6 49960438 49960438 Missense_Mutation T T A TCGA-23-1022-01A-02W-0486-08 ENST00000322066 p.T22S COL9A1 chr6 70302061 70302061 Missense_Mutation A A T TCGA-23-1022-01A-02W-0486-08 ENST00000357250 p.F10I MYO6 chr6 75915041 75915041 3'UTR G G A TCGA-23-1022-01A-02W-0486-08 ENST00000369977 RRAGD chr6 89379307 89379307 Missense_Mutation T T C TCGA-23-1022-01A-02W-0486-08 ENST00000369415 p.I226V MANEA chr6 95586612 95586612 Missense_Mutation A A T TCGA-23-1022-01A-02W-0486-08 ENST00000358812 p.N58I ENPP1 chr6 131850007 131850007 Missense_Mutation C C T TCGA-23-1022-01A-02W-0486-08 ENST00000360971 p.R111C PEX3 chr6 143471563 143471563 Missense_Mutation C C G TCGA-23-1022-01A-02W-0486-08 ENST00000367591 p.T177R UST chr6 149021475 149021475 Missense_Mutation G G C TCGA-23-1022-01A-02W-0486-08 ENST00000367463 p.D311H FAM120B chr6 170404570 170404571 Frame_Shift_Ins - - T TCGA-23-1022-01A-02W-0486-08 ENST00000476287 p.D905Vfs*102 PPP1R17 chr7 31707222 31707222 Missense_Mutation A A G TCGA-23-1022-01A-02W-0486-08 ENST00000342032 p.D136G BMPER chr7 33937346 33937346 Missense_Mutation C C G TCGA-23-1022-01A-02W-0486-08 ENST00000297161 p.L93V C7orf62 chr7 88794601 88794601 Silent A A G TCGA-23-1022-01A-02W-0486-08 ENST00000297203 p.Y114Y COL1A2 chr7 94425637 94425637 Missense_Mutation G G A TCGA-23-1022-01A-02W-0486-08 ENST00000297268 p.G937S ASNS chr7 97853072 97853072 Nonsense_Mutation G G C TCGA-23-1022-01A-02W-0486-08 ENST00000175506 p.Y488* TAF6 chr7 100112227 100112227 Missense_Mutation G G T TCGA-23-1022-01A-02W-0486-08 ENST00000344095 p.L201M LRCH4 chr7 100576273 100576273 Missense_Mutation G G T TCGA-23-1022-01A-02W-0486-08 ENST00000310300 p.P535T FBXO24 chr7 100590314 100590314 Missense_Mutation G G C TCGA-23-1022-01A-02W-0486-08 ENST00000241071 p.Q93H MUC17 chr7 101040711 101040711 Missense_Mutation A A T TCGA-23-1022-01A-02W-0486-08 ENST00000306151 p.T3099S CBLL1 chr7 107748956 107748956 Silent C C T TCGA-23-1022-01A-02W-0486-08 ENST00000440859 p.L30L WNT2 chr7 117297697 117297697 Silent A A T TCGA-23-1022-01A-02W-0486-08 ENST00000265441 p.A256A PAX4 chr7 127613044 127613044 Silent G G C TCGA-23-1022-01A-02W-0486-08 ENST00000341640 p.L223L CHRM2 chr7 137015149 137015149 Missense_Mutation T T G TCGA-23-1022-01A-02W-0486-08 ENST00000320658 p.V95G DENND2A chr7 140601470 140601470 Missense_Mutation A A C TCGA-23-1022-01A-02W-0486-08 ENST00000275884 p.S310A ZNF862 chr7 149864168 149864168 Missense_Mutation A A G TCGA-23-1022-01A-02W-0486-08 ENST00000223210 p.K1132E GIMAP5 chr7 150742292 150742292 Silent C C G TCGA-23-1022-01A-02W-0486-08 ENST00000358647 p.P51P AOC1 chr7 150860623 150860623 Missense_Mutation T T C TCGA-23-1022-01A-02W-0486-08 ENST00000360937 p.I660T DPP6 chr7 154803861 154803861 Splice_Region C C T TCGA-23-1022-01A-02W-0486-08 ENST00000377770 LZTS1 chr8 20254869 20254870 Frame_Shift_Ins - - G TCGA-23-1022-01A-02W-0486-08 ENST00000265801 p.K105Qfs*133 BAG4 chr8 38210476 38210477 Frame_Shift_Ins - - A TCGA-23-1022-01A-02W-0486-08 ENST00000287322 p.G456Rfs*70 MATN2 chr8 97941801 97941801 Missense_Mutation A A T TCGA-23-1022-01A-02W-0486-08 ENST00000254898 p.E246V ABRA chr8 106770004 106770004 Missense_Mutation G G T TCGA-23-1022-01A-02W-0486-08 ENST00000311955 p.P63T PKHD1L1 chr8 109518174 109518174 Frame_Shift_Del C C - TCGA-23-1022-01A-02W-0486-08 ENST00000378402 p.L3900Ffs*38 FAM135B chr8 138132639 138132639 Missense_Mutation A A G TCGA-23-1022-01A-02W-0486-08 ENST00000395297 p.F1392S SHARPIN chr8 144098956 144098956 Silent G G A TCGA-23-1022-01A-02W-0486-08 ENST00000398712 p.A362A GLIS3 chr9 4118066 4118066 Missense_Mutation G G C TCGA-23-1022-01A-02W-0486-08 ENST00000324333 p.P316R RANBP6 chr9 6015291 6015291 Missense_Mutation T T C TCGA-23-1022-01A-02W-0486-08 ENST00000259569 p.K106R FOCAD chr9 20881927 20881927 Missense_Mutation G G T TCGA-23-1022-01A-02W-0486-08 ENST00000338382 p.G792W KIF24 chr9 34255786 34255786 Missense_Mutation C C T TCGA-23-1022-01A-02W-0486-08 ENST00000379166 p.C1274Y RORB chr9 74642579 74642579 Missense_Mutation A A G TCGA-23-1022-01A-02W-0486-08 ENST00000396204 p.N145S S1PR3 chr9 89002132 89002132 Missense_Mutation G G T TCGA-23-1022-01A-02W-0486-08 ENST00000358157 p.R311L ZFP37 chr9 113056630 113056630 Missense_Mutation C C T TCGA-23-1022-01A-02W-0486-08 ENST00000374227 p.R20K ODF2 chr9 128494689 128494689 Intron G G T TCGA-23-1022-01A-02W-0486-08 ENST00000434106 ST8SIA6 chr10 17321275 17321275 Missense_Mutation A A C TCGA-23-1022-01A-02W-0486-08 ENST00000377602 p.L267R SVILP1 chr10 30689502 30689502 Splice_Site A A C TCGA-23-1022-01A-02W-0486-08 ENST00000422642 ZNF485 chr10 43605623 43605623 5'Flank C C A TCGA-23-1022-01A-02W-0486-08 ENST00000361807 INA chr10 103288466 103288466 Missense_Mutation A A C TCGA-23-1022-01A-02W-0486-08 ENST00000369849 p.S433R NRAP chr10 113608457 113608457 Missense_Mutation G G T TCGA-23-1022-01A-02W-0486-08 ENST00000359988 p.P1220H OR51E2 chr11 4681810 4681810 Missense_Mutation C C A TCGA-23-1022-01A-02W-0486-08 ENST00000396950 p.R301L PIK3C2A chr11 17150625 17150625 Missense_Mutation G G C TCGA-23-1022-01A-02W-0486-08 ENST00000265970 p.H400Q CELF1 chr11 47486771 47486771 Missense_Mutation C C G TCGA-23-1022-01A-02W-0486-08 ENST00000358597 p.A97P OR5AS1 chr11 56031255 56031255 Silent T T G TCGA-23-1022-01A-02W-0486-08 ENST00000313555 p.T279T OR8U1 chr11 56375947 56375947 Missense_Mutation G G T TCGA-23-1022-01A-02W-0486-08 ENST00000302270 p.M108I OR4D6 chr11 59457820 59457820 Missense_Mutation A A C TCGA-23-1022-01A-02W-0486-08 ENST00000300127 p.Y287S SCGB2A2 chr11 62270245 62270245 Missense_Mutation C C T TCGA-23-1022-01A-02W-0486-08 ENST00000227918 p.A10V C2CD3 chr11 74132949 74132949 Missense_Mutation C C G TCGA-23-1022-01A-02W-0486-08 ENST00000334126 p.R371P RAB38 chr11 88175403 88175403 5'UTR G G A TCGA-23-1022-01A-02W-0486-08 ENST00000243662 FAT3 chr11 92352784 92352784 Missense_Mutation G G T TCGA-23-1022-01A-02W-0486-08 ENST00000525166 p.K74N CUL5 chr11 108054656 108054656 Missense_Mutation G G T TCGA-23-1022-01A-02W-0486-08 ENST00000393094 p.C188F NNMT chr11 114296642 114296642 Missense_Mutation C C G TCGA-23-1022-01A-02W-0486-08 ENST00000299964 p.S29C JAM3 chr11 134069150 134069150 Missense_Mutation C C A TCGA-23-1022-01A-02W-0486-08 ENST00000299106 p.L23I GNB3 chr12 6841362 6841362 Intron C C T TCGA-23-1022-01A-02W-0486-08 ENST00000229264 ACSM4 chr12 7304368 7304368 Missense_Mutation A A T TCGA-23-1022-01A-02W-0486-08 ENST00000399422 p.I13F C2CD5 chr12 22469787 22469787 Missense_Mutation C C G TCGA-23-1022-01A-02W-0486-08 ENST00000333957 p.D819H LMNTD1 chr12 25526205 25526205 Missense_Mutation G G A TCGA-23-1022-01A-02W-0486-08 ENST00000282881 p.A210V TBC1D15 chr12 71839745 71839745 5'UTR G G A TCGA-23-1022-01A-02W-0486-08 ENST00000550746 CAPS2 chr12 75282336 75282336 Missense_Mutation T T G TCGA-23-1022-01A-02W-0486-08 ENST00000409445 p.K528N CSRP2 chr12 76858966 76858966 Missense_Mutation C C A TCGA-23-1022-01A-02W-0486-08 ENST00000311083 p.V190F CEP290 chr12 88071389 88071389 Silent A A G TCGA-23-1022-01A-02W-0486-08 ENST00000552810 p.D1972D PLXNC1 chr12 94181530 94181530 Missense_Mutation G G A TCGA-23-1022-01A-02W-0486-08 ENST00000258526 p.V430I SCYL2 chr12 100314582 100314582 Missense_Mutation G G A TCGA-23-1022-01A-02W-0486-08 ENST00000360820 p.G355R STAB2 chr12 103660343 103660343 Missense_Mutation C C T TCGA-23-1022-01A-02W-0486-08 ENST00000388887 p.L583F TDG chr12 103982924 103982924 Missense_Mutation G G T TCGA-23-1022-01A-02W-0486-08 ENST00000392872 p.D202Y EID3 chr12 104304711 104304736 Frame_Shift_Del ATTTTATGTTTCTTTTATTGTAAGAG ATTTTATGTTTCTTTTATTGTAAGAG - TCGA-23-1022-01A-02W-0486-08 ENST00000527879 p.F260Wfs*8 HECTD4 chr12 112172679 112172679 Missense_Mutation C C T TCGA-23-1022-01A-02W-0486-08 ENST00000550722 p.C3792Y ADGRD1 chr12 130966466 130966466 Missense_Mutation T T A TCGA-23-1022-01A-02W-0486-08 ENST00000261654 p.F36Y SACS chr13 23339731 23339731 Missense_Mutation T T C TCGA-23-1022-01A-02W-0486-08 ENST00000382292 p.H1382R POSTN chr13 37563282 37563282 3'UTR C C A TCGA-23-1022-01A-02W-0486-08 ENST00000379747 FREM2 chr13 38784677 38784677 Missense_Mutation T T C TCGA-23-1022-01A-02W-0486-08 ENST00000280481 p.I1963T RP11-536C10.25 chr14 18711872 18711872 RNA T T A TCGA-23-1022-01A-02W-0486-08 ENST00000613227 OR4N2 chr14 19828356 19828356 Missense_Mutation A A T TCGA-23-1022-01A-02W-0486-08 ENST00000315947 p.N303I CTSG chr14 24573541 24573541 3'Flank A A C TCGA-23-1022-01A-02W-0486-08 ENST00000216336 HEATR5A chr14 31387159 31387159 Missense_Mutation C C G TCGA-23-1022-01A-02W-0486-08 ENST00000543095 p.D384H AKAP6 chr14 32824349 32824349 Missense_Mutation C C G TCGA-23-1022-01A-02W-0486-08 ENST00000280979 p.S2179C AL391261.1 chr14 66013608 66013608 5'Flank C C A TCGA-23-1022-01A-02W-0486-08 ENST00000458915 CCDC88C chr14 91305897 91305897 Silent C G G TCGA-23-1022-01A-02W-0486-08 ENST00000389857 p.L1075L FSIP1 chr15 39763913 39763913 Missense_Mutation G G T TCGA-23-1022-01A-02W-0486-08 ENST00000350221 p.S156Y GLDN chr15 51394962 51394962 Silent C C T TCGA-23-1022-01A-02W-0486-08 ENST00000335449 p.S223S RNF111 chr15 59092541 59092541 Missense_Mutation A A T TCGA-23-1022-01A-02W-0486-08 ENST00000557998 p.K923I TRIP4 chr15 64397819 64397819 Splice_Site G G T TCGA-23-1022-01A-02W-0486-08 ENST00000261884 p.X206_splice PIAS1 chr15 68141953 68141953 Silent C C T TCGA-23-1022-01A-02W-0486-08 ENST00000249636 p.D159D HEXA chr15 72346552 72346552 Silent G G A TCGA-23-1022-01A-02W-0486-08 ENST00000268097 p.Y435Y HCN4 chr15 73343632 73343632 Missense_Mutation T T A TCGA-23-1022-01A-02W-0486-08 ENST00000261917 p.E321V ALPK3 chr15 84857610 84857610 Missense_Mutation G G C TCGA-23-1022-01A-02W-0486-08 ENST00000258888 p.D1160H UMOD chr16 20337364 20337364 Missense_Mutation G G C TCGA-23-1022-01A-02W-0486-08 ENST00000302509 p.A556G XPO6 chr16 28181031 28181031 Missense_Mutation C C G TCGA-23-1022-01A-02W-0486-08 ENST00000304658 p.A2P DOC2A chr16 30010029 30010029 Missense_Mutation G G A TCGA-23-1022-01A-02W-0486-08 ENST00000350119 p.A65V HYDIN chr16 70943894 70943894 Missense_Mutation G C C TCGA-23-1022-01A-02W-0486-08 ENST00000393567 p.P2196R GAN chr16 81357815 81357815 Missense_Mutation G A A TCGA-23-1022-01A-02W-0486-08 ENST00000568107 p.R286Q NXN chr17 822432 822432 Missense_Mutation C C T TCGA-23-1022-01A-02W-0486-08 ENST00000336868 p.R213Q SLC16A11 chr17 7041836 7041836 Missense_Mutation C C A TCGA-23-1022-01A-02W-0486-08 ENST00000308009 p.S420I TP53 chr17 7675122 7675122 Missense_Mutation T C C TCGA-23-1022-01A-02W-0486-08 ENST00000269305 p.K164E ADORA2B chr17 15975271 15975271 Missense_Mutation C C T TCGA-23-1022-01A-02W-0486-08 ENST00000304222 p.L310F RNF112 chr17 19414122 19414122 Missense_Mutation G G A TCGA-23-1022-01A-02W-0486-08 ENST00000461366 p.D285N RP11-848P1.9 chr17 31022013 31022013 RNA G G T TCGA-23-1022-01A-02W-0486-08 ENST00000579692 PSMD3 chr17 39995227 39995227 Missense_Mutation G G T TCGA-23-1022-01A-02W-0486-08 ENST00000264639 p.G383V KRT13 chr17 41501247 41501247 3'UTR C C A TCGA-23-1022-01A-02W-0486-08 ENST00000246635 RP11-156P1.3 chr17 47018226 47018226 RNA A A T TCGA-23-1022-01A-02W-0486-08 ENST00000575173 GRIN2C chr17 74854682 74854694 Splice_Site TTGGACATGCACC TTGGACATGCACC - TCGA-23-1022-01A-02W-0486-08 ENST00000293190 p.X133_splice C1QTNF1 chr17 79047670 79047670 Missense_Mutation G G A TCGA-23-1022-01A-02W-0486-08 ENST00000339142 p.S143N MTCL1 chr18 8784737 8784737 Missense_Mutation C C A TCGA-23-1022-01A-02W-0486-08 ENST00000306329 p.P902H RP11-815J4.6 chr18 12076320 12076320 RNA A A T TCGA-23-1022-01A-02W-0486-08 ENST00000591780 CHST9 chr18 26916398 26916398 Missense_Mutation C C T TCGA-23-1022-01A-02W-0486-08 ENST00000581714 p.R398K ACAA2 chr18 49783929 49783929 Missense_Mutation C C G TCGA-23-1022-01A-02W-0486-08 ENST00000285093 p.R371P OR7D2 chr19 9186109 9186109 Missense_Mutation C C G TCGA-23-1022-01A-02W-0486-08 ENST00000344248 p.L110V CYP4F12 chr19 15682394 15682394 Missense_Mutation G G T TCGA-23-1022-01A-02W-0486-08 ENST00000550308 p.K177N CYP4F2 chr19 15878748 15878748 3'UTR G G C TCGA-23-1022-01A-02W-0486-08 ENST00000221700 UNC13A chr19 17606124 17606124 Missense_Mutation G G A TCGA-23-1022-01A-02W-0486-08 ENST00000519716 p.A1681V ZNF90 chr19 20105282 20105282 Silent T T A TCGA-23-1022-01A-02W-0486-08 ENST00000418063 p.T64T ZNF724P chr19 23223076 23223076 Missense_Mutation C C G TCGA-23-1022-01A-02W-0486-08 ENST00000418100 p.G390A ZNF91 chr19 23360154 23360154 Missense_Mutation T T G TCGA-23-1022-01A-02W-0486-08 ENST00000300619 p.E942A FAM187B chr19 35228407 35228407 Missense_Mutation G G A TCGA-23-1022-01A-02W-0486-08 ENST00000324675 p.L92F RYR1 chr19 38507738 38507738 Missense_Mutation C C G TCGA-23-1022-01A-02W-0486-08 ENST00000359596 p.S2948W SARS2 chr19 38930519 38930542 In_Frame_Del GCGTGTGCGGCCTCTTCTGGGCAT GCGTGTGCGGCCTCTTCTGGGCAT - TCGA-23-1022-01A-02W-0486-08 ENST00000221431 p.C66_A73del AC093063.3 chr19 39682167 39682167 5'Flank C C - TCGA-23-1022-01A-02W-0486-08 ENST00000456368 NUMBL chr19 40682938 40682938 Missense_Mutation G G A TCGA-23-1022-01A-02W-0486-08 ENST00000252891 p.R94W B9D2 chr19 41358001 41358001 Nonsense_Mutation G G T TCGA-23-1022-01A-02W-0486-08 ENST00000243578 p.S37* MYH14 chr19 50301708 50301708 Silent C C G TCGA-23-1022-01A-02W-0486-08 ENST00000376970 p.A1798A KLK3 chr19 50858056 50858056 Missense_Mutation C C A TCGA-23-1022-01A-02W-0486-08 ENST00000326003 p.H78Q SIGLEC8 chr19 51454709 51454709 Missense_Mutation G G T TCGA-23-1022-01A-02W-0486-08 ENST00000321424 p.L375M ZNF613 chr19 51945636 51945636 Silent T T C TCGA-23-1022-01A-02W-0486-08 ENST00000293471 p.L585L MIR518A2 chr19 53739355 53739355 RNA G G T TCGA-23-1022-01A-02W-0486-08 ENST00000384966 NLRP12 chr19 53811280 53811280 Missense_Mutation C C T TCGA-23-1022-01A-02W-0486-08 ENST00000324134 p.E127K BRSK1 chr19 55294220 55294220 Silent C C A TCGA-23-1022-01A-02W-0486-08 ENST00000309383 p.P194P NLRP13 chr19 55912605 55912605 Missense_Mutation T T A TCGA-23-1022-01A-02W-0486-08 ENST00000342929 p.E404D ZNF583 chr19 56414347 56414347 Missense_Mutation G G T TCGA-23-1022-01A-02W-0486-08 ENST00000291598 p.V47F ZNF324B chr19 58455838 58455838 Silent G G C TCGA-23-1022-01A-02W-0486-08 ENST00000336614 p.S298S ACTR5 chr20 38771823 38771823 3'UTR C C G TCGA-23-1022-01A-02W-0486-08 ENST00000243903 RIMS4 chr20 44756277 44756277 Silent G G A TCGA-23-1022-01A-02W-0486-08 ENST00000372851 p.L223L RIMS4 chr20 44756278 44756278 Missense_Mutation C C G TCGA-23-1022-01A-02W-0486-08 ENST00000372851 p.E222D PTGIS chr20 49514332 49514332 Missense_Mutation C C A TCGA-23-1022-01A-02W-0486-08 ENST00000244043 p.A307S NFATC2 chr20 51474006 51474007 Frame_Shift_Del TG TG - TCGA-23-1022-01A-02W-0486-08 ENST00000396009 p.Q561Dfs*4 NFATC2 chr20 51474010 51474011 In_Frame_Ins - - CGATGC TCGA-23-1022-01A-02W-0486-08 ENST00000396009 p.S559_L560insAS NFATC2 chr20 51474013 51474013 Missense_Mutation A A T TCGA-23-1022-01A-02W-0486-08 ENST00000396009 p.S559T TIAM1 chr21 31266464 31266464 Missense_Mutation G G A TCGA-23-1022-01A-02W-0486-08 ENST00000286827 p.S170F EVA1C chr21 32514896 32514896 Silent A A G TCGA-23-1022-01A-02W-0486-08 ENST00000300255 p.R344R XKR3 chr22 16784343 16784343 Missense_Mutation A A G TCGA-23-1022-01A-02W-0486-08 ENST00000331428 p.I219T AIFM3 chr22 20967948 20967948 Missense_Mutation G G A TCGA-23-1022-01A-02W-0486-08 ENST00000399167 p.G2S RGL4 chr22 23696614 23696614 Missense_Mutation G G T TCGA-23-1022-01A-02W-0486-08 ENST00000290691 p.A363S PLA2G6 chr22 38113575 38113575 Missense_Mutation C C T TCGA-23-1022-01A-02W-0486-08 ENST00000332509 p.C705Y WBP2NL chr22 42019737 42019737 Missense_Mutation C C G TCGA-23-1022-01A-02W-0486-08 ENST00000328823 p.L83V FRMPD4 chrX 12720627 12720627 3'UTR T T C TCGA-23-1022-01A-02W-0486-08 ENST00000380682 KLHL34 chrX 21656051 21656051 Missense_Mutation T T G TCGA-23-1022-01A-02W-0486-08 ENST00000379499 p.K580Q ACOT9 chrX 23713156 23713156 Missense_Mutation G G C TCGA-23-1022-01A-02W-0486-08 ENST00000336430 p.A205G BCOR chrX 40062818 40062818 Silent G G A TCGA-23-1022-01A-02W-0486-08 ENST00000378444 p.H1367H LPAR4 chrX 78755453 78755453 Missense_Mutation G G A TCGA-23-1022-01A-02W-0486-08 ENST00000435339 p.R195H SATL1 chrX 85108579 85108579 5'UTR G G T TCGA-23-1022-01A-02W-0486-08 ENST00000395409 ZCCHC18 chrX 104114312 104114312 Missense_Mutation A A T TCGA-23-1022-01A-02W-0486-08 ENST00000537356 p.Q67H NUDC chr1 26941811 26941811 Missense_Mutation G G A TCGA-61-2111-01A-01W-0722-08 ENST00000321265 p.G141E COL16A1 chr1 31691625 31691625 Silent G G T TCGA-61-2111-01A-01W-0722-08 ENST00000373672 p.I425I ST3GAL3 chr1 43930154 43930154 Missense_Mutation G G A TCGA-61-2111-01A-01W-0722-08 ENST00000361392 p.R354Q CDC7 chr1 91507923 91507923 Missense_Mutation A A G TCGA-61-2111-01A-01W-0722-08 ENST00000234626 p.D62G CIAO1 chr2 96271128 96271128 Missense_Mutation C C T TCGA-61-2111-01A-01W-0722-08 ENST00000488633 p.A266V GRB14 chr2 164493156 164493156 Silent G G A TCGA-61-2111-01A-01W-0722-08 ENST00000263915 p.H501H CCDC141 chr2 178837690 178837690 Silent G G A TCGA-61-2111-01A-01W-0722-08 ENST00000420890 p.L1177L LANCL1 chr2 210434521 210434521 Missense_Mutation G G A TCGA-61-2111-01A-01W-0722-08 ENST00000233714 p.P389L ACOX2 chr3 58524538 58524539 Frame_Shift_Del GA GA - TCGA-61-2111-01A-01W-0722-08 ENST00000302819 p.P472Ifs*9 MSANTD1 chr4 3253421 3253421 Missense_Mutation G G A TCGA-61-2111-01A-01W-0722-08 ENST00000438480 p.E179K GPM6A chr4 175635002 175635002 Missense_Mutation C C A TCGA-61-2111-01A-01W-0722-08 ENST00000280187 p.R247L IL31RA chr5 55890128 55890128 Frame_Shift_Del G G - TCGA-61-2111-01A-01W-0722-08 ENST00000447346 p.E256Kfs*13 GIN1 chr5 103088137 103088137 Missense_Mutation C C G TCGA-61-2111-01A-01W-0722-08 ENST00000399004 p.D444H PCDHB3 chr5 141102025 141102025 Missense_Mutation T T C TCGA-61-2111-01A-01W-0722-08 ENST00000231130 p.F459S TENM2 chr5 168248359 168248359 Missense_Mutation A A G TCGA-61-2111-01A-01W-0722-08 ENST00000518659 p.N2474D ZNF391 chr6 27400355 27400355 5'UTR G G A TCGA-61-2111-01A-01W-0722-08 ENST00000244576 DDX56 chr7 44568957 44568957 Silent C C T TCGA-61-2111-01A-01W-0722-08 ENST00000258772 p.R443R RANBP6 chr9 6013873 6013873 Missense_Mutation C C T TCGA-61-2111-01A-01W-0722-08 ENST00000259569 p.E579K TUBB4B chr9 137242540 137242540 Missense_Mutation G G A TCGA-61-2111-01A-01W-0722-08 ENST00000340384 p.E108K ARHGAP21 chr10 24620234 24620234 Missense_Mutation C C G TCGA-61-2111-01A-01W-0722-08 ENST00000396432 p.R554P ZMIZ1 chr10 79277191 79277191 Silent C C A TCGA-61-2111-01A-01W-0722-08 ENST00000334512 p.S97S CFAP43 chr10 104161108 104161108 Missense_Mutation C C T TCGA-61-2111-01A-01W-0722-08 ENST00000357060 p.E1157K PGAP2 chr11 3825513 3825513 3'UTR G G A TCGA-61-2111-01A-01W-0722-08 ENST00000463452 KIF18A chr11 28023838 28023838 Missense_Mutation G G C TCGA-61-2111-01A-01W-0722-08 ENST00000263181 p.N839K SSSCA1 chr11 65570508 65570508 Missense_Mutation C C A TCGA-61-2111-01A-01W-0722-08 ENST00000309328 p.A6D TRPC6 chr11 101504160 101504160 Missense_Mutation G G T TCGA-61-2111-01A-01W-0722-08 ENST00000344327 p.S270Y USP2 chr11 119357285 119357285 Silent G G A TCGA-61-2111-01A-01W-0722-08 ENST00000260187 p.Y544Y ZBTB44 chr11 130260867 130260867 Missense_Mutation G G A TCGA-61-2111-01A-01W-0722-08 ENST00000357899 p.S336F B3GAT1 chr11 134382017 134382017 Missense_Mutation A A C TCGA-61-2111-01A-01W-0722-08 ENST00000312527 p.V309G PRMT8 chr12 3593104 3593104 Silent C C T TCGA-61-2111-01A-01W-0722-08 ENST00000382622 p.D369D SLC39A5 chr12 56236653 56236653 Missense_Mutation G G A TCGA-61-2111-01A-01W-0722-08 ENST00000266980 p.G372S PIWIL1 chr12 130347040 130347040 Missense_Mutation T T A TCGA-61-2111-01A-01W-0722-08 ENST00000245255 p.F211I IGHG1 chr14 106012354 106012354 Intron C C A TCGA-61-2111-01A-01W-0722-08 ENST00000618756 MGA chr15 41749365 41749365 Missense_Mutation A A G TCGA-61-2111-01A-01W-0722-08 ENST00000219905 p.T1920A TP53 chr17 7674233 7674233 Missense_Mutation C C A TCGA-61-2111-01A-01W-0722-08 ENST00000269305 p.G244C CCDC144NL chr17 20896027 20896027 5'UTR C C T TCGA-61-2111-01A-01W-0722-08 ENST00000327925 STAT5B chr17 42207708 42207708 Missense_Mutation G G C TCGA-61-2111-01A-01W-0722-08 ENST00000293328 p.L643V WNK4 chr17 42782774 42782774 Missense_Mutation G G C TCGA-61-2111-01A-01W-0722-08 ENST00000246914 p.R212T ATP8B1 chr18 57688361 57688361 Missense_Mutation G G A TCGA-61-2111-01A-01W-0722-08 ENST00000283684 p.T456M SMIM21 chr18 75418886 75418886 Missense_Mutation T T G TCGA-61-2111-01A-01W-0722-08 ENST00000579022 p.T54P ATP9B chr18 79337364 79337364 Missense_Mutation A A G TCGA-61-2111-01A-01W-0722-08 ENST00000426216 p.E733G PIK3R2 chr19 18166171 18166171 Missense_Mutation G G A TCGA-61-2111-01A-01W-0722-08 ENST00000222254 p.M476I ZNF526 chr19 42224841 42224841 Silent G G A TCGA-61-2111-01A-01W-0722-08 ENST00000301215 p.Q146Q PPP2R1A chr19 52212729 52212729 Missense_Mutation C C T TCGA-61-2111-01A-01W-0722-08 ENST00000322088 p.R183W VSTM2L chr20 37944042 37944042 Missense_Mutation C C T TCGA-61-2111-01A-01W-0722-08 ENST00000373461 p.T135M KRTAP13-1 chr21 30396272 30396272 Missense_Mutation G G T TCGA-61-2111-01A-01W-0722-08 ENST00000355459 p.E62D AP1B1 chr22 29330450 29330450 Missense_Mutation C C A TCGA-61-2111-01A-01W-0722-08 ENST00000405198 p.Q898H MYH9 chr22 36300165 36300165 Nonsense_Mutation G G A TCGA-61-2111-01A-01W-0722-08 ENST00000216181 p.Q980* FIGF chrX 15358092 15358092 Missense_Mutation G G A TCGA-61-2111-01A-01W-0722-08 ENST00000297904 p.P135S CNKSR2 chrX 21609318 21609318 Missense_Mutation C C T TCGA-61-2111-01A-01W-0722-08 ENST00000379510 p.A798V EPHB2 chr1 22882420 22882420 Silent G G A TCGA-24-1564-01A-01W-0551-08 ENST00000400191 p.S455S CSMD2 chr1 33611084 33611084 Silent G G A TCGA-24-1564-01A-01W-0551-08 ENST00000241312 p.S2060S PLEKHA6 chr1 204245666 204245666 Missense_Mutation C C T TCGA-24-1564-01A-01W-0551-08 ENST00000272203 p.G661R ACTN2 chr1 236757579 236757579 Missense_Mutation A A G TCGA-24-1564-01A-01W-0551-08 ENST00000366578 p.I750V COLEC11 chr2 3643911 3643911 Silent C C T TCGA-24-1564-01A-01W-0551-08 ENST00000349077 p.I203I VRK2 chr2 58048863 58048863 Missense_Mutation T T A TCGA-24-1564-01A-01W-0551-08 ENST00000340157 p.L11H PSD4 chr2 113197579 113197579 Missense_Mutation G G A TCGA-24-1564-01A-01W-0551-08 ENST00000245796 p.R801H BBS5 chr2 169479587 169479587 Missense_Mutation G G T TCGA-24-1564-01A-01W-0551-08 ENST00000295240 p.D12Y EPHB1 chr3 135166023 135166023 Silent G G A TCGA-24-1564-01A-01W-0551-08 ENST00000398015 p.A547A PHOX2B chr4 41745815 41745815 Missense_Mutation T T G TCGA-24-1564-01A-01W-0551-08 ENST00000226382 p.M313L MCTP1 chr5 94710828 94710828 Silent G G C TCGA-24-1564-01A-01W-0551-08 ENST00000515393 p.V940V PRR3 chr6 30562466 30562466 Missense_Mutation C C G TCGA-24-1564-01A-01W-0551-08 ENST00000376560 p.H180D DEFB110 chr6 50021880 50021880 Splice_Site C C T TCGA-24-1564-01A-01W-0551-08 ENST00000371148 p.X19_splice KHDRBS2 chr6 61680970 61680970 Missense_Mutation C C A TCGA-24-1564-01A-01W-0551-08 ENST00000281156 p.R348I TBC1D32 chr6 121080684 121080686 3'Flank TGT TGT - TCGA-24-1564-01A-01W-0551-08 ENST00000398212 GRM1 chr6 146029505 146029505 5'UTR C C T TCGA-24-1564-01A-01W-0551-08 ENST00000282753 SEC61G chr7 54752301 54752301 3'UTR A A - TCGA-24-1564-01A-01W-0551-08 ENST00000352861 CACNA2D1 chr7 82084835 82084835 Missense_Mutation C C T TCGA-24-1564-01A-01W-0551-08 ENST00000356253 p.E198K TAF6 chr7 100107341 100107342 Frame_Shift_Ins - - C TCGA-24-1564-01A-01W-0551-08 ENST00000344095 p.K647Efs*? SLC26A3 chr7 107787365 107787365 Missense_Mutation A A C TCGA-24-1564-01A-01W-0551-08 ENST00000340010 p.F294V MYOM2 chr8 2057656 2057656 Missense_Mutation T T G TCGA-24-1564-01A-01W-0551-08 ENST00000262113 p.F146V CNBD1 chr8 86887601 86887601 Missense_Mutation G G C TCGA-24-1564-01A-01W-0551-08 ENST00000518476 p.G50R RP11-613M10.9 chr9 37879171 37879171 Intron C C A TCGA-24-1564-01A-01W-0551-08 ENST00000540557 TLE1 chr9 81585576 81585576 Missense_Mutation A A T TCGA-24-1564-01A-01W-0551-08 ENST00000376499 p.V686E NEBL chr10 20812881 20812881 Silent G G A TCGA-24-1564-01A-01W-0551-08 ENST00000377122 p.D802D ZSWIM8 chr10 73800427 73800427 Missense_Mutation G G A TCGA-24-1564-01A-01W-0551-08 ENST00000605216 p.V1656I ZDHHC16 chr10 97452429 97452429 Silent C C T TCGA-24-1564-01A-01W-0551-08 ENST00000370854 p.I151I OR5L1 chr11 55811580 55811580 Silent G G A TCGA-24-1564-01A-01W-0551-08 ENST00000333973 p.T38T FTH1 chr11 61964849 61964849 Missense_Mutation T T C TCGA-24-1564-01A-01W-0551-08 ENST00000273550 p.K144E NCAPD3 chr11 134192874 134192874 Nonsense_Mutation C C T TCGA-24-1564-01A-01W-0551-08 ENST00000534548 p.W620* ALG10 chr12 34026740 34026740 Missense_Mutation G G A TCGA-24-1564-01A-01W-0551-08 ENST00000266483 p.R416H SLC4A8 chr12 51463698 51463698 Missense_Mutation C C G TCGA-24-1564-01A-01W-0551-08 ENST00000453097 p.L445V LRP1 chr12 57204503 57204503 Missense_Mutation A A G TCGA-24-1564-01A-01W-0551-08 ENST00000243077 p.N3682S NBEA chr13 35110911 35110911 Silent C C T TCGA-24-1564-01A-01W-0551-08 ENST00000400445 p.H645H RHOJ chr14 63205023 63205023 Missense_Mutation C C T TCGA-24-1564-01A-01W-0551-08 ENST00000316754 p.P52S USP8 chr15 50465083 50465083 Missense_Mutation C C T TCGA-24-1564-01A-01W-0551-08 ENST00000307179 p.T193M MYH11 chr16 15750181 15750181 Missense_Mutation G G A TCGA-24-1564-01A-01W-0551-08 ENST00000300036 p.T672M ANKS4B chr16 21249885 21249885 Missense_Mutation A A T TCGA-24-1564-01A-01W-0551-08 ENST00000311620 p.S107C ZNF267 chr16 31916168 31916168 Missense_Mutation C C T TCGA-24-1564-01A-01W-0551-08 ENST00000300870 p.A640V TP53 chr17 7675052 7675052 Splice_Site C C A TCGA-24-1564-01A-01W-0551-08 ENST00000269305 p.X187_splice AP2B1 chr17 35650543 35650543 Missense_Mutation C C G TCGA-24-1564-01A-01W-0551-08 ENST00000621914 p.P517R SDK2 chr17 73391492 73391492 Silent C C T TCGA-24-1564-01A-01W-0551-08 ENST00000392650 p.T1315T INSR chr19 7152742 7152742 Missense_Mutation C C G TCGA-24-1564-01A-01W-0551-08 ENST00000302850 p.V739L MUC16 chr19 8972911 8972911 Missense_Mutation G G A TCGA-24-1564-01A-01W-0551-08 ENST00000397910 p.S2743L MRI1 chr19 13764542 13764542 5'Flank C C A TCGA-24-1564-01A-01W-0551-08 ENST00000040663 ADGRE5 chr19 14402629 14402629 Missense_Mutation A A G TCGA-24-1564-01A-01W-0551-08 ENST00000242786 p.N406D NLRP2 chr19 55000858 55000858 Missense_Mutation C C A TCGA-24-1564-01A-01W-0551-08 ENST00000448584 p.P1050H LPIN3 chr20 41348764 41348764 Missense_Mutation G G C TCGA-24-1564-01A-01W-0551-08 ENST00000373257 p.R145P TMPRSS15 chr21 18312946 18312946 Missense_Mutation C C A TCGA-24-1564-01A-01W-0551-08 ENST00000284885 p.G722W SYNJ1 chr21 32700048 32700048 Missense_Mutation A A G TCGA-24-1564-01A-01W-0551-08 ENST00000433931 p.I129T BACE2 chr21 41237573 41237573 Missense_Mutation G G T TCGA-24-1564-01A-01W-0551-08 ENST00000330333 p.W154C ACE2 chrX 15575759 15575759 Missense_Mutation A A G TCGA-24-1564-01A-01W-0551-08 ENST00000252519 p.L450P HEPH chrX 66170640 66170640 Missense_Mutation G G T TCGA-24-1564-01A-01W-0551-08 ENST00000343002 p.A24S KIAA1210 chrX 119116653 119116653 Missense_Mutation A A C TCGA-24-1564-01A-01W-0551-08 ENST00000402510 p.C165G FGF13 chrX 138985073 138985073 Missense_Mutation G G T TCGA-24-1564-01A-01W-0551-08 ENST00000455663 p.S4R RAVER2 chr1 64831235 64831235 3'UTR A A G TCGA-24-1616-01A-01W-0553-09 ENST00000294428 LPPR4 chr1 99306701 99306701 Silent C C T TCGA-24-1616-01A-01W-0553-09 ENST00000370185 p.Y661Y SYT6 chr1 114097758 114097758 Missense_Mutation G G C TCGA-24-1616-01A-01W-0553-09 ENST00000610222 p.S495C AMPD1 chr1 114688931 114688931 Intron T T C TCGA-24-1616-01A-01W-0553-09 ENST00000520113 IGSF3 chr1 116616440 116616440 Missense_Mutation G G A TCGA-24-1616-01A-01W-0553-09 ENST00000369486 p.R21W NOTCH2NL chr1 146164933 146164933 Missense_Mutation G G T TCGA-24-1616-01A-01W-0553-09 ENST00000362074 p.T39N ASTN1 chr1 176868969 176868969 Silent C C T TCGA-24-1616-01A-01W-0553-09 ENST00000361833 p.Q1174Q TEDDM1 chr1 182399776 182399776 Missense_Mutation T T C TCGA-24-1616-01A-01W-0553-09 ENST00000367565 p.K237R PTPRC chr1 198702432 198702432 Missense_Mutation C C A TCGA-24-1616-01A-01W-0553-09 ENST00000442510 p.P162Q NFASC chr1 205001205 205001205 Missense_Mutation C C T TCGA-24-1616-01A-01W-0553-09 ENST00000339876 p.L1019F IKBKE chr1 206479062 206479062 Missense_Mutation C C T TCGA-24-1616-01A-01W-0553-09 ENST00000581977 p.A371V KIDINS220 chr2 8786333 8786333 Silent T T C TCGA-24-1616-01A-01W-0553-09 ENST00000256707 p.R604R TRIM43 chr2 95594112 95594112 Missense_Mutation G G T TCGA-24-1616-01A-01W-0553-09 ENST00000272395 p.C30F NXPH2 chr2 138671299 138671299 Nonsense_Mutation C C A TCGA-24-1616-01A-01W-0553-09 ENST00000272641 p.G140* ORC4 chr2 147972768 147972768 Missense_Mutation T T A TCGA-24-1616-01A-01W-0553-09 ENST00000264169 p.I66F GPD2 chr2 156582857 156582857 Missense_Mutation C C T TCGA-24-1616-01A-01W-0553-09 ENST00000310454 p.A708V SCN1A chr2 166036451 166036451 Missense_Mutation A A G TCGA-24-1616-01A-01W-0553-09 ENST00000303395 p.M1009T GULP1 chr2 188584314 188584314 Missense_Mutation T T C TCGA-24-1616-01A-01W-0553-09 ENST00000359135 p.I220T ECE2 chr3 184290585 184290585 Missense_Mutation G G A TCGA-24-1616-01A-01W-0553-09 ENST00000402825 p.A680T SDHAP1 chr3 195982209 195982209 RNA G G A TCGA-24-1616-01A-01W-0553-09 ENST00000427841 AASDH chr4 56354098 56354098 Nonsense_Mutation G G A TCGA-24-1616-01A-01W-0553-09 ENST00000205214 p.R442* ADGRL3 chr4 61947046 61947046 Missense_Mutation C C G TCGA-24-1616-01A-01W-0553-09 ENST00000514591 p.T783R FYB chr5 39134274 39134274 Missense_Mutation G G A TCGA-24-1616-01A-01W-0553-09 ENST00000351578 p.P584L VCAN chr5 83539730 83539730 Missense_Mutation A G G TCGA-24-1616-01A-01W-0553-09 ENST00000265077 p.T2243A TTC37 chr5 95520774 95520774 Missense_Mutation C C G TCGA-24-1616-01A-01W-0553-09 ENST00000358746 p.D686H TTC37 chr5 95520792 95520792 Missense_Mutation C C A TCGA-24-1616-01A-01W-0553-09 ENST00000358746 p.A680S TTC37 chr5 95522177 95522177 Nonsense_Mutation C C A TCGA-24-1616-01A-01W-0553-09 ENST00000358746 p.E630* GABRG2 chr5 162153295 162153295 Missense_Mutation A A G TCGA-24-1616-01A-01W-0553-09 ENST00000361925 p.Y444C FAM8A1 chr6 17608341 17608342 3'UTR - - C TCGA-24-1616-01A-01W-0553-09 ENST00000259963 HIST1H1C chr6 26056418 26056418 Missense_Mutation G G C TCGA-24-1616-01A-01W-0553-09 ENST00000343677 p.T4S KCNQ5 chr6 73077795 73077795 Missense_Mutation G G A TCGA-24-1616-01A-01W-0553-09 ENST00000370398 p.V276I PLEKHG1 chr6 150768674 150768674 Missense_Mutation C C T TCGA-24-1616-01A-01W-0553-09 ENST00000358517 p.P150S KCTD7 chr7 66638892 66638892 Missense_Mutation G G A TCGA-24-1616-01A-01W-0553-09 ENST00000275532 p.R177H DYNC1I1 chr7 95804809 95804809 Missense_Mutation G G A TCGA-24-1616-01A-01W-0553-09 ENST00000324972 p.R27Q GCC1 chr7 127582738 127582738 Missense_Mutation C C T TCGA-24-1616-01A-01W-0553-09 ENST00000321407 p.R535Q TNPO3 chr7 128972465 128972465 Silent C C T TCGA-24-1616-01A-01W-0553-09 ENST00000265388 p.R797R HAS2 chr8 121614297 121614297 Missense_Mutation C C A TCGA-24-1616-01A-01W-0553-09 ENST00000303924 p.G491C IFNA17 chr9 21227988 21227988 Silent G G A TCGA-24-1616-01A-01W-0553-09 ENST00000413767 p.P62P SPATA31D1 chr9 81994688 81994688 Silent G G A TCGA-24-1616-01A-01W-0553-09 ENST00000344803 p.R1406R NUTM2HP chr10 50685104 50685104 RNA A A T TCGA-24-1616-01A-01W-0553-09 ENST00000442076 ACADSB chr10 123043166 123043166 Missense_Mutation G G A TCGA-24-1616-01A-01W-0553-09 ENST00000358776 p.V268I MPEG1 chr11 59211370 59211370 Missense_Mutation G G C TCGA-24-1616-01A-01W-0553-09 ENST00000361050 p.A499G PICALM chr11 85974752 85974752 Missense_Mutation C C T TCGA-24-1616-01A-01W-0553-09 ENST00000393346 p.V634I SCN3B chr11 123642497 123642497 Missense_Mutation G G A TCGA-24-1616-01A-01W-0553-09 ENST00000299333 p.R132W SLCO1B1 chr12 21176895 21176895 Missense_Mutation A A T TCGA-24-1616-01A-01W-0553-09 ENST00000256958 p.K160I SRGAP1 chr12 64109016 64109016 Missense_Mutation A A G TCGA-24-1616-01A-01W-0553-09 ENST00000355086 p.Y633C GNPTAB chr12 101760056 101760056 Nonsense_Mutation G G A TCGA-24-1616-01A-01W-0553-09 ENST00000299314 p.Q1075* STAB2 chr12 103737705 103737705 Silent C C T TCGA-24-1616-01A-01W-0553-09 ENST00000388887 p.A1874A ATP8A2 chr13 25837238 25837238 Missense_Mutation C C T TCGA-24-1616-01A-01W-0553-09 ENST00000381655 p.P944S CCNA1 chr13 36442622 36442622 Missense_Mutation G A A TCGA-24-1616-01A-01W-0553-09 ENST00000255465 p.C452Y OR4K1 chr14 19935742 19935742 Missense_Mutation T T C TCGA-24-1616-01A-01W-0553-09 ENST00000285600 p.F26L DHRS4L2 chr14 23990320 23990320 Missense_Mutation T T A TCGA-24-1616-01A-01W-0553-09 ENST00000335125 p.H89Q UNC79 chr14 93653967 93653967 Missense_Mutation C C T TCGA-24-1616-01A-01W-0553-09 ENST00000393151 p.S2114L TCL1B chr14 95690849 95690849 Silent C C T TCGA-24-1616-01A-01W-0553-09 ENST00000340722 p.P92P IGHG1 chr14 105668905 105668905 Intron G G C TCGA-24-1616-01A-01W-0553-09 ENST00000618756 IVD chr15 40407645 40407645 Missense_Mutation A A G TCGA-24-1616-01A-01W-0553-09 ENST00000487418 p.T55A BCKDK chr16 31110437 31110437 Silent C C T TCGA-24-1616-01A-01W-0553-09 ENST00000219794 p.L194L CDH8 chr16 61653683 61653683 Silent G G A TCGA-24-1616-01A-01W-0553-09 ENST00000577390 p.Y775Y TP53 chr17 7674256 7674256 Missense_Mutation T C C TCGA-24-1616-01A-01W-0553-09 ENST00000269305 p.Y236C PIRT chr17 10825637 10825637 Missense_Mutation C C T TCGA-24-1616-01A-01W-0553-09 ENST00000580256 p.M3I RP11-283C24.1 chr17 20784924 20784924 5'Flank A A G TCGA-24-1616-01A-01W-0553-09 ENST00000578585 DSC3 chr18 31025916 31025916 Splice_Site C C A TCGA-24-1616-01A-01W-0553-09 ENST00000360428 p.X159_splice PPP2R1A chr19 52213074 52213074 Missense_Mutation G G T TCGA-24-1616-01A-01W-0553-09 ENST00000322088 p.W257C SYN1 chrX 47576202 47576202 Missense_Mutation T T C TCGA-24-1616-01A-01W-0553-09 ENST00000295987 p.I363V ACRC chrX 71603895 71603895 Silent C C T TCGA-24-1616-01A-01W-0553-09 ENST00000373695 p.D206D ATRX chrX 77557632 77557632 Missense_Mutation T T C TCGA-24-1616-01A-01W-0553-09 ENST00000373344 p.D2173G SH3BGRL chrX 81202186 81202186 5'UTR G G C TCGA-24-1616-01A-01W-0553-09 ENST00000373212 DIAPH2 chrX 96930751 96930751 Missense_Mutation A A T TCGA-24-1616-01A-01W-0553-09 ENST00000324765 p.I333L MTOR chr1 11212881 11212881 Missense_Mutation C T T TCGA-24-2254-01A-01W-0722-08 ENST00000361445 p.A1105T HAO2 chr1 119393790 119393790 Missense_Mutation C C T TCGA-24-2254-01A-01W-0722-08 ENST00000325945 p.R336W PGLYRP4 chr1 153345358 153345358 Missense_Mutation G G A TCGA-24-2254-01A-01W-0722-08 ENST00000359650 p.T55M DCST1 chr1 155041763 155041763 Silent G G A TCGA-24-2254-01A-01W-0722-08 ENST00000295542 p.K266K EDARADD chr1 236394400 236394400 5'UTR C C T TCGA-24-2254-01A-01W-0722-08 ENST00000334232 CHRM3 chr1 239908915 239908915 Silent A A G TCGA-24-2254-01A-01W-0722-08 ENST00000255380 p.K488K INSIG2 chr2 118103217 118103217 Missense_Mutation C C G TCGA-24-2254-01A-01W-0722-08 ENST00000245787 p.P89A SAP130 chr2 127996417 127996429 Frame_Shift_Del GGCTACTCCTCTC GGCTACTCCTCTC - TCGA-24-2254-01A-01W-0722-08 ENST00000259235 p.E452* MAP3K19 chr2 135021753 135021753 Missense_Mutation T T A TCGA-24-2254-01A-01W-0722-08 ENST00000375845 p.N34Y MYO3B chr2 170392402 170392402 Silent A A T TCGA-24-2254-01A-01W-0722-08 ENST00000408978 p.G566G FKBP7 chr2 178478453 178478453 Missense_Mutation T T A TCGA-24-2254-01A-01W-0722-08 ENST00000424785 p.Y16F MDH1B chr2 206755051 206755051 Missense_Mutation C C T TCGA-24-2254-01A-01W-0722-08 ENST00000374412 p.A290T MDH1B chr2 206755052 206755052 Missense_Mutation T T A TCGA-24-2254-01A-01W-0722-08 ENST00000374412 p.E289D KANSL1L chr2 210024036 210024036 Silent G G C TCGA-24-2254-01A-01W-0722-08 ENST00000281772 p.T910T ALG1L chr3 125925082 125925088 3'Flank CCAGAGA CCAGAGA - TCGA-24-2254-01A-01W-0722-08 ENST00000340333 MASP1 chr3 187251739 187251739 Silent T T C TCGA-24-2254-01A-01W-0722-08 ENST00000337774 p.P302P ZFYVE28 chr4 2305000 2305000 Frame_Shift_Del A A - TCGA-24-2254-01A-01W-0722-08 ENST00000290974 p.I447Tfs*12 ZFYVE28 chr4 2305008 2305008 Silent C C A TCGA-24-2254-01A-01W-0722-08 ENST00000290974 p.A444A PLEKHG4B chr5 156080 156080 Nonsense_Mutation G G T TCGA-24-2254-01A-01W-0722-08 ENST00000283426 p.E384* LIFR chr5 38523576 38523576 Missense_Mutation A A T TCGA-24-2254-01A-01W-0722-08 ENST00000263409 p.I135N SLC36A3 chr5 151277563 151277563 Missense_Mutation C C G TCGA-24-2254-01A-01W-0722-08 ENST00000335230 p.E415Q SLC36A3 chr5 151277638 151277638 Missense_Mutation G G A TCGA-24-2254-01A-01W-0722-08 ENST00000335230 p.R390C KIAA1191 chr5 176347710 176347710 Missense_Mutation A A C TCGA-24-2254-01A-01W-0722-08 ENST00000298569 p.L270V GCM2 chr6 10874921 10874921 Missense_Mutation G G C TCGA-24-2254-01A-01W-0722-08 ENST00000379491 p.Q199E MLIP chr6 54124754 54124754 Silent G G A TCGA-24-2254-01A-01W-0722-08 ENST00000274897 p.S167S ARHGAP18 chr6 129638454 129638454 Frame_Shift_Del T T - TCGA-24-2254-01A-01W-0722-08 ENST00000368149 p.K164Nfs*54 ZNRF2 chr7 30371974 30371974 3'Flank G G A TCGA-24-2254-01A-01W-0722-08 ENST00000323037 PHTF2 chr7 77920439 77920439 Frame_Shift_Del G G - TCGA-24-2254-01A-01W-0722-08 ENST00000248550 p.G313Efs*3 GAL3ST4 chr7 100160245 100160245 Missense_Mutation C C G TCGA-24-2254-01A-01W-0722-08 ENST00000360039 p.E382Q RELN chr7 103661375 103661375 Splice_Site C C T TCGA-24-2254-01A-01W-0722-08 ENST00000428762 p.X481_splice RHOBTB2 chr8 23007046 23007046 Silent C C T TCGA-24-2254-01A-01W-0722-08 ENST00000251822 p.D267D KCNK9 chr8 139618520 139618520 Missense_Mutation G A A TCGA-24-2254-01A-01W-0722-08 ENST00000303015 p.A288V TRPM3 chr9 70536585 70536585 Missense_Mutation G G A TCGA-24-2254-01A-01W-0722-08 ENST00000377110 p.R1498C GNA14 chr9 77424142 77424142 Missense_Mutation C C T TCGA-24-2254-01A-01W-0722-08 ENST00000341700 p.R302K PHF2 chr9 93673846 93673846 Silent C C T TCGA-24-2254-01A-01W-0722-08 ENST00000359246 p.F870F ZNF189 chr9 101408622 101408622 Missense_Mutation A A G TCGA-24-2254-01A-01W-0722-08 ENST00000339664 p.E285G MYBPC3 chr11 47332194 47332194 Missense_Mutation C C T TCGA-24-2254-01A-01W-0722-08 ENST00000545968 p.S1231N HRASLS5 chr11 63466120 63466120 Missense_Mutation C C T TCGA-24-2254-01A-01W-0722-08 ENST00000301790 p.R246Q SESN3 chr11 95173249 95173249 3'UTR G G C TCGA-24-2254-01A-01W-0722-08 ENST00000536441 VWF chr12 5949125 5949125 Missense_Mutation G G A TCGA-24-2254-01A-01W-0722-08 ENST00000261405 p.R2778W MON2 chr12 62592789 62592789 3'UTR A A G TCGA-24-2254-01A-01W-0722-08 ENST00000393630 CLIP1 chr12 122354452 122354452 Splice_Site C T T TCGA-24-2254-01A-01W-0722-08 ENST00000540338 p.X436_splice SCEL chr13 77602699 77602699 Missense_Mutation T T A TCGA-24-2254-01A-01W-0722-08 ENST00000349847 p.N341K MYH6 chr14 23400752 23400752 Missense_Mutation T T G TCGA-24-2254-01A-01W-0722-08 ENST00000356287 p.Y456S SRL chr16 4192676 4192676 Missense_Mutation G G A TCGA-24-2254-01A-01W-0722-08 ENST00000399609 p.P300L CDH8 chr16 61821001 61821001 Missense_Mutation G C C TCGA-24-2254-01A-01W-0722-08 ENST00000577390 p.I316M ATP2A3 chr17 3947703 3947703 Silent G G T TCGA-24-2254-01A-01W-0722-08 ENST00000352011 p.S261S TP53 chr17 7674241 7674241 Missense_Mutation G A A TCGA-24-2254-01A-01W-0722-08 ENST00000269305 p.S241F MYH1 chr17 10492506 10492506 Silent G A A TCGA-24-2254-01A-01W-0722-08 ENST00000226207 p.A1910A DENND1C chr19 6467566 6467566 Nonsense_Mutation G G A TCGA-24-2254-01A-01W-0722-08 ENST00000381480 p.Q782* CLIP3 chr19 36017935 36017935 Missense_Mutation C T T TCGA-24-2254-01A-01W-0722-08 ENST00000360535 p.A414T CEACAM8 chr19 42594868 42594868 5'UTR C C A TCGA-24-2254-01A-01W-0722-08 ENST00000244336 PSG9 chr19 43267825 43267826 Frame_Shift_Ins - - C TCGA-24-2254-01A-01W-0722-08 ENST00000270077 p.E130Gfs*3 ZNF649 chr19 51896867 51896867 Missense_Mutation T T A TCGA-24-2254-01A-01W-0722-08 ENST00000354957 p.N43Y EMILIN3 chr20 41361724 41361724 Silent G C C TCGA-24-2254-01A-01W-0722-08 ENST00000332312 p.A615A KAL1 chrX 8585372 8585372 Missense_Mutation T T A TCGA-24-2254-01A-01W-0722-08 ENST00000262648 p.T251S MAP3K15 chrX 19362834 19362834 Missense_Mutation C C G TCGA-24-2254-01A-01W-0722-08 ENST00000338883 p.V1195L FAM47C chrX 37008632 37008632 Silent C C T TCGA-24-2254-01A-01W-0722-08 ENST00000358047 p.D74D RPS26P11 chrX 72044833 72044833 RNA C C A TCGA-24-2254-01A-01W-0722-08 ENST00000463445 UPF3B chrX 119841119 119841119 Missense_Mutation C C T TCGA-24-2254-01A-01W-0722-08 ENST00000276201 p.R255K PDPN chr1 13610510 13610510 Missense_Mutation T T C TCGA-59-2348-01A-01D-0704-01 ENST00000621990 p.S109P CSMD2 chr1 33698926 33698926 Missense_Mutation C C A TCGA-59-2348-01A-01D-0704-01 ENST00000241312 p.C1211F ZFP69B chr1 40457403 40457403 Missense_Mutation C C G TCGA-59-2348-01A-01D-0704-01 ENST00000361584 p.L134V GIPC2 chr1 78080739 78080739 Missense_Mutation G G A TCGA-59-2348-01A-01D-0704-01 ENST00000370759 p.G102E GTF2B chr1 88860008 88860008 Nonsense_Mutation G G A TCGA-59-2348-01A-01D-0704-01 ENST00000370500 p.R137* LRRC8B chr1 89584043 89584043 Missense_Mutation C C G TCGA-59-2348-01A-01D-0704-01 ENST00000330947 p.L465V TMED5 chr1 93180147 93180147 Silent G G C TCGA-59-2348-01A-01D-0704-01 ENST00000370282 p.L32L AMY2B chr1 103573067 103573067 Missense_Mutation G G C TCGA-59-2348-01A-01D-0704-01 ENST00000361355 p.R107P KIAA1324 chr1 109164539 109164539 Missense_Mutation C C A TCGA-59-2348-01A-01D-0704-01 ENST00000369939 p.D105E MOV10 chr1 112694098 112694098 Missense_Mutation G G T TCGA-59-2348-01A-01D-0704-01 ENST00000357443 p.Q407H ADAR chr1 154601893 154601893 Missense_Mutation G G A TCGA-59-2348-01A-01D-0704-01 ENST00000368474 p.A250V THBS3 chr1 155202840 155202840 Missense_Mutation T T C TCGA-59-2348-01A-01D-0704-01 ENST00000368378 p.N310S ASPM chr1 197146140 197146140 Splice_Site C C A TCGA-59-2348-01A-01D-0704-01 ENST00000367409 p.X99_splice CRB1 chr1 197427704 197427704 Silent C C A TCGA-59-2348-01A-01D-0704-01 ENST00000367400 p.V793V CDC42BPA chr1 227034759 227034759 Silent C C T TCGA-59-2348-01A-01D-0704-01 ENST00000334218 p.Q1102Q OR2L3 chr1 248060723 248060723 Missense_Mutation A A T TCGA-59-2348-01A-01D-0704-01 ENST00000359959 p.L14F NPAS2 chr2 100964119 100964119 Silent A A G TCGA-59-2348-01A-01D-0704-01 ENST00000335681 p.L220L CACNB4 chr2 151872448 151872448 Silent A A T TCGA-59-2348-01A-01D-0704-01 ENST00000539935 p.S189S TTN chr2 178747388 178747388 Intron G G A TCGA-59-2348-01A-01D-0704-01 ENST00000591111 CPNE9 chr3 9718544 9718544 Missense_Mutation C C T TCGA-59-2348-01A-01D-0704-01 ENST00000383832 p.R395C HDAC11 chr3 13496771 13496771 Silent C C T TCGA-59-2348-01A-01D-0704-01 ENST00000295757 p.P96P MST1R chr3 49895247 49895247 Missense_Mutation G G C TCGA-59-2348-01A-01D-0704-01 ENST00000296474 p.S1064C NRROS chr3 196660855 196660855 Silent G G C TCGA-59-2348-01A-01D-0704-01 ENST00000328557 p.L404L APBB2 chr4 40827220 40827220 Splice_Site C C T TCGA-59-2348-01A-01D-0704-01 ENST00000295974 p.X548_splice PHOX2B chr4 41747444 41747444 Missense_Mutation C C G TCGA-59-2348-01A-01D-0704-01 ENST00000226382 p.E112Q ELF2 chr4 139059040 139059040 Silent T T C TCGA-59-2348-01A-01D-0704-01 ENST00000379550 p.S575S ASIC5 chr4 155863483 155863483 Missense_Mutation C C A TCGA-59-2348-01A-01D-0704-01 ENST00000537611 p.M104I NR3C1 chr5 143281908 143281908 Missense_Mutation A A G TCGA-59-2348-01A-01D-0704-01 ENST00000343796 p.L772P ZNF451 chr6 57147230 57147230 Missense_Mutation A A C TCGA-59-2348-01A-01D-0704-01 ENST00000370706 p.Q382P DDX43 chr6 73416166 73416166 Silent G G A TCGA-59-2348-01A-01D-0704-01 ENST00000370336 p.Q629Q CARD11 chr7 2922751 2922751 Missense_Mutation A A C TCGA-59-2348-01A-01D-0704-01 ENST00000396946 p.C718G NPC1L1 chr7 44533396 44533396 Intron G G C TCGA-59-2348-01A-01D-0704-01 ENST00000289547 NPC1L1 chr7 44536302 44536302 Missense_Mutation A A G TCGA-59-2348-01A-01D-0704-01 ENST00000289547 p.F603S ADCY1 chr7 45710618 45710618 Missense_Mutation G G A TCGA-59-2348-01A-01D-0704-01 ENST00000297323 p.R1008Q PARP12 chr7 140027347 140027347 Silent G G A TCGA-59-2348-01A-01D-0704-01 ENST00000263549 p.R519R OR2A5 chr7 144050992 144050992 Silent G G A TCGA-59-2348-01A-01D-0704-01 ENST00000408906 p.V197V PREX2 chr8 68077449 68077449 Missense_Mutation A A G TCGA-59-2348-01A-01D-0704-01 ENST00000288368 p.D541G HINT2 chr9 35813169 35813169 Intron G G A TCGA-59-2348-01A-01D-0704-01 ENST00000259667 FRMPD1 chr9 37745744 37745744 Missense_Mutation G G T TCGA-59-2348-01A-01D-0704-01 ENST00000377765 p.D1238Y SPATA31A7 chr9 61192108 61192108 Missense_Mutation G A A TCGA-59-2348-01A-01D-0704-01 ENST00000619167 p.E93K OMD chr9 92417538 92417538 Missense_Mutation T T C TCGA-59-2348-01A-01D-0704-01 ENST00000375550 p.I7M HSPA5 chr9 125236634 125236634 Silent G G A TCGA-59-2348-01A-01D-0704-01 ENST00000324460 p.P641P VIM chr10 17235379 17235379 Missense_Mutation G G A TCGA-59-2348-01A-01D-0704-01 ENST00000224237 p.E407K GRID1 chr10 85916185 85916185 Splice_Site C C T TCGA-59-2348-01A-01D-0704-01 ENST00000327946 p.X260_splice VWA2 chr10 114288997 114288997 Missense_Mutation C C A TCGA-59-2348-01A-01D-0704-01 ENST00000392982 p.P544T TRIM5 chr11 5680056 5680056 Missense_Mutation G G A TCGA-59-2348-01A-01D-0704-01 ENST00000380034 p.A41V OR52N5 chr11 5778210 5778216 Frame_Shift_Del GCATAAC GCATAAC - TCGA-59-2348-01A-01D-0704-01 ENST00000317093 p.R140Lfs*18 NELL1 chr11 20947369 20947369 Missense_Mutation C C A TCGA-59-2348-01A-01D-0704-01 ENST00000357134 p.P369T OR5M11 chr11 56542911 56542911 Missense_Mutation G G T TCGA-59-2348-01A-01D-0704-01 ENST00000528616 p.A116E AHNAK chr11 62520892 62520892 Missense_Mutation T T G TCGA-59-2348-01A-01D-0704-01 ENST00000378024 p.M4509L UBE4A chr11 118382656 118382656 Missense_Mutation C C G TCGA-59-2348-01A-01D-0704-01 ENST00000252108 p.Q693E OR10S1 chr11 123977417 123977417 Missense_Mutation G G A TCGA-59-2348-01A-01D-0704-01 ENST00000531945 p.P92L CD27 chr12 6450577 6450578 Frame_Shift_Del CT CT - TCGA-59-2348-01A-01D-0704-01 ENST00000266557 p.L163Gfs*2 PRICKLE1 chr12 42460168 42460168 Missense_Mutation T T C TCGA-59-2348-01A-01D-0704-01 ENST00000345127 p.I713V KRT86 chr12 52306159 52306159 Missense_Mutation C C G TCGA-59-2348-01A-01D-0704-01 ENST00000293525 p.Q376E CALCOCO1 chr12 53725163 53725163 Missense_Mutation T T C TCGA-59-2348-01A-01D-0704-01 ENST00000550804 p.N27S MDM1 chr12 68302785 68302785 Missense_Mutation C C A TCGA-59-2348-01A-01D-0704-01 ENST00000303145 p.D603Y TPH2 chr12 71941613 71941613 Silent C C T TCGA-59-2348-01A-01D-0704-01 ENST00000333850 p.D45D RPH3A chr12 112865471 112865471 Silent C C T TCGA-59-2348-01A-01D-0704-01 ENST00000389385 p.N96N GCN1L1 chr12 120148313 120148313 Missense_Mutation C C A TCGA-59-2348-01A-01D-0704-01 ENST00000300648 p.C1527F DZIP1 chr13 95590338 95590338 Missense_Mutation C C T TCGA-59-2348-01A-01D-0704-01 ENST00000347108 p.R595Q MIPOL1 chr14 37308369 37308369 Missense_Mutation C C A TCGA-59-2348-01A-01D-0704-01 ENST00000327441 p.N226K SLC35F4 chr14 57581311 57581311 Missense_Mutation A A T TCGA-59-2348-01A-01D-0704-01 ENST00000339762 p.L273Q EML5 chr14 88746262 88746263 Nonsense_Mutation - - TTCA TCGA-59-2348-01A-01D-0704-01 ENST00000380664 p.D127* SNORD114-11 chr14 100968152 100968152 RNA G G A TCGA-59-2348-01A-01D-0704-01 ENST00000363738 IGHV4-55 chr14 106606337 106606337 RNA A A G TCGA-59-2348-01A-01D-0704-01 ENST00000520889 RYR3 chr15 33739865 33739865 Missense_Mutation C C T TCGA-59-2348-01A-01D-0704-01 ENST00000389232 p.P2564S NXN chr17 801006 801006 Silent G G A TCGA-59-2348-01A-01D-0704-01 ENST00000336868 p.I417I TP53 chr17 7673803 7673803 Missense_Mutation G G A TCGA-59-2348-01A-01D-0704-01 ENST00000269305 p.R273C MYH13 chr17 10346695 10346695 Silent C C T TCGA-59-2348-01A-01D-0704-01 ENST00000252172 p.G416G RP11-385D13.1 chr17 15632601 15632601 Nonsense_Mutation G G T TCGA-59-2348-01A-01D-0704-01 ENST00000455584 p.S308* KRT13 chr17 41502586 41502586 Silent C C G TCGA-59-2348-01A-01D-0704-01 ENST00000246635 p.G344G ABCA8 chr17 68875269 68875269 Missense_Mutation C C T TCGA-59-2348-01A-01D-0704-01 ENST00000269080 p.R1501Q FBN3 chr19 8073257 8073257 Missense_Mutation G G T TCGA-59-2348-01A-01D-0704-01 ENST00000270509 p.S2581R COL5A3 chr19 9995598 9995598 Missense_Mutation C C T TCGA-59-2348-01A-01D-0704-01 ENST00000264828 p.G518E SLC1A6 chr19 14972872 14972872 Silent G G A TCGA-59-2348-01A-01D-0704-01 ENST00000221742 p.S13S FBXO27 chr19 39026997 39026997 Missense_Mutation G G T TCGA-59-2348-01A-01D-0704-01 ENST00000292853 p.A194D CYP2A13 chr19 41090088 41090088 Missense_Mutation C C G TCGA-59-2348-01A-01D-0704-01 ENST00000330436 p.R129G SIGLEC11 chr19 49960742 49960742 Missense_Mutation G G C TCGA-59-2348-01A-01D-0704-01 ENST00000447370 p.N90K NLRP4 chr19 55859218 55859218 Missense_Mutation G G T TCGA-59-2348-01A-01D-0704-01 ENST00000301295 p.V609F NLRP4 chr19 55862095 55862095 Missense_Mutation C C T TCGA-59-2348-01A-01D-0704-01 ENST00000301295 p.R708C C19orf18 chr19 57974169 57974169 Silent G G C TCGA-59-2348-01A-01D-0704-01 ENST00000314391 p.T52T ZNF280B chr22 22489387 22489387 Silent T T C TCGA-59-2348-01A-01D-0704-01 ENST00000613655 p.S4S GPKOW chrX 49122653 49122653 Silent C C T TCGA-59-2348-01A-01D-0704-01 ENST00000156109 p.V100V IQSEC2 chrX 53251127 53251127 Silent C C T TCGA-59-2348-01A-01D-0704-01 ENST00000396435 p.P483P CAPN6 chrX 111248693 111248693 Missense_Mutation G G A TCGA-59-2348-01A-01D-0704-01 ENST00000324068 p.R454C GABRE chrX 151970200 151970200 Missense_Mutation G G A TCGA-59-2348-01A-01D-0704-01 ENST00000370328 p.R87C SPOCD1 chr1 31799857 31799857 Missense_Mutation G G C TCGA-13-1489-01A-01W-0549-09 ENST00000360482 p.P579A DENND2D chr1 111199648 111199648 Missense_Mutation G G T TCGA-13-1489-01A-01W-0549-09 ENST00000357640 p.P73H MOV10 chr1 112689934 112689934 Silent G G A TCGA-13-1489-01A-01W-0549-09 ENST00000357443 p.S224S HIST2H2AB chr1 149887614 149887614 Silent G G T TCGA-13-1489-01A-01W-0549-09 ENST00000331128 p.V101V FLG2 chr1 152354172 152354172 Missense_Mutation A A T TCGA-13-1489-01A-01W-0549-09 ENST00000388718 p.F1205Y FLG2 chr1 152356458 152356458 Missense_Mutation T T A TCGA-13-1489-01A-01W-0549-09 ENST00000388718 p.E443V IQGAP3 chr1 156552083 156552083 Silent G G C TCGA-13-1489-01A-01W-0549-09 ENST00000361170 p.A487A FCRL1 chr1 157803984 157803984 Silent G G A TCGA-13-1489-01A-01W-0549-09 ENST00000368176 p.A60A ACKR1 chr1 159205804 159205817 Frame_Shift_Del GCACTCGCAGCTCT GCACTCGCAGCTCT - TCGA-13-1489-01A-01W-0549-09 ENST00000368122 p.T123Pfs*3 PLXNA2 chr1 208210241 208210241 Intron G G T TCGA-13-1489-01A-01W-0549-09 ENST00000367033 ENAH chr1 225514610 225514610 Silent T T G TCGA-13-1489-01A-01W-0549-09 ENST00000366844 p.R402R KIF26B chr1 245646279 245646282 Splice_Site AAGT AAGT - TCGA-13-1489-01A-01W-0549-09 ENST00000407071 p.X753_splice C2orf16 chr2 27581477 27581477 Missense_Mutation G G C TCGA-13-1489-01A-01W-0549-09 ENST00000408964 p.Q1635H SFTPB chr2 85665328 85665328 Silent G G A TCGA-13-1489-01A-01W-0549-09 ENST00000393822 p.C211C FAHD2B chr2 97090169 97090169 Missense_Mutation G G C TCGA-13-1489-01A-01W-0549-09 ENST00000272610 p.S134R MAP3K19 chr2 134991545 134991545 Missense_Mutation T T C TCGA-13-1489-01A-01W-0549-09 ENST00000375845 p.S204G SCN1A chr2 166043942 166043942 Silent G G A TCGA-13-1489-01A-01W-0549-09 ENST00000303395 p.F590F TTN chr2 178547519 178547519 Frame_Shift_Del T T - TCGA-13-1489-01A-01W-0549-09 ENST00000591111 p.V29729Sfs*26 CRYGB chr2 208145784 208145790 Frame_Shift_Del AGGCAGC AGGCAGC - TCGA-13-1489-01A-01W-0549-09 ENST00000260988 p.C79Sfs*11 INHA chr2 219575297 219575297 Missense_Mutation G G C TCGA-13-1489-01A-01W-0549-09 ENST00000243786 p.C291S CELSR3 chr3 48660519 48660519 Missense_Mutation C T T TCGA-13-1489-01A-01W-0549-09 ENST00000164024 p.G706S CACNA1D chr3 53497170 53497170 Missense_Mutation G G T TCGA-13-1489-01A-01W-0549-09 ENST00000350061 p.G29V STXBP5L chr3 121418401 121418401 Missense_Mutation T T G TCGA-13-1489-01A-01W-0549-09 ENST00000273666 p.S1121R SLC36A2 chr5 151325391 151325391 Missense_Mutation C A A TCGA-13-1489-01A-01W-0549-09 ENST00000335244 p.G302V FOXI1 chr5 170106318 170106318 Missense_Mutation C A A TCGA-13-1489-01A-01W-0549-09 ENST00000306268 p.L121M SKIV2L chr6 31961195 31961195 Splice_Site G G - TCGA-13-1489-01A-01W-0549-09 ENST00000375394 p.X200_splice NOTCH4 chr6 32204330 32204330 Missense_Mutation T T A TCGA-13-1489-01A-01W-0549-09 ENST00000375023 p.Q975H CLIC5 chr6 45903184 45903184 Silent G G A TCGA-13-1489-01A-01W-0549-09 ENST00000185206 p.N379N RIMS1 chr6 72265448 72265448 Missense_Mutation C C A TCGA-13-1489-01A-01W-0549-09 ENST00000521978 p.H1085N LATS1 chr6 149683103 149683103 Silent T C C TCGA-13-1489-01A-01W-0549-09 ENST00000253339 p.K662K POM121 chr7 72942166 72942166 Missense_Mutation C C T TCGA-13-1489-01A-01W-0549-09 ENST00000434423 p.P725S CYP3A43 chr7 99859991 99859991 Splice_Site G G T TCGA-13-1489-01A-01W-0549-09 ENST00000354829 p.X342_splice ZAN chr7 100767850 100767850 Missense_Mutation C C G TCGA-13-1489-01A-01W-0549-09 ENST00000613979 p.A1627G EXOC4 chr7 133895600 133895600 Missense_Mutation G G A TCGA-13-1489-01A-01W-0549-09 ENST00000253861 p.S579N HIPK2 chr7 139600537 139600537 Missense_Mutation G G A TCGA-13-1489-01A-01W-0549-09 ENST00000406875 p.T772I MGAM chr7 142050707 142050707 Missense_Mutation A A G TCGA-13-1489-01A-01W-0549-09 ENST00000549489 p.E883G GSTK1 chr7 143265177 143265195 Intron CTGCCCCCGCCCGGGGGAT CTGCCCCCGCCCGGGGGAT - TCGA-13-1489-01A-01W-0549-09 ENST00000358406 CSPP1 chr8 67175399 67175399 Missense_Mutation G G C TCGA-13-1489-01A-01W-0549-09 ENST00000262210 p.K1019N ANGPT1 chr8 107303318 107303319 Nonsense_Mutation - - TT TCGA-13-1489-01A-01W-0549-09 ENST00000517746 p.C286* ANGPT1 chr8 107303319 107303319 Missense_Mutation C C T TCGA-13-1489-01A-01W-0549-09 ENST00000517746 p.C286Y INVS chr9 100242610 100242610 Silent G A A TCGA-13-1489-01A-01W-0549-09 ENST00000262457 p.K279K RSU1P1 chr10 42737157 42737157 RNA G G A TCGA-13-1489-01A-01W-0549-09 ENST00000453416 ANK3 chr10 60071857 60071857 Missense_Mutation G C C TCGA-13-1489-01A-01W-0549-09 ENST00000280772 p.H3008Q KAT6B chr10 75029677 75029677 Missense_Mutation G G T TCGA-13-1489-01A-01W-0549-09 ENST00000287239 p.S1618I HIPK3 chr11 33337145 33337145 Missense_Mutation G G T TCGA-13-1489-01A-01W-0549-09 ENST00000303296 p.R431I HIPK3 chr11 33337146 33337146 Missense_Mutation A A T TCGA-13-1489-01A-01W-0549-09 ENST00000303296 p.R431S OR5B21 chr11 58507695 58507695 Silent A A G TCGA-13-1489-01A-01W-0549-09 ENST00000360374 p.G137G SIK2 chr11 111724163 111724163 3'UTR G G C TCGA-13-1489-01A-01W-0549-09 ENST00000304987 RP11-108O10.8 chr11 111853394 111853394 Missense_Mutation C T T TCGA-13-1489-01A-01W-0549-09 ENST00000622211 p.G527E SNX19 chr11 130915153 130915153 Missense_Mutation C A A TCGA-13-1489-01A-01W-0549-09 ENST00000265909 p.V263L FAR2 chr12 29293476 29293476 Splice_Site G G C TCGA-13-1489-01A-01W-0549-09 ENST00000182377 p.X122_splice SLC38A1 chr12 46201185 46201185 Missense_Mutation T T C TCGA-13-1489-01A-01W-0549-09 ENST00000398637 p.K306E ERBB3 chr12 56093382 56093382 Missense_Mutation G A A TCGA-13-1489-01A-01W-0549-09 ENST00000267101 p.V438I RB1 chr13 48459831 48459831 Missense_Mutation C A A TCGA-13-1489-01A-01W-0549-09 ENST00000267163 p.Q702K PCDH9 chr13 66304936 66304936 Missense_Mutation G G A TCGA-13-1489-01A-01W-0549-09 ENST00000377865 p.P1145S RALGAPA1 chr14 35539616 35539616 3'UTR T C C TCGA-13-1489-01A-01W-0549-09 ENST00000389698 NID2 chr14 52068164 52068164 Splice_Site C C G TCGA-13-1489-01A-01W-0549-09 ENST00000216286 p.X77_splice ELMSAN1 chr14 73739493 73739494 Frame_Shift_Ins - - C TCGA-13-1489-01A-01W-0549-09 ENST00000286523 p.Q174Tfs*99 PDIA3 chr15 43765929 43765929 Missense_Mutation G T T TCGA-13-1489-01A-01W-0549-09 ENST00000300289 p.L254F VWA3A chr16 22132916 22132916 Missense_Mutation A A G TCGA-13-1489-01A-01W-0549-09 ENST00000389398 p.Y630C CD2BP2 chr16 30353234 30353234 Missense_Mutation C C G TCGA-13-1489-01A-01W-0549-09 ENST00000305596 p.E288Q KARS chr16 75629472 75629472 Silent C T T TCGA-13-1489-01A-01W-0549-09 ENST00000302445 p.A498A TP53 chr17 7670685 7670685 Nonsense_Mutation G A A TCGA-13-1489-01A-01W-0549-09 ENST00000269305 p.R342* BRCA1 chr17 43091736 43091737 Frame_Shift_Ins - TT TT TCGA-13-1489-01A-01W-0549-09 ENST00000357654 p.N1265Kfs*4 WDR45B chr17 82616564 82616564 Silent C A A TCGA-13-1489-01A-01W-0549-09 ENST00000392325 p.P296P HAUS1 chr18 46128114 46128114 Missense_Mutation A A T TCGA-13-1489-01A-01W-0549-09 ENST00000282058 p.M276L ZNF101 chr19 19680125 19680125 Missense_Mutation G G T TCGA-13-1489-01A-01W-0549-09 ENST00000318110 p.S379I HAO1 chr20 7940413 7940413 Missense_Mutation G G A TCGA-13-1489-01A-01W-0549-09 ENST00000378789 p.R4W DLGAP4 chr20 36432044 36432044 Missense_Mutation G G C TCGA-13-1489-01A-01W-0549-09 ENST00000339266 p.E109D C21orf62 chr21 32794242 32794242 Missense_Mutation C C A TCGA-13-1489-01A-01W-0549-09 ENST00000479548 p.M60I IGLV5-48 chr22 22353181 22353182 Frame_Shift_Ins - - A TCGA-13-1489-01A-01W-0549-09 ENST00000390293 p.T40Nfs*12 CBY1 chr22 38668126 38668126 Silent G A A TCGA-13-1489-01A-01W-0549-09 ENST00000216029 p.L24L JOSD1 chr22 38689404 38689419 Frame_Shift_Del ACCATGGTGTTTGGAG ACCATGGTGTTTGGAG - TCGA-13-1489-01A-01W-0549-09 ENST00000216039 p.S64* MCAT chr22 43137160 43137160 Missense_Mutation G G T TCGA-13-1489-01A-01W-0549-09 ENST00000290429 p.S217Y ATXN3L chrX 13319225 13319225 Missense_Mutation C C T TCGA-13-1489-01A-01W-0549-09 ENST00000380622 p.R237H BTK chrX 101353327 101353327 Missense_Mutation G A A TCGA-13-1489-01A-01W-0549-09 ENST00000308731 p.S592F RAP1GAP chr1 21617366 21617366 Silent G G T TCGA-13-1504-01A-01W-0545-08 ENST00000374765 p.T77T IQCC chr1 32207030 32207030 Silent C C T TCGA-13-1504-01A-01W-0545-08 ENST00000291358 p.S156S ITPKB chr1 226735630 226735632 In_Frame_Del GAG GAG - TCGA-13-1504-01A-01W-0545-08 ENST00000272117 p.S611del RNASEH1 chr2 3545779 3545779 3'UTR C C G TCGA-13-1504-01A-01W-0545-08 ENST00000315212 IGKC chr2 88857369 88857369 Missense_Mutation C C G TCGA-13-1504-01A-01W-0545-08 ENST00000614656 p.E235Q AMER3 chr2 130762994 130762994 Missense_Mutation A A T TCGA-13-1504-01A-01W-0545-08 ENST00000321420 p.R308W DNAH1 chr3 52384967 52384967 Missense_Mutation G G A TCGA-13-1504-01A-01W-0545-08 ENST00000420323 p.G2835D SEMA3G chr3 52441389 52441389 Missense_Mutation C C T TCGA-13-1504-01A-01W-0545-08 ENST00000231721 p.A230T ST3GAL6 chr3 98791892 98791892 Missense_Mutation A A G TCGA-13-1504-01A-01W-0545-08 ENST00000394162 p.I270V CHRD chr3 184386716 184386716 Silent G G A TCGA-13-1504-01A-01W-0545-08 ENST00000204604 p.A719A MED10 chr5 6372511 6372511 Missense_Mutation G G A TCGA-13-1504-01A-01W-0545-08 ENST00000255764 p.P134S AMACR chr5 34008021 34008021 5'UTR G G A TCGA-13-1504-01A-01W-0545-08 ENST00000335606 MAST4 chr5 67054472 67054472 Missense_Mutation C C T TCGA-13-1504-01A-01W-0545-08 ENST00000403625 p.S248L KCNN2 chr5 114404831 114404831 Missense_Mutation G G A TCGA-13-1504-01A-01W-0545-08 ENST00000264773 p.A326T UNC5A chr5 176874408 176874408 Missense_Mutation G G A TCGA-13-1504-01A-01W-0545-08 ENST00000329542 p.R407H FOXC1 chr6 1610886 1610886 Silent C C T TCGA-13-1504-01A-01W-0545-08 ENST00000380874 p.G147G HIST1H4F chr6 26240719 26240719 Silent G G A TCGA-13-1504-01A-01W-0545-08 ENST00000244537 p.L98L MAS1L chr6 29487030 29487030 Missense_Mutation C C T TCGA-13-1504-01A-01W-0545-08 ENST00000377127 p.M291I DNAH8 chr6 38873300 38873300 Missense_Mutation T T C TCGA-13-1504-01A-01W-0545-08 ENST00000359357 p.F2298S PAPOLB chr7 4861661 4861661 Silent G G A TCGA-13-1504-01A-01W-0545-08 ENST00000404991 p.F50F PRKAR2B chr7 107146387 107146387 Missense_Mutation G G A TCGA-13-1504-01A-01W-0545-08 ENST00000265717 p.E223K ING3 chr7 120969105 120969105 Missense_Mutation G G C TCGA-13-1504-01A-01W-0545-08 ENST00000315870 p.R270T FLNC chr7 128844929 128844929 Missense_Mutation C C T TCGA-13-1504-01A-01W-0545-08 ENST00000325888 p.P1155L ZFHX4 chr8 76854046 76854046 Silent C C T TCGA-13-1504-01A-01W-0545-08 ENST00000521891 p.N2375N DCAF4L2 chr8 87873524 87873524 Missense_Mutation C C G TCGA-13-1504-01A-01W-0545-08 ENST00000319675 p.A150P CBWD1 chr9 178930 178930 Missense_Mutation G G C TCGA-13-1504-01A-01W-0545-08 ENST00000356521 p.P14A ADAMTSL1 chr9 18574171 18574171 Missense_Mutation G G A TCGA-13-1504-01A-01W-0545-08 ENST00000380548 p.G127R MLLT3 chr9 20413987 20413987 Missense_Mutation T T C TCGA-13-1504-01A-01W-0545-08 ENST00000380338 p.I287V SLC44A1 chr9 105348427 105348427 Missense_Mutation G G T TCGA-13-1504-01A-01W-0545-08 ENST00000374720 p.C159F GLB1L2 chr11 134342813 134342813 Missense_Mutation C C T TCGA-13-1504-01A-01W-0545-08 ENST00000339772 p.A49V STAB2 chr12 103725079 103725079 Silent C C T TCGA-13-1504-01A-01W-0545-08 ENST00000388887 p.R1596R SRRM4 chr12 119130683 119130683 Missense_Mutation G G A TCGA-13-1504-01A-01W-0545-08 ENST00000267260 p.R207H AP5M1 chr14 57286249 57286249 Silent A A G TCGA-13-1504-01A-01W-0545-08 ENST00000261558 p.T440T DYNC1H1 chr14 102026602 102026602 Nonsense_Mutation T T A TCGA-13-1504-01A-01W-0545-08 ENST00000360184 p.L2889* ACAN chr15 88873973 88873973 Missense_Mutation C C T TCGA-13-1504-01A-01W-0545-08 ENST00000439576 p.R2489W TP53 chr17 7674211 7674211 Missense_Mutation A A C TCGA-13-1504-01A-01W-0545-08 ENST00000269305 p.I251S SUPT6H chr17 28697926 28697926 Missense_Mutation C C G TCGA-13-1504-01A-01W-0545-08 ENST00000314616 p.I1448M WIPF2 chr17 40260534 40260534 Splice_Site G G A TCGA-13-1504-01A-01W-0545-08 ENST00000323571 p.X22_splice OR7C1 chr19 14800057 14800057 Missense_Mutation A A G TCGA-13-1504-01A-01W-0545-08 ENST00000248073 p.L27P ZNF233 chr19 44273372 44273372 Missense_Mutation A A T TCGA-13-1504-01A-01W-0545-08 ENST00000391958 p.N238Y C20orf197 chr20 60070712 60070712 RNA T T C TCGA-13-1504-01A-01W-0545-08 ENST00000625080 WBP2NL chr22 41998834 41998834 Missense_Mutation A A T TCGA-13-1504-01A-01W-0545-08 ENST00000328823 p.S6C PLP1 chrX 103786682 103786682 Missense_Mutation C C T TCGA-13-1504-01A-01W-0545-08 ENST00000612423 p.R137W S1PR1 chr1 101239774 101239774 Missense_Mutation G G A TCGA-24-2261-01A-01W-0722-08 ENST00000305352 p.V264I SPRR2A chr1 153056523 153056523 Missense_Mutation G G T TCGA-24-2261-01A-01W-0722-08 ENST00000392653 p.S71R LGR6 chr1 202306868 202306868 Splice_Region C C T TCGA-24-2261-01A-01W-0722-08 ENST00000367278 p.I379I FMN2 chr1 240208622 240208622 Silent C C A TCGA-24-2261-01A-01W-0722-08 ENST00000319653 p.G1270G COMMD1 chr2 61905854 61905854 Missense_Mutation T T A TCGA-24-2261-01A-01W-0722-08 ENST00000311832 p.L59H SAP130 chr2 127955337 127955337 Missense_Mutation G G T TCGA-24-2261-01A-01W-0722-08 ENST00000259235 p.P682T ARHGEF4 chr2 131027985 131027985 Silent C C T TCGA-24-2261-01A-01W-0722-08 ENST00000326016 p.D156D ORC4 chr2 147955347 147955348 Frame_Shift_Ins - - T TCGA-24-2261-01A-01W-0722-08 ENST00000264169 p.G146Rfs*2 NBEAL1 chr2 203172757 203172757 Missense_Mutation C C T TCGA-24-2261-01A-01W-0722-08 ENST00000449802 p.S2047L DOCK10 chr2 224775028 224775028 Missense_Mutation G G A TCGA-24-2261-01A-01W-0722-08 ENST00000258390 p.R1964W NGEF chr2 232888046 232888046 Missense_Mutation T T C TCGA-24-2261-01A-01W-0722-08 ENST00000264051 p.K445R DOCK3 chr3 51361946 51361946 Silent G G C TCGA-24-2261-01A-01W-0722-08 ENST00000266037 p.L1698L MME chr3 155115105 155115105 Missense_Mutation G G T TCGA-24-2261-01A-01W-0722-08 ENST00000360490 p.R103L IGJ chr4 70656301 70656302 3'UTR AG AG - TCGA-24-2261-01A-01W-0722-08 ENST00000254801 IRX2 chr5 2748535 2748535 Missense_Mutation G G T TCGA-24-2261-01A-01W-0722-08 ENST00000302057 p.N391K RAI14 chr5 34824172 34824172 Missense_Mutation C C T TCGA-24-2261-01A-01W-0722-08 ENST00000265109 p.A777V HIST1H2BH chr6 26251655 26251655 Missense_Mutation C C T TCGA-24-2261-01A-01W-0722-08 ENST00000619466 p.P2L USP49 chr6 41806539 41806539 Missense_Mutation G G A TCGA-24-2261-01A-01W-0722-08 ENST00000373009 p.R149C AARS2 chr6 44305188 44305188 Missense_Mutation C C T TCGA-24-2261-01A-01W-0722-08 ENST00000244571 p.R482Q SOGA3 chr6 127476052 127476052 Silent C C G TCGA-24-2261-01A-01W-0722-08 ENST00000481848 p.L658L RAET1E chr6 149890053 149890053 Missense_Mutation G G A TCGA-24-2261-01A-01W-0722-08 ENST00000357183 p.L60F SDK1 chr7 4077023 4077023 Silent C C T TCGA-24-2261-01A-01W-0722-08 ENST00000404826 p.Y1012Y RUNDC3B chr7 87807495 87807495 Missense_Mutation G G A TCGA-24-2261-01A-01W-0722-08 ENST00000338056 p.R377Q MUC3A chr7 100959035 100959035 Missense_Mutation C C G TCGA-24-2261-01A-01W-0722-08 ENST00000379458 p.T2419S AKR1B1 chr7 134450799 134450799 Missense_Mutation G G A TCGA-24-2261-01A-01W-0722-08 ENST00000285930 p.P113L CSMD3 chr8 112650240 112650240 Silent T T A TCGA-24-2261-01A-01W-0722-08 ENST00000297405 p.S1038S CSMD3 chr8 112650241 112650241 Nonsense_Mutation G G T TCGA-24-2261-01A-01W-0722-08 ENST00000297405 p.S1038* MYC chr8 127738910 127738910 Silent C C T TCGA-24-2261-01A-01W-0722-08 ENST00000377970 p.F216F ZMIZ1 chr10 79292288 79292288 Missense_Mutation G G A TCGA-24-2261-01A-01W-0722-08 ENST00000334512 p.A297T LRIT2 chr10 84222043 84222043 Silent G G A TCGA-24-2261-01A-01W-0722-08 ENST00000372113 p.T510T SF1 chr11 64769548 64769548 Missense_Mutation C C T TCGA-24-2261-01A-01W-0722-08 ENST00000377390 p.G181R PACS1 chr11 66216771 66216783 Splice_Site CAAGGGTGAGCCT CAAGGGTGAGCCT - TCGA-24-2261-01A-01W-0722-08 ENST00000320580 p.X326_splice CACNA1C chr12 2607035 2607035 Missense_Mutation A A T TCGA-24-2261-01A-01W-0722-08 ENST00000347598 p.Q1107H SOX5 chr12 23563364 23563364 Missense_Mutation T T C TCGA-24-2261-01A-01W-0722-08 ENST00000451604 p.Q461R SPTLC2 chr14 77521537 77521537 Silent T T G TCGA-24-2261-01A-01W-0722-08 ENST00000216484 p.R450R NRXN3 chr14 79663895 79663895 Missense_Mutation G G A TCGA-24-2261-01A-01W-0722-08 ENST00000557594 p.G183S DIO3 chr14 101561867 101561867 Missense_Mutation A A T TCGA-24-2261-01A-01W-0722-08 ENST00000510508 p.D124V DIO3 chr14 101562259 101562259 Missense_Mutation G G A TCGA-24-2261-01A-01W-0722-08 ENST00000510508 p.G255S IGHG1 chr14 105986788 105986788 Intron G G A TCGA-24-2261-01A-01W-0722-08 ENST00000618756 PTPN9 chr15 75468701 75468701 3'UTR T G G TCGA-24-2261-01A-01W-0722-08 ENST00000618819 CSPG4 chr15 75687476 75687476 Missense_Mutation C T T TCGA-24-2261-01A-01W-0722-08 ENST00000308508 p.V1197I ADCY9 chr16 3992223 3992223 Silent C C T TCGA-24-2261-01A-01W-0722-08 ENST00000294016 p.S710S GP2 chr16 20324071 20324071 Missense_Mutation G G T TCGA-24-2261-01A-01W-0722-08 ENST00000381362 p.R94S GPS2 chr17 7313385 7313388 Frame_Shift_Del TGAG TGAG - TCGA-24-2261-01A-01W-0722-08 ENST00000380728 p.T239Rfs*105 TP53 chr17 7675124 7675124 Missense_Mutation T T C TCGA-24-2261-01A-01W-0722-08 ENST00000269305 p.Y163C HSF5 chr17 58480116 58480116 Silent G G A TCGA-24-2261-01A-01W-0722-08 ENST00000323777 p.S234S JMJD6 chr17 76725800 76725800 Missense_Mutation C A A TCGA-24-2261-01A-01W-0722-08 ENST00000397625 p.R62L ASXL3 chr18 33738491 33738491 Missense_Mutation G G A TCGA-24-2261-01A-01W-0722-08 ENST00000269197 p.G363S RAVER1 chr19 10323562 10323562 Missense_Mutation G G A TCGA-24-2261-01A-01W-0722-08 ENST00000615032 p.A254V PTPRH chr19 55198686 55198686 Silent C C T TCGA-24-2261-01A-01W-0722-08 ENST00000376350 p.R549R MAGED1 chrX 51896540 51896540 Silent C C G TCGA-24-2261-01A-01W-0722-08 ENST00000326587 p.L295L ZDHHC15 chrX 75429952 75429952 Missense_Mutation G G A TCGA-24-2261-01A-01W-0722-08 ENST00000373367 p.P160S FRMPD3 chrX 107601001 107601001 Missense_Mutation G G A TCGA-24-2261-01A-01W-0722-08 ENST00000276185 p.E1021K UBE4B chr1 10033643 10033643 5'UTR A A T TCGA-23-1032-01A-02W-0486-08 ENST00000343090 PRAMEF4 chr1 12879885 12879885 Missense_Mutation C C G TCGA-23-1032-01A-02W-0486-08 ENST00000235349 p.D366H CTPS1 chr1 40997401 40997401 Missense_Mutation C C T TCGA-23-1032-01A-02W-0486-08 ENST00000372616 p.R294C LRRC41 chr1 46285359 46285359 Splice_Region C C T TCGA-23-1032-01A-02W-0486-08 ENST00000343304 IL12RB2 chr1 67350939 67350939 Missense_Mutation G G A TCGA-23-1032-01A-02W-0486-08 ENST00000262345 p.G370R ZNF697 chr1 119622879 119622879 Silent C C T TCGA-23-1032-01A-02W-0486-08 ENST00000421812 p.T488T NBPF15 chr1 144456554 144456554 5'UTR T T C TCGA-23-1032-01A-02W-0486-08 ENST00000488031 ZBTB7B chr1 155015123 155015123 Missense_Mutation G G A TCGA-23-1032-01A-02W-0486-08 ENST00000292176 p.D155N CLK2 chr1 155269489 155269489 Missense_Mutation G G A TCGA-23-1032-01A-02W-0486-08 ENST00000368361 p.S133L RGS4 chr1 163074438 163074438 Missense_Mutation C C T TCGA-23-1032-01A-02W-0486-08 ENST00000367909 p.R166C ASTN1 chr1 176864241 176864241 3'UTR C C G TCGA-23-1032-01A-02W-0486-08 ENST00000361833 ZBTB41 chr1 197191753 197191757 Frame_Shift_Del TGTGC TGTGC - TCGA-23-1032-01A-02W-0486-08 ENST00000367405 p.H422Vfs*5 CNIH4 chr1 224360508 224360508 Missense_Mutation C C T TCGA-23-1032-01A-02W-0486-08 ENST00000465271 p.S28F GALNT2 chr1 230255319 230255319 Missense_Mutation G G A TCGA-23-1032-01A-02W-0486-08 ENST00000366672 p.G371S ARID4B chr1 235182114 235182114 Nonsense_Mutation C C T TCGA-23-1032-01A-02W-0486-08 ENST00000264183 p.W935* DTNB chr2 25455405 25455405 Missense_Mutation C C T TCGA-23-1032-01A-02W-0486-08 ENST00000406818 p.R390H C2orf71 chr2 29072929 29072929 Missense_Mutation A A T TCGA-23-1032-01A-02W-0486-08 ENST00000331664 p.S445T ALMS1 chr2 73452913 73452913 Missense_Mutation G G A TCGA-23-1032-01A-02W-0486-08 ENST00000613296 p.G2129D THNSL2 chr2 88182751 88182751 Silent G G A TCGA-23-1032-01A-02W-0486-08 ENST00000324166 p.V285V IGKV1D-27 chr2 89969304 89969304 RNA A A T TCGA-23-1032-01A-02W-0486-08 ENST00000453184 IGKV2D-24 chr2 90005504 90005504 Missense_Mutation C C G TCGA-23-1032-01A-02W-0486-08 ENST00000462693 p.R79G GGT8P chr2 91775952 91775952 RNA G G A TCGA-23-1032-01A-02W-0486-08 ENST00000418938 ZEB2 chr2 144429843 144429843 Missense_Mutation T T C TCGA-23-1032-01A-02W-0486-08 ENST00000409487 p.D86G XIRP2 chr2 167258236 167258236 3'UTR C C A TCGA-23-1032-01A-02W-0486-08 ENST00000628543 TTN chr2 178720935 178720935 Missense_Mutation G G A TCGA-23-1032-01A-02W-0486-08 ENST00000591111 p.A7378V TTN chr2 178747144 178747144 Intron T T C TCGA-23-1032-01A-02W-0486-08 ENST00000591111 TTN chr2 178747145 178747145 Intron G G T TCGA-23-1032-01A-02W-0486-08 ENST00000591111 MARS2 chr2 197706082 197706082 Missense_Mutation T T C TCGA-23-1032-01A-02W-0486-08 ENST00000282276 p.L226P RAPH1 chr2 203441411 203441411 Splice_Region G G T TCGA-23-1032-01A-02W-0486-08 ENST00000319170 p.A593A ABCA12 chr2 214980506 214980506 Missense_Mutation G G A TCGA-23-1032-01A-02W-0486-08 ENST00000272895 p.H1573Y CRYBA2 chr2 218990934 218990934 Missense_Mutation C C T TCGA-23-1032-01A-02W-0486-08 ENST00000295728 p.D122N SLC16A14 chr2 230046019 230046019 Silent G G T TCGA-23-1032-01A-02W-0486-08 ENST00000295190 p.I369I B3GNT7 chr2 231398756 231398756 Missense_Mutation G G C TCGA-23-1032-01A-02W-0486-08 ENST00000287590 p.G346A UGT1A7 chr2 233682697 233682697 Nonsense_Mutation C C T TCGA-23-1032-01A-02W-0486-08 ENST00000373426 p.R254* XYLB chr3 38413160 38413160 3'UTR C C T TCGA-23-1032-01A-02W-0486-08 ENST00000207870 NBEAL2 chr3 47007644 47007644 Missense_Mutation G G A TCGA-23-1032-01A-02W-0486-08 ENST00000450053 p.R2485Q ROBO2 chr3 77602273 77602273 Missense_Mutation T T A TCGA-23-1032-01A-02W-0486-08 ENST00000461745 p.I973N GPR156 chr3 120173471 120173471 Splice_Site C C T TCGA-23-1032-01A-02W-0486-08 ENST00000315843 p.X312_splice IGSF10 chr3 151445839 151445839 Missense_Mutation G G A TCGA-23-1032-01A-02W-0486-08 ENST00000282466 p.T1381I SMC4 chr3 160402805 160402805 Missense_Mutation G G A TCGA-23-1032-01A-02W-0486-08 ENST00000344722 p.D150N ACOX3 chr4 8392334 8392334 Splice_Region G G T TCGA-23-1032-01A-02W-0486-08 ENST00000356406 p.A433A FIP1L1 chr4 53459359 53459360 Frame_Shift_Ins - - A TCGA-23-1032-01A-02W-0486-08 ENST00000337488 p.S568Ifs*2 UGT2B28 chr4 69294914 69294915 3'UTR - - A TCGA-23-1032-01A-02W-0486-08 ENST00000335568 AFM chr4 73485952 73485952 Missense_Mutation A A G TCGA-23-1032-01A-02W-0486-08 ENST00000226355 p.R121G SLC39A8 chr4 102267878 102267878 Missense_Mutation C C T TCGA-23-1032-01A-02W-0486-08 ENST00000356736 p.E348K TACR3 chr4 103719543 103719543 Silent G G A TCGA-23-1032-01A-02W-0486-08 ENST00000304883 p.L45L GATB chr4 151671169 151671169 3'UTR A A G TCGA-23-1032-01A-02W-0486-08 ENST00000263985 WDR17 chr4 176125269 176125269 Missense_Mutation T T C TCGA-23-1032-01A-02W-0486-08 ENST00000280190 p.I259T TAS2R1 chr5 9629897 9629897 Missense_Mutation G G C TCGA-23-1032-01A-02W-0486-08 ENST00000382492 p.L46V PIK3R1 chr5 68297608 68297609 3'UTR - - A TCGA-23-1032-01A-02W-0486-08 ENST00000521381 MCTP1 chr5 95284323 95284323 Missense_Mutation T T C TCGA-23-1032-01A-02W-0486-08 ENST00000515393 p.K85E ZNF608 chr5 124648948 124648948 Missense_Mutation C C T TCGA-23-1032-01A-02W-0486-08 ENST00000306315 p.R479Q SH3TC2 chr5 149026529 149026529 Intron G G A TCGA-23-1032-01A-02W-0486-08 ENST00000515425 SLC26A2 chr5 149980859 149980859 Silent C C G TCGA-23-1032-01A-02W-0486-08 ENST00000286298 p.G422G RNF44 chr5 176529384 176529384 Silent A A G TCGA-23-1032-01A-02W-0486-08 ENST00000274811 p.C380C BTNL3 chr5 180993008 180993008 Missense_Mutation G G A TCGA-23-1032-01A-02W-0486-08 ENST00000342868 p.R82Q HIST1H2BE chr6 26184141 26184141 Missense_Mutation A A T TCGA-23-1032-01A-02W-0486-08 ENST00000614097 p.T116S HSPA1L chr6 31810659 31810659 Silent G G T TCGA-23-1032-01A-02W-0486-08 ENST00000375654 p.P438P PPP2R5D chr6 43009112 43009112 Missense_Mutation T T C TCGA-23-1032-01A-02W-0486-08 ENST00000485511 p.M379T ADGRF2 chr6 47673416 47673416 Intron G G C TCGA-23-1032-01A-02W-0486-08 ENST00000296862 GPRC6A chr6 116809516 116809516 Missense_Mutation A T T TCGA-23-1032-01A-02W-0486-08 ENST00000310357 p.I99N TBC1D32 chr6 121170436 121170436 Intron C C G TCGA-23-1032-01A-02W-0486-08 ENST00000398212 THBS2 chr6 169248730 169248730 Missense_Mutation G G A TCGA-23-1032-01A-02W-0486-08 ENST00000366787 p.T99M FERD3L chr7 19144826 19144826 3'UTR T T G TCGA-23-1032-01A-02W-0486-08 ENST00000275461 NUPL2 chr7 23199527 23199527 Missense_Mutation A A T TCGA-23-1032-01A-02W-0486-08 ENST00000258742 p.T227S HOXA11 chr7 27184724 27184724 Missense_Mutation C C G TCGA-23-1032-01A-02W-0486-08 ENST00000006015 p.D141H GRB10 chr7 50592822 50592822 3'UTR G G C TCGA-23-1032-01A-02W-0486-08 ENST00000398812 GRM3 chr7 86839689 86839689 Silent A A G TCGA-23-1032-01A-02W-0486-08 ENST00000361669 p.T725T LRRN3 chr7 111123495 111123495 Silent C C T TCGA-23-1032-01A-02W-0486-08 ENST00000308478 p.I241I PPP1R3A chr7 113879353 113879353 Missense_Mutation T T A TCGA-23-1032-01A-02W-0486-08 ENST00000284601 p.D580V CLCN1 chr7 143351749 143351749 Silent T T G TCGA-23-1032-01A-02W-0486-08 ENST00000343257 p.T917T TMEM176B chr7 150796565 150796565 Missense_Mutation G G A TCGA-23-1032-01A-02W-0486-08 ENST00000326442 p.T2M TEX15 chr8 30848540 30848540 Missense_Mutation A A G TCGA-23-1032-01A-02W-0486-08 ENST00000256246 p.S160P IDO2 chr8 39982699 39982699 Missense_Mutation C C A TCGA-23-1032-01A-02W-0486-08 ENST00000389060 p.N121K CCNE2 chr8 94890431 94890431 Missense_Mutation A A C TCGA-23-1032-01A-02W-0486-08 ENST00000308108 p.L146R SPAG1 chr8 100240939 100240939 Silent C T T TCGA-23-1032-01A-02W-0486-08 ENST00000251809 p.L900L FOCAD chr9 20874702 20874702 Missense_Mutation C C G TCGA-23-1032-01A-02W-0486-08 ENST00000338382 p.P738A AGTPBP1 chr9 85633121 85633121 Missense_Mutation G G C TCGA-23-1032-01A-02W-0486-08 ENST00000357081 p.T519S WNK2 chr9 93252890 93252890 Silent C C T TCGA-23-1032-01A-02W-0486-08 ENST00000297954 p.S614S SVEP1 chr9 110408174 110408174 Missense_Mutation T T A TCGA-23-1032-01A-02W-0486-08 ENST00000374469 p.T2476S FPGS chr9 127813282 127813282 Missense_Mutation A A T TCGA-23-1032-01A-02W-0486-08 ENST00000373247 p.Q481L CCBL1 chr9 128837784 128837784 Silent G G T TCGA-23-1032-01A-02W-0486-08 ENST00000302586 p.S156S SDCCAG3 chr9 136407866 136407866 Missense_Mutation C C T TCGA-23-1032-01A-02W-0486-08 ENST00000357365 p.G121D ITIH5 chr10 7576837 7576837 Missense_Mutation C C G TCGA-23-1032-01A-02W-0486-08 ENST00000397146 p.A532P FAM171A1 chr10 15212837 15212837 3'UTR C C T TCGA-23-1032-01A-02W-0486-08 ENST00000378116 ANKRD30A chr10 37142045 37142045 Missense_Mutation T T A TCGA-23-1032-01A-02W-0486-08 ENST00000611781 p.I383N ZWINT chr10 56358376 56358376 Splice_Site C C G TCGA-23-1032-01A-02W-0486-08 ENST00000373944 TET1 chr10 68573581 68573581 Nonsense_Mutation C C T TCGA-23-1032-01A-02W-0486-08 ENST00000373644 p.Q415* DLG5 chr10 77835741 77835741 Missense_Mutation A A C TCGA-23-1032-01A-02W-0486-08 ENST00000372391 p.I540S ZNF518A chr10 96157103 96157103 Missense_Mutation C C T TCGA-23-1032-01A-02W-0486-08 ENST00000316045 p.P261S LOXL4 chr10 98255637 98255637 Missense_Mutation C G G TCGA-23-1032-01A-02W-0486-08 ENST00000260702 p.G511R STIM1 chr11 4082879 4082879 Splice_Region C C T TCGA-23-1032-01A-02W-0486-08 ENST00000300737 GALNT18 chr11 11340980 11340980 Missense_Mutation C C G TCGA-23-1032-01A-02W-0486-08 ENST00000227756 p.E373Q SLC6A5 chr11 20628017 20628017 Missense_Mutation T T C TCGA-23-1032-01A-02W-0486-08 ENST00000525748 p.L478S LRRC4C chr11 40116248 40116248 Silent A A C TCGA-23-1032-01A-02W-0486-08 ENST00000278198 p.G15G OR5L1 chr11 55812307 55812307 Missense_Mutation G G C TCGA-23-1032-01A-02W-0486-08 ENST00000333973 p.V281L LPXN chr11 58549852 58549852 Missense_Mutation T T C TCGA-23-1032-01A-02W-0486-08 ENST00000395074 p.M226V SLC22A25 chr11 63229429 63229429 Missense_Mutation A A G TCGA-23-1032-01A-02W-0486-08 ENST00000306494 p.I75T SAC3D1 chr11 65044743 65044743 3'UTR C C T TCGA-23-1032-01A-02W-0486-08 ENST00000614106 SSH3 chr11 67311814 67311814 Missense_Mutation C C T TCGA-23-1032-01A-02W-0486-08 ENST00000308127 p.S636F TPCN2 chr11 69078948 69078948 Silent T T C TCGA-23-1032-01A-02W-0486-08 ENST00000294309 p.F489F LRRK2 chr12 40299217 40299217 Nonsense_Mutation T T A TCGA-23-1032-01A-02W-0486-08 ENST00000298910 p.C1152* SCN8A chr12 51721669 51721669 Missense_Mutation G G A TCGA-23-1032-01A-02W-0486-08 ENST00000354534 p.E587K KRT7 chr12 52243038 52243038 Silent G G C TCGA-23-1032-01A-02W-0486-08 ENST00000331817 p.G295G CLLU1 chr12 92424837 92424837 Missense_Mutation T T G TCGA-23-1032-01A-02W-0486-08 ENST00000378485 p.S53A RASAL1 chr12 113104202 113104202 Missense_Mutation C C T TCGA-23-1032-01A-02W-0486-08 ENST00000261729 p.D642N KSR2 chr12 117484446 117484446 Missense_Mutation A A G TCGA-23-1032-01A-02W-0486-08 ENST00000339824 p.F807S WSB2 chr12 118034241 118034241 Silent T T C TCGA-23-1032-01A-02W-0486-08 ENST00000315436 p.P390P RPLP0 chr12 120197394 120197394 Silent A A G TCGA-23-1032-01A-02W-0486-08 ENST00000228306 p.S240S MTUS2 chr13 29025147 29025147 Missense_Mutation G G T TCGA-23-1032-01A-02W-0486-08 ENST00000612955 p.R160M HMGB1 chr13 30463206 30463206 Splice_Site C C T TCGA-23-1032-01A-02W-0486-08 ENST00000339872 p.X99_splice GPC5 chr13 91728605 91728605 Missense_Mutation A A G TCGA-23-1032-01A-02W-0486-08 ENST00000377067 p.E365G LAMP1 chr13 113322287 113322287 Missense_Mutation G G A TCGA-23-1032-01A-02W-0486-08 ENST00000332556 p.E374K FANCM chr14 45175373 45175373 Silent T T C TCGA-23-1032-01A-02W-0486-08 ENST00000267430 p.G873G KLHDC2 chr14 49778196 49778196 Silent G G A TCGA-23-1032-01A-02W-0486-08 ENST00000298307 p.G162G PCNXL4 chr14 60115261 60115261 Missense_Mutation A A G TCGA-23-1032-01A-02W-0486-08 ENST00000406854 p.N386S MIR376C chr14 101039694 101039694 RNA G G C TCGA-23-1032-01A-02W-0486-08 ENST00000607441 BAG5 chr14 103561085 103561085 Missense_Mutation A A C TCGA-23-1032-01A-02W-0486-08 ENST00000299204 p.V27G MKRN3 chr15 23566008 23566008 Missense_Mutation C C T TCGA-23-1032-01A-02W-0486-08 ENST00000314520 p.P76S PAK6 chr15 40274236 40274236 Missense_Mutation T T A TCGA-23-1032-01A-02W-0486-08 ENST00000260404 p.L613H CYP19A1 chr15 51227810 51227810 Silent G G A TCGA-23-1032-01A-02W-0486-08 ENST00000260433 p.L140L ALDH1A2 chr15 57993033 57993033 Missense_Mutation G G A TCGA-23-1032-01A-02W-0486-08 ENST00000249750 p.P199L SNX33 chr15 75649038 75649038 5'UTR T T C TCGA-23-1032-01A-02W-0486-08 ENST00000308527 AXIN1 chr16 289475 289475 Missense_Mutation C C A TCGA-23-1032-01A-02W-0486-08 ENST00000262320 p.Q809H LMF1 chr16 869942 869942 Missense_Mutation A A T TCGA-23-1032-01A-02W-0486-08 ENST00000262301 p.C453S CASKIN1 chr16 2185360 2185360 Missense_Mutation G G A TCGA-23-1032-01A-02W-0486-08 ENST00000343516 p.S366L MGRN1 chr16 4673561 4673561 Missense_Mutation G G A TCGA-23-1032-01A-02W-0486-08 ENST00000399577 p.D287N ABCC1 chr16 16114815 16114815 Silent G G A TCGA-23-1032-01A-02W-0486-08 ENST00000399410 p.L1043L ZNF778 chr16 89228623 89228623 3'UTR C C T TCGA-23-1032-01A-02W-0486-08 ENST00000620195 DPH1 chr17 2036589 2036589 Missense_Mutation T T C TCGA-23-1032-01A-02W-0486-08 ENST00000263083 p.I159T RNASEK chr17 7012652 7012652 Missense_Mutation T T C TCGA-23-1032-01A-02W-0486-08 ENST00000402093 p.L29P SLC16A13 chr17 7036400 7036401 Frame_Shift_Ins - - C TCGA-23-1032-01A-02W-0486-08 ENST00000308027 p.D9Rfs*38 TP53 chr17 7674220 7674220 Missense_Mutation C T T TCGA-23-1032-01A-02W-0486-08 ENST00000269305 p.R248Q KDM6B chr17 7847265 7847265 Missense_Mutation G G A TCGA-23-1032-01A-02W-0486-08 ENST00000448097 p.G357E CFAP52 chr17 9632895 9632895 Silent C C T TCGA-23-1032-01A-02W-0486-08 ENST00000352665 p.N394N CDRT1 chr17 15619590 15619590 5'Flank A A G TCGA-23-1032-01A-02W-0486-08 ENST00000395906 MYO15A chr17 18119297 18119297 Missense_Mutation G G T TCGA-23-1032-01A-02W-0486-08 ENST00000205890 p.R166L SHMT1 chr17 18328779 18328779 Missense_Mutation A C C TCGA-23-1032-01A-02W-0486-08 ENST00000316694 p.F475V TOP2A chr17 40412944 40412945 Frame_Shift_Del CA CA - TCGA-23-1032-01A-02W-0486-08 ENST00000423485 p.G202* KLHL11 chr17 41853810 41853810 Missense_Mutation C C T TCGA-23-1032-01A-02W-0486-08 ENST00000319121 p.R686K ACLY chr17 41909039 41909039 Missense_Mutation A A G TCGA-23-1032-01A-02W-0486-08 ENST00000352035 p.F189S TUBG2 chr17 42665761 42665761 Silent G G C TCGA-23-1032-01A-02W-0486-08 ENST00000251412 p.S259S MPP3 chr17 43831886 43831886 Missense_Mutation G C C TCGA-23-1032-01A-02W-0486-08 ENST00000398389 p.D7E NGFR chr17 49512788 49512788 Missense_Mutation G T T TCGA-23-1032-01A-02W-0486-08 ENST00000172229 p.A355S CLTC chr17 59683007 59683007 Missense_Mutation A G G TCGA-23-1032-01A-02W-0486-08 ENST00000269122 p.Y1289C FAM20A chr17 68542737 68542737 Silent G G C TCGA-23-1032-01A-02W-0486-08 ENST00000592554 p.V295V ABHD3 chr18 21703722 21703722 Missense_Mutation T T C TCGA-23-1032-01A-02W-0486-08 ENST00000289119 p.E63G LAMA3 chr18 23749461 23749461 Missense_Mutation G G A TCGA-23-1032-01A-02W-0486-08 ENST00000313654 p.R200Q ATP9B chr18 79359426 79359426 Silent G G A TCGA-23-1032-01A-02W-0486-08 ENST00000426216 p.A992A ILF3 chr19 10682081 10682081 Silent G G A TCGA-23-1032-01A-02W-0486-08 ENST00000590261 p.Q423Q TNPO2 chr19 12715423 12715423 Frame_Shift_Del T T - TCGA-23-1032-01A-02W-0486-08 ENST00000425528 p.H183Pfs*14 KLHL26 chr19 18664329 18664329 Missense_Mutation A A C TCGA-23-1032-01A-02W-0486-08 ENST00000300976 p.Q51P ZNF257 chr19 22052495 22052495 5'UTR C C T TCGA-23-1032-01A-02W-0486-08 ENST00000594947 KMT2B chr19 35725294 35725294 Silent G G A TCGA-23-1032-01A-02W-0486-08 ENST00000420124 p.P1201P IFNL2 chr19 39269159 39269159 Missense_Mutation C C G TCGA-23-1032-01A-02W-0486-08 ENST00000331982 p.S67W GRWD1 chr19 48453020 48453020 Missense_Mutation G G A TCGA-23-1032-01A-02W-0486-08 ENST00000253237 p.V446I AP2A1 chr19 49799439 49799439 Missense_Mutation G G A TCGA-23-1032-01A-02W-0486-08 ENST00000359032 p.E360K ZNF761 chr19 53456874 53456874 3'UTR G G C TCGA-23-1032-01A-02W-0486-08 ENST00000432094 MIR519E chr19 53679964 53679964 RNA G G A TCGA-23-1032-01A-02W-0486-08 ENST00000385075 MIR519E chr19 53679965 53679965 RNA G G A TCGA-23-1032-01A-02W-0486-08 ENST00000385075 PRKCG chr19 53904671 53904671 Nonsense_Mutation C C T TCGA-23-1032-01A-02W-0486-08 ENST00000263431 p.Q565* TMC4 chr19 54160521 54160521 Silent A A C TCGA-23-1032-01A-02W-0486-08 ENST00000617472 p.A672A RPS9 chr19 54207504 54207504 Missense_Mutation C C A TCGA-23-1032-01A-02W-0486-08 ENST00000302907 p.R172S ATRN chr20 3597919 3597919 Silent T T A TCGA-23-1032-01A-02W-0486-08 ENST00000262919 p.I1161I TTLL9 chr20 31942949 31942949 Silent C C T TCGA-23-1032-01A-02W-0486-08 ENST00000375938 p.C416C SNX21 chr20 45840388 45840388 Intron G G A TCGA-23-1032-01A-02W-0486-08 ENST00000491381 ZNF334 chr20 46501935 46501935 Frame_Shift_Del T T - TCGA-23-1032-01A-02W-0486-08 ENST00000347606 p.K468Nfs*33 ZNF334 chr20 46501953 46501953 Silent T T C TCGA-23-1032-01A-02W-0486-08 ENST00000347606 p.E462E PTGIS chr20 49513262 49513262 Splice_Site C C T TCGA-23-1032-01A-02W-0486-08 ENST00000244043 p.X342_splice CDH4 chr20 61844671 61844671 Missense_Mutation C C T TCGA-23-1032-01A-02W-0486-08 ENST00000614565 p.R194W CLDN17 chr21 30166118 30166118 Missense_Mutation A A C TCGA-23-1032-01A-02W-0486-08 ENST00000286808 p.L167R RSPH14 chr22 23061828 23061828 Silent G G A TCGA-23-1032-01A-02W-0486-08 ENST00000216036 p.F257F CRYBB3 chr22 25205217 25205217 Splice_Region C T T TCGA-23-1032-01A-02W-0486-08 ENST00000215855 DEPDC5 chr22 31766624 31766624 Nonsense_Mutation C T T TCGA-23-1032-01A-02W-0486-08 ENST00000400246 p.Q107* EFCAB6 chr22 43615830 43615830 Missense_Mutation G G C TCGA-23-1032-01A-02W-0486-08 ENST00000262726 p.S853C PRR5-ARHGAP8 chr22 44825537 44825537 Silent G G A TCGA-23-1032-01A-02W-0486-08 ENST00000517296 p.K211K CDKL5 chrX 18650582 18650582 Silent C C A TCGA-23-1032-01A-02W-0486-08 ENST00000379989 p.T990T BMP15 chrX 50916057 50916057 Missense_Mutation A A T TCGA-23-1032-01A-02W-0486-08 ENST00000252677 p.Q210L MTMR8 chrX 64354818 64354818 Missense_Mutation T T A TCGA-23-1032-01A-02W-0486-08 ENST00000374852 p.N143Y DACH2 chrX 86814727 86814727 Missense_Mutation A A T TCGA-23-1032-01A-02W-0486-08 ENST00000373125 p.K526M DIAPH2 chrX 97247832 97247832 Missense_Mutation A A T TCGA-23-1032-01A-02W-0486-08 ENST00000324765 p.K946M ZMAT1 chrX 101898116 101898116 Splice_Region C C A TCGA-23-1032-01A-02W-0486-08 ENST00000372782 TMEM164 chrX 110173278 110173278 Missense_Mutation C C T TCGA-23-1032-01A-02W-0486-08 ENST00000372068 p.P241S ALG13 chrX 111728283 111728283 Silent G G A TCGA-23-1032-01A-02W-0486-08 ENST00000394780 p.E782E SLC25A14 chrX 130340328 130340328 Missense_Mutation C C T TCGA-23-1032-01A-02W-0486-08 ENST00000218197 p.A17V MACF1 chr1 39333733 39333733 Missense_Mutation G G A TCGA-13-2060-01A-01W-0799-08 ENST00000372915 p.C2387Y PODN chr1 53077297 53077297 Missense_Mutation G G A TCGA-13-2060-01A-01W-0799-08 ENST00000312553 p.R278H TMEM81 chr1 205084131 205084132 Nonsense_Mutation CA CA - TCGA-13-2060-01A-01W-0799-08 ENST00000367167 p.C63* FAM179A chr2 28998215 28998215 Missense_Mutation C C T TCGA-13-2060-01A-01W-0799-08 ENST00000379558 p.P34L NRXN1 chr2 50538529 50538529 Missense_Mutation C C T TCGA-13-2060-01A-01W-0799-08 ENST00000406316 p.A623T UXS1 chr2 106145349 106145349 Missense_Mutation C C G TCGA-13-2060-01A-01W-0799-08 ENST00000409501 p.V100L CNTNAP5 chr2 124914191 124914191 Missense_Mutation A A C TCGA-13-2060-01A-01W-0799-08 ENST00000431078 p.K1275T CD200R1 chr3 112929462 112929462 Missense_Mutation C C G TCGA-13-2060-01A-01W-0799-08 ENST00000471858 p.C60S DVL3 chr3 184164835 184164835 Missense_Mutation G G A TCGA-13-2060-01A-01W-0799-08 ENST00000313143 p.R168Q CPN2 chr3 194341653 194341653 Silent C C G TCGA-13-2060-01A-01W-0799-08 ENST00000323830 p.T350T UGT2A1 chr4 69647520 69647520 Missense_Mutation T T G TCGA-13-2060-01A-01W-0799-08 ENST00000503640 p.E42A MUC7 chr4 70480929 70480929 Missense_Mutation C C G TCGA-13-2060-01A-01W-0799-08 ENST00000304887 p.S62C WDR70 chr5 37479908 37479908 Missense_Mutation A A T TCGA-13-2060-01A-01W-0799-08 ENST00000265107 p.K254M DMGDH chr5 79063650 79063650 Missense_Mutation T T C TCGA-13-2060-01A-01W-0799-08 ENST00000255189 p.E80G FBN2 chr5 128349453 128349453 Silent C C T TCGA-13-2060-01A-01W-0799-08 ENST00000262464 p.V961V TMEM170B chr6 11575622 11575622 3'UTR G G C TCGA-13-2060-01A-01W-0799-08 ENST00000379426 GMNN chr6 24784109 24784109 Missense_Mutation G G T TCGA-13-2060-01A-01W-0799-08 ENST00000230056 p.W99C MRPL14 chr6 44114106 44114106 Missense_Mutation G G T TCGA-13-2060-01A-01W-0799-08 ENST00000372014 p.H59N DDX43 chr6 73395145 73395145 Silent C C T TCGA-13-2060-01A-01W-0799-08 ENST00000370336 p.G80G RRAGD chr6 89368178 89368178 Missense_Mutation G G A TCGA-13-2060-01A-01W-0799-08 ENST00000369415 p.R361W MDN1 chr6 89727852 89727852 Missense_Mutation T T C TCGA-13-2060-01A-01W-0799-08 ENST00000369393 p.H1818R COA1 chr7 43648620 43648620 5'UTR A A G TCGA-13-2060-01A-01W-0799-08 ENST00000223336 ABCB1 chr7 87515260 87515260 Missense_Mutation G G A TCGA-13-2060-01A-01W-0799-08 ENST00000265724 p.R1085W BET1 chr7 94004329 94004329 5'UTR C C G TCGA-13-2060-01A-01W-0799-08 ENST00000222547 SMURF1 chr7 99032965 99032965 Intron A A - TCGA-13-2060-01A-01W-0799-08 ENST00000361125 CNBD1 chr8 86939670 86939670 Missense_Mutation A A G TCGA-13-2060-01A-01W-0799-08 ENST00000518476 p.Q116R FAM135B chr8 138153020 138153020 Silent A A G TCGA-13-2060-01A-01W-0799-08 ENST00000395297 p.N485N KIFC2 chr8 144469613 144469613 Missense_Mutation A A G TCGA-13-2060-01A-01W-0799-08 ENST00000301332 p.D449G CNTLN chr9 17466063 17466063 Frame_Shift_Del A A - TCGA-13-2060-01A-01W-0799-08 ENST00000380647 p.K1206Sfs*15 TBC1D2 chr9 98244094 98244094 Missense_Mutation G G C TCGA-13-2060-01A-01W-0799-08 ENST00000465784 p.P183A GAPVD1 chr9 125307897 125307897 Intron G G T TCGA-13-2060-01A-01W-0799-08 ENST00000394104 BEND7 chr10 13499893 13499893 Silent C C T TCGA-13-2060-01A-01W-0799-08 ENST00000341083 p.P59P STAM chr10 17714729 17714729 Silent C C T TCGA-13-2060-01A-01W-0799-08 ENST00000377524 p.S524S RET chr10 43114507 43114507 Missense_Mutation C C T TCGA-13-2060-01A-01W-0799-08 ENST00000355710 p.T636M GRK5 chr10 119423212 119423212 Missense_Mutation C C T TCGA-13-2060-01A-01W-0799-08 ENST00000392870 p.T129M LRRC27 chr10 132333568 132333568 Missense_Mutation C C A TCGA-13-2060-01A-01W-0799-08 ENST00000368613 p.A15D ACCSL chr11 44059897 44059897 Missense_Mutation T T G TCGA-13-2060-01A-01W-0799-08 ENST00000378832 p.L562V AGBL2 chr11 47685955 47685955 Missense_Mutation G G T TCGA-13-2060-01A-01W-0799-08 ENST00000525123 p.R576S AAAS chr12 53307645 53307645 Silent G G A TCGA-13-2060-01A-01W-0799-08 ENST00000209873 p.S495S ATP6V0A2 chr12 123748583 123748583 Missense_Mutation G G A TCGA-13-2060-01A-01W-0799-08 ENST00000330342 p.R578K ATP11A chr13 112858257 112858257 Silent G G A TCGA-13-2060-01A-01W-0799-08 ENST00000375645 p.R878R ZFYVE26 chr14 67807420 67807420 Silent C C T TCGA-13-2060-01A-01W-0799-08 ENST00000347230 p.P288P TMOD3 chr15 51893883 51893883 Missense_Mutation A A G TCGA-13-2060-01A-01W-0799-08 ENST00000308580 p.S189G TICRR chr15 89576216 89576216 Nonsense_Mutation G G A TCGA-13-2060-01A-01W-0799-08 ENST00000268138 p.W210* OR4F6 chr15 101806476 101806483 Frame_Shift_Del CCATTAAT CCATTAAT - TCGA-13-2060-01A-01W-0799-08 ENST00000328882 p.P253Lfs*13 TRAF7 chr16 2173966 2173966 Missense_Mutation G G A TCGA-13-2060-01A-01W-0799-08 ENST00000326181 p.G394D RBFOX1 chr16 7630666 7630666 Missense_Mutation T T C TCGA-13-2060-01A-01W-0799-08 ENST00000547338 p.L247P TP53 chr17 7675076 7675076 Missense_Mutation T T C TCGA-13-2060-01A-01W-0799-08 ENST00000269305 p.H179R FLCN chr17 17215078 17215078 Missense_Mutation A A G TCGA-13-2060-01A-01W-0799-08 ENST00000285071 p.I482T KIF18B chr17 44932677 44932677 Missense_Mutation C C T TCGA-13-2060-01A-01W-0799-08 ENST00000593135 p.E412K DCC chr18 53305647 53305647 Nonsense_Mutation C C T TCGA-13-2060-01A-01W-0799-08 ENST00000442544 p.R661* ONECUT2 chr18 57476497 57476497 Missense_Mutation G G A TCGA-13-2060-01A-01W-0799-08 ENST00000491143 p.R430H RFXANK chr19 19199183 19199183 Missense_Mutation G G A TCGA-13-2060-01A-01W-0799-08 ENST00000303088 p.D221N ZFP82 chr19 36422275 36422275 5'Flank A A C TCGA-13-2060-01A-01W-0799-08 ENST00000392161 ZNF585B chr19 37187148 37187148 Missense_Mutation T T C TCGA-13-2060-01A-01W-0799-08 ENST00000532828 p.Y130C PRRG2 chr19 49583931 49583931 Missense_Mutation T T A TCGA-13-2060-01A-01W-0799-08 ENST00000246794 p.Y94N SIGLEC1 chr20 3689319 3689319 Intron A A G TCGA-13-2060-01A-01W-0799-08 ENST00000344754 APMAP chr20 24969038 24969038 Missense_Mutation C C T TCGA-13-2060-01A-01W-0799-08 ENST00000217456 p.E299K HTR2C chrX 114907216 114907216 Missense_Mutation C C T TCGA-13-2060-01A-01W-0799-08 ENST00000276198 p.P393L DOCK11 chrX 118675967 118675967 Missense_Mutation G G T TCGA-13-2060-01A-01W-0799-08 ENST00000276202 p.G1744V SDC3 chr1 30878650 30878650 Missense_Mutation C C T TCGA-13-A5FU-01A-11D-A403-09 ENST00000339394 p.D77N ADGRB2 chr1 31739529 31739529 Silent G G T TCGA-13-A5FU-01A-11D-A403-09 ENST00000373658 p.R758R GJB3 chr1 34785590 34785590 3'UTR T T A TCGA-13-A5FU-01A-11D-A403-09 ENST00000373362 ODF2L chr1 86385542 86385542 Silent A A T TCGA-13-A5FU-01A-11D-A403-09 ENST00000317336 p.L54L CRNN chr1 152410866 152410866 Missense_Mutation C C A TCGA-13-A5FU-01A-11D-A403-09 ENST00000271835 p.K72N NTRK1 chr1 156873681 156873681 Missense_Mutation G G T TCGA-13-A5FU-01A-11D-A403-09 ENST00000524377 p.C300F GUK1 chr1 228147525 228147525 Missense_Mutation C C T TCGA-13-A5FU-01A-11D-A403-09 ENST00000312726 p.P124L MT1HL1 chr1 237004219 237004219 Missense_Mutation C C A TCGA-13-A5FU-01A-11D-A403-09 ENST00000464121 p.G52W DESI2 chr1 244689331 244689331 Silent A A G TCGA-13-A5FU-01A-11D-A403-09 ENST00000302550 p.T66T GREB1 chr2 11638724 11638724 Silent G G A TCGA-13-A5FU-01A-11D-A403-09 ENST00000234142 p.S1867S NCOA1 chr2 24706623 24706623 Nonsense_Mutation C C T TCGA-13-A5FU-01A-11D-A403-09 ENST00000348332 p.R385* TEX261 chr2 70986343 70986343 3'UTR G G C TCGA-13-A5FU-01A-11D-A403-09 ENST00000272438 SH3RF3 chr2 109398817 109398817 Silent C C T TCGA-13-A5FU-01A-11D-A403-09 ENST00000309415 p.S391S UBR3 chr2 169950022 169950022 Missense_Mutation A A G TCGA-13-A5FU-01A-11D-A403-09 ENST00000272793 p.K1168E HOXD10 chr2 176119699 176119699 3'UTR A A - TCGA-13-A5FU-01A-11D-A403-09 ENST00000249501 CDK15 chr2 201807644 201807644 Splice_Site G G A TCGA-13-A5FU-01A-11D-A403-09 ENST00000450471 p.X91_splice COL6A3 chr2 237368772 237368772 Missense_Mutation C C T TCGA-13-A5FU-01A-11D-A403-09 ENST00000295550 p.R1564H GLB1 chr3 33077195 33077195 Intron G G A TCGA-13-A5FU-01A-11D-A403-09 ENST00000307363 NPRL2 chr3 50350092 50350092 Intron C C T TCGA-13-A5FU-01A-11D-A403-09 ENST00000232501 NEK4 chr3 52711609 52711609 3'UTR T T C TCGA-13-A5FU-01A-11D-A403-09 ENST00000233027 PODXL2 chr3 127660620 127660620 Missense_Mutation G G C TCGA-13-A5FU-01A-11D-A403-09 ENST00000342480 p.E198Q CPA3 chr3 148896884 148896884 3'UTR A A T TCGA-13-A5FU-01A-11D-A403-09 ENST00000296046 RP11-651P23.5 chr3 149982573 149982573 3'Flank C C A TCGA-13-A5FU-01A-11D-A403-09 ENST00000471176 IGSF10 chr3 151447109 151447109 Missense_Mutation C C G TCGA-13-A5FU-01A-11D-A403-09 ENST00000282466 p.V958L TTC14 chr3 180607697 180607697 Missense_Mutation G G A TCGA-13-A5FU-01A-11D-A403-09 ENST00000296015 p.A408T LPP chr3 188876796 188876796 3'UTR T T G TCGA-13-A5FU-01A-11D-A403-09 ENST00000617246 OSTN chr3 191218801 191218801 Missense_Mutation A A G TCGA-13-A5FU-01A-11D-A403-09 ENST00000339051 p.K53E ZDHHC19 chr3 196208509 196208509 Missense_Mutation A A T TCGA-13-A5FU-01A-11D-A403-09 ENST00000296326 p.F154I CPLX1 chr4 786533 786533 Missense_Mutation G G A TCGA-13-A5FU-01A-11D-A403-09 ENST00000304062 p.P125S YIPF7 chr4 44650098 44650098 Missense_Mutation C C T TCGA-13-A5FU-01A-11D-A403-09 ENST00000332990 p.M25I ADGRL3 chr4 62071046 62071046 3'UTR T T - TCGA-13-A5FU-01A-11D-A403-09 ENST00000514591 FAM175A chr4 83485109 83485109 5'UTR C C A TCGA-13-A5FU-01A-11D-A403-09 ENST00000321945 C4orf32 chr4 112187738 112187739 3'UTR - - T TCGA-13-A5FU-01A-11D-A403-09 ENST00000309733 OTUD4 chr4 145174700 145174700 Silent A A G TCGA-13-A5FU-01A-11D-A403-09 ENST00000447906 p.C68C F2RL1 chr5 76819071 76819071 5'UTR G G C TCGA-13-A5FU-01A-11D-A403-09 ENST00000296677 PCSK1 chr5 96390960 96390960 3'UTR G G T TCGA-13-A5FU-01A-11D-A403-09 ENST00000311106 MAN2A1 chr5 109767632 109767632 Silent C C T TCGA-13-A5FU-01A-11D-A403-09 ENST00000261483 p.I311I PCDHA2 chr5 140797105 140797105 Missense_Mutation C C T TCGA-13-A5FU-01A-11D-A403-09 ENST00000526136 p.T714M TENM2 chr5 167375322 167375322 Silent C C T TCGA-13-A5FU-01A-11D-A403-09 ENST00000518659 p.S117S FAF2 chr5 176507025 176507026 3'UTR - - A TCGA-13-A5FU-01A-11D-A403-09 ENST00000261942 ZNF322 chr6 26637441 26637441 Silent T T A TCGA-13-A5FU-01A-11D-A403-09 ENST00000415922 p.T371T HIST1H2AK chr6 27838189 27838189 Missense_Mutation A A T TCGA-13-A5FU-01A-11D-A403-09 ENST00000618958 p.Y51N TAPBP chr6 33303866 33303866 Missense_Mutation C C T TCGA-13-A5FU-01A-11D-A403-09 ENST00000426633 p.G475D FRS3 chr6 41775585 41775585 Missense_Mutation C C G TCGA-13-A5FU-01A-11D-A403-09 ENST00000259748 p.E29D XPO5 chr6 43546739 43546739 Missense_Mutation A A G TCGA-13-A5FU-01A-11D-A403-09 ENST00000265351 p.V725A MAN1A1 chr6 119201253 119201253 Splice_Site C C T TCGA-13-A5FU-01A-11D-A403-09 ENST00000368468 p.X404_splice TAAR8 chr6 132553227 132553234 Frame_Shift_Del TTAGTAAG TTAGTAAG - TCGA-13-A5FU-01A-11D-A403-09 ENST00000275200 p.L179Cfs*37 CYP51A1 chr7 92118561 92118561 Missense_Mutation G G T TCGA-13-A5FU-01A-11D-A403-09 ENST00000003100 p.P381T SRRT chr7 100881295 100881295 Missense_Mutation C C T TCGA-13-A5FU-01A-11D-A403-09 ENST00000611405 p.R45C PLXNA4 chr7 132133162 132133162 Missense_Mutation C C T TCGA-13-A5FU-01A-11D-A403-09 ENST00000321063 p.D1826N RP1 chr8 54622163 54622163 Missense_Mutation C C T TCGA-13-A5FU-01A-11D-A403-09 ENST00000220676 p.A221V FAM95B1 chr9 40327201 40327201 RNA G G C TCGA-13-A5FU-01A-11D-A403-09 ENST00000592873 TRPM6 chr9 74762434 74762434 Missense_Mutation A A T TCGA-13-A5FU-01A-11D-A403-09 ENST00000360774 p.L1413I ZNF367 chr9 96394943 96394943 Splice_Site C C T TCGA-13-A5FU-01A-11D-A403-09 ENST00000375256 p.X191_splice CACNA1B chr9 137955732 137955732 Missense_Mutation C C T TCGA-13-A5FU-01A-11D-A403-09 ENST00000371372 p.R369C ARHGAP22 chr10 48450948 48450948 Missense_Mutation G G C TCGA-13-A5FU-01A-11D-A403-09 ENST00000249601 p.S394C BTRC chr10 101532972 101532972 Silent G G A TCGA-13-A5FU-01A-11D-A403-09 ENST00000370187 p.L333L GBF1 chr10 102367109 102367109 Missense_Mutation A A C TCGA-13-A5FU-01A-11D-A403-09 ENST00000369983 p.N819H WDR11 chr10 120862780 120862780 Missense_Mutation C C G TCGA-13-A5FU-01A-11D-A403-09 ENST00000263461 p.S191C GVINP1 chr11 6719355 6719355 RNA G G A TCGA-13-A5FU-01A-11D-A403-09 ENST00000526769 SLC3A2 chr11 62852909 62852909 5'Flank C C T TCGA-13-A5FU-01A-11D-A403-09 ENST00000377890 LTBP3 chr11 65552015 65552015 Silent G G A TCGA-13-A5FU-01A-11D-A403-09 ENST00000301873 p.S496S CEP126 chr11 101962418 101962418 Silent G G A TCGA-13-A5FU-01A-11D-A403-09 ENST00000263468 p.T461T RNF26 chr11 119335802 119335802 Missense_Mutation A A G TCGA-13-A5FU-01A-11D-A403-09 ENST00000311413 p.N227S AC215219.2 chr12 16040 16040 3'Flank G G A TCGA-13-A5FU-01A-11D-A403-09 ENST00000611710 KDM5A chr12 284130 284130 3'UTR T T - TCGA-13-A5FU-01A-11D-A403-09 ENST00000399788 KIAA1551 chr12 31981823 31981823 Missense_Mutation C C G TCGA-13-A5FU-01A-11D-A403-09 ENST00000312561 p.P290A KMT2D chr12 49026430 49026430 Missense_Mutation C C T TCGA-13-A5FU-01A-11D-A403-09 ENST00000301067 p.R5179H GJA3 chr13 20141584 20141584 3'UTR C C A TCGA-13-A5FU-01A-11D-A403-09 ENST00000241125 ARL11 chr13 49633562 49633562 3'UTR C C T TCGA-13-A5FU-01A-11D-A403-09 ENST00000282026 RP11-407N17.3 chr14 39247296 39247296 Missense_Mutation C C T TCGA-13-A5FU-01A-11D-A403-09 ENST00000553728 p.S241L PACS2 chr14 105369883 105369883 Missense_Mutation T T G TCGA-13-A5FU-01A-11D-A403-09 ENST00000325438 p.F262V HERC2 chr15 28111709 28111709 3'UTR C C T TCGA-13-A5FU-01A-11D-A403-09 ENST00000261609 SPTBN5 chr15 41886110 41886110 Missense_Mutation C C T TCGA-13-A5FU-01A-11D-A403-09 ENST00000320955 p.R382H FAM195A chr16 648219 648219 3'UTR G G - TCGA-13-A5FU-01A-11D-A403-09 ENST00000307650 ABCC6 chr16 16214437 16214437 Missense_Mutation C C T TCGA-13-A5FU-01A-11D-A403-09 ENST00000205557 p.D163N ZKSCAN2 chr16 25246845 25246845 Missense_Mutation C C A TCGA-13-A5FU-01A-11D-A403-09 ENST00000328086 p.A451S PIEZO1 chr16 88721970 88721970 Silent G G A TCGA-13-A5FU-01A-11D-A403-09 ENST00000301015 p.A1684A TP53 chr17 7673802 7673802 Missense_Mutation C T T TCGA-13-A5FU-01A-11D-A403-09 ENST00000269305 p.R273H COIL chr17 56938994 56938994 3'UTR A A - TCGA-13-A5FU-01A-11D-A403-09 ENST00000240316 FTSJ3 chr17 63827579 63827579 5'UTR G G T TCGA-13-A5FU-01A-11D-A403-09 ENST00000427159 PRKCA chr17 66732816 66732816 Missense_Mutation T T A TCGA-13-A5FU-01A-11D-A403-09 ENST00000413366 p.S349R OTOP3 chr17 74941803 74941803 Missense_Mutation G G T TCGA-13-A5FU-01A-11D-A403-09 ENST00000328801 p.V162L ANKRD12 chr18 9257082 9257082 Missense_Mutation G G A TCGA-13-A5FU-01A-11D-A403-09 ENST00000262126 p.R1272Q ZNF532 chr18 58984502 58984502 3'UTR T T C TCGA-13-A5FU-01A-11D-A403-09 ENST00000336078 RBPJL chr20 45314131 45314131 Missense_Mutation C C A TCGA-13-A5FU-01A-11D-A403-09 ENST00000343694 p.T285K SULF2 chr20 47684457 47684457 Missense_Mutation T T A TCGA-13-A5FU-01A-11D-A403-09 ENST00000359930 p.M288L SSX7 chrX 52648308 52648308 Missense_Mutation C C A TCGA-13-A5FU-01A-11D-A403-09 ENST00000298181 p.C140F PDZD11 chrX 70287735 70287735 Silent G G A TCGA-13-A5FU-01A-11D-A403-09 ENST00000239666 p.S108S OGT chrX 71529742 71529742 5'Flank C C A TCGA-13-A5FU-01A-11D-A403-09 ENST00000373719 ZCCHC13 chrX 74304456 74304456 Missense_Mutation G G A TCGA-13-A5FU-01A-11D-A403-09 ENST00000339534 p.G64R PCDH11X chrX 91879033 91879033 Missense_Mutation C C G TCGA-13-A5FU-01A-11D-A403-09 ENST00000373094 p.D931E HNRNPH2 chrX 101413944 101413945 3'UTR - - T TCGA-13-A5FU-01A-11D-A403-09 ENST00000316594 MAP7D3 chrX 136231843 136231843 Missense_Mutation C C T TCGA-13-A5FU-01A-11D-A403-09 ENST00000316077 p.V372M MAGEA11 chrX 149688978 149688978 Translation_Start_Site G G A TCGA-13-A5FU-01A-11D-A403-09 ENST00000333104 p.M1? OPN1LW chrX 154154596 154154596 Missense_Mutation A A G TCGA-13-A5FU-01A-11D-A403-09 ENST00000369951 p.T201A EFNA4 chr1 155068943 155068943 Missense_Mutation T T C TCGA-13-0899-01A-01W-0420-08 ENST00000368409 p.L187S DUSP27 chr1 167126533 167126533 Missense_Mutation G G A TCGA-13-0899-01A-01W-0420-08 ENST00000271385 p.A468T NLRP3 chr1 247424860 247424860 Missense_Mutation G G A TCGA-13-0899-01A-01W-0420-08 ENST00000336119 p.A473T SCN2A chr2 165342334 165342334 Missense_Mutation G G T TCGA-13-0899-01A-01W-0420-08 ENST00000283256 p.K809N FAM171B chr2 186751260 186751260 Missense_Mutation G G C TCGA-13-0899-01A-01W-0420-08 ENST00000304698 p.S284T PLA2G12A chr4 109718717 109718717 Missense_Mutation G G A TCGA-13-0899-01A-01W-0420-08 ENST00000243501 p.P84L VCAN chr5 83541586 83541586 Silent A A C TCGA-13-0899-01A-01W-0420-08 ENST00000265077 p.P2861P HIST1H2BD chr6 26158234 26158234 Missense_Mutation C C G TCGA-13-0899-01A-01W-0420-08 ENST00000289316 p.A22G MAPK14 chr6 36028187 36028187 Silent G G C TCGA-13-0899-01A-01W-0420-08 ENST00000229794 p.R10R PTK7 chr6 43145197 43145197 Splice_Region C C T TCGA-13-0899-01A-01W-0420-08 ENST00000230419 AKAP9 chr7 92080068 92080068 Missense_Mutation A A T TCGA-13-0899-01A-01W-0420-08 ENST00000356239 p.E2645D TOPORS chr9 32543839 32543840 Frame_Shift_Del TG TG - TCGA-13-0899-01A-01W-0420-08 ENST00000360538 p.Q229Vfs*15 UPF2 chr10 11959238 11959238 Missense_Mutation C C T TCGA-13-0899-01A-01W-0420-08 ENST00000356352 p.R768H TET1 chr10 68691470 68691470 Missense_Mutation G G A TCGA-13-0899-01A-01W-0420-08 ENST00000373644 p.A2023T NTHL1 chr16 2046149 2046150 Frame_Shift_Del AT AT - TCGA-13-0899-01A-01W-0420-08 ENST00000219066 p.Y119* CIRH1A chr16 69168979 69168979 3'UTR G A A TCGA-13-0899-01A-01W-0420-08 ENST00000314423 ITGAE chr17 3747967 3747967 Missense_Mutation G G A TCGA-13-0899-01A-01W-0420-08 ENST00000263087 p.R704C TP53 chr17 7673579 7673579 Nonsense_Mutation G A A TCGA-13-0899-01A-01W-0420-08 ENST00000269305 p.Q317* ZNF331 chr19 53577138 53577138 Missense_Mutation G G A TCGA-13-0899-01A-01W-0420-08 ENST00000253144 p.G193E CD40 chr20 46122689 46122689 Silent G G A TCGA-13-0899-01A-01W-0420-08 ENST00000372285 p.T112T PHEX chrX 22032919 22032919 5'UTR C C A TCGA-13-0899-01A-01W-0420-08 ENST00000379374 CLCN6 chr1 11828588 11828588 Missense_Mutation G A A TCGA-24-1846-01A-01W-0639-09 ENST00000346436 p.R362H RP1-163M9.7 chr1 16704110 16704110 Intron G A A TCGA-24-1846-01A-01W-0639-09 ENST00000624517 TXNDC12 chr1 52028614 52028614 Missense_Mutation C C G TCGA-24-1846-01A-01W-0639-09 ENST00000371626 p.V59L BTF3L4 chr1 52086714 52086714 Missense_Mutation C C A TCGA-24-1846-01A-01W-0639-09 ENST00000313334 p.L145I INADL chr1 62114379 62114379 Intron C G G TCGA-24-1846-01A-01W-0639-09 ENST00000371158 NEXN chr1 77918226 77918252 In_Frame_Del TTAGAAAAGAGGAAAATACAGCGTGAA TTAGAAAAGAGGAAAATACAGCGTGAA - TCGA-24-1846-01A-01W-0639-09 ENST00000334785 p.E135_L143del NEXN chr1 77918254 77918254 Missense_Mutation T T C TCGA-24-1846-01A-01W-0639-09 ENST00000334785 p.L143S GFI1 chr1 92483021 92483021 Silent C C G TCGA-24-1846-01A-01W-0639-09 ENST00000294702 p.A47A ARHGAP29 chr1 94190280 94190280 Intron C C G TCGA-24-1846-01A-01W-0639-09 ENST00000260526 VAV3 chr1 107573019 107573019 3'UTR A A G TCGA-24-1846-01A-01W-0639-09 ENST00000370056 CD101 chr1 117009849 117009849 Splice_Site G G A TCGA-24-1846-01A-01W-0639-09 ENST00000256652 p.X15_splice RP11-134G8.5 chr1 201520591 201520591 RNA A A - TCGA-24-1846-01A-01W-0639-09 ENST00000441932 MIA3 chr1 222629858 222629858 Missense_Mutation C C T TCGA-24-1846-01A-01W-0639-09 ENST00000344922 p.H880Y OBSCN chr1 228286876 228286876 Missense_Mutation C C G TCGA-24-1846-01A-01W-0639-09 ENST00000422127 p.C3127W ADSS chr1 244432560 244432560 Missense_Mutation C C G TCGA-24-1846-01A-01W-0639-09 ENST00000366535 p.D131H OR2B11 chr1 247451518 247451518 Silent A A G TCGA-24-1846-01A-01W-0639-09 ENST00000318749 p.S155S GREB1 chr2 11612580 11612580 Missense_Mutation G A A TCGA-24-1846-01A-01W-0639-09 ENST00000234142 p.G1031E MEMO1 chr2 31918022 31918022 Missense_Mutation C C G TCGA-24-1846-01A-01W-0639-09 ENST00000295065 p.W114S IGKC chr2 88857558 88857558 Missense_Mutation C C T TCGA-24-1846-01A-01W-0639-09 ENST00000614656 p.V172M EPB41L5 chr2 120174925 120174925 3'UTR A G G TCGA-24-1846-01A-01W-0639-09 ENST00000263713 POTEF chr2 130075477 130075477 Missense_Mutation C C T TCGA-24-1846-01A-01W-0639-09 ENST00000357462 p.M665I POTEE chr2 131263385 131263385 Missense_Mutation G G T TCGA-24-1846-01A-01W-0639-09 ENST00000356920 p.V644F DARS chr2 135985484 135985484 5'UTR G A A TCGA-24-1846-01A-01W-0639-09 ENST00000264161 CXCR4 chr2 136116152 136116152 Intron G C C TCGA-24-1846-01A-01W-0639-09 ENST00000241393 DPP4 chr2 162035239 162035239 Silent G A A TCGA-24-1846-01A-01W-0639-09 ENST00000360534 p.V233V TTN chr2 178564062 178564062 Missense_Mutation G G T TCGA-24-1846-01A-01W-0639-09 ENST00000591111 p.T25716K TTN chr2 178719638 178719638 Nonsense_Mutation C C A TCGA-24-1846-01A-01W-0639-09 ENST00000591111 p.E7635* SLC23A3 chr2 219169607 219169607 Silent T T C TCGA-24-1846-01A-01W-0639-09 ENST00000409878 p.G78G DOCK10 chr2 224774961 224774961 Missense_Mutation G G A TCGA-24-1846-01A-01W-0639-09 ENST00000258390 p.S1986L CAB39 chr2 230818543 230818543 Nonsense_Mutation C C T TCGA-24-1846-01A-01W-0639-09 ENST00000258418 p.Q289* COLQ chr3 15455909 15455909 Silent G A A TCGA-24-1846-01A-01W-0639-09 ENST00000383788 p.D395D FBXW12 chr3 48378387 48378418 Frame_Shift_Del ATCTCGCCATCACTATGGATCGGAAAAAAACT ATCTCGCCATCACTATGGATCGGAAAAAAACT - TCGA-24-1846-01A-01W-0639-09 ENST00000296438 p.L160Qfs*42 IP6K2 chr3 48695117 48695131 In_Frame_Del TCTCAGCAGGGAGGG TCTCAGCAGGGAGGG - TCGA-24-1846-01A-01W-0639-09 ENST00000328631 p.T54_E58del IP6K2 chr3 48695243 48695243 Frame_Shift_Del C - - TCGA-24-1846-01A-01W-0639-09 ENST00000328631 p.V17Sfs*68 COL8A1 chr3 99796027 99796027 Missense_Mutation G G A TCGA-24-1846-01A-01W-0639-09 ENST00000261037 p.R709K ATP2C1 chr3 130999553 130999553 Silent T T C TCGA-24-1846-01A-01W-0639-09 ENST00000428331 p.N841N CLRN1 chr3 150972889 150972889 5'UTR A A T TCGA-24-1846-01A-01W-0639-09 ENST00000327047 OTOL1 chr3 161503826 161503826 Missense_Mutation C C A TCGA-24-1846-01A-01W-0639-09 ENST00000327928 p.Q440K HTR3C chr3 184060505 184060505 3'UTR G G C TCGA-24-1846-01A-01W-0639-09 ENST00000318351 DGKG chr3 186268808 186268808 Missense_Mutation C C T TCGA-24-1846-01A-01W-0639-09 ENST00000265022 p.R370Q TFRC chr3 196058615 196058615 Silent A A C TCGA-24-1846-01A-01W-0639-09 ENST00000360110 p.T518T SLIT2 chr4 20589681 20589681 Missense_Mutation G G C TCGA-24-1846-01A-01W-0639-09 ENST00000504154 p.Q1042H KDR chr4 55088948 55088948 Missense_Mutation G G A TCGA-24-1846-01A-01W-0639-09 ENST00000263923 p.H1144Y SLC10A7 chr4 146256335 146256335 3'Flank C T T TCGA-24-1846-01A-01W-0639-09 ENST00000507030 DNAH5 chr5 13859549 13859549 Nonsense_Mutation G G C TCGA-24-1846-01A-01W-0639-09 ENST00000265104 p.S1618* RXFP3 chr5 33937933 33937933 Missense_Mutation A C C TCGA-24-1846-01A-01W-0639-09 ENST00000330120 p.K398T FAM151B chr5 80541956 80541956 3'UTR T T A TCGA-24-1846-01A-01W-0639-09 ENST00000282226 FAM151B chr5 80541959 80541979 3'UTR ATTGTATGCTTACTCTGTGGG ATTGTATGCTTACTCTGTGGG - TCGA-24-1846-01A-01W-0639-09 ENST00000282226 OR2Y1 chr5 180739789 180739789 Silent G G C TCGA-24-1846-01A-01W-0639-09 ENST00000307832 p.R90R DSP chr6 7559362 7559380 Frame_Shift_Del GTCACCAGTGAATGTTTGG GTCACCAGTGAATGTTTGG - TCGA-24-1846-01A-01W-0639-09 ENST00000379802 p.V187Gfs*3 ZBED9 chr6 28586384 28586384 Missense_Mutation C C T TCGA-24-1846-01A-01W-0639-09 ENST00000452236 p.V112M HTR1E chr6 87015973 87015973 Silent C C T TCGA-24-1846-01A-01W-0639-09 ENST00000305344 p.Y213Y LPAL2 chr6 160500828 160500828 RNA A A G TCGA-24-1846-01A-01W-0639-09 ENST00000454031 CYTH3 chr7 6173708 6173708 Missense_Mutation G G T TCGA-24-1846-01A-01W-0639-09 ENST00000396741 p.Q132K ABCA13 chr7 48272943 48272943 Missense_Mutation G C C TCGA-24-1846-01A-01W-0639-09 ENST00000435803 p.D1093H GIGYF1 chr7 100686691 100686691 Missense_Mutation C T T TCGA-24-1846-01A-01W-0639-09 ENST00000275732 p.G218R LAMB1 chr7 107931469 107931469 Missense_Mutation G C C TCGA-24-1846-01A-01W-0639-09 ENST00000222399 p.A1475G OPN1SW chr7 128775463 128775463 Missense_Mutation C C T TCGA-24-1846-01A-01W-0639-09 ENST00000249389 p.E110K KCNU1 chr8 36911005 36911005 Missense_Mutation C A A TCGA-24-1846-01A-01W-0639-09 ENST00000399881 p.P803T MSC chr8 71843524 71843524 Intron C C A TCGA-24-1846-01A-01W-0639-09 ENST00000325509 ZFHX4 chr8 76704564 76704564 Missense_Mutation A A T TCGA-24-1846-01A-01W-0639-09 ENST00000521891 p.K159I RP11-240B13.2 chr8 132038824 132038824 Silent G G T TCGA-24-1846-01A-01W-0639-09 ENST00000262283 p.T394T ZFAT chr8 134601692 134601692 Missense_Mutation G G A TCGA-24-1846-01A-01W-0639-09 ENST00000377838 p.S676L CYP11B2 chr8 142917681 142917681 Missense_Mutation G G C TCGA-24-1846-01A-01W-0639-09 ENST00000323110 p.Q54E ZFP41 chr8 143250124 143250124 Missense_Mutation G G A TCGA-24-1846-01A-01W-0639-09 ENST00000626353 p.R94Q IL33 chr9 6253593 6253593 Missense_Mutation A A T TCGA-24-1846-01A-01W-0639-09 ENST00000381434 p.N171Y PLIN2 chr9 19116532 19116532 Missense_Mutation T T C TCGA-24-1846-01A-01W-0639-09 ENST00000276914 p.K344E TAF1L chr9 32632138 32632138 Missense_Mutation G G C TCGA-24-1846-01A-01W-0639-09 ENST00000242310 p.L1148V CCL21 chr9 34709537 34709537 Missense_Mutation T T A TCGA-24-1846-01A-01W-0639-09 ENST00000259607 p.T112S SPATA31A3 chr9 66986400 66986400 3'UTR T T A TCGA-24-1846-01A-01W-0639-09 ENST00000428649 ERP44 chr9 100052525 100052525 Missense_Mutation A G G TCGA-24-1846-01A-01W-0639-09 ENST00000262455 p.F60L MURC chr9 100586171 100586171 Missense_Mutation G A A TCGA-24-1846-01A-01W-0639-09 ENST00000307584 p.R272H C5 chr9 120981843 120981843 Splice_Site C T T TCGA-24-1846-01A-01W-0639-09 ENST00000223642 p.X1162_splice RAPGEF1 chr9 131625988 131626008 In_Frame_Del TAAAATCACCCACAAATTCGA TAAAATCACCCACAAATTCGA - TCGA-24-1846-01A-01W-0639-09 ENST00000372189 p.V522_T529delinsA NRP1 chr10 33270677 33270677 Missense_Mutation C C A TCGA-24-1846-01A-01W-0639-09 ENST00000265371 p.R143I ZNF22 chr10 45003880 45003880 Missense_Mutation A A C TCGA-24-1846-01A-01W-0639-09 ENST00000298299 p.E171A PCDH15 chr10 53811598 53811598 Missense_Mutation T T C TCGA-24-1846-01A-01W-0639-09 ENST00000495484 p.I181V AIFM2 chr10 70115117 70115117 Missense_Mutation C C T TCGA-24-1846-01A-01W-0639-09 ENST00000307864 p.S258N CPXM2 chr10 123754694 123754694 Silent G G A TCGA-24-1846-01A-01W-0639-09 ENST00000241305 p.S662S C3AR1 chr12 8060059 8060059 Missense_Mutation G G T TCGA-24-1846-01A-01W-0639-09 ENST00000307637 p.L43M TAS2R7 chr12 10802081 10802081 Silent T T G TCGA-24-1846-01A-01W-0639-09 ENST00000240687 p.R164R CALCOCO1 chr12 53723649 53723649 Nonsense_Mutation C C A TCGA-24-1846-01A-01W-0639-09 ENST00000550804 p.E132* DDIT3 chr12 57517417 57517417 5'UTR G G C TCGA-24-1846-01A-01W-0639-09 ENST00000346473 POC1B chr12 89471697 89471697 Missense_Mutation C C G TCGA-24-1846-01A-01W-0639-09 ENST00000313546 p.G198A SLITRK1 chr13 83881636 83881637 5'UTR - - G TCGA-24-1846-01A-01W-0639-09 ENST00000377084 CIDEB chr14 24306455 24306455 Silent G G A TCGA-24-1846-01A-01W-0639-09 ENST00000258807 p.D85D PAPOLA chr14 96555853 96555853 Silent C T T TCGA-24-1846-01A-01W-0639-09 ENST00000216277 p.N557N MYO5A chr15 52370306 52370306 Missense_Mutation C C T TCGA-24-1846-01A-01W-0639-09 ENST00000399231 p.E977K GRIN2A chr16 9764569 9764569 Missense_Mutation T G G TCGA-24-1846-01A-01W-0639-09 ENST00000330684 p.N992T SLC12A3 chr16 56886372 56886372 Missense_Mutation G A A TCGA-24-1846-01A-01W-0639-09 ENST00000563236 p.C645Y HP chr16 72056546 72056547 Frame_Shift_Ins - - C TCGA-24-1846-01A-01W-0639-09 ENST00000355906 p.E38Rfs*16 OR1E1 chr17 3398364 3398364 Missense_Mutation C C T TCGA-24-1846-01A-01W-0639-09 ENST00000322608 p.G16D ALOX15 chr17 4638632 4638632 Missense_Mutation C C A TCGA-24-1846-01A-01W-0639-09 ENST00000293761 p.D199Y MINK1 chr17 4896558 4896558 Silent C C T TCGA-24-1846-01A-01W-0639-09 ENST00000355280 p.L1249L CLDN7 chr17 7260210 7260211 3'UTR - - C TCGA-24-1846-01A-01W-0639-09 ENST00000360325 TP53 chr17 7675166 7675167 Frame_Shift_Ins - A A TCGA-24-1846-01A-01W-0639-09 ENST00000269305 p.S149Ffs*32 RAI1 chr17 17796813 17796820 Frame_Shift_Del GCCACAAA - - TCGA-24-1846-01A-01W-0639-09 ENST00000353383 p.T1290Pfs*55 SLC6A4 chr17 30209224 30209224 Missense_Mutation T C C TCGA-24-1846-01A-01W-0639-09 ENST00000261707 p.K490E SLC6A4 chr17 30218839 30218839 Nonsense_Mutation C A A TCGA-24-1846-01A-01W-0639-09 ENST00000261707 p.G146* PEX12 chr17 35575760 35575760 3'UTR G C C TCGA-24-1846-01A-01W-0639-09 ENST00000225873 EIF1 chr17 41691047 41691047 3'UTR G G - TCGA-24-1846-01A-01W-0639-09 ENST00000469257 BRCA1 chr17 43092065 43092066 Nonsense_Mutation - - ATCTAACA TCGA-24-1846-01A-01W-0639-09 ENST00000357654 p.D1156Cfs*2 RP11-707O23.5 chr17 45601651 45601651 RNA G G A TCGA-24-1846-01A-01W-0639-09 ENST00000580257 CCDC40 chr17 80050170 80050170 Missense_Mutation A A T TCGA-24-1846-01A-01W-0639-09 ENST00000397545 p.H349L CEP192 chr18 13124740 13124740 Silent A A G TCGA-24-1846-01A-01W-0639-09 ENST00000506447 p.R2528R ZNF24 chr18 35340383 35340383 Missense_Mutation G G C TCGA-24-1846-01A-01W-0639-09 ENST00000261332 p.Q90E OR10H4 chr19 15949420 15949420 Missense_Mutation G G A TCGA-24-1846-01A-01W-0639-09 ENST00000322107 p.S138N GRIN2D chr19 48419570 48419586 Splice_Site CCTGGCCCCCTGCAGGC CCTGGCCCCCTGCAGGC - TCGA-24-1846-01A-01W-0639-09 ENST00000263269 p.X621_splice DPRX chr19 53632126 53632126 Missense_Mutation T G G TCGA-24-1846-01A-01W-0639-09 ENST00000376650 p.L7R RALGAPA2 chr20 20572955 20572955 Missense_Mutation C C G TCGA-24-1846-01A-01W-0639-09 ENST00000202677 p.D941H CST4 chr20 23685750 23685750 3'UTR G G T TCGA-24-1846-01A-01W-0639-09 ENST00000217423 RBM12 chr20 35655286 35655286 Missense_Mutation C C A TCGA-24-1846-01A-01W-0639-09 ENST00000359646 p.V13L TRPM2 chr21 44426671 44426671 Silent G G T TCGA-24-1846-01A-01W-0639-09 ENST00000300482 p.L1269L PVALB chr22 36813679 36813679 Missense_Mutation C A A TCGA-24-1846-01A-01W-0639-09 ENST00000216200 p.D91Y ZNF182 chrX 47982983 47982983 Silent C C T TCGA-24-1846-01A-01W-0639-09 ENST00000305127 p.P85P DLG3 chrX 70499942 70499942 Missense_Mutation G G A TCGA-24-1846-01A-01W-0639-09 ENST00000374360 p.E680K SRPX2 chrX 100666905 100666905 Missense_Mutation G G C TCGA-24-1846-01A-01W-0639-09 ENST00000373004 p.Q311H GPRASP2 chrX 102715024 102715024 Missense_Mutation C C G TCGA-24-1846-01A-01W-0639-09 ENST00000332262 p.T52S PLP1 chrX 103786813 103786813 Intron G G T TCGA-24-1846-01A-01W-0639-09 ENST00000612423 THOC2 chrX 123603705 123603705 Intron A A C TCGA-24-1846-01A-01W-0639-09 ENST00000245838 BCORL1 chrX 130056006 130056006 Missense_Mutation C C A TCGA-24-1846-01A-01W-0639-09 ENST00000218147 p.A1669D BCORL1 chrX 130056007 130056007 Silent C C A TCGA-24-1846-01A-01W-0639-09 ENST00000218147 p.A1669A HSPG2 chr1 21885374 21885374 Missense_Mutation A A C TCGA-29-1764-01A-01W-0633-09 ENST00000374695 p.F386V CYP4A11 chr1 46938126 46938126 Missense_Mutation G G C TCGA-29-1764-01A-01W-0633-09 ENST00000310638 p.D69E DNAJC6 chr1 65364706 65364706 Missense_Mutation A A G TCGA-29-1764-01A-01W-0633-09 ENST00000395325 p.R32G AK5 chr1 77417711 77417711 Missense_Mutation A A G TCGA-29-1764-01A-01W-0633-09 ENST00000354567 p.D352G HIAT1 chr1 100082213 100082213 3'UTR C C A TCGA-29-1764-01A-01W-0633-09 ENST00000370152 ANKRD35 chr1 145872949 145872949 Missense_Mutation C C T TCGA-29-1764-01A-01W-0633-09 ENST00000355594 p.G607D BCL9 chr1 147613119 147613119 Missense_Mutation G G C TCGA-29-1764-01A-01W-0633-09 ENST00000234739 p.G97A FLG2 chr1 152354297 152354321 Frame_Shift_Del TGATTGACTGGAGCCAGTACCATGT TGATTGACTGGAGCCAGTACCATGT - TCGA-29-1764-01A-01W-0633-09 ENST00000388718 p.Q1155Hfs*64 HAX1 chr1 154272667 154272667 5'UTR C C T TCGA-29-1764-01A-01W-0633-09 ENST00000328703 LENEP chr1 154993609 154993609 Translation_Start_Site T T A TCGA-29-1764-01A-01W-0633-09 ENST00000368427 p.M1? FAM163A chr1 179814229 179814259 3'UTR CCCTGGCGGGGGCCATGGGGGTGATGAATGA CCCTGGCGGGGGCCATGGGGGTGATGAATGA - TCGA-29-1764-01A-01W-0633-09 ENST00000341785 FAM129A chr1 184795777 184795777 Missense_Mutation G G T TCGA-29-1764-01A-01W-0633-09 ENST00000367511 p.P663T TROVE2 chr1 193069256 193069256 Missense_Mutation G G A TCGA-29-1764-01A-01W-0633-09 ENST00000367441 p.G68S SERTAD4 chr1 210241601 210241601 Missense_Mutation C C A TCGA-29-1764-01A-01W-0633-09 ENST00000367012 p.S112Y APOB chr2 21009081 21009081 Missense_Mutation G G C TCGA-29-1764-01A-01W-0633-09 ENST00000233242 p.T2596S ASXL2 chr2 25750380 25750380 Silent C C T TCGA-29-1764-01A-01W-0633-09 ENST00000435504 p.L392L FSHR chr2 49154340 49154340 Silent A A T TCGA-29-1764-01A-01W-0633-09 ENST00000406846 p.S26S RGPD1 chr2 86987289 86987289 Missense_Mutation T T A TCGA-29-1764-01A-01W-0633-09 ENST00000409776 p.S1456T IL18RAP chr2 102452423 102452423 3'UTR C C A TCGA-29-1764-01A-01W-0633-09 ENST00000264260 LY75 chr2 159852329 159852329 Missense_Mutation G G C TCGA-29-1764-01A-01W-0633-09 ENST00000263636 p.P919A PLEKHA3 chr2 178503758 178503758 Splice_Site A A G TCGA-29-1764-01A-01W-0633-09 ENST00000234453 p.X259_splice FN1 chr2 215408352 215408352 Missense_Mutation G G C TCGA-29-1764-01A-01W-0633-09 ENST00000359671 p.Q792E EBLN2 chr3 73062728 73062728 Missense_Mutation T T G TCGA-29-1764-01A-01W-0633-09 ENST00000533473 p.M216R ABLIM2 chr4 8080774 8080774 Missense_Mutation C C G TCGA-29-1764-01A-01W-0633-09 ENST00000341937 p.K161N USP17L18 chr4 9248860 9248860 Silent G G T TCGA-29-1764-01A-01W-0633-09 ENST00000504209 p.A77A CENPC chr4 67518325 67518325 Missense_Mutation C C G TCGA-29-1764-01A-01W-0633-09 ENST00000273853 p.D221H UGT2A1 chr4 69647320 69647320 Missense_Mutation G G C TCGA-29-1764-01A-01W-0633-09 ENST00000503640 p.Q109E SLC6A18 chr5 1242725 1242725 Silent C C T TCGA-29-1764-01A-01W-0633-09 ENST00000324642 p.I331I SLC6A3 chr5 1432636 1432636 Missense_Mutation C C T TCGA-29-1764-01A-01W-0633-09 ENST00000270349 p.A161T CTD-2066L21.3 chr5 33162278 33162278 Intron G G A TCGA-29-1764-01A-01W-0633-09 ENST00000510327 RANBP17 chr5 170919473 170919473 Nonsense_Mutation T T G TCGA-29-1764-01A-01W-0633-09 ENST00000523189 p.Y378* NUDT3 chr6 34288698 34288698 3'UTR G G C TCGA-29-1764-01A-01W-0633-09 ENST00000607016 TSPO2 chr6 41042963 41042963 Splice_Region C C A TCGA-29-1764-01A-01W-0633-09 ENST00000373161 EYS chr6 65402573 65402573 Silent T T G TCGA-29-1764-01A-01W-0633-09 ENST00000370616 p.T363T AEBP1 chr7 44112755 44112755 Missense_Mutation G G C TCGA-29-1764-01A-01W-0633-09 ENST00000223357 p.E805D ABCA13 chr7 48240970 48240970 Missense_Mutation C C A TCGA-29-1764-01A-01W-0633-09 ENST00000435803 p.P389H PCLO chr7 82909014 82909014 Splice_Site C C A TCGA-29-1764-01A-01W-0633-09 ENST00000333891 p.X4434_splice NRCAM chr7 108184580 108184580 Silent C C T TCGA-29-1764-01A-01W-0633-09 ENST00000379028 p.K690K PTPRZ1 chr7 122011461 122011461 Silent G G A TCGA-29-1764-01A-01W-0633-09 ENST00000393386 p.V805V TCAF1 chr7 143876304 143876312 In_Frame_Del GCCAAAGGT GCCAAAGGT - TCGA-29-1764-01A-01W-0633-09 ENST00000479870 p.P100_A102del ZNF777 chr7 149455629 149455629 Missense_Mutation G G C TCGA-29-1764-01A-01W-0633-09 ENST00000247930 p.P132A KMT2C chr7 152249890 152249890 Missense_Mutation C C T TCGA-29-1764-01A-01W-0633-09 ENST00000262189 p.S600N PABPC1 chr8 100709524 100709524 Missense_Mutation T T G TCGA-29-1764-01A-01W-0633-09 ENST00000318607 p.N394H PKHD1L1 chr8 109452207 109452207 Frame_Shift_Del T T - TCGA-29-1764-01A-01W-0633-09 ENST00000378402 p.M2145Rfs*71 TG chr8 132888033 132888033 Silent G G A TCGA-29-1764-01A-01W-0633-09 ENST00000220616 p.V742V COL22A1 chr8 138826675 138826675 Missense_Mutation G G T TCGA-29-1764-01A-01W-0633-09 ENST00000303045 p.Q318K COL22A1 chr8 138826676 138826676 Missense_Mutation G G T TCGA-29-1764-01A-01W-0633-09 ENST00000303045 p.D317E CBWD1 chr9 175736 175736 Missense_Mutation C C A TCGA-29-1764-01A-01W-0633-09 ENST00000356521 p.S68I KIAA2026 chr9 5922767 5922767 Missense_Mutation C C G TCGA-29-1764-01A-01W-0633-09 ENST00000399933 p.D1077H TTC39B chr9 15189771 15189771 Missense_Mutation G G T TCGA-29-1764-01A-01W-0633-09 ENST00000512701 p.A376E GARNL3 chr9 127393251 127393251 Missense_Mutation G G C TCGA-29-1764-01A-01W-0633-09 ENST00000373387 p.K1013N VAV2 chr9 133796448 133796448 Missense_Mutation T T A TCGA-29-1764-01A-01W-0633-09 ENST00000371850 p.K338I SLC39A12 chr10 17987584 17987584 Nonsense_Mutation T T A TCGA-29-1764-01A-01W-0633-09 ENST00000377369 p.L401* CHAT chr10 49619727 49619727 Splice_Region G G A TCGA-29-1764-01A-01W-0633-09 ENST00000337653 p.G130G DMBT1 chr10 122601934 122601934 Silent A A C TCGA-29-1764-01A-01W-0633-09 ENST00000338354 p.R1161R CCDC73 chr11 32615962 32615962 Missense_Mutation A A C TCGA-29-1764-01A-01W-0633-09 ENST00000335185 p.F451L OR9Q1 chr11 58179433 58179433 Splice_Region A A G TCGA-29-1764-01A-01W-0633-09 ENST00000335397 TECTA chr11 121128246 121128246 Missense_Mutation A A G TCGA-29-1764-01A-01W-0633-09 ENST00000264037 p.K757E OVCH1 chr12 29495413 29495413 Missense_Mutation A A G TCGA-29-1764-01A-01W-0633-09 ENST00000318184 p.L109P ERBB3 chr12 56101681 56101681 Missense_Mutation G G A TCGA-29-1764-01A-01W-0633-09 ENST00000267101 p.E1219K B4GALNT1 chr12 57630054 57630054 Intron C C A TCGA-29-1764-01A-01W-0633-09 ENST00000341156 DIABLO chr12 122216552 122216552 Silent C C T TCGA-29-1764-01A-01W-0633-09 ENST00000443649 p.L153L ATP8A2 chr13 25769140 25769140 Missense_Mutation G G A TCGA-29-1764-01A-01W-0633-09 ENST00000381655 p.G827R OR4K2 chr14 19876704 19876704 Missense_Mutation T T A TCGA-29-1764-01A-01W-0633-09 ENST00000298642 p.V146E CTSG chr14 24574407 24574407 Silent C C G TCGA-29-1764-01A-01W-0633-09 ENST00000216336 p.V144V HECTD1 chr14 31178247 31178247 Missense_Mutation G G T TCGA-29-1764-01A-01W-0633-09 ENST00000399332 p.P50T SFTA3 chr14 36473758 36473758 3'UTR T T A TCGA-29-1764-01A-01W-0633-09 ENST00000518529 SIPA1L1 chr14 71739128 71739128 Silent A A G TCGA-29-1764-01A-01W-0633-09 ENST00000555818 p.T1794T ZFYVE1 chr14 72998174 72998174 Missense_Mutation T T C TCGA-29-1764-01A-01W-0633-09 ENST00000556143 p.K209E ALKBH1 chr14 77694891 77694891 Missense_Mutation A A C TCGA-29-1764-01A-01W-0633-09 ENST00000216489 p.F101C OR4N3P chr15 22125834 22125834 RNA A A G TCGA-29-1764-01A-01W-0633-09 ENST00000559395 MPG chr16 85507 85507 Silent C C G TCGA-29-1764-01A-01W-0633-09 ENST00000219431 p.L209L SEC14L5 chr16 4997035 4997035 Missense_Mutation C C A TCGA-29-1764-01A-01W-0633-09 ENST00000251170 p.Q321K NDE1 chr16 15677815 15677815 Silent G G A TCGA-29-1764-01A-01W-0633-09 ENST00000396355 p.V84V ACSM2A chr16 20486592 20486592 Missense_Mutation C C A TCGA-29-1764-01A-01W-0633-09 ENST00000219054 p.L550M RP11-1166P10.6 chr16 32059249 32059249 Intron G G C TCGA-29-1764-01A-01W-0633-09 ENST00000566806 BRD7 chr16 50350062 50350062 Frame_Shift_Del C C - TCGA-29-1764-01A-01W-0633-09 ENST00000394688 p.I185Sfs*9 TOX3 chr16 52446184 52446184 Missense_Mutation T T C TCGA-29-1764-01A-01W-0633-09 ENST00000219746 p.K239R CDH11 chr16 64981942 64981942 Intron C C G TCGA-29-1764-01A-01W-0633-09 ENST00000268603 TP53 chr17 7673803 7673803 Missense_Mutation G G A TCGA-29-1764-01A-01W-0633-09 ENST00000269305 p.R273C LRRC37B chr17 32021900 32021900 Missense_Mutation C C G TCGA-29-1764-01A-01W-0633-09 ENST00000341671 p.P252A RPL27 chr17 42998638 42998638 Intron G G C TCGA-29-1764-01A-01W-0633-09 ENST00000253788 COL1A1 chr17 50190327 50190328 Frame_Shift_Ins - - G TCGA-29-1764-01A-01W-0633-09 ENST00000225964 p.G818Wfs*3 SRSF1 chr17 58006432 58006432 Missense_Mutation C C T TCGA-29-1764-01A-01W-0633-09 ENST00000258962 p.R97Q LRRC30 chr18 7232020 7232020 Nonsense_Mutation C C A TCGA-29-1764-01A-01W-0633-09 ENST00000383467 p.Y294* SERPINB5 chr18 63503884 63503884 3'UTR T T - TCGA-29-1764-01A-01W-0633-09 ENST00000382771 SERPINB13 chr18 63594479 63594479 Missense_Mutation G G C TCGA-29-1764-01A-01W-0633-09 ENST00000344731 p.E199D SERPINB4 chr18 63637754 63637754 Missense_Mutation T T A TCGA-29-1764-01A-01W-0633-09 ENST00000341074 p.S380C TSHZ1 chr18 75287385 75287385 Missense_Mutation G G C TCGA-29-1764-01A-01W-0633-09 ENST00000580243 p.E660Q OR7D4 chr19 9214004 9214004 Silent G G A TCGA-29-1764-01A-01W-0633-09 ENST00000308682 p.Y278Y NLRP4 chr19 55858519 55858519 Missense_Mutation G G A TCGA-29-1764-01A-01W-0633-09 ENST00000301295 p.V376I SEL1L2 chr20 13849557 13849557 Silent T T C TCGA-29-1764-01A-01W-0633-09 ENST00000284951 p.P665P RBM39 chr20 35713045 35713045 Missense_Mutation C C G TCGA-29-1764-01A-01W-0633-09 ENST00000253363 p.G383A ZFP64 chr20 52097098 52097098 Nonstop_Mutation A A C TCGA-29-1764-01A-01W-0633-09 ENST00000395979 p.*132Gext*4 ATP5E chr20 59030415 59030415 Missense_Mutation G G A TCGA-29-1764-01A-01W-0633-09 ENST00000243997 p.S16F TRIOBP chr22 37724735 37724735 Missense_Mutation C C T TCGA-29-1764-01A-01W-0633-09 ENST00000406386 p.R727W HCFC1 chrX 153957465 153957465 Silent G G A TCGA-29-1764-01A-01W-0633-09 ENST00000310441 p.T734T HMGCL chr1 23814291 23814291 Missense_Mutation C C G TCGA-36-2543-01A-01D-1526-09 ENST00000374490 p.E132D GRIK3 chr1 36825602 36825602 Splice_Site C C A TCGA-36-2543-01A-01D-1526-09 ENST00000373091 p.X585_splice PTPRF chr1 43604927 43604927 Missense_Mutation C C T TCGA-36-2543-01A-01D-1526-09 ENST00000359947 p.A1021V AMPD2 chr1 109626335 109626335 Missense_Mutation G G T TCGA-36-2543-01A-01D-1526-09 ENST00000256578 p.G201C ATF6 chr1 161819677 161819677 Missense_Mutation A A T TCGA-36-2543-01A-01D-1526-09 ENST00000367942 p.E318D QSOX1 chr1 180194212 180194212 Splice_Site G G C TCGA-36-2543-01A-01D-1526-09 ENST00000367602 p.X430_splice BRINP3 chr1 190098527 190098527 Missense_Mutation G G A TCGA-36-2543-01A-01D-1526-09 ENST00000367462 p.R598W ARID4B chr1 235234481 235234481 Silent A A C TCGA-36-2543-01A-01D-1526-09 ENST00000264183 p.P199P HEATR1 chr1 236588010 236588010 Missense_Mutation C C G TCGA-36-2543-01A-01D-1526-09 ENST00000366582 p.V522L C1orf101 chr1 244591725 244591725 Missense_Mutation T T C TCGA-36-2543-01A-01D-1526-09 ENST00000366534 p.I728T OTOF chr2 26477224 26477224 Missense_Mutation T T A TCGA-36-2543-01A-01D-1526-09 ENST00000272371 p.K824M MDH1 chr2 63597407 63597407 Missense_Mutation G G A TCGA-36-2543-01A-01D-1526-09 ENST00000233114 p.A70T DYSF chr2 71574215 71574215 Silent G G A TCGA-36-2543-01A-01D-1526-09 ENST00000258104 p.A1064A IL1RL1 chr2 102351670 102351670 Missense_Mutation G G A TCGA-36-2543-01A-01D-1526-09 ENST00000233954 p.D474N USP4 chr3 49340003 49340003 Missense_Mutation G G A TCGA-36-2543-01A-01D-1526-09 ENST00000265560 p.R8C RBM6 chr3 49967667 49967667 Missense_Mutation C C T TCGA-36-2543-01A-01D-1526-09 ENST00000266022 p.P81L IQCF2 chr3 51861674 51861674 Missense_Mutation T T C TCGA-36-2543-01A-01D-1526-09 ENST00000333127 p.V3A SLC9C1 chr3 112208248 112208248 Missense_Mutation A A T TCGA-36-2543-01A-01D-1526-09 ENST00000305815 p.I639N EEFSEC chr3 128408153 128408155 In_Frame_Del AGG AGG - TCGA-36-2543-01A-01D-1526-09 ENST00000254730 p.E564del CORIN chr4 47603592 47603592 Missense_Mutation G G A TCGA-36-2543-01A-01D-1526-09 ENST00000273857 p.R873C GYPA chr4 144116929 144116929 Silent G G C TCGA-36-2543-01A-01D-1526-09 ENST00000360771 p.L94L GCNT4 chr5 75029757 75029757 Missense_Mutation T T C TCGA-36-2543-01A-01D-1526-09 ENST00000322348 p.D94G CCDC112 chr5 115271384 115271384 Silent A A G TCGA-36-2543-01A-01D-1526-09 ENST00000395557 p.H304H ADAMTS19 chr5 129737115 129737115 Missense_Mutation G G A TCGA-36-2543-01A-01D-1526-09 ENST00000274487 p.R1174Q BLOC1S5-TXNDC5 chr6 7987288 7987288 Intron C C T TCGA-36-2543-01A-01D-1526-09 ENST00000539054 GCNT2 chr6 10586223 10586223 Intron G G A TCGA-36-2543-01A-01D-1526-09 ENST00000379597 LTA chr6 31573375 31573375 Silent G G C TCGA-36-2543-01A-01D-1526-09 ENST00000454783 p.L100L MAPK14 chr6 36107509 36107509 Missense_Mutation C C T TCGA-36-2543-01A-01D-1526-09 ENST00000229794 p.A299V TREM1 chr6 41276105 41276105 3'UTR A A C TCGA-36-2543-01A-01D-1526-09 ENST00000244709 GPR6 chr6 109979397 109979397 Silent G G A TCGA-36-2543-01A-01D-1526-09 ENST00000275169 p.A95A PAPOLB chr7 4861060 4861060 Missense_Mutation C C T TCGA-36-2543-01A-01D-1526-09 ENST00000404991 p.A251T FKBP14 chr7 30014776 30014776 Missense_Mutation T T C TCGA-36-2543-01A-01D-1526-09 ENST00000222803 p.I199V SAMD9L chr7 93134182 93134182 Missense_Mutation C C G TCGA-36-2543-01A-01D-1526-09 ENST00000318238 p.R597T COG5 chr7 107564004 107564004 5'UTR C C G TCGA-36-2543-01A-01D-1526-09 ENST00000347053 LYN chr8 55953986 55953986 Splice_Site T T G TCGA-36-2543-01A-01D-1526-09 ENST00000519728 p.X264_splice SDR16C5 chr8 56316240 56316240 Missense_Mutation C C A TCGA-36-2543-01A-01D-1526-09 ENST00000303749 p.K36N PREX2 chr8 68231478 68231478 3'UTR T T - TCGA-36-2543-01A-01D-1526-09 ENST00000288368 UBR5 chr8 102305223 102305223 Missense_Mutation G G T TCGA-36-2543-01A-01D-1526-09 ENST00000520539 p.Q897K RP11-1082L8.1 chr8 124922072 124922072 RNA C C G TCGA-36-2543-01A-01D-1526-09 ENST00000514059 TMEM71 chr8 132722101 132722101 Missense_Mutation G G C TCGA-36-2543-01A-01D-1526-09 ENST00000356838 p.Q212E JRK chr8 142666337 142666337 5'UTR A A G TCGA-36-2543-01A-01D-1526-09 ENST00000612905 FOXD4 chr9 117579 117579 Missense_Mutation C C A TCGA-36-2543-01A-01D-1526-09 ENST00000382500 p.D181Y TESK1 chr9 35609521 35609521 Missense_Mutation C C A TCGA-36-2543-01A-01D-1526-09 ENST00000336395 p.P554T CNTNAP3 chr9 39109168 39109168 Missense_Mutation C C T TCGA-36-2543-01A-01D-1526-09 ENST00000297668 p.R786H TRPM6 chr9 74776018 74776018 Missense_Mutation G G A TCGA-36-2543-01A-01D-1526-09 ENST00000360774 p.R1090C ZNF438 chr10 30850011 30850011 Missense_Mutation C C G TCGA-36-2543-01A-01D-1526-09 ENST00000361310 p.A132P RET chr10 43105068 43105068 Missense_Mutation G G A TCGA-36-2543-01A-01D-1526-09 ENST00000355710 p.G248S SBF2 chr11 9781591 9781591 Missense_Mutation A A C TCGA-36-2543-01A-01D-1526-09 ENST00000256190 p.I1789M OR5J2 chr11 56177363 56177363 Missense_Mutation C C G TCGA-36-2543-01A-01D-1526-09 ENST00000312298 p.T249S MTA2 chr11 62598360 62598360 Missense_Mutation C C G TCGA-36-2543-01A-01D-1526-09 ENST00000278823 p.E113D NUDT22 chr11 64226899 64226899 Missense_Mutation G G A TCGA-36-2543-01A-01D-1526-09 ENST00000279206 p.G83S EHD1 chr11 64860098 64860098 Silent G G A TCGA-36-2543-01A-01D-1526-09 ENST00000320631 p.P247P DSCAML1 chr11 117431629 117431629 Missense_Mutation C C T TCGA-36-2543-01A-01D-1526-09 ENST00000321322 p.R1820H TBCEL chr11 121047624 121047624 Missense_Mutation C C T TCGA-36-2543-01A-01D-1526-09 ENST00000422003 p.S77L CNTN1 chr12 40922421 40922421 Silent C C T TCGA-36-2543-01A-01D-1526-09 ENST00000347616 p.S131S COX14 chr12 50120212 50120212 Missense_Mutation A A T TCGA-36-2543-01A-01D-1526-09 ENST00000317943 p.M57L KRT79 chr12 52830241 52830241 Silent C C G TCGA-36-2543-01A-01D-1526-09 ENST00000330553 p.V250V PAK6 chr15 40266288 40266288 Missense_Mutation G G A TCGA-36-2543-01A-01D-1526-09 ENST00000260404 p.M217I SETD1A chr16 30964128 30964128 Missense_Mutation C C G TCGA-36-2543-01A-01D-1526-09 ENST00000262519 p.A225G MYLK3 chr16 46727173 46727173 Intron G G A TCGA-36-2543-01A-01D-1526-09 ENST00000394809 TP53 chr17 7673835 7673835 Missense_Mutation C C A TCGA-36-2543-01A-01D-1526-09 ENST00000269305 p.G262V SMCR8 chr17 18316395 18316395 Missense_Mutation G G C TCGA-36-2543-01A-01D-1526-09 ENST00000406438 p.L202F NF1 chr17 31338092 31338092 Nonsense_Mutation C C T TCGA-36-2543-01A-01D-1526-09 ENST00000358273 p.R2258* AC015849.16 chr17 35909328 35909328 RNA G G T TCGA-36-2543-01A-01D-1526-09 ENST00000604907 AC015849.16 chr17 35909640 35909640 RNA G G T TCGA-36-2543-01A-01D-1526-09 ENST00000604907 PRKCA chr17 66786881 66786881 Silent T T G TCGA-36-2543-01A-01D-1526-09 ENST00000413366 p.G540G KDM4B chr19 5039886 5039886 Silent C C T TCGA-36-2543-01A-01D-1526-09 ENST00000159111 p.D64D FARSA chr19 12924258 12924258 Silent C C T TCGA-36-2543-01A-01D-1526-09 ENST00000314606 p.K427K HKR1 chr19 37362969 37362969 Missense_Mutation C C G TCGA-36-2543-01A-01D-1526-09 ENST00000324411 p.R392G YIF1B chr19 38309615 38309615 Missense_Mutation C C G TCGA-36-2543-01A-01D-1526-09 ENST00000339413 p.Q29H FCGBP chr19 39927944 39927944 Missense_Mutation C C T TCGA-36-2543-01A-01D-1526-09 ENST00000616721 p.G140S NPAS1 chr19 47039133 47039133 Silent C C G TCGA-36-2543-01A-01D-1526-09 ENST00000449844 p.V262V SPACA6P-AS chr19 51692902 51692902 RNA C C G TCGA-36-2543-01A-01D-1526-09 ENST00000602324 ZNF841 chr19 52066472 52066472 Silent T T C TCGA-36-2543-01A-01D-1526-09 ENST00000426391 p.S354S ADRM1 chr20 62308060 62308060 Missense_Mutation C C T TCGA-36-2543-01A-01D-1526-09 ENST00000253003 p.P299L MID2 chrX 107841353 107841353 Missense_Mutation G G A TCGA-36-2543-01A-01D-1526-09 ENST00000262843 p.A230T ADGRG4 chrX 136346472 136346472 Missense_Mutation T T G TCGA-36-2543-01A-01D-1526-09 ENST00000370652 p.S922R AFF2 chrX 148885934 148885934 Silent T T C TCGA-36-2543-01A-01D-1526-09 ENST00000370460 p.L436L PCSK9 chr1 55052689 55052689 Missense_Mutation G G C TCGA-61-1725-01A-01W-0639-09 ENST00000302118 p.V233L CTH chr1 70411290 70411290 5'UTR C C T TCGA-61-1725-01A-01W-0639-09 ENST00000370938 GBP1 chr1 89053183 89053183 3'UTR T T - TCGA-61-1725-01A-01W-0639-09 ENST00000370473 LAMTOR5 chr1 110407715 110407715 5'Flank C C G TCGA-61-1725-01A-01W-0639-09 ENST00000602318 ZBTB37 chr1 173870377 173870377 Missense_Mutation C C A TCGA-61-1725-01A-01W-0639-09 ENST00000367701 p.A51D HMCN1 chr1 186018174 186018187 Splice_Site TTTCTATAGGTGGC TTTCTATAGGTGGC - TCGA-61-1725-01A-01W-0639-09 ENST00000271588 p.X1767_splice HMCN1 chr1 186037940 186037940 Missense_Mutation C C G TCGA-61-1725-01A-01W-0639-09 ENST00000271588 p.P1919R ICOS chr2 203957860 203957860 Missense_Mutation C C G TCGA-61-1725-01A-01W-0639-09 ENST00000316386 p.T188R ABCA12 chr2 215001001 215001001 Silent A A T TCGA-61-1725-01A-01W-0639-09 ENST00000272895 p.P961P SP100 chr2 230449592 230449592 Missense_Mutation G G C TCGA-61-1725-01A-01W-0639-09 ENST00000264052 p.E206D ABHD10 chr3 111986998 111986998 Missense_Mutation G G T TCGA-61-1725-01A-01W-0639-09 ENST00000273359 p.V175L CCDC80 chr3 112638240 112638240 Missense_Mutation T T A TCGA-61-1725-01A-01W-0639-09 ENST00000206423 p.N556Y KIAA1407 chr3 113978859 113978859 Missense_Mutation T T G TCGA-61-1725-01A-01W-0639-09 ENST00000295878 p.Q820P PLXND1 chr3 129584433 129584433 Missense_Mutation A A G TCGA-61-1725-01A-01W-0639-09 ENST00000324093 p.C661R PLXND1 chr3 129584434 129584434 Nonsense_Mutation G G T TCGA-61-1725-01A-01W-0639-09 ENST00000324093 p.Y660* TMCC1 chr3 129651640 129651640 Missense_Mutation C C G TCGA-61-1725-01A-01W-0639-09 ENST00000393238 p.L601F GPR160 chr3 170084607 170084607 Missense_Mutation G G C TCGA-61-1725-01A-01W-0639-09 ENST00000355897 p.R212T CENPE chr4 103182857 103182857 Nonsense_Mutation G G A TCGA-61-1725-01A-01W-0639-09 ENST00000265148 p.R290* FASTKD3 chr5 7866899 7866899 Silent A A C TCGA-61-1725-01A-01W-0639-09 ENST00000264669 p.T395T RAD17 chr5 69386217 69386217 Missense_Mutation A A T TCGA-61-1725-01A-01W-0639-09 ENST00000380774 p.I257L MEGF10 chr5 127435417 127435417 Missense_Mutation A A G TCGA-61-1725-01A-01W-0639-09 ENST00000274473 p.N678D ANKHD1-EIF4EBP3 chr5 140529462 140529462 Silent C C T TCGA-61-1725-01A-01W-0639-09 ENST00000532219 p.G2172G PCDHB7 chr5 141173529 141173529 Missense_Mutation G G T TCGA-61-1725-01A-01W-0639-09 ENST00000231137 p.V232F PCDHGA3 chr5 141344325 141344325 Missense_Mutation C C G TCGA-61-1725-01A-01W-0639-09 ENST00000253812 p.Q98E PCDH1 chr5 141863666 141863666 Missense_Mutation C C G TCGA-61-1725-01A-01W-0639-09 ENST00000394536 p.G889R CCDC69 chr5 151184421 151184421 Silent C C T TCGA-61-1725-01A-01W-0639-09 ENST00000355417 p.L212L FAT2 chr5 151545081 151545081 Nonsense_Mutation G G A TCGA-61-1725-01A-01W-0639-09 ENST00000261800 p.Q2016* FAM153A chr5 177724362 177724363 Splice_Site TC TC - TCGA-61-1725-01A-01W-0639-09 ENST00000360669 p.X258_splice PHIP chr6 78941188 78941188 Silent C C T TCGA-61-1725-01A-01W-0639-09 ENST00000275034 p.K1657K SEMA3D chr7 85121749 85121750 Frame_Shift_Del GT GT - TCGA-61-1725-01A-01W-0639-09 ENST00000284136 p.T48Lfs*9 SEMA3D chr7 85121753 85121754 Frame_Shift_Del GC GC - TCGA-61-1725-01A-01W-0639-09 ENST00000284136 p.K46Nfs*11 FBXO24 chr7 100592972 100592972 Missense_Mutation G G A TCGA-61-1725-01A-01W-0639-09 ENST00000241071 p.V250M PLXNA4 chr7 132180703 132180703 Silent C C T TCGA-61-1725-01A-01W-0639-09 ENST00000321063 p.G1174G ZC3HAV1 chr7 139089730 139089730 Missense_Mutation A A G TCGA-61-1725-01A-01W-0639-09 ENST00000242351 p.L113P ST18 chr8 52159035 52159035 Missense_Mutation G G A TCGA-61-1725-01A-01W-0639-09 ENST00000276480 p.R557C TMEM55A chr8 90995815 90995815 Silent G G T TCGA-61-1725-01A-01W-0639-09 ENST00000285419 p.G212G ALDH1B1 chr9 38396590 38396590 Missense_Mutation G G A TCGA-61-1725-01A-01W-0639-09 ENST00000377698 p.R281K AGTPBP1 chr9 85575452 85575452 Silent T T C TCGA-61-1725-01A-01W-0639-09 ENST00000357081 p.E1122E AGTPBP1 chr9 85575453 85575453 Missense_Mutation T T C TCGA-61-1725-01A-01W-0639-09 ENST00000357081 p.E1122G AIFM2 chr10 70114144 70114164 3'UTR CCTGCTGCGGTAGTTCTCCCG CCTGCTGCGGTAGTTCTCCCG - TCGA-61-1725-01A-01W-0639-09 ENST00000307864 PSAP chr10 71818718 71818718 Missense_Mutation C C T TCGA-61-1725-01A-01W-0639-09 ENST00000394936 p.G480R RP11-113D6.10 chr11 18210242 18210242 RNA T T - TCGA-61-1725-01A-01W-0639-09 ENST00000527059 PHF21A chr11 45971088 45971088 Intron C C A TCGA-61-1725-01A-01W-0639-09 ENST00000418153 FOLR3 chr11 72139779 72139779 Missense_Mutation A A G TCGA-61-1725-01A-01W-0639-09 ENST00000611028 p.Y229C DYNC2H1 chr11 103155343 103155343 Missense_Mutation A A C TCGA-61-1725-01A-01W-0639-09 ENST00000375735 p.I1196L FXYD6 chr11 117840018 117840018 Intron C C G TCGA-61-1725-01A-01W-0639-09 ENST00000260282 NOP2 chr12 6561760 6561760 Missense_Mutation C C A TCGA-61-1725-01A-01W-0639-09 ENST00000322166 p.A371S EPS8 chr12 15654212 15654212 Missense_Mutation T T G TCGA-61-1725-01A-01W-0639-09 ENST00000281172 p.N395H C12orf40 chr12 39683030 39683030 Missense_Mutation A A C TCGA-61-1725-01A-01W-0639-09 ENST00000324616 p.E369A PCED1B chr12 47235209 47235209 Missense_Mutation G G C TCGA-61-1725-01A-01W-0639-09 ENST00000432328 p.R49T KNTC1 chr12 122577764 122577789 Frame_Shift_Del ACAAGAAGAGCCAGATCATTCTAAAG ACAAGAAGAGCCAGATCATTCTAAAG - TCGA-61-1725-01A-01W-0639-09 ENST00000333479 p.Q939Gfs*17 SLAIN1 chr13 77761035 77761035 Missense_Mutation G G T TCGA-61-1725-01A-01W-0639-09 ENST00000466548 p.S519I RABGGTA chr14 24270028 24270028 Missense_Mutation C C T TCGA-61-1725-01A-01W-0639-09 ENST00000216840 p.G118S PPP2R5E chr14 63453809 63453809 Missense_Mutation G G T TCGA-61-1725-01A-01W-0639-09 ENST00000337537 p.D78E APBA2 chr15 29054054 29054054 Missense_Mutation C C T TCGA-61-1725-01A-01W-0639-09 ENST00000558259 p.A57V TCF12 chr15 57262150 57262150 Silent T T C TCGA-61-1725-01A-01W-0639-09 ENST00000267811 p.S484S GLCE chr15 69269026 69269026 Missense_Mutation A A C TCGA-61-1725-01A-01W-0639-09 ENST00000261858 p.K546Q GNPTG chr16 1362860 1362860 Silent G G T TCGA-61-1725-01A-01W-0639-09 ENST00000204679 p.L259L USP7 chr16 8905259 8905259 Missense_Mutation G G A TCGA-61-1725-01A-01W-0639-09 ENST00000344836 p.H501Y GDPD3 chr16 30111393 30111393 Missense_Mutation G G C TCGA-61-1725-01A-01W-0639-09 ENST00000406256 p.I234M RPGRIP1L chr16 53649063 53649063 Missense_Mutation T T G TCGA-61-1725-01A-01W-0639-09 ENST00000379925 p.L735F TP53 chr17 7674242 7674242 Missense_Mutation A A C TCGA-61-1725-01A-01W-0639-09 ENST00000269305 p.S241A TVP23B chr17 18804152 18804152 Missense_Mutation G G A TCGA-61-1725-01A-01W-0639-09 ENST00000307767 p.M159I NF1 chr17 31206365 31206365 Frame_Shift_Del G G - TCGA-61-1725-01A-01W-0639-09 ENST00000358273 p.A463Hfs*10 JAK3 chr19 17831343 17831343 Missense_Mutation T T A TCGA-61-1725-01A-01W-0639-09 ENST00000458235 p.I955F ZNF613 chr19 51945660 51945660 Missense_Mutation G G A TCGA-61-1725-01A-01W-0639-09 ENST00000293471 p.E593K FAM47A chrX 34130781 34130781 Missense_Mutation G G A TCGA-61-1725-01A-01W-0639-09 ENST00000346193 p.R500W ATRX chrX 77508202 77508202 3'UTR A A - TCGA-61-1725-01A-01W-0639-09 ENST00000373344 VDAC1P1 chrX 80930070 80930070 RNA C C T TCGA-61-1725-01A-01W-0639-09 ENST00000439229 BRDTP1 chrX 96337560 96337560 RNA T T C TCGA-61-1725-01A-01W-0639-09 ENST00000605735 SYTL4 chrX 100686962 100686962 Intron C C G TCGA-61-1725-01A-01W-0639-09 ENST00000263033 AJAP1 chr1 4711988 4711988 Missense_Mutation G G A TCGA-25-2409-01A-01W-0799-08 ENST00000378190 p.A40T PTPRF chr1 43598600 43598601 Intron TG TG - TCGA-25-2409-01A-01W-0799-08 ENST00000359947 TPO chr2 1484628 1484628 Silent C C T TCGA-25-2409-01A-01W-0799-08 ENST00000329066 p.I457I SDC1 chr2 20203980 20203980 Missense_Mutation G G A TCGA-25-2409-01A-01W-0799-08 ENST00000254351 p.H154Y APOB chr2 21003083 21003107 Frame_Shift_Del CTCAGCATTGTTCTGCAGATTTCTT CTCAGCATTGTTCTGCAGATTTCTT - TCGA-25-2409-01A-01W-0799-08 ENST00000233242 p.R4105Sfs*16 PTCD3 chr2 86125007 86125007 Silent C C T TCGA-25-2409-01A-01W-0799-08 ENST00000254630 p.N243N TTN chr2 178739544 178739544 Silent G G A TCGA-25-2409-01A-01W-0799-08 ENST00000591111 p.D4246D SGOL2 chr2 200572915 200572915 Missense_Mutation C C G TCGA-25-2409-01A-01W-0799-08 ENST00000357799 p.Q857E IQCA1 chr2 236486879 236486879 Missense_Mutation G G A TCGA-25-2409-01A-01W-0799-08 ENST00000409907 p.R224C SCN5A chr3 38585749 38585749 Missense_Mutation G G A TCGA-25-2409-01A-01W-0799-08 ENST00000333535 p.S910L SH3D19 chr4 151127704 151127704 Missense_Mutation T T G TCGA-25-2409-01A-01W-0799-08 ENST00000304527 p.S724R THBS2 chr6 169250732 169250732 Splice_Site C C T TCGA-25-2409-01A-01W-0799-08 ENST00000366787 p.X18_splice GPR141 chr7 37741307 37741307 Missense_Mutation G G A TCGA-25-2409-01A-01W-0799-08 ENST00000334425 p.R305H SLC25A40 chr7 87858741 87858741 5'UTR T T A TCGA-25-2409-01A-01W-0799-08 ENST00000341119 GIMAP1 chr7 150720529 150720529 Silent C C T TCGA-25-2409-01A-01W-0799-08 ENST00000307194 p.R175R PCM1 chr8 18014603 18014603 Silent T C C TCGA-25-2409-01A-01W-0799-08 ENST00000325083 p.P1868P VPS13B chr8 99854230 99854230 Missense_Mutation A A G TCGA-25-2409-01A-01W-0799-08 ENST00000358544 p.Y3639C DEPTOR chr8 119873953 119873953 Missense_Mutation C C G TCGA-25-2409-01A-01W-0799-08 ENST00000286234 p.T36S S1PR3 chr9 89001618 89001618 Missense_Mutation A A G TCGA-25-2409-01A-01W-0799-08 ENST00000358157 p.M140V HABP4 chr9 96458446 96458446 Missense_Mutation G G A TCGA-25-2409-01A-01W-0799-08 ENST00000375249 p.M139I OR1L1 chr9 122661964 122661964 Silent G G A TCGA-25-2409-01A-01W-0799-08 ENST00000373686 p.V133V ENG chr9 127825295 127825295 Missense_Mutation A A G TCGA-25-2409-01A-01W-0799-08 ENST00000373203 p.L251P MAPK8IP1 chr11 45904120 45904120 Missense_Mutation A A G TCGA-25-2409-01A-01W-0799-08 ENST00000241014 p.Y542C MBD6 chr12 57526012 57526012 Silent C G G TCGA-25-2409-01A-01W-0799-08 ENST00000355673 p.A348A PCCA chr13 100262815 100262815 Missense_Mutation G G A TCGA-25-2409-01A-01W-0799-08 ENST00000376285 p.R268H OR4N2 chr14 19827761 19827761 Missense_Mutation C C T TCGA-25-2409-01A-01W-0799-08 ENST00000315947 p.H105Y MYH7 chr14 23426018 23426018 Missense_Mutation C C T TCGA-25-2409-01A-01W-0799-08 ENST00000355349 p.R703H LRFN5 chr14 41886808 41886808 Missense_Mutation T T A TCGA-25-2409-01A-01W-0799-08 ENST00000298119 p.N61K HERC2P2 chr15 22539177 22539177 RNA G G A TCGA-25-2409-01A-01W-0799-08 ENST00000619021 CLCN7 chr16 1455138 1455138 Missense_Mutation G G A TCGA-25-2409-01A-01W-0799-08 ENST00000382745 p.S365L DNAJA3 chr16 4441519 4441519 Missense_Mutation G G A TCGA-25-2409-01A-01W-0799-08 ENST00000262375 p.E192K SLC16A13 chr17 7039903 7039903 Missense_Mutation G G T TCGA-25-2409-01A-01W-0799-08 ENST00000308027 p.V408L TP53 chr17 7674221 7674221 Missense_Mutation G G A TCGA-25-2409-01A-01W-0799-08 ENST00000269305 p.R248W ENDOV chr17 80436206 80436206 3'UTR C C T TCGA-25-2409-01A-01W-0799-08 ENST00000518137 ARHGEF18 chr19 7442003 7442003 Silent C C T TCGA-25-2409-01A-01W-0799-08 ENST00000359920 p.Y249Y ZNF324B chr19 58454310 58454310 Silent C C T TCGA-25-2409-01A-01W-0799-08 ENST00000336614 p.T68T IGSF3 chr1 116579791 116579791 Missense_Mutation G G A TCGA-29-1771-01A-01W-0633-09 ENST00000369486 p.R979C TTC7A chr2 47060868 47060868 Missense_Mutation G G A TCGA-29-1771-01A-01W-0633-09 ENST00000319190 p.R751Q RAPH1 chr2 203439837 203439837 Missense_Mutation T T G TCGA-29-1771-01A-01W-0633-09 ENST00000319170 p.K1118T RAPH1 chr2 203439838 203439838 Missense_Mutation T T C TCGA-29-1771-01A-01W-0633-09 ENST00000319170 p.K1118E ADCY2 chr5 7626188 7626188 Missense_Mutation T T A TCGA-29-1771-01A-01W-0633-09 ENST00000338316 p.F198I HIST1H2BL chr6 27807779 27807779 Frame_Shift_Del T T - TCGA-29-1771-01A-01W-0633-09 ENST00000377401 p.Y43Sfs*4 PDE10A chr6 165332942 165332943 3'UTR - - C TCGA-29-1771-01A-01W-0633-09 ENST00000366882 ZFHX4 chr8 76851193 76851193 Silent G G A TCGA-29-1771-01A-01W-0633-09 ENST00000521891 p.A1424A FBXW4 chr10 101611750 101611750 Missense_Mutation C C T TCGA-29-1771-01A-01W-0633-09 ENST00000331272 p.E333K MYO7A chr11 77156991 77156991 Missense_Mutation G G A TCGA-29-1771-01A-01W-0633-09 ENST00000409709 p.R241H KMT2A chr11 118505860 118505860 Missense_Mutation G G A TCGA-29-1771-01A-01W-0633-09 ENST00000389506 p.S3320N TBC1D4 chr13 75310016 75310016 Missense_Mutation C C T TCGA-29-1771-01A-01W-0633-09 ENST00000377636 p.R840K EMP2 chr16 10532760 10532761 3'UTR - - TTTC TCGA-29-1771-01A-01W-0633-09 ENST00000359543 SALL1 chr16 51139311 51139311 Missense_Mutation C C T TCGA-29-1771-01A-01W-0633-09 ENST00000251020 p.D971N MON1B chr16 77194959 77194959 Missense_Mutation G G A TCGA-29-1771-01A-01W-0633-09 ENST00000248248 p.R367Q TP53 chr17 7675082 7675082 Missense_Mutation G G C TCGA-29-1771-01A-01W-0633-09 ENST00000269305 p.P177R NF1 chr17 31259032 31259036 Frame_Shift_Del ATACT - - TCGA-29-1771-01A-01W-0633-09 ENST00000358273 p.I1445Sfs*20 KMT2B chr19 35727613 35727613 Silent C C G TCGA-29-1771-01A-01W-0633-09 ENST00000420124 p.L1431L BIK chr22 43124068 43124068 Missense_Mutation C C T TCGA-29-1771-01A-01W-0633-09 ENST00000216115 p.L16F FRMPD4 chrX 12498678 12498678 Splice_Site A A T TCGA-29-1771-01A-01W-0633-09 ENST00000380682 p.X14_splice CAMTA1 chr1 7663496 7663496 Missense_Mutation C C G TCGA-25-1329-01A-01W-0492-08 ENST00000303635 p.H317D MTOR chr1 11259289 11259289 Missense_Mutation C C A TCGA-25-1329-01A-01W-0492-08 ENST00000361445 p.A41S ZRANB2 chr1 71066804 71066804 Nonsense_Mutation T T A TCGA-25-1329-01A-01W-0492-08 ENST00000370920 p.R301* WDR63 chr1 85073085 85073085 Missense_Mutation G G C TCGA-25-1329-01A-01W-0492-08 ENST00000294664 p.E32D PHGDH chr1 119741861 119741861 Silent G G A TCGA-25-1329-01A-01W-0492-08 ENST00000369409 p.V391V KCNS3 chr2 17931511 17931511 Missense_Mutation G G A TCGA-25-1329-01A-01W-0492-08 ENST00000304101 p.R168Q TTN chr2 178733461 178733461 Missense_Mutation C C T TCGA-25-1329-01A-01W-0492-08 ENST00000591111 p.A4961T TTN chr2 178776817 178776817 Nonsense_Mutation G G A TCGA-25-1329-01A-01W-0492-08 ENST00000591111 p.R1683* FSIP2 chr2 185807821 185807821 Missense_Mutation A A T TCGA-25-1329-01A-01W-0492-08 ENST00000424728 p.D6172V OSBPL11 chr3 125547449 125547449 Missense_Mutation T T C TCGA-25-1329-01A-01W-0492-08 ENST00000296220 p.I600V EPHB1 chr3 135132732 135132732 Missense_Mutation G G A TCGA-25-1329-01A-01W-0492-08 ENST00000398015 p.R327H KIAA1109 chr4 122324479 122324479 Missense_Mutation G G A TCGA-25-1329-01A-01W-0492-08 ENST00000264501 p.R3616Q MFAP3L chr4 169992251 169992251 Missense_Mutation G G T TCGA-25-1329-01A-01W-0492-08 ENST00000361618 p.D119E SLC6A18 chr5 1232245 1232245 Missense_Mutation G G A TCGA-25-1329-01A-01W-0492-08 ENST00000324642 p.A63T ZNF622 chr5 16465723 16465723 5'UTR C C A TCGA-25-1329-01A-01W-0492-08 ENST00000308683 PRDM9 chr5 23526236 23526236 Missense_Mutation C C G TCGA-25-1329-01A-01W-0492-08 ENST00000296682 p.P383R CRHBP chr5 76953098 76953098 5'UTR C C T TCGA-25-1329-01A-01W-0492-08 ENST00000274368 BTN3A1 chr6 26413723 26413723 3'UTR C C T TCGA-25-1329-01A-01W-0492-08 ENST00000289361 ZFP57 chr6 29672827 29672827 Silent G G A TCGA-25-1329-01A-01W-0492-08 ENST00000376881 p.V344V VWA7 chr6 31766313 31766313 Silent C C T TCGA-25-1329-01A-01W-0492-08 ENST00000375688 p.S752S CENPQ chr6 49481003 49481003 Missense_Mutation T T G TCGA-25-1329-01A-01W-0492-08 ENST00000335783 p.L134V TBX18 chr6 84748054 84748054 Nonsense_Mutation G G A TCGA-25-1329-01A-01W-0492-08 ENST00000369663 p.R269* CHN2 chr7 29507255 29507255 Missense_Mutation A A T TCGA-25-1329-01A-01W-0492-08 ENST00000222792 p.N340I RSBN1L chr7 77696483 77696483 Missense_Mutation C C T TCGA-25-1329-01A-01W-0492-08 ENST00000334955 p.P5L TRBV4-2 chr7 142345558 142345558 Silent G G A TCGA-25-1329-01A-01W-0492-08 ENST00000390392 p.A9A TNFRSF10A chr8 23202725 23202725 Missense_Mutation C C T TCGA-25-1329-01A-01W-0492-08 ENST00000221132 p.R147Q ZNF7 chr8 144842181 144842181 Silent G G A TCGA-25-1329-01A-01W-0492-08 ENST00000528372 p.G358G SLC25A51 chr9 37888382 37888382 Nonsense_Mutation G G A TCGA-25-1329-01A-01W-0492-08 ENST00000242275 p.R57* PRPF4 chr9 113291554 113291554 Missense_Mutation T T A TCGA-25-1329-01A-01W-0492-08 ENST00000374198 p.L488Q COL5A1 chr9 134824650 134824650 Silent G G A TCGA-25-1329-01A-01W-0492-08 ENST00000371817 p.T1583T ITGB1 chr10 32920305 32920305 Silent G G A TCGA-25-1329-01A-01W-0492-08 ENST00000302278 p.N403N MRGPRE chr11 3228760 3228760 Missense_Mutation C C T TCGA-25-1329-01A-01W-0492-08 ENST00000389832 p.A14T OR5F1 chr11 55994567 55994567 Missense_Mutation G G A TCGA-25-1329-01A-01W-0492-08 ENST00000278409 p.T20M STIP1 chr11 64204060 64204060 Missense_Mutation A A T TCGA-25-1329-01A-01W-0492-08 ENST00000305218 p.L522F GRIK4 chr11 120905439 120905439 Silent C C T TCGA-25-1329-01A-01W-0492-08 ENST00000438375 p.G474G NINJ2 chr12 565398 565398 Missense_Mutation C C T TCGA-25-1329-01A-01W-0492-08 ENST00000305108 p.R135Q CD163L1 chr12 7379038 7379038 Nonsense_Mutation G G A TCGA-25-1329-01A-01W-0492-08 ENST00000313599 p.R771* DTX3 chr12 57609161 57609161 3'UTR G G A TCGA-25-1329-01A-01W-0492-08 ENST00000337737 LEMD3 chr12 65169736 65169736 Missense_Mutation G G A TCGA-25-1329-01A-01W-0492-08 ENST00000308330 p.R47Q GLIPR1L2 chr12 75422951 75422951 Missense_Mutation G G A TCGA-25-1329-01A-01W-0492-08 ENST00000550916 p.R211Q TMEM132D chr12 129074504 129074504 Nonsense_Mutation G G A TCGA-25-1329-01A-01W-0492-08 ENST00000422113 p.Q891* PROSER1 chr13 39013253 39013253 Missense_Mutation T T C TCGA-25-1329-01A-01W-0492-08 ENST00000352251 p.S667G ANGEL1 chr14 76809349 76809349 Missense_Mutation G G A TCGA-25-1329-01A-01W-0492-08 ENST00000251089 p.A120V SERPINA12 chr14 94487443 94487443 Missense_Mutation C C T TCGA-25-1329-01A-01W-0492-08 ENST00000341228 p.A369T DIO3 chr14 101561960 101561960 Missense_Mutation C C T TCGA-25-1329-01A-01W-0492-08 ENST00000510508 p.A155V SRL chr16 4204546 4204546 Silent G G A TCGA-25-1329-01A-01W-0492-08 ENST00000399609 p.S50S TP53 chr17 7676229 7676229 Frame_Shift_Del G G - TCGA-25-1329-01A-01W-0492-08 ENST00000269305 p.P47Rfs*76 TOP2A chr17 40412947 40412947 Missense_Mutation C C A TCGA-25-1329-01A-01W-0492-08 ENST00000423485 p.A201S MIB1 chr18 21815703 21815703 Missense_Mutation T T G TCGA-25-1329-01A-01W-0492-08 ENST00000261537 p.L523V MBD1 chr18 50274216 50274217 Frame_Shift_Del AC AC - TCGA-25-1329-01A-01W-0492-08 ENST00000269468 p.C372Sfs*22 HMHA1 chr19 1084345 1084345 Missense_Mutation A A T TCGA-25-1329-01A-01W-0492-08 ENST00000313093 p.R1021S PTPRS chr19 5220050 5220050 Silent G G T TCGA-25-1329-01A-01W-0492-08 ENST00000357368 p.P1218P ZNF358 chr19 7519630 7519631 Frame_Shift_Ins - - C TCGA-25-1329-01A-01W-0492-08 ENST00000394341 p.Q132Pfs*267 MYO1F chr19 8551774 8551774 Missense_Mutation C C G TCGA-25-1329-01A-01W-0492-08 ENST00000338257 p.G246A CEACAM18 chr19 51480564 51480565 Frame_Shift_Del AC AC - TCGA-25-1329-01A-01W-0492-08 ENST00000396477 p.N95Kfs*14 KIR3DL3 chr19 54727671 54727671 Missense_Mutation C C T TCGA-25-1329-01A-01W-0492-08 ENST00000291860 p.T139M ATP9A chr20 51607560 51607560 Missense_Mutation A A C TCGA-25-1329-01A-01W-0492-08 ENST00000338821 p.F924V TSIX chrX 73822498 73822498 RNA T C C TCGA-25-1329-01A-01W-0492-08 ENST00000604411 PARS2 chr1 54757907 54757907 Nonsense_Mutation C C A TCGA-24-1427-01A-01W-0549-09 ENST00000371279 p.G419* HSD3BP2 chr1 119445796 119445796 RNA G G A TCGA-24-1427-01A-01W-0549-09 ENST00000457615 THEM5 chr1 151851147 151851147 Nonsense_Mutation C C A TCGA-24-1427-01A-01W-0549-09 ENST00000368817 p.G124* NES chr1 156670758 156670758 Missense_Mutation G G T TCGA-24-1427-01A-01W-0549-09 ENST00000368223 p.L1144I OR10K1 chr1 158466004 158466004 Missense_Mutation C C A TCGA-24-1427-01A-01W-0549-09 ENST00000289451 p.A148D SYT2 chr1 202599290 202599290 Silent G G T TCGA-24-1427-01A-01W-0549-09 ENST00000367267 p.T327T LGALS8 chr1 236537561 236537561 Missense_Mutation G G A TCGA-24-1427-01A-01W-0549-09 ENST00000341872 p.G37E RYR2 chr1 237614138 237614138 Missense_Mutation C C G TCGA-24-1427-01A-01W-0549-09 ENST00000366574 p.H1670Q PLB1 chr2 28620978 28620978 Missense_Mutation G G T TCGA-24-1427-01A-01W-0549-09 ENST00000327757 p.R1176M ALK chr2 29717690 29717690 Missense_Mutation G G T TCGA-24-1427-01A-01W-0549-09 ENST00000389048 p.S225R NRXN1 chr2 50497448 50497448 Missense_Mutation G G T TCGA-24-1427-01A-01W-0549-09 ENST00000406316 p.Q922K BMP10 chr2 68866384 68866384 Missense_Mutation T T A TCGA-24-1427-01A-01W-0549-09 ENST00000295379 p.K174N LRRTM1 chr2 80302494 80302494 Silent C C A TCGA-24-1427-01A-01W-0549-09 ENST00000295057 p.V442V MRPL35 chr2 86210713 86210713 3'UTR G G T TCGA-24-1427-01A-01W-0549-09 ENST00000337109 IGKV3D-7 chr2 90235266 90235266 Missense_Mutation G G C TCGA-24-1427-01A-01W-0549-09 ENST00000443397 p.R85S MFSD9 chr2 102719009 102719009 Missense_Mutation T T A TCGA-24-1427-01A-01W-0549-09 ENST00000258436 p.N279I BIN1 chr2 127069998 127069998 Silent G G T TCGA-24-1427-01A-01W-0549-09 ENST00000316724 p.I136I CHRNA1 chr2 174753474 174753474 Intron G G T TCGA-24-1427-01A-01W-0549-09 ENST00000261007 PDE11A chr2 177997984 177997984 Intron C C A TCGA-24-1427-01A-01W-0549-09 ENST00000286063 TTN chr2 178571363 178571363 Missense_Mutation G G T TCGA-24-1427-01A-01W-0549-09 ENST00000591111 p.D23282E SDPR chr2 191846545 191846545 Silent C C T TCGA-24-1427-01A-01W-0549-09 ENST00000304141 p.A127A SATB2 chr2 199272613 199272613 Silent C C T TCGA-24-1427-01A-01W-0549-09 ENST00000260926 p.A600A LSM3 chr3 14198104 14198104 Silent G G T TCGA-24-1427-01A-01W-0549-09 ENST00000306024 p.L99L CLASP2 chr3 33573173 33573173 Missense_Mutation C C A TCGA-24-1427-01A-01W-0549-09 ENST00000480013 p.W667L ARPP21 chr3 35682877 35682877 Silent A A G TCGA-24-1427-01A-01W-0549-09 ENST00000187397 p.R53R SETD2 chr3 47121689 47121689 Nonsense_Mutation C C A TCGA-24-1427-01A-01W-0549-09 ENST00000409792 p.E983* CCDC71 chr3 49163315 49163315 Silent C C T TCGA-24-1427-01A-01W-0549-09 ENST00000321895 p.K298K MYH15 chr3 108486519 108486519 Silent G G C TCGA-24-1427-01A-01W-0549-09 ENST00000273353 p.L313L POLQ chr3 121468315 121468315 Missense_Mutation G G A TCGA-24-1427-01A-01W-0549-09 ENST00000264233 p.P2279S MYLK chr3 123629477 123629477 Missense_Mutation A A G TCGA-24-1427-01A-01W-0549-09 ENST00000360304 p.M1704T TRPC1 chr3 142804016 142804016 Missense_Mutation C C A TCGA-24-1427-01A-01W-0549-09 ENST00000476941 p.F599L TNIK chr3 171101575 171101575 Missense_Mutation G G C TCGA-24-1427-01A-01W-0549-09 ENST00000436636 p.P822R ZDHHC19 chr3 196211207 196211207 Silent G G A TCGA-24-1427-01A-01W-0549-09 ENST00000296326 p.L37L KDR chr4 55114994 55114994 Missense_Mutation C C T TCGA-24-1427-01A-01W-0549-09 ENST00000263923 p.D180N GPRIN3 chr4 89248593 89248593 Missense_Mutation G G T TCGA-24-1427-01A-01W-0549-09 ENST00000333209 p.D506E TRMT10A chr4 99558192 99558192 Missense_Mutation G G A TCGA-24-1427-01A-01W-0549-09 ENST00000273962 p.R69C PCDH10 chr4 133190164 133190164 3'UTR A A G TCGA-24-1427-01A-01W-0549-09 ENST00000264360 ZDHHC11B chr5 730451 730451 Silent C C G TCGA-24-1427-01A-01W-0549-09 ENST00000382776 p.P347P ADCY2 chr5 7802251 7802251 Missense_Mutation G G A TCGA-24-1427-01A-01W-0549-09 ENST00000338316 p.V888I RAI14 chr5 34814576 34814590 Splice_Site TTTTTAGTTGAGTGA TTTTTAGTTGAGTGA - TCGA-24-1427-01A-01W-0549-09 ENST00000265109 p.X285_splice FEM1C chr5 115543180 115543180 Missense_Mutation T T C TCGA-24-1427-01A-01W-0549-09 ENST00000274457 p.H105R SKIV2L chr6 31964081 31964081 Missense_Mutation C C T TCGA-24-1427-01A-01W-0549-09 ENST00000375394 p.R606C TRMT11 chr6 125996025 125996025 Missense_Mutation G G T TCGA-24-1427-01A-01W-0549-09 ENST00000334379 p.R66L FBXO30 chr6 145806139 145806139 Silent G G A TCGA-24-1427-01A-01W-0549-09 ENST00000237281 p.C89C AGAP3 chr7 151117747 151117747 Missense_Mutation G G A TCGA-24-1427-01A-01W-0549-09 ENST00000622464 p.E190K HAS2 chr8 121628743 121628743 Missense_Mutation C C T TCGA-24-1427-01A-01W-0549-09 ENST00000303924 p.A200T DFNB31 chr9 114466368 114466368 Missense_Mutation G G A TCGA-24-1427-01A-01W-0549-09 ENST00000362057 p.R288W BMS1P7 chr10 48050295 48050295 RNA T T C TCGA-24-1427-01A-01W-0549-09 ENST00000602440 CYP2C19 chr10 94775530 94775530 Missense_Mutation A A C TCGA-24-1427-01A-01W-0549-09 ENST00000371321 p.K158Q RP11-566F5.1 chr10 109680857 109680857 RNA G G A TCGA-24-1427-01A-01W-0549-09 ENST00000603162 CACUL1 chr10 118685944 118685945 3'UTR - - T TCGA-24-1427-01A-01W-0549-09 ENST00000369151 MUC5B chr11 1243065 1243065 Missense_Mutation C C T TCGA-24-1427-01A-01W-0549-09 ENST00000529681 p.T2062I CARS chr11 3041170 3041170 Intron C C A TCGA-24-1427-01A-01W-0549-09 ENST00000397111 OR52A1 chr11 5151764 5151764 Silent A A G TCGA-24-1427-01A-01W-0549-09 ENST00000328942 p.G202G SLC3A2 chr11 62888761 62888761 3'UTR T T C TCGA-24-1427-01A-01W-0549-09 ENST00000377890 MARK2 chr11 63899932 63899932 Missense_Mutation G G A TCGA-24-1427-01A-01W-0549-09 ENST00000402010 p.S197N APLP2 chr11 130140444 130140444 Missense_Mutation G G T TCGA-24-1427-01A-01W-0549-09 ENST00000263574 p.E640D NDUFA9 chr12 4654306 4654306 Missense_Mutation G G T TCGA-24-1427-01A-01W-0549-09 ENST00000266544 p.A22S LTBR chr12 6388462 6388464 In_Frame_Del CTC CTC - TCGA-24-1427-01A-01W-0549-09 ENST00000228918 p.S245del SLCO1B1 chr12 21141645 21141645 Missense_Mutation G G T TCGA-24-1427-01A-01W-0549-09 ENST00000256958 p.C24F BAZ2A chr12 56615066 56615066 Silent T T C TCGA-24-1427-01A-01W-0549-09 ENST00000551812 p.A228A ERCC5 chr13 102858303 102858303 Missense_Mutation T T C TCGA-24-1427-01A-01W-0549-09 ENST00000355739 p.I186T ANPEP chr15 89801467 89801467 Silent G G T TCGA-24-1427-01A-01W-0549-09 ENST00000300060 p.P570P RBBP6 chr16 24548950 24548950 Missense_Mutation G G A TCGA-24-1427-01A-01W-0549-09 ENST00000319715 p.R91Q OR1A1 chr17 3215923 3215923 Missense_Mutation G G A TCGA-24-1427-01A-01W-0549-09 ENST00000304094 p.M101I TP53 chr17 7673806 7673806 Frame_Shift_Del C C - TCGA-24-1427-01A-01W-0549-09 ENST00000269305 p.V272Cfs*73 KIAA0100 chr17 28639613 28639613 Missense_Mutation G G A TCGA-24-1427-01A-01W-0549-09 ENST00000528896 p.R349C ABCA8 chr17 68932166 68932166 Intron C C T TCGA-24-1427-01A-01W-0549-09 ENST00000269080 SEC14L1 chr17 77211949 77211949 Splice_Site G G T TCGA-24-1427-01A-01W-0549-09 ENST00000430767 p.X538_splice SEC14L1 chr17 77211950 77211950 Missense_Mutation A A T TCGA-24-1427-01A-01W-0549-09 ENST00000430767 p.I538F LIPE chr19 42410613 42410613 Silent G G A TCGA-24-1427-01A-01W-0549-09 ENST00000244289 p.N371N SIGLEC8 chr19 51452438 51452438 Missense_Mutation C C A TCGA-24-1427-01A-01W-0549-09 ENST00000321424 p.A481S SYCP2 chr20 59880302 59880302 Splice_Site C C T TCGA-24-1427-01A-01W-0549-09 ENST00000357552 p.X981_splice POTED chr21 13620244 13620244 Missense_Mutation A A G TCGA-24-1427-01A-01W-0549-09 ENST00000299443 p.D335G CXADR chr21 17551882 17551882 Missense_Mutation T T A TCGA-24-1427-01A-01W-0549-09 ENST00000284878 p.I115N ADRBK2 chr22 25722567 25722567 3'UTR G G A TCGA-24-1427-01A-01W-0549-09 ENST00000324198 TRIOBP chr22 37725676 37725676 Missense_Mutation C C A TCGA-24-1427-01A-01W-0549-09 ENST00000406386 p.F1040L CCDC27 chr1 3752731 3752731 Missense_Mutation A A G TCGA-30-1857-01A-02W-0639-09 ENST00000294600 p.K84E UBE4B chr1 10126833 10126834 Frame_Shift_Del AA AA - TCGA-30-1857-01A-02W-0639-09 ENST00000343090 p.K532Rfs*7 MAP3K6 chr1 27358229 27358229 Missense_Mutation G G C TCGA-30-1857-01A-02W-0639-09 ENST00000357582 p.P956R THRAP3 chr1 36301037 36301038 Frame_Shift_Del TT TT - TCGA-30-1857-01A-02W-0639-09 ENST00000354618 p.F819Cfs*5 MAST2 chr1 46035987 46035987 Missense_Mutation G G A TCGA-30-1857-01A-02W-0639-09 ENST00000361297 p.R1773K LRP8 chr1 53250782 53250782 Missense_Mutation C C G TCGA-30-1857-01A-02W-0639-09 ENST00000306052 p.D862H HFM1 chr1 91266108 91266108 Splice_Site C C T TCGA-30-1857-01A-02W-0639-09 ENST00000370425 p.X1295_splice RP5-998N21.4 chr1 143880544 143880544 Intron C C G TCGA-30-1857-01A-02W-0639-09 ENST00000415338 BCAN chr1 156657045 156657045 Missense_Mutation G G C TCGA-30-1857-01A-02W-0639-09 ENST00000329117 p.G720R F5 chr1 169529666 169529668 In_Frame_Del CTT CTT - TCGA-30-1857-01A-02W-0639-09 ENST00000367797 p.K1787del C1orf112 chr1 169842498 169842498 Missense_Mutation G G A TCGA-30-1857-01A-02W-0639-09 ENST00000286031 p.E603K KIFAP3 chr1 170034377 170034379 In_Frame_Del TTC TTC - TCGA-30-1857-01A-02W-0639-09 ENST00000361580 p.K246del ACTA1 chr1 229432862 229432862 Missense_Mutation C C A TCGA-30-1857-01A-02W-0639-09 ENST00000366684 p.G50C ADGRF3 chr2 26311681 26311681 Missense_Mutation C C T TCGA-30-1857-01A-02W-0639-09 ENST00000311519 p.G683S OXER1 chr2 42764022 42764022 Missense_Mutation G G T TCGA-30-1857-01A-02W-0639-09 ENST00000378661 p.S53Y DYNC2LI1 chr2 43795933 43795933 Missense_Mutation T T A TCGA-30-1857-01A-02W-0639-09 ENST00000260605 p.I184N ANKRD20A8P chr2 94829051 94829051 RNA C C T TCGA-30-1857-01A-02W-0639-09 ENST00000432432 ANAPC1 chr2 111809139 111809139 Missense_Mutation C C A TCGA-30-1857-01A-02W-0639-09 ENST00000341068 p.A1214S LCT chr2 135836867 135836867 Missense_Mutation G G C TCGA-30-1857-01A-02W-0639-09 ENST00000264162 p.S101R HSPE1 chr2 197503440 197503440 3'UTR A A G TCGA-30-1857-01A-02W-0639-09 ENST00000233893 CXCR2 chr2 218135036 218135036 Missense_Mutation G G A TCGA-30-1857-01A-02W-0639-09 ENST00000318507 p.G79S UGT1A3 chr2 233743575 233743575 Intron G G C TCGA-30-1857-01A-02W-0639-09 ENST00000482026 ZNF502 chr3 44722401 44722404 Frame_Shift_Del CAGA CAGA - TCGA-30-1857-01A-02W-0639-09 ENST00000296091 p.R529Ifs*20 MAPKAPK3 chr3 50645770 50645772 In_Frame_Del TCA TCA - TCGA-30-1857-01A-02W-0639-09 ENST00000357955 p.I231del DNAH12 chr3 57507718 57507720 In_Frame_Del CTT CTT - TCGA-30-1857-01A-02W-0639-09 ENST00000351747 p.K274del CMSS1 chr3 100167737 100167737 Splice_Site G G C TCGA-30-1857-01A-02W-0639-09 ENST00000421999 p.X139_splice GTPBP8 chr3 112991298 112991298 Missense_Mutation T T C TCGA-30-1857-01A-02W-0639-09 ENST00000383678 p.V100A ACAD11 chr3 132618721 132618721 Missense_Mutation C C T TCGA-30-1857-01A-02W-0639-09 ENST00000264990 p.G443R CLSTN2 chr3 140404638 140404638 Missense_Mutation C C T TCGA-30-1857-01A-02W-0639-09 ENST00000458420 p.T170M TM4SF4 chr3 149475826 149475826 Missense_Mutation A A G TCGA-30-1857-01A-02W-0639-09 ENST00000305354 p.I60V KPNA4 chr3 160568226 160568226 5'Flank G G A TCGA-30-1857-01A-02W-0639-09 ENST00000334256 MASP1 chr3 187220106 187220106 Missense_Mutation C C G TCGA-30-1857-01A-02W-0639-09 ENST00000337774 p.D689H BOD1L1 chr4 13601778 13601778 Missense_Mutation C C G TCGA-30-1857-01A-02W-0639-09 ENST00000040738 p.D1708H SLIT2 chr4 20618827 20618827 Missense_Mutation G G T TCGA-30-1857-01A-02W-0639-09 ENST00000504154 p.A1470S ARAP2 chr4 36229045 36229046 Frame_Shift_Del GA GA - TCGA-30-1857-01A-02W-0639-09 ENST00000303965 p.P148Sfs*2 PDGFRA chr4 54265298 54265298 Intron T T C TCGA-30-1857-01A-02W-0639-09 ENST00000257290 POLR2B chr4 57031158 57031158 3'UTR C C G TCGA-30-1857-01A-02W-0639-09 ENST00000314595 TTC29 chr4 146707502 146707502 Silent A A G TCGA-30-1857-01A-02W-0639-09 ENST00000325106 p.R460R FASTKD3 chr5 7865982 7865982 Splice_Region A A T TCGA-30-1857-01A-02W-0639-09 ENST00000264669 p.G480G TENM2 chr5 168247530 168247530 Missense_Mutation T T G TCGA-30-1857-01A-02W-0639-09 ENST00000518659 p.N2197K ADTRP chr6 11723416 11723416 Silent G G A TCGA-30-1857-01A-02W-0639-09 ENST00000414691 p.F197F HIST1H4B chr6 26027012 26027013 Frame_Shift_Del TC TC - TCGA-30-1857-01A-02W-0639-09 ENST00000377745 p.K80Nfs*47 OR2J3 chr6 29112650 29112650 Missense_Mutation T T A TCGA-30-1857-01A-02W-0639-09 ENST00000377169 p.F254I ZNF138 chr7 64832797 64832797 3'Flank A A G TCGA-30-1857-01A-02W-0639-09 ENST00000307355 CDK14 chr7 90726771 90726772 Frame_Shift_Del AA AA - TCGA-30-1857-01A-02W-0639-09 ENST00000380050 p.K110Rfs*4 RELN chr7 103917095 103917095 Missense_Mutation C C T TCGA-30-1857-01A-02W-0639-09 ENST00000428762 p.G106D DOCK4 chr7 111758692 111758692 Missense_Mutation G G T TCGA-30-1857-01A-02W-0639-09 ENST00000437633 p.H1412N FOXP2 chr7 114662093 114662093 Missense_Mutation A A C TCGA-30-1857-01A-02W-0639-09 ENST00000350908 p.H559P FAM71F1 chr7 128731160 128731160 3'UTR C C A TCGA-30-1857-01A-02W-0639-09 ENST00000315184 DGKI chr7 137391248 137391248 Missense_Mutation C C A TCGA-30-1857-01A-02W-0639-09 ENST00000288490 p.G1057V HTR5A chr7 155071227 155071227 Missense_Mutation G G T TCGA-30-1857-01A-02W-0639-09 ENST00000287907 p.G110C LOXL2 chr8 23317028 23317028 Silent C C T TCGA-30-1857-01A-02W-0639-09 ENST00000389131 p.A519A POP1 chr8 98130131 98130131 Missense_Mutation A A G TCGA-30-1857-01A-02W-0639-09 ENST00000349693 p.M214V VPS13B chr8 99121206 99121206 Nonsense_Mutation C C T TCGA-30-1857-01A-02W-0639-09 ENST00000358544 p.Q323* TG chr8 132871385 132871385 Missense_Mutation A A T TCGA-30-1857-01A-02W-0639-09 ENST00000220616 p.L104F EQTN chr9 27284705 27284705 3'UTR C C G TCGA-30-1857-01A-02W-0639-09 ENST00000380032 ZBTB5 chr9 37442078 37442078 Silent G G C TCGA-30-1857-01A-02W-0639-09 ENST00000307750 p.L158L ALDH1A1 chr9 72901134 72901134 3'UTR T T G TCGA-30-1857-01A-02W-0639-09 ENST00000297785 SCAI chr9 124971802 124971802 Missense_Mutation T T C TCGA-30-1857-01A-02W-0639-09 ENST00000336505 p.N481S RALGPS1 chr9 127218950 127218950 3'UTR G G C TCGA-30-1857-01A-02W-0639-09 ENST00000259351 DHTKD1 chr10 12120878 12120878 Missense_Mutation C C A TCGA-30-1857-01A-02W-0639-09 ENST00000263035 p.T917N SVILP1 chr10 30712683 30712683 Splice_Region G G A TCGA-30-1857-01A-02W-0639-09 ENST00000422642 NRP1 chr10 33194746 33194746 Intron G G C TCGA-30-1857-01A-02W-0639-09 ENST00000265371 PCDH15 chr10 53808698 53808698 Silent T T A TCGA-30-1857-01A-02W-0639-09 ENST00000613657 p.A1789A DNAJC12 chr10 67823377 67823377 Missense_Mutation C C G TCGA-30-1857-01A-02W-0639-09 ENST00000225171 p.A32P SIRT1 chr10 67887463 67887463 Silent C C T TCGA-30-1857-01A-02W-0639-09 ENST00000212015 p.S159S WAPAL chr10 86517890 86517890 Missense_Mutation C C G TCGA-30-1857-01A-02W-0639-09 ENST00000298767 p.K60N DDB1 chr11 61316090 61316090 Intron T T A TCGA-30-1857-01A-02W-0639-09 ENST00000301764 SNX15 chr11 65027594 65027594 Missense_Mutation G G T TCGA-30-1857-01A-02W-0639-09 ENST00000377244 p.R19S KDM4D chr11 94998502 94998502 Missense_Mutation T T A TCGA-30-1857-01A-02W-0639-09 ENST00000335080 p.L377H TRIM29 chr11 120137655 120137673 Frame_Shift_Del TCGCCCTTTTCGGCAAAGG TCGCCCTTTTCGGCAAAGG - TCGA-30-1857-01A-02W-0639-09 ENST00000341846 p.T120Sfs*133 FOXM1 chr12 2872168 2872168 Silent T T G TCGA-30-1857-01A-02W-0639-09 ENST00000359843 p.G194G FMNL3 chr12 49649305 49649305 Missense_Mutation C C T TCGA-30-1857-01A-02W-0639-09 ENST00000335154 p.S780N FMNL3 chr12 49649306 49649306 Missense_Mutation T T G TCGA-30-1857-01A-02W-0639-09 ENST00000335154 p.S780R LRP1 chr12 57185145 57185145 Nonsense_Mutation C C T TCGA-30-1857-01A-02W-0639-09 ENST00000243077 p.R2135* ALX1 chr12 85283681 85283681 Silent G G A TCGA-30-1857-01A-02W-0639-09 ENST00000316824 p.E112E RFC5 chr12 118031232 118031232 Missense_Mutation T T A TCGA-30-1857-01A-02W-0639-09 ENST00000454402 p.I326N RNF34 chr12 121416313 121416314 Frame_Shift_Ins - - TT TCGA-30-1857-01A-02W-0639-09 ENST00000361234 p.T55Lfs*7 RNF34 chr12 121416316 121416325 Frame_Shift_Del CGGAAGGGCC CGGAAGGGCC - TCGA-30-1857-01A-02W-0639-09 ENST00000361234 p.E56Tfs*2 EP400 chr12 132064887 132064890 Splice_Site GTAA GTAA - TCGA-30-1857-01A-02W-0639-09 ENST00000389562 p.X2851_splice DCT chr13 94469007 94469007 Missense_Mutation C C A TCGA-30-1857-01A-02W-0639-09 ENST00000377028 p.G112C LRP10 chr14 22875451 22875451 Missense_Mutation G G T TCGA-30-1857-01A-02W-0639-09 ENST00000359591 p.G168V LRRC16B chr14 24056986 24056986 Missense_Mutation A A T TCGA-30-1857-01A-02W-0639-09 ENST00000342740 p.S342C ARG2 chr14 67642196 67642197 Frame_Shift_Del AA AA - TCGA-30-1857-01A-02W-0639-09 ENST00000261783 p.K66Rfs*14 ZFYVE26 chr14 67786174 67786174 Missense_Mutation G G A TCGA-30-1857-01A-02W-0639-09 ENST00000347230 p.L1027F ANGEL1 chr14 76790632 76790632 Missense_Mutation A A G TCGA-30-1857-01A-02W-0639-09 ENST00000251089 p.C611R BDKRB1 chr14 96264214 96264214 Missense_Mutation A A G TCGA-30-1857-01A-02W-0639-09 ENST00000216629 p.I178V UNC13C chr15 54623797 54623797 Missense_Mutation A A T TCGA-30-1857-01A-02W-0639-09 ENST00000260323 p.I2068F ARNT2 chr15 80475042 80475042 Silent T T C TCGA-30-1857-01A-02W-0639-09 ENST00000303329 p.D147D BNC1 chr15 83257887 83257887 Missense_Mutation G G T TCGA-30-1857-01A-02W-0639-09 ENST00000345382 p.S847Y PEX11A chr15 89686432 89686432 Missense_Mutation T T A TCGA-30-1857-01A-02W-0639-09 ENST00000300056 p.K57N LONP2 chr16 48261467 48261483 Frame_Shift_Del GTACTTTAGAAGATGAA GTACTTTAGAAGATGAA - TCGA-30-1857-01A-02W-0639-09 ENST00000285737 p.T257* LONP2 chr16 48261485 48261485 Missense_Mutation A A C TCGA-30-1857-01A-02W-0639-09 ENST00000285737 p.D262A ZNF594 chr17 5182519 5182519 Missense_Mutation T T C TCGA-30-1857-01A-02W-0639-09 ENST00000399604 p.S580G TP53 chr17 7675124 7675124 Missense_Mutation T T C TCGA-30-1857-01A-02W-0639-09 ENST00000269305 p.Y163C KIAA0100 chr17 28637940 28637940 Nonsense_Mutation G G T TCGA-30-1857-01A-02W-0639-09 ENST00000528896 p.S556* NF1 chr17 31159045 31159048 Frame_Shift_Del TCTC TCTC - TCGA-30-1857-01A-02W-0639-09 ENST00000358273 p.Q83* BRCA1 chr17 43093133 43093133 Nonsense_Mutation T T A TCGA-30-1857-01A-02W-0639-09 ENST00000357654 p.K800* LUC7L3 chr17 50744727 50744727 Missense_Mutation G G C TCGA-30-1857-01A-02W-0639-09 ENST00000240304 p.D203H OR4D1 chr17 58156077 58156077 Missense_Mutation C C G TCGA-30-1857-01A-02W-0639-09 ENST00000268912 p.C308W C17orf64 chr17 60435610 60435610 3'Flank C C T TCGA-30-1857-01A-02W-0639-09 ENST00000269127 DNAH17 chr17 78450339 78450339 Missense_Mutation C C T TCGA-30-1857-01A-02W-0639-09 ENST00000389840 p.R3652H ZNF532 chr18 58920359 58920359 Missense_Mutation T T G TCGA-30-1857-01A-02W-0639-09 ENST00000336078 p.I691R CDH7 chr18 65843900 65843900 Missense_Mutation C C T TCGA-30-1857-01A-02W-0639-09 ENST00000323011 p.P357L LDLR chr19 11102758 11102758 Nonsense_Mutation C C A TCGA-30-1857-01A-02W-0639-09 ENST00000558518 p.C95* DMRTC2 chr19 41850656 41850656 Missense_Mutation C C A TCGA-30-1857-01A-02W-0639-09 ENST00000269945 p.P316H PSG3 chr19 42740335 42740335 Missense_Mutation C C T TCGA-30-1857-01A-02W-0639-09 ENST00000327495 p.G17E SIGLEC8 chr19 51458347 51458347 Missense_Mutation G G A TCGA-30-1857-01A-02W-0639-09 ENST00000321424 p.T14I GDF5 chr20 35434302 35434302 Silent C C T TCGA-30-1857-01A-02W-0639-09 ENST00000374369 p.E371E ZSWIM3 chr20 45878528 45878528 Missense_Mutation A A T TCGA-30-1857-01A-02W-0639-09 ENST00000255152 p.Q657L PIK3CB chr3 138712268 138712269 Frame_Shift_Ins - - A TCGA-13-0889-01A-01W-0420-08 ENST00000289153 p.D447* PIK3CA chr3 179218304 179218304 Missense_Mutation A A C TCGA-13-0889-01A-01W-0420-08 ENST00000263967 p.E545A ANAPC4 chr4 25383352 25383353 Frame_Shift_Ins - - G TCGA-13-0889-01A-01W-0420-08 ENST00000315368 p.V110Gfs*21 MAPK14 chr6 36102641 36102641 Missense_Mutation A A T TCGA-13-0889-01A-01W-0420-08 ENST00000229794 p.N278I PPP2R5B chr11 64931869 64931869 Splice_Site G G T TCGA-13-0889-01A-01W-0420-08 ENST00000164133 p.X372_splice ATF1 chr12 50819739 50819740 Frame_Shift_Ins - - A TCGA-13-0889-01A-01W-0420-08 ENST00000262053 p.T261Nfs*9 LRP1 chr12 57177154 57177154 Missense_Mutation G G A TCGA-13-0889-01A-01W-0420-08 ENST00000243077 p.E1369K TP53 chr17 7673803 7673803 Missense_Mutation G G A TCGA-13-0889-01A-01W-0420-08 ENST00000269305 p.R273C ERBB2 chr17 39711955 39711955 Missense_Mutation C C T TCGA-13-0889-01A-01W-0420-08 ENST00000269571 p.S310F TPTE chr21 10561047 10561047 Missense_Mutation T T C TCGA-13-0889-01A-01W-0420-08 ENST00000618007 p.L101P HDAC6 chrX 48814379 48814380 Intron - - G TCGA-13-0889-01A-01W-0420-08 ENST00000334136 ATRX chrX 77522369 77522369 Missense_Mutation T T C TCGA-13-0889-01A-01W-0420-08 ENST00000373344 p.N2290S PER3 chr1 7788240 7788240 Missense_Mutation C C A TCGA-09-2044-01B-01D-0704-01 ENST00000361923 p.Q196K NPPA chr1 11846014 11846014 Missense_Mutation A A G TCGA-09-2044-01B-01D-0704-01 ENST00000376480 p.Y151H PADI3 chr1 17267848 17267848 Missense_Mutation A A G TCGA-09-2044-01B-01D-0704-01 ENST00000375460 p.M180V INPP5B chr1 37891361 37891361 Missense_Mutation G G T TCGA-09-2044-01B-01D-0704-01 ENST00000373023 p.P289Q BMP8A chr1 39522330 39522330 Intron C C G TCGA-09-2044-01B-01D-0704-01 ENST00000331593 SMAP2 chr1 40408686 40408686 Silent C C A TCGA-09-2044-01B-01D-0704-01 ENST00000372718 p.R91R HIST2H2AC chr1 149887047 149887047 Nonsense_Mutation C C T TCGA-09-2044-01B-01D-0704-01 ENST00000331380 p.Q25* PGLYRP4 chr1 153340448 153340448 Missense_Mutation G G A TCGA-09-2044-01B-01D-0704-01 ENST00000359650 p.R253C RASAL2 chr1 178300073 178300073 Nonsense_Mutation G G T TCGA-09-2044-01B-01D-0704-01 ENST00000367649 p.E138* KCNT2 chr1 196280926 196280926 Missense_Mutation A A C TCGA-09-2044-01B-01D-0704-01 ENST00000294725 p.C948W CR2 chr1 207466762 207466762 Nonsense_Mutation G G T TCGA-09-2044-01B-01D-0704-01 ENST00000367058 p.G99* RYR2 chr1 237496738 237496738 Missense_Mutation T T C TCGA-09-2044-01B-01D-0704-01 ENST00000366574 p.L730P VN1R5 chr1 247256717 247256717 RNA G G C TCGA-09-2044-01B-01D-0704-01 ENST00000472952 KIF3C chr2 25980583 25980583 Silent G T T TCGA-09-2044-01B-01D-0704-01 ENST00000264712 p.P445P IL18RAP chr2 102437344 102437344 Missense_Mutation G G T TCGA-09-2044-01B-01D-0704-01 ENST00000264260 p.V238F BIN1 chr2 127070591 127070591 Missense_Mutation C C T TCGA-09-2044-01B-01D-0704-01 ENST00000316724 p.D93N ITGA4 chr2 181480183 181480183 Missense_Mutation C C G TCGA-09-2044-01B-01D-0704-01 ENST00000397033 p.S224C MYO1B chr2 191396494 191396494 Missense_Mutation G G C TCGA-09-2044-01B-01D-0704-01 ENST00000304164 p.W764C SLC4A3 chr2 219635271 219635271 Missense_Mutation C C G TCGA-09-2044-01B-01D-0704-01 ENST00000317151 p.L583V NYAP2 chr2 225582238 225582238 Missense_Mutation C C A TCGA-09-2044-01B-01D-0704-01 ENST00000272907 p.P274H UGT1A10 chr2 233637177 233637177 Missense_Mutation T T C TCGA-09-2044-01B-01D-0704-01 ENST00000344644 p.F219L SRGAP3 chr3 8993044 8993053 Frame_Shift_Del AAGGCATCAT AAGGCATCAT - TCGA-09-2044-01B-01D-0704-01 ENST00000383836 p.D804Afs*5 FANCD2 chr3 10081528 10081528 Intron G G C TCGA-09-2044-01B-01D-0704-01 ENST00000287647 SLC6A1 chr3 11017970 11017970 Silent C C T TCGA-09-2044-01B-01D-0704-01 ENST00000287766 p.F122F GOLGA4 chr3 37324740 37324740 Missense_Mutation C C A TCGA-09-2044-01B-01D-0704-01 ENST00000361924 p.Q952K CTNNB1 chr3 41236586 41236586 Splice_Site A A G TCGA-09-2044-01B-01D-0704-01 ENST00000349496 p.X652_splice COL7A1 chr3 48572017 48572017 Missense_Mutation C C G TCGA-09-2044-01B-01D-0704-01 ENST00000328333 p.G2351A UQCRC1 chr3 48605846 48605846 Missense_Mutation C C A TCGA-09-2044-01B-01D-0704-01 ENST00000203407 p.W74L TMEM45A chr3 100568939 100568939 Missense_Mutation G G A TCGA-09-2044-01B-01D-0704-01 ENST00000323523 p.V236I EEFSEC chr3 128341349 128341349 Silent G G T TCGA-09-2044-01B-01D-0704-01 ENST00000254730 p.G301G ARMC8 chr3 138239505 138239507 In_Frame_Del GAT GAT - TCGA-09-2044-01B-01D-0704-01 ENST00000469044 p.D273del ABCF3 chr3 184192630 184192630 Silent C C G TCGA-09-2044-01B-01D-0704-01 ENST00000429586 p.T533T PPEF2 chr4 75896317 75896317 Silent G G A TCGA-09-2044-01B-01D-0704-01 ENST00000286719 p.S3S THAP9 chr4 82918539 82918539 Missense_Mutation A A T TCGA-09-2044-01B-01D-0704-01 ENST00000302236 p.E776V PTPN13 chr4 86809935 86809935 Missense_Mutation C C A TCGA-09-2044-01B-01D-0704-01 ENST00000411767 p.T2417N MEPE chr4 87845936 87845936 Missense_Mutation C C A TCGA-09-2044-01B-01D-0704-01 ENST00000361056 p.N356K BANK1 chr4 102025377 102025378 Frame_Shift_Del TA TA - TCGA-09-2044-01B-01D-0704-01 ENST00000322953 p.Y488Cfs*7 ETNPPL chr4 108762844 108762844 Missense_Mutation C C T TCGA-09-2044-01B-01D-0704-01 ENST00000296486 p.G19R COL25A1 chr4 108846147 108846147 Nonsense_Mutation C C A TCGA-09-2044-01B-01D-0704-01 ENST00000399132 p.G503* FAT4 chr4 125320770 125320770 Silent T T A TCGA-09-2044-01B-01D-0704-01 ENST00000394329 p.G1453G TKTL2 chr4 163472395 163472395 Missense_Mutation C A A TCGA-09-2044-01B-01D-0704-01 ENST00000280605 p.C447F CPE chr4 165464488 165464488 Missense_Mutation C C A TCGA-09-2044-01B-01D-0704-01 ENST00000402744 p.Q136K GLRA3 chr4 174659122 174659122 Missense_Mutation C C T TCGA-09-2044-01B-01D-0704-01 ENST00000274093 p.A335T ICE1 chr5 5460460 5460460 Missense_Mutation G G A TCGA-09-2044-01B-01D-0704-01 ENST00000296564 p.D376N MYO10 chr5 16672770 16672770 Missense_Mutation G G A TCGA-09-2044-01B-01D-0704-01 ENST00000513610 p.A1743V HCN1 chr5 45396539 45396539 Missense_Mutation C C A TCGA-09-2044-01B-01D-0704-01 ENST00000303230 p.A395S IL31RA chr5 55916813 55916813 Missense_Mutation A G G TCGA-09-2044-01B-01D-0704-01 ENST00000447346 p.N663S FCHO2 chr5 73068723 73068723 Missense_Mutation G G T TCGA-09-2044-01B-01D-0704-01 ENST00000430046 p.S508I ADGRV1 chr5 90725651 90725651 Missense_Mutation A T T TCGA-09-2044-01B-01D-0704-01 ENST00000405460 p.T3386S SLCO6A1 chr5 102498665 102498665 Missense_Mutation C C A TCGA-09-2044-01B-01D-0704-01 ENST00000379807 p.R60S PCDHB12 chr5 141210095 141210095 Silent G G T TCGA-09-2044-01B-01D-0704-01 ENST00000239450 p.S396S FCHSD1 chr5 141646721 141646721 Missense_Mutation A A G TCGA-09-2044-01B-01D-0704-01 ENST00000435817 p.V309A GCM2 chr6 10876526 10876526 Missense_Mutation C C A TCGA-09-2044-01B-01D-0704-01 ENST00000379491 p.L125F TRIM31 chr6 30112571 30112571 Missense_Mutation G G T TCGA-09-2044-01B-01D-0704-01 ENST00000376734 p.Q79K TEAD3 chr6 35486573 35486573 Missense_Mutation A A C TCGA-09-2044-01B-01D-0704-01 ENST00000338863 p.D30E SLC26A8 chr6 35951189 35951189 Missense_Mutation G G A TCGA-09-2044-01B-01D-0704-01 ENST00000355574 p.R816W MOCS1 chr6 39909852 39909852 Missense_Mutation T C C TCGA-09-2044-01B-01D-0704-01 ENST00000340692 p.K362R DST chr6 56600131 56600131 Missense_Mutation G G T TCGA-09-2044-01B-01D-0704-01 ENST00000312431 p.Q1621K CD109 chr6 73808233 73808233 Silent A A C TCGA-09-2044-01B-01D-0704-01 ENST00000287097 p.R1114R CGA chr6 87085820 87085820 Missense_Mutation C C G TCGA-09-2044-01B-01D-0704-01 ENST00000627148 p.G96A SLC35A1 chr6 87511563 87511563 3'UTR C C A TCGA-09-2044-01B-01D-0704-01 ENST00000369552 EPB41L2 chr6 130867618 130867618 Intron G C C TCGA-09-2044-01B-01D-0704-01 ENST00000337057 DOCK4 chr7 111863379 111863379 Silent G G T TCGA-09-2044-01B-01D-0704-01 ENST00000437633 p.T822T MET chr7 116699746 116699746 Missense_Mutation A A G TCGA-09-2044-01B-01D-0704-01 ENST00000397752 p.E221G MTRNR2L6 chr7 142671120 142671120 3'Flank A A G TCGA-09-2044-01B-01D-0704-01 ENST00000604952 DPP6 chr7 154587816 154587816 Intron A A G TCGA-09-2044-01B-01D-0704-01 ENST00000377770 NPBWR1 chr8 52940875 52940875 Missense_Mutation C C T TCGA-09-2044-01B-01D-0704-01 ENST00000331251 p.T323I ASPH chr8 61576792 61576792 Missense_Mutation C C G TCGA-09-2044-01B-01D-0704-01 ENST00000379454 p.A377P CYP7B1 chr8 64596886 64596886 Missense_Mutation G G A TCGA-09-2044-01B-01D-0704-01 ENST00000310193 p.T426I CSPP1 chr8 67175245 67175245 Intron C C G TCGA-09-2044-01B-01D-0704-01 ENST00000262210 C9orf72 chr9 27548310 27548310 Missense_Mutation C C G TCGA-09-2044-01B-01D-0704-01 ENST00000380003 p.G458R KIAA1161 chr9 34371956 34371956 Missense_Mutation G G T TCGA-09-2044-01B-01D-0704-01 ENST00000297625 p.Q330K UNC13B chr9 35310546 35310546 Missense_Mutation C C T TCGA-09-2044-01B-01D-0704-01 ENST00000378495 p.H281Y SETX chr9 132329587 132329587 Missense_Mutation G G T TCGA-09-2044-01B-01D-0704-01 ENST00000224140 p.Q671K TSC1 chr9 132903687 132903697 Frame_Shift_Del GATCACCTTGC GATCACCTTGC - TCGA-09-2044-01B-01D-0704-01 ENST00000298552 p.R721Qfs*9 SURF6 chr9 133332725 133332725 Silent C C T TCGA-09-2044-01B-01D-0704-01 ENST00000372022 p.E143E CACNA1B chr9 137986852 137986852 Missense_Mutation C C A TCGA-09-2044-01B-01D-0704-01 ENST00000371372 p.Q658K FBXO18 chr10 5895065 5895065 Intron G G T TCGA-09-2044-01B-01D-0704-01 ENST00000362091 CYP2C19 chr10 94842972 94842972 Missense_Mutation T T A TCGA-09-2044-01B-01D-0704-01 ENST00000371321 p.L366Q CUZD1 chr10 122832242 122832242 3'UTR G G T TCGA-09-2044-01B-01D-0704-01 ENST00000368904 UBQLNL chr11 5515081 5515081 Missense_Mutation T T G TCGA-09-2044-01B-01D-0704-01 ENST00000380184 p.E454A OR8H1 chr11 56290394 56290394 Silent G G T TCGA-09-2044-01B-01D-0704-01 ENST00000313022 p.T223T SSRP1 chr11 57328414 57328414 Silent G G A TCGA-09-2044-01B-01D-0704-01 ENST00000278412 p.N498N PACS1 chr11 66211206 66211206 Missense_Mutation C C T TCGA-09-2044-01B-01D-0704-01 ENST00000320580 p.R203W DDIAS chr11 82928842 82928842 Missense_Mutation C C T TCGA-09-2044-01B-01D-0704-01 ENST00000329143 p.S60F FAT3 chr11 92354721 92354721 Missense_Mutation T G G TCGA-09-2044-01B-01D-0704-01 ENST00000525166 p.V720G ACAT1 chr11 108141657 108141657 Silent T T C TCGA-09-2044-01B-01D-0704-01 ENST00000265838 p.F261F NECAP1 chr12 8081342 8081342 5'Flank G G A TCGA-09-2044-01B-01D-0704-01 ENST00000339754 PLCZ1 chr12 18737390 18737390 5'UTR G G A TCGA-09-2044-01B-01D-0704-01 ENST00000266505 GXYLT1 chr12 42105967 42105967 Frame_Shift_Del T T - TCGA-09-2044-01B-01D-0704-01 ENST00000398675 p.T239Hfs*15 GXYLT1 chr12 42105968 42105968 Silent G G A TCGA-09-2044-01B-01D-0704-01 ENST00000398675 p.S238S ATF7 chr12 53524646 53524646 Missense_Mutation C C A TCGA-09-2044-01B-01D-0704-01 ENST00000548446 p.R359L CCDC62 chr12 122801272 122801272 Missense_Mutation T T G TCGA-09-2044-01B-01D-0704-01 ENST00000253079 p.C376G SBNO1 chr12 123309572 123309572 Nonsense_Mutation C C A TCGA-09-2044-01B-01D-0704-01 ENST00000420886 p.G1152* SLITRK6 chr13 85796241 85796241 Missense_Mutation C C A TCGA-09-2044-01B-01D-0704-01 ENST00000400286 p.A90S FGF14 chr13 101726696 101726696 Silent A A G TCGA-09-2044-01B-01D-0704-01 ENST00000376143 p.L175L PNP chr14 20472385 20472386 Frame_Shift_Del TC TC - TCGA-09-2044-01B-01D-0704-01 ENST00000361505 p.I30Mfs*10 SLC22A17 chr14 23349288 23349288 Silent C C A TCGA-09-2044-01B-01D-0704-01 ENST00000206544 p.L170L AKAP6 chr14 32545976 32545976 Silent G G A TCGA-09-2044-01B-01D-0704-01 ENST00000280979 p.L441L SEC23A chr14 39092609 39092609 Missense_Mutation C C A TCGA-09-2044-01B-01D-0704-01 ENST00000307712 p.G100C YLPM1 chr14 74798542 74798545 Frame_Shift_Del GGTT GGTT - TCGA-09-2044-01B-01D-0704-01 ENST00000325680 p.L1083* GPATCH2L chr14 76177997 76177997 Missense_Mutation A A T TCGA-09-2044-01B-01D-0704-01 ENST00000261530 p.K354N TDP1 chr14 89988960 89988966 Frame_Shift_Del GTCAGTT GTCAGTT - TCGA-09-2044-01B-01D-0704-01 ENST00000335725 p.G396Vfs*24 BDKRB1 chr14 96264277 96264277 Missense_Mutation C C A TCGA-09-2044-01B-01D-0704-01 ENST00000216629 p.H199N ATG2B chr14 96322256 96322257 Splice_Region - - AA TCGA-09-2044-01B-01D-0704-01 ENST00000359933 RYR3 chr15 33601457 33601457 Silent G G T TCGA-09-2044-01B-01D-0704-01 ENST00000389232 p.G609G RMI2 chr16 11350719 11350719 Missense_Mutation C C T TCGA-09-2044-01B-01D-0704-01 ENST00000312499 p.L125F ERCC4 chr16 13947936 13947936 Silent C C T TCGA-09-2044-01B-01D-0704-01 ENST00000311895 p.S780S MYH11 chr16 15786611 15786611 Intron A G G TCGA-09-2044-01B-01D-0704-01 ENST00000300036 DNAH3 chr16 21058104 21058104 Silent C C A TCGA-09-2044-01B-01D-0704-01 ENST00000261383 p.L1302L PRRT2 chr16 29813192 29813192 Silent G A A TCGA-09-2044-01B-01D-0704-01 ENST00000358758 p.E46E INCA1 chr17 4989600 4989600 Missense_Mutation C C A TCGA-09-2044-01B-01D-0704-01 ENST00000574617 p.G75C EIF4A1 chr17 7577639 7577639 Missense_Mutation A G G TCGA-09-2044-01B-01D-0704-01 ENST00000293831 p.N280S TP53 chr17 7674948 7674972 Splice_Site TAAGATGCTGAGGAGGGGCCAGACC TAAGATGCTGAGGAGGGGCCAGACC - TCGA-09-2044-01B-01D-0704-01 ENST00000269305 p.X187_splice MYH10 chr17 8475911 8475911 Missense_Mutation C C A TCGA-09-2044-01B-01D-0704-01 ENST00000269243 p.G1942C LGALS9C chr17 18483916 18483916 Missense_Mutation C C A TCGA-09-2044-01B-01D-0704-01 ENST00000328114 p.D27E KRT23 chr17 40936608 40936608 5'UTR C C G TCGA-09-2044-01B-01D-0704-01 ENST00000209718 IFI35 chr17 43013611 43013611 Missense_Mutation G T T TCGA-09-2044-01B-01D-0704-01 ENST00000415816 p.V171F RGS9 chr17 65225300 65225300 Missense_Mutation G G A TCGA-09-2044-01B-01D-0704-01 ENST00000262406 p.R569Q BPTF chr17 67904786 67904786 Missense_Mutation G G C TCGA-09-2044-01B-01D-0704-01 ENST00000321892 p.V1046L TSEN54 chr17 75524353 75524353 Missense_Mutation G G T TCGA-09-2044-01B-01D-0704-01 ENST00000333213 p.G508C RNMT chr18 13737135 13737135 Missense_Mutation G G T TCGA-09-2044-01B-01D-0704-01 ENST00000262173 p.D227Y AC078899.1 chr19 20258374 20258374 RNA G G C TCGA-09-2044-01B-01D-0704-01 ENST00000521432 CYP2A6 chr19 40847049 40847049 Splice_Region G G T TCGA-09-2044-01B-01D-0704-01 ENST00000301141 p.L219L SYMPK chr19 45844169 45844169 Missense_Mutation C C A TCGA-09-2044-01B-01D-0704-01 ENST00000245934 p.L236F ZNF765 chr19 53409077 53409077 Missense_Mutation A A T TCGA-09-2044-01B-01D-0704-01 ENST00000396408 p.N508Y MIR519D chr19 53713427 53713427 RNA G G A TCGA-09-2044-01B-01D-0704-01 ENST00000385246 LILRA1 chr19 54594931 54594931 Missense_Mutation C C T TCGA-09-2044-01B-01D-0704-01 ENST00000251372 p.P113S VPS16 chr20 2865440 2865440 Missense_Mutation A A G TCGA-09-2044-01B-01D-0704-01 ENST00000380445 p.D739G SPEF1 chr20 3779735 3779735 Missense_Mutation C C A TCGA-09-2044-01B-01D-0704-01 ENST00000379756 p.M50I BPIFB2 chr20 33013945 33013945 Missense_Mutation T T A TCGA-09-2044-01B-01D-0704-01 ENST00000170150 p.D148E BPIFB2 chr20 33013946 33013946 Missense_Mutation G G A TCGA-09-2044-01B-01D-0704-01 ENST00000170150 p.G149S DSN1 chr20 36770874 36770874 Splice_Region T T G TCGA-09-2044-01B-01D-0704-01 ENST00000373750 p.T118T TGM2 chr20 38142128 38142128 Missense_Mutation G G C TCGA-09-2044-01B-01D-0704-01 ENST00000361475 p.L311V DNTTIP1 chr20 45801438 45801438 Nonsense_Mutation G G T TCGA-09-2044-01B-01D-0704-01 ENST00000372622 p.G160* SULF2 chr20 47736736 47736736 Missense_Mutation C C A TCGA-09-2044-01B-01D-0704-01 ENST00000359930 p.A128S B4GALT5 chr20 49646991 49646991 Missense_Mutation G G T TCGA-09-2044-01B-01D-0704-01 ENST00000371711 p.T113N HLCS chr21 36936977 36936977 Missense_Mutation G G T TCGA-09-2044-01B-01D-0704-01 ENST00000336648 p.N156K TCEAL6 chrX 102140810 102140811 Frame_Shift_Ins - - T TCGA-09-2044-01B-01D-0704-01 ENST00000372774 p.Q175Pfs*27 FAM199X chrX 104189704 104189704 Missense_Mutation T T C TCGA-09-2044-01B-01D-0704-01 ENST00000493442 p.F365L KIAA1210 chrX 119094052 119094052 Missense_Mutation T T A TCGA-09-2044-01B-01D-0704-01 ENST00000402510 p.L437F SPANXN4 chrX 143034217 143034217 Nonsense_Mutation G G T TCGA-09-2044-01B-01D-0704-01 ENST00000446864 p.G91* RPL10 chrX 154398493 154398493 5'UTR G A A TCGA-09-2044-01B-01D-0704-01 ENST00000344746 P3H1 chr1 42754945 42754945 Missense_Mutation G G T TCGA-23-1031-01A-01W-0486-08 ENST00000296388 p.N423K LRRC7 chr1 70036558 70036558 Missense_Mutation G G C TCGA-23-1031-01A-01W-0486-08 ENST00000035383 p.R703P ERICH3 chr1 74571196 74571196 Missense_Mutation T T A TCGA-23-1031-01A-01W-0486-08 ENST00000326665 p.E1505V ASTN1 chr1 177030945 177030945 Missense_Mutation G G T TCGA-23-1031-01A-01W-0486-08 ENST00000361833 p.D291E TMEM9 chr1 201135809 201135809 Missense_Mutation G G C TCGA-23-1031-01A-01W-0486-08 ENST00000367330 p.R136G PRSS38 chr1 227846226 227846226 3'UTR T T A TCGA-23-1031-01A-01W-0486-08 ENST00000366757 HIST3H2A chr1 228457527 228457527 Silent C C T TCGA-23-1031-01A-01W-0486-08 ENST00000366695 p.L97L RYR2 chr1 237783994 237783994 Silent C C T TCGA-23-1031-01A-01W-0486-08 ENST00000366574 p.I4094I OR2M2 chr1 248180002 248180002 Missense_Mutation A A G TCGA-23-1031-01A-01W-0486-08 ENST00000359682 p.Q6R AC113607.2 chr2 910210 910210 5'Flank T T A TCGA-23-1031-01A-01W-0486-08 ENST00000445279 MYT1L chr2 1923115 1923115 Silent C C A TCGA-23-1031-01A-01W-0486-08 ENST00000399161 p.R218R BRE chr2 28327343 28327343 Intron T T A TCGA-23-1031-01A-01W-0486-08 ENST00000342045 BIRC6 chr2 32465119 32465119 Missense_Mutation C C G TCGA-23-1031-01A-01W-0486-08 ENST00000421745 p.Q1771E PUS10 chr2 60953083 60953083 Nonsense_Mutation C C A TCGA-23-1031-01A-01W-0486-08 ENST00000316752 p.E408* ADD2 chr2 70673296 70673296 Intron C C G TCGA-23-1031-01A-01W-0486-08 ENST00000264436 CNTNAP5 chr2 124772844 124772844 Missense_Mutation T T C TCGA-23-1031-01A-01W-0486-08 ENST00000431078 p.V859A MFSD6 chr2 190436682 190436682 Missense_Mutation C C G TCGA-23-1031-01A-01W-0486-08 ENST00000281416 p.P218R CHPF chr2 219541025 219541025 Missense_Mutation G G A TCGA-23-1031-01A-01W-0486-08 ENST00000243776 p.P330L CHPF chr2 219541026 219541026 Missense_Mutation G G T TCGA-23-1031-01A-01W-0486-08 ENST00000243776 p.P330T PTMA chr2 231708712 231708712 Silent A A G TCGA-23-1031-01A-01W-0486-08 ENST00000341369 p.S2S UGT1A1 chr2 233760810 233760810 Silent C C T TCGA-23-1031-01A-01W-0486-08 ENST00000305208 p.L175L ATP2B2 chr3 10449369 10449369 Missense_Mutation G G A TCGA-23-1031-01A-01W-0486-08 ENST00000352432 p.R59C AZI2 chr3 28338583 28338583 Silent G G A TCGA-23-1031-01A-01W-0486-08 ENST00000479665 p.S83S ZNF80 chr3 114236700 114236701 In_Frame_Ins - - TGCTGA TCGA-23-1031-01A-01W-0486-08 ENST00000308095 p.R124_Q125insHQ NPHP3 chr3 132715086 132715086 Missense_Mutation T T A TCGA-23-1031-01A-01W-0486-08 ENST00000337331 p.K319M TSC22D2 chr3 150409943 150409943 Missense_Mutation C C G TCGA-23-1031-01A-01W-0486-08 ENST00000361875 p.S198C MUC4 chr3 195789381 195789381 Silent G G C TCGA-23-1031-01A-01W-0486-08 ENST00000463781 p.S733S UGT2B10 chr4 68816409 68816409 Silent T T C TCGA-23-1031-01A-01W-0486-08 ENST00000265403 p.V130V PPP3CA chr4 101083206 101083206 Silent G G C TCGA-23-1031-01A-01W-0486-08 ENST00000394854 p.A280A RASGRF2 chr5 81225819 81225819 3'UTR C C T TCGA-23-1031-01A-01W-0486-08 ENST00000265080 PCDHGA12 chr5 141433047 141433047 Missense_Mutation C C T TCGA-23-1031-01A-01W-0486-08 ENST00000252085 p.S763L HIST1H3J chr6 27890766 27890766 Silent G G C TCGA-23-1031-01A-01W-0486-08 ENST00000359303 p.R9R TRIM39-RPP21 chr6 30346517 30346517 Silent C C A TCGA-23-1031-01A-01W-0486-08 ENST00000623385 p.L458L MEP1A chr6 46829369 46829369 Silent C C T TCGA-23-1031-01A-01W-0486-08 ENST00000230588 p.F314F EYS chr6 65405225 65405225 Missense_Mutation C C G TCGA-23-1031-01A-01W-0486-08 ENST00000370616 p.E335D IMPG1 chr6 75950942 75950942 Missense_Mutation G G A TCGA-23-1031-01A-01W-0486-08 ENST00000369950 p.P482S ELOVL4 chr6 79921659 79921659 Missense_Mutation C C A TCGA-23-1031-01A-01W-0486-08 ENST00000369816 p.W169C HTR1E chr6 87015605 87015605 Missense_Mutation G G C TCGA-23-1031-01A-01W-0486-08 ENST00000305344 p.G91R TIAM2 chr6 155137188 155137188 Silent C C A TCGA-23-1031-01A-01W-0486-08 ENST00000318981 p.S402S CPVL chr7 29030710 29030710 Missense_Mutation G G C TCGA-23-1031-01A-01W-0486-08 ENST00000265394 p.T396R KIAA1324L chr7 86912088 86912088 Missense_Mutation C C T TCGA-23-1031-01A-01W-0486-08 ENST00000450689 p.S718N CTTNBP2 chr7 117746056 117746056 Missense_Mutation C C G TCGA-23-1031-01A-01W-0486-08 ENST00000160373 p.S1131T IQUB chr7 123512079 123512079 Missense_Mutation C C A TCGA-23-1031-01A-01W-0486-08 ENST00000324698 p.V88F TTC26 chr7 139147195 139147195 Silent C C T TCGA-23-1031-01A-01W-0486-08 ENST00000464848 p.V150V KMT2C chr7 152248539 152248539 Missense_Mutation G G C TCGA-23-1031-01A-01W-0486-08 ENST00000262189 p.S632C DUSP4 chr8 29345506 29345506 Intron G G A TCGA-23-1031-01A-01W-0486-08 ENST00000240100 ZFPM2 chr8 105801351 105801351 Missense_Mutation C C G TCGA-23-1031-01A-01W-0486-08 ENST00000407775 p.S423R SLA chr8 133060189 133060189 5'UTR G G A TCGA-23-1031-01A-01W-0486-08 ENST00000338087 CNTFR chr9 34564664 34564664 Missense_Mutation C C G TCGA-23-1031-01A-01W-0486-08 ENST00000351266 p.G85A TLN1 chr9 35699453 35699453 Missense_Mutation C C A TCGA-23-1031-01A-01W-0486-08 ENST00000314888 p.Q2259H SMC5 chr9 70324120 70324120 Missense_Mutation T T C TCGA-23-1031-01A-01W-0486-08 ENST00000361138 p.S792P PSAT1 chr9 78328180 78328186 Frame_Shift_Del AGGGCAT AGGGCAT - TCGA-23-1031-01A-01W-0486-08 ENST00000376588 C9orf129 chr9 93318398 93318398 Nonstop_Mutation T T C TCGA-23-1031-01A-01W-0486-08 ENST00000375419 p.*197Wext*? RGS3 chr9 113462176 113462176 Silent C T T TCGA-23-1031-01A-01W-0486-08 ENST00000350696 p.I130I C10orf113 chr10 21146375 21146375 Missense_Mutation C C G TCGA-23-1031-01A-01W-0486-08 ENST00000534331 p.C45S ARID5B chr10 62090956 62090956 Missense_Mutation A A T TCGA-23-1031-01A-01W-0486-08 ENST00000279873 p.E498V NLRP14 chr11 7049782 7049782 Silent A T T TCGA-23-1031-01A-01W-0486-08 ENST00000299481 p.G745G FNBP4 chr11 47734084 47734084 Missense_Mutation A A C TCGA-23-1031-01A-01W-0486-08 ENST00000263773 p.F543V BARX2 chr11 129436923 129436923 Missense_Mutation G G T TCGA-23-1031-01A-01W-0486-08 ENST00000281437 p.E120D COPS7A chr12 6729386 6729386 Missense_Mutation A A G TCGA-23-1031-01A-01W-0486-08 ENST00000229251 p.Y156C CD163 chr12 7487491 7487491 Missense_Mutation T T C TCGA-23-1031-01A-01W-0486-08 ENST00000359156 p.K640E DDX47 chr12 12821667 12821667 Missense_Mutation G G T TCGA-23-1031-01A-01W-0486-08 ENST00000358007 p.G128V C12orf40 chr12 39683021 39683021 Missense_Mutation G G T TCGA-23-1031-01A-01W-0486-08 ENST00000324616 p.S366I C12orf40 chr12 39721003 39721003 Missense_Mutation T T G TCGA-23-1031-01A-01W-0486-08 ENST00000324616 p.C571G COL2A1 chr12 47997678 47997681 Frame_Shift_Del TCCA TCCA - TCGA-23-1031-01A-01W-0486-08 ENST00000380518 p.D152Efs*46 KRT79 chr12 52833946 52833946 Missense_Mutation A A T TCGA-23-1031-01A-01W-0486-08 ENST00000330553 p.F105L SHMT2 chr12 57231887 57231888 Frame_Shift_Ins - - A TCGA-23-1031-01A-01W-0486-08 ENST00000328923 p.G163Rfs*17 LRRIQ1 chr12 85106525 85106525 Missense_Mutation T T C TCGA-23-1031-01A-01W-0486-08 ENST00000393217 p.L1096P RPH3A chr12 112847827 112847827 Missense_Mutation A A T TCGA-23-1031-01A-01W-0486-08 ENST00000389385 p.E72V OAS2 chr12 113005094 113005094 Missense_Mutation A A T TCGA-23-1031-01A-01W-0486-08 ENST00000342315 p.E447V CIT chr12 119713595 119713595 Missense_Mutation C C T TCGA-23-1031-01A-01W-0486-08 ENST00000261833 p.G1412S GPR12 chr13 26759582 26759582 Silent T T C TCGA-23-1031-01A-01W-0486-08 ENST00000381436 p.L82L ESD chr13 46787034 46787034 Silent C A A TCGA-23-1031-01A-01W-0486-08 ENST00000378720 p.L48L KLF5 chr13 73062442 73062442 Missense_Mutation G G T TCGA-23-1031-01A-01W-0486-08 ENST00000377687 p.M281I TEP1 chr14 20383789 20383789 Missense_Mutation G G T TCGA-23-1031-01A-01W-0486-08 ENST00000262715 p.L1222M RNASE8 chr14 21058229 21058243 In_Frame_Del GGGAAGTACCCAAAC GGGAAGTACCCAAAC - TCGA-23-1031-01A-01W-0486-08 ENST00000308227 p.G113_N117del PNN chr14 39181017 39181017 Missense_Mutation T T A TCGA-23-1031-01A-01W-0486-08 ENST00000216832 p.D436E KIAA0586 chr14 58472257 58472257 Missense_Mutation A A G TCGA-23-1031-01A-01W-0486-08 ENST00000619416 p.D856G SIX1 chr14 60646247 60646247 3'UTR T T A TCGA-23-1031-01A-01W-0486-08 ENST00000247182 ZNF839 chr14 102339192 102339192 Silent G G A TCGA-23-1031-01A-01W-0486-08 ENST00000558850 p.E516E GPR176 chr15 39801410 39801410 Missense_Mutation G G T TCGA-23-1031-01A-01W-0486-08 ENST00000561100 p.P424T TYRO3 chr15 41567394 41567394 Missense_Mutation C C G TCGA-23-1031-01A-01W-0486-08 ENST00000263798 p.A273G EPB42 chr15 43206532 43206532 Silent G G C TCGA-23-1031-01A-01W-0486-08 ENST00000441366 p.A472A SPG11 chr15 44660520 44660520 Silent A A G TCGA-23-1031-01A-01W-0486-08 ENST00000261866 p.F118F SLC28A2 chr15 45265653 45265653 Missense_Mutation T T C TCGA-23-1031-01A-01W-0486-08 ENST00000347644 p.V284A AQP9 chr15 58173156 58173156 Missense_Mutation G G C TCGA-23-1031-01A-01W-0486-08 ENST00000219919 p.Q109H RP11-114H24.7 chr15 77920046 77920046 Intron C C G TCGA-23-1031-01A-01W-0486-08 ENST00000565869 CREBBP chr16 3731419 3731420 Frame_Shift_Ins - - G TCGA-23-1031-01A-01W-0486-08 ENST00000262367 p.I1649Hfs*11 ADCY9 chr16 3966248 3966248 Missense_Mutation T C C TCGA-23-1031-01A-01W-0486-08 ENST00000294016 p.M1197V ZC3H7A chr16 11767544 11767544 Missense_Mutation G G C TCGA-23-1031-01A-01W-0486-08 ENST00000355758 p.N465K GDE1 chr16 19517091 19517091 Silent A A T TCGA-23-1031-01A-01W-0486-08 ENST00000353258 p.T120T DNAH3 chr16 21019763 21019763 Missense_Mutation C C G TCGA-23-1031-01A-01W-0486-08 ENST00000261383 p.W1961C CNOT1 chr16 58545369 58545369 Missense_Mutation T T G TCGA-23-1031-01A-01W-0486-08 ENST00000317147 p.N1377H DLG4 chr17 7193711 7193711 Missense_Mutation C C T TCGA-23-1031-01A-01W-0486-08 ENST00000399506 p.R516Q TP53 chr17 7674196 7674204 In_Frame_Del GTGATGATG GTGATGATG - TCGA-23-1031-01A-01W-0486-08 ENST00000269305 p.I254_T256del CHD3 chr17 7890680 7890680 Missense_Mutation G G T TCGA-23-1031-01A-01W-0486-08 ENST00000330494 p.R108L MYH4 chr17 10445131 10445142 In_Frame_Del CAGCCATCATGG CAGCCATCATGG - TCGA-23-1031-01A-01W-0486-08 ENST00000255381 p.A1767_A1770del TEKT3 chr17 15331098 15331098 Missense_Mutation T A A TCGA-23-1031-01A-01W-0486-08 ENST00000338696 p.E163V RHOT1 chr17 32202820 32202820 Missense_Mutation G G C TCGA-23-1031-01A-01W-0486-08 ENST00000333942 p.V418L GGNBP2 chr17 36587090 36587090 Missense_Mutation G G C TCGA-23-1031-01A-01W-0486-08 ENST00000613102 p.D579H TOP2A chr17 40412971 40412974 Splice_Site TCTA TCTA - TCGA-23-1031-01A-01W-0486-08 ENST00000423485 p.X193_splice KIF2B chr17 53824323 53824323 Missense_Mutation G G C TCGA-23-1031-01A-01W-0486-08 ENST00000268919 p.Q430H RNF213 chr17 80345818 80345818 Missense_Mutation A A C TCGA-23-1031-01A-01W-0486-08 ENST00000582970 p.I2495L CEP192 chr18 13114131 13114131 Missense_Mutation G G C TCGA-23-1031-01A-01W-0486-08 ENST00000506447 p.S2390T DSG3 chr18 31466654 31466654 Silent C C T TCGA-23-1031-01A-01W-0486-08 ENST00000257189 p.S512S RFX2 chr19 6002726 6002726 Missense_Mutation C G G TCGA-23-1031-01A-01W-0486-08 ENST00000303657 p.V549L CTXN1 chr19 7925398 7925398 Silent C C G TCGA-23-1031-01A-01W-0486-08 ENST00000318978 p.V47V MUC16 chr19 8964270 8964270 Missense_Mutation G C C TCGA-23-1031-01A-01W-0486-08 ENST00000397910 p.A4167G ZNF812 chr19 9690915 9690915 Missense_Mutation C C G TCGA-23-1031-01A-01W-0486-08 ENST00000453792 p.Q196H PGLYRP2 chr19 15468694 15468694 Missense_Mutation G G T TCGA-23-1031-01A-01W-0486-08 ENST00000340880 p.P567Q HKR1 chr19 37362234 37362234 Missense_Mutation C C T TCGA-23-1031-01A-01W-0486-08 ENST00000324411 p.P147S CATSPERG chr19 38370695 38370695 Missense_Mutation C C T TCGA-23-1031-01A-01W-0486-08 ENST00000409235 p.S1128F PNMAL2 chr19 46494523 46494523 Missense_Mutation C C T TCGA-23-1031-01A-01W-0486-08 ENST00000599531 p.D315N CALM3 chr19 46609138 46609138 Missense_Mutation G G C TCGA-23-1031-01A-01W-0486-08 ENST00000291295 p.M145I SPTLC3 chr20 13009254 13009254 5'UTR G G C TCGA-23-1031-01A-01W-0486-08 ENST00000399002 MYLK2 chr20 31823566 31823566 Missense_Mutation A A C TCGA-23-1031-01A-01W-0486-08 ENST00000375985 p.K288Q DPM1 chr20 50958502 50958502 Missense_Mutation G G T TCGA-23-1031-01A-01W-0486-08 ENST00000371588 p.R8S CTCFL chr20 57503504 57503504 Missense_Mutation A A G TCGA-23-1031-01A-01W-0486-08 ENST00000243914 p.I591T PDE9A chr21 42697439 42697439 Intron A A C TCGA-23-1031-01A-01W-0486-08 ENST00000291539 OSBP2 chr22 30695234 30695234 Missense_Mutation G G C TCGA-23-1031-01A-01W-0486-08 ENST00000332585 p.E109Q CYP2D7 chr22 42141575 42141575 Missense_Mutation G G C TCGA-23-1031-01A-01W-0486-08 ENST00000612115 p.A315G SAMM50 chr22 43976106 43976106 Missense_Mutation G G A TCGA-23-1031-01A-01W-0486-08 ENST00000350028 p.E234K SUPT20HL2 chrX 24311555 24311555 RNA A A C TCGA-23-1031-01A-01W-0486-08 ENST00000486479 ZCCHC5 chrX 78657642 78657642 Missense_Mutation C C G TCGA-23-1031-01A-01W-0486-08 ENST00000321110 p.S260T TENM1 chrX 124896158 124896179 Frame_Shift_Del GCTGGTAGCCATGCCGAGAAAC GCTGGTAGCCATGCCGAGAAAC - TCGA-23-1031-01A-01W-0486-08 ENST00000371130 p.V94* RP11-219C24.6 chr1 13306735 13306735 RNA A G G TCGA-04-1648-01A-01W-0639-09 ENST00000437300 EPS8L3 chr1 109750777 109750777 Silent A A C TCGA-04-1648-01A-01W-0639-09 ENST00000361965 p.L551L RHOC chr1 112702575 112702575 Silent G G C TCGA-04-1648-01A-01W-0639-09 ENST00000285735 p.A132A PDE4DIP chr1 149001892 149001892 Nonsense_Mutation G G T TCGA-04-1648-01A-01W-0639-09 ENST00000369354 p.E1147* MCFD2 chr2 46907932 46907932 Missense_Mutation G G C TCGA-04-1648-01A-01W-0639-09 ENST00000319466 p.P63A LINC01106 chr2 110387203 110387203 5'Flank C C A TCGA-04-1648-01A-01W-0639-09 ENST00000448359 ZNF445 chr3 44446582 44446582 Missense_Mutation C C T TCGA-04-1648-01A-01W-0639-09 ENST00000396077 p.R1030K CABS1 chr4 70335176 70335176 Missense_Mutation A A G TCGA-04-1648-01A-01W-0639-09 ENST00000273936 p.D46G FGA chr4 154587620 154587620 Silent C C A TCGA-04-1648-01A-01W-0639-09 ENST00000302053 p.L134L RAPGEF2 chr4 159356047 159356047 Missense_Mutation G G A TCGA-04-1648-01A-01W-0639-09 ENST00000264431 p.G1455R CSF1R chr5 150080165 150080165 Missense_Mutation T T C TCGA-04-1648-01A-01W-0639-09 ENST00000286301 p.H160R VOPP1 chr7 55492348 55492348 Missense_Mutation G G A TCGA-04-1648-01A-01W-0639-09 ENST00000285279 p.P88S SERPINE1 chr7 101131896 101131896 Missense_Mutation G G C TCGA-04-1648-01A-01W-0639-09 ENST00000223095 p.G176A ARHGEF5 chr7 144362890 144362890 Missense_Mutation C C T TCGA-04-1648-01A-01W-0639-09 ENST00000056217 p.T74M TNFRSF11B chr8 118924092 118924092 3'UTR T T - TCGA-04-1648-01A-01W-0639-09 ENST00000297350 FAM135B chr8 138168025 138168025 Silent G G A TCGA-04-1648-01A-01W-0639-09 ENST00000395297 p.S376S IFNW1 chr9 21141415 21141415 Nonsense_Mutation A A T TCGA-04-1648-01A-01W-0639-09 ENST00000380229 p.C52* CD72 chr9 35616352 35616352 Intron C C G TCGA-04-1648-01A-01W-0639-09 ENST00000259633 FCN1 chr9 134917899 134917899 5'UTR C C T TCGA-04-1648-01A-01W-0639-09 ENST00000371806 OR4A5 chr11 54707349 54707349 Silent G G A TCGA-04-1648-01A-01W-0639-09 ENST00000319760 p.A155A CNTN1 chr12 40933720 40933720 Missense_Mutation G G A TCGA-04-1648-01A-01W-0639-09 ENST00000347616 p.R276Q COPZ1 chr12 54350519 54350519 Missense_Mutation G G C TCGA-04-1648-01A-01W-0639-09 ENST00000262061 p.R177P METTL25 chr12 82479018 82479018 Silent G G A TCGA-04-1648-01A-01W-0639-09 ENST00000248306 p.Q602Q TBX5 chr12 114355904 114355904 Silent G G A TCGA-04-1648-01A-01W-0639-09 ENST00000310346 p.D395D ANKRD20A9P chr13 18838561 18838561 RNA C C T TCGA-04-1648-01A-01W-0639-09 ENST00000457997 SLC10A1 chr14 69778464 69778464 Missense_Mutation T T G TCGA-04-1648-01A-01W-0639-09 ENST00000216540 p.N271T BAHD1 chr15 40465953 40465953 Frame_Shift_Del G G - TCGA-04-1648-01A-01W-0639-09 ENST00000416165 p.A723Pfs*76 IGSF6 chr16 21647398 21647398 Silent G G A TCGA-04-1648-01A-01W-0639-09 ENST00000268389 p.S54S CNTNAP4 chr16 76495097 76495097 Intron A A T TCGA-04-1648-01A-01W-0639-09 ENST00000611870 ATP2C2 chr16 84463645 84463645 Silent C C T TCGA-04-1648-01A-01W-0639-09 ENST00000262429 p.S918S SMG6 chr17 2300365 2300365 Missense_Mutation G G T TCGA-04-1648-01A-01W-0639-09 ENST00000263073 p.R130S KRBA2 chr17 8369107 8369107 3'UTR G G A TCGA-04-1648-01A-01W-0639-09 ENST00000331336 NGFR chr17 49512764 49512764 Missense_Mutation G G C TCGA-04-1648-01A-01W-0639-09 ENST00000172229 p.V347L MTCL1 chr18 8793104 8793104 Intron C C A TCGA-04-1648-01A-01W-0639-09 ENST00000306329 CXADRP3 chr18 14478407 14478407 RNA G G A TCGA-04-1648-01A-01W-0639-09 ENST00000581457 NOL4 chr18 34223064 34223064 Missense_Mutation G G T TCGA-04-1648-01A-01W-0639-09 ENST00000261592 p.L64M GRIN2D chr19 48414877 48414878 Frame_Shift_Ins - - C TCGA-04-1648-01A-01W-0639-09 ENST00000263269 p.R478Pfs*166 SLC9A8 chr20 49884051 49884051 Frame_Shift_Del C C - TCGA-04-1648-01A-01W-0639-09 ENST00000361573 p.S492Rfs*44 SETD4 chr21 36035952 36035952 3'UTR C C T TCGA-04-1648-01A-01W-0639-09 ENST00000332131 MKL1 chr22 40429652 40429652 Missense_Mutation C C A TCGA-04-1648-01A-01W-0639-09 ENST00000355630 p.E85D RS1 chrX 18641857 18641858 3'UTR - - A TCGA-04-1648-01A-01W-0639-09 ENST00000379984 MAGEB3 chrX 30236236 30236236 Silent G G T TCGA-04-1648-01A-01W-0639-09 ENST00000361644 p.V104V MAGEB1 chrX 30250930 30250930 Missense_Mutation T T A TCGA-04-1648-01A-01W-0639-09 ENST00000378981 p.F146Y TCEAL6 chrX 102140668 102140668 3'UTR A A G TCGA-04-1648-01A-01W-0639-09 ENST00000372774 NXF3 chrX 103084415 103084415 Missense_Mutation T T C TCGA-04-1648-01A-01W-0639-09 ENST00000395065 p.E93G DUSP9 chrX 153649632 153649632 Silent C C T TCGA-04-1648-01A-01W-0639-09 ENST00000342782 p.S258S PLEKHM2 chr1 15730626 15730626 Missense_Mutation C G G TCGA-13-0905-01B-01W-0492-08 ENST00000375799 p.P768R ASAP3 chr1 23435811 23435811 Intron A G G TCGA-13-0905-01B-01W-0492-08 ENST00000336689 AZIN2 chr1 33084072 33084072 Missense_Mutation C C G TCGA-13-0905-01B-01W-0492-08 ENST00000294517 p.P75R MAP7D1 chr1 36176254 36176254 Silent G G A TCGA-13-0905-01B-01W-0492-08 ENST00000373151 p.T302T ZC3H12A chr1 37483475 37483475 Missense_Mutation G G A TCGA-13-0905-01B-01W-0492-08 ENST00000373087 p.S555N RRAGC chr1 38855855 38855855 Missense_Mutation T T C TCGA-13-0905-01B-01W-0492-08 ENST00000373001 p.Y165C CC2D1B chr1 52357696 52357696 Missense_Mutation G G A TCGA-13-0905-01B-01W-0492-08 ENST00000371586 p.R534W PDE4B chr1 66363538 66363538 Silent G T T TCGA-13-0905-01B-01W-0492-08 ENST00000329654 p.S417S SCAMP3 chr1 155262138 155262138 Missense_Mutation C C G TCGA-13-0905-01B-01W-0492-08 ENST00000302631 p.R5T OR6Y1 chr1 158547466 158547466 Missense_Mutation T T G TCGA-13-0905-01B-01W-0492-08 ENST00000302617 p.I214L PPP1R12B chr1 202425667 202425667 Missense_Mutation C C T TCGA-13-0905-01B-01W-0492-08 ENST00000608999 p.R215C TARBP1 chr1 234429609 234429609 Nonsense_Mutation C T T TCGA-13-0905-01B-01W-0492-08 ENST00000040877 p.W893* ZNF638 chr2 71388723 71388723 Intron A A C TCGA-13-0905-01B-01W-0492-08 ENST00000264447 PKP4 chr2 158661346 158661346 Missense_Mutation G G A TCGA-13-0905-01B-01W-0492-08 ENST00000389759 p.A703T CSRNP3 chr2 165679004 165679004 Missense_Mutation G G C TCGA-13-0905-01B-01W-0492-08 ENST00000314499 p.D337H FN1 chr2 215370386 215370386 Missense_Mutation G G C TCGA-13-0905-01B-01W-0492-08 ENST00000359671 p.T2163S SUSD5 chr3 33213960 33213960 Silent G A A TCGA-13-0905-01B-01W-0492-08 ENST00000309558 p.C86C NISCH chr3 52492002 52492002 Silent C G G TCGA-13-0905-01B-01W-0492-08 ENST00000345716 p.L1345L BBX chr3 107791247 107791247 Silent G G T TCGA-13-0905-01B-01W-0492-08 ENST00000325805 p.G767G SEC22A chr3 123225150 123225150 Missense_Mutation C C G TCGA-13-0905-01B-01W-0492-08 ENST00000309934 p.L132V KALRN chr3 124446764 124446764 Missense_Mutation C C A TCGA-13-0905-01B-01W-0492-08 ENST00000240874 p.A1142E CHST2 chr3 143121932 143121932 Silent G G A TCGA-13-0905-01B-01W-0492-08 ENST00000309575 p.A372A LETM1 chr4 1823007 1823016 Frame_Shift_Del TGCAGCTCCT TGCAGCTCCT - TCGA-13-0905-01B-01W-0492-08 ENST00000302787 p.K483Rfs*16 CD38 chr4 15778389 15778389 5'UTR G G T TCGA-13-0905-01B-01W-0492-08 ENST00000226279 PDZD2 chr5 32089513 32089513 Missense_Mutation G G A TCGA-13-0905-01B-01W-0492-08 ENST00000438447 p.C2022Y PCDHB9 chr5 141187674 141187674 Missense_Mutation C C G TCGA-13-0905-01B-01W-0492-08 ENST00000316105 p.A119G ZNF300 chr5 150895815 150895815 Missense_Mutation G G A TCGA-13-0905-01B-01W-0492-08 ENST00000274599 p.S475F GABRA6 chr5 161690290 161690290 Missense_Mutation G G C TCGA-13-0905-01B-01W-0492-08 ENST00000274545 p.V255L GRM6 chr5 178986537 178986537 Missense_Mutation G G A TCGA-13-0905-01B-01W-0492-08 ENST00000231188 p.P573S C6orf47 chr6 31659484 31659484 Nonsense_Mutation A T T TCGA-13-0905-01B-01W-0492-08 ENST00000375911 p.L155* TULP1 chr6 35503642 35503642 Missense_Mutation C G G TCGA-13-0905-01B-01W-0492-08 ENST00000229771 p.G414R MEP1A chr6 46793682 46793682 Silent T C C TCGA-13-0905-01B-01W-0492-08 ENST00000230588 p.F37F FAXC chr6 99349217 99349217 Silent C C G TCGA-13-0905-01B-01W-0492-08 ENST00000389677 p.G52G PRDM1 chr6 106105449 106105449 Missense_Mutation G G A TCGA-13-0905-01B-01W-0492-08 ENST00000369096 p.S430N TRAF3IP2 chr6 111591473 111591473 Missense_Mutation T T G TCGA-13-0905-01B-01W-0492-08 ENST00000340026 p.D214A ENPP3 chr6 131726198 131726198 Splice_Region T T C TCGA-13-0905-01B-01W-0492-08 ENST00000357639 p.L651L SHPRH chr6 145935067 145935067 Missense_Mutation C A A TCGA-13-0905-01B-01W-0492-08 ENST00000275233 p.D944Y SHPRH chr6 145935068 145935068 Silent C T T TCGA-13-0905-01B-01W-0492-08 ENST00000275233 p.Q943Q PDE10A chr6 165430299 165430299 Missense_Mutation A T T TCGA-13-0905-01B-01W-0492-08 ENST00000366882 p.L254H DAGLB chr7 6416680 6416680 Silent G G A TCGA-13-0905-01B-01W-0492-08 ENST00000297056 p.A458A VSTM2A chr7 54549938 54549938 Nonsense_Mutation C C A TCGA-13-0905-01B-01W-0492-08 ENST00000407838 p.Y134* TECPR1 chr7 98225034 98225034 Missense_Mutation G G A TCGA-13-0905-01B-01W-0492-08 ENST00000447648 p.T861M CSMD1 chr8 3219400 3219400 Silent T T C TCGA-13-0905-01B-01W-0492-08 ENST00000520002 p.E1510E CHRNB3 chr8 42697474 42697474 5'UTR A A C TCGA-13-0905-01B-01W-0492-08 ENST00000289957 ZFAND1 chr8 81714870 81714870 Missense_Mutation A A T TCGA-13-0905-01B-01W-0492-08 ENST00000220669 p.C98S UBR5 chr8 102265223 102265223 Missense_Mutation T T A TCGA-13-0905-01B-01W-0492-08 ENST00000520539 p.D2493V EFR3A chr8 132003271 132003271 Silent G G A TCGA-13-0905-01B-01W-0492-08 ENST00000254624 p.L782L KCNQ3 chr8 132132241 132132241 Missense_Mutation G G C TCGA-13-0905-01B-01W-0492-08 ENST00000388996 p.P608R HGH1 chr8 144139285 144139285 Missense_Mutation C C T TCGA-13-0905-01B-01W-0492-08 ENST00000347708 p.R328W AGTPBP1 chr9 85632997 85632997 Silent A A T TCGA-13-0905-01B-01W-0492-08 ENST00000357081 p.L560L MRRF chr9 122313326 122313326 Missense_Mutation C G G TCGA-13-0905-01B-01W-0492-08 ENST00000344641 p.N217K RPP38 chr10 15103377 15103377 Silent G G T TCGA-13-0905-01B-01W-0492-08 ENST00000378197 p.V21V ANXA8L1 chr10 46382678 46382678 Missense_Mutation C C T TCGA-13-0905-01B-01W-0492-08 ENST00000619162 p.H103Y DMBT1 chr10 122631033 122631033 Missense_Mutation G G T TCGA-13-0905-01B-01W-0492-08 ENST00000338354 p.G1904V QSER1 chr11 32935183 32935183 Missense_Mutation G G C TCGA-13-0905-01B-01W-0492-08 ENST00000399302 p.G1180R GYLTL1B chr11 45927331 45927331 Missense_Mutation G G T TCGA-13-0905-01B-01W-0492-08 ENST00000325468 p.A448S B3GAT3 chr11 62617119 62617119 Missense_Mutation G G C TCGA-13-0905-01B-01W-0492-08 ENST00000265471 p.N162K UTP20 chr12 101290258 101290258 Missense_Mutation A T T TCGA-13-0905-01B-01W-0492-08 ENST00000261637 p.H240L LCP1 chr13 46158541 46158541 Silent G T T TCGA-13-0905-01B-01W-0492-08 ENST00000323076 p.G113G SUPT16H chr14 21363014 21363038 Splice_Site TGCTCAGTGAAAACTCTTACTTCTG TGCTCAGTGAAAACTCTTACTTCTG - TCGA-13-0905-01B-01W-0492-08 ENST00000216297 p.X503_splice CGRRF1 chr14 54522555 54522555 Missense_Mutation G G C TCGA-13-0905-01B-01W-0492-08 ENST00000216420 p.G69A FNTB chr14 65054612 65054612 Missense_Mutation G G A TCGA-13-0905-01B-01W-0492-08 ENST00000246166 p.G369S SERPINA5 chr14 94587513 94587513 Missense_Mutation G G C TCGA-13-0905-01B-01W-0492-08 ENST00000329597 p.D51H CHP1 chr15 41278821 41278821 Missense_Mutation G A A TCGA-13-0905-01B-01W-0492-08 ENST00000334660 p.A156T B2M chr15 44716300 44716301 Intron - - T TCGA-13-0905-01B-01W-0492-08 ENST00000558401 ERCC4 chr16 13935303 13935303 Silent C C T TCGA-13-0905-01B-01W-0492-08 ENST00000311895 p.D457D PRKCB chr16 24154774 24154774 Missense_Mutation T T A TCGA-13-0905-01B-01W-0492-08 ENST00000321728 p.C386S BBS2 chr16 56500994 56500994 Silent T T A TCGA-13-0905-01B-01W-0492-08 ENST00000245157 p.A419A TP53 chr17 7673802 7673802 Missense_Mutation C G G TCGA-13-0905-01B-01W-0492-08 ENST00000269305 p.R273P TOP2A chr17 40412934 40412937 Frame_Shift_Del TCCA TCCA - TCGA-13-0905-01B-01W-0492-08 ENST00000423485 p.M204Nfs*34 LDLRAD4 chr18 13645398 13645398 Missense_Mutation T T G TCGA-13-0905-01B-01W-0492-08 ENST00000359446 p.I221S IZUMO4 chr19 2098544 2098544 Intron C C G TCGA-13-0905-01B-01W-0492-08 ENST00000395301 CPAMD8 chr19 17009310 17009310 Missense_Mutation T T C TCGA-13-0905-01B-01W-0492-08 ENST00000443236 p.Y213C PDE4C chr19 18210916 18210916 3'UTR C C T TCGA-13-0905-01B-01W-0492-08 ENST00000355502 ABCG1 chr21 42282323 42282323 Missense_Mutation G G A TCGA-13-0905-01B-01W-0492-08 ENST00000361802 p.R213Q PCNT chr21 46363889 46363889 Missense_Mutation A A C TCGA-13-0905-01B-01W-0492-08 ENST00000359568 p.H855P CECR1 chr22 17203735 17203735 Missense_Mutation T T G TCGA-13-0905-01B-01W-0492-08 ENST00000262607 p.E194A KAL1 chrX 8532894 8532894 3'UTR C C T TCGA-13-0905-01B-01W-0492-08 ENST00000262648 FAM47B chrX 34943703 34943703 Missense_Mutation G G A TCGA-13-0905-01B-01W-0492-08 ENST00000329357 p.R291H WASF4P chrX 47804210 47804210 RNA T T G TCGA-13-0905-01B-01W-0492-08 ENST00000444248 LAS1L chrX 65518247 65518247 Missense_Mutation T T C TCGA-13-0905-01B-01W-0492-08 ENST00000374811 p.E556G SERPINA7 chrX 106037066 106037066 5'UTR G G T TCGA-13-0905-01B-01W-0492-08 ENST00000327674 L1CAM chrX 153865728 153865728 Silent G G C TCGA-13-0905-01B-01W-0492-08 ENST00000370060 p.V841V GPR153 chr1 6254143 6254143 Missense_Mutation T T C TCGA-24-0979-01A-01W-0486-08 ENST00000377893 p.S121G MASP2 chr1 11037788 11037788 Missense_Mutation C C G TCGA-24-0979-01A-01W-0486-08 ENST00000400897 p.A305P FBXO42 chr1 16251131 16251131 Missense_Mutation C C A TCGA-24-0979-01A-01W-0486-08 ENST00000375592 p.A565S AKR7A3 chr1 19284058 19284058 Missense_Mutation C C A TCGA-24-0979-01A-01W-0486-08 ENST00000361640 p.A258S COL16A1 chr1 31652784 31652784 Missense_Mutation C C A TCGA-24-0979-01A-01W-0486-08 ENST00000373672 p.G1561V SPOCD1 chr1 31815157 31815157 Silent G G T TCGA-24-0979-01A-01W-0486-08 ENST00000360482 p.I59I FAM159A chr1 52657043 52657043 3'UTR A A T TCGA-24-0979-01A-01W-0486-08 ENST00000517870 SSBP3 chr1 54228819 54228819 Missense_Mutation A A T TCGA-24-0979-01A-01W-0486-08 ENST00000371320 p.M312K INADL chr1 61766285 61766285 Missense_Mutation C C T TCGA-24-0979-01A-01W-0486-08 ENST00000371158 p.H66Y HSD3BP2 chr1 119445373 119445373 RNA G G A TCGA-24-0979-01A-01W-0486-08 ENST00000457615 FLG2 chr1 152354592 152354592 Missense_Mutation C C A TCGA-24-0979-01A-01W-0486-08 ENST00000388718 p.G1065V ATP8B2 chr1 154343480 154343480 Missense_Mutation T T C TCGA-24-0979-01A-01W-0486-08 ENST00000368489 p.L590P ARHGEF2 chr1 155951965 155951965 Missense_Mutation T T C TCGA-24-0979-01A-01W-0486-08 ENST00000361247 p.N709S NHLH1 chr1 160370754 160370754 Missense_Mutation T T C TCGA-24-0979-01A-01W-0486-08 ENST00000302101 p.M8T SCYL3 chr1 169855905 169855905 Missense_Mutation C C G TCGA-24-0979-01A-01W-0486-08 ENST00000367770 p.L455F PLD5 chr1 242090043 242090043 Silent T T G TCGA-24-0979-01A-01W-0486-08 ENST00000442594 p.A474A OR2W3 chr1 247896092 247896092 Missense_Mutation G G A TCGA-24-0979-01A-01W-0486-08 ENST00000360358 p.C169Y TPO chr2 1414415 1414415 Missense_Mutation G G T TCGA-24-0979-01A-01W-0486-08 ENST00000329066 p.A3S APOB chr2 21003275 21003275 Missense_Mutation A A T TCGA-24-0979-01A-01W-0486-08 ENST00000233242 p.D4049E MTIF2 chr2 55246395 55246395 Missense_Mutation C C A TCGA-24-0979-01A-01W-0486-08 ENST00000263629 p.D350Y EIF2AK3 chr2 88590922 88590922 Missense_Mutation C C G TCGA-24-0979-01A-01W-0486-08 ENST00000303236 p.E300Q ANKRD36BP2 chr2 88782746 88782746 RNA A A C TCGA-24-0979-01A-01W-0486-08 ENST00000622311 ANKRD36BP2 chr2 88782748 88782749 RNA - - TG TCGA-24-0979-01A-01W-0486-08 ENST00000622311 GCC2 chr2 108471263 108471263 Missense_Mutation T T G TCGA-24-0979-01A-01W-0486-08 ENST00000309863 p.V645G IL36G chr2 112984878 112984878 Silent C C A TCGA-24-0979-01A-01W-0486-08 ENST00000259205 p.P113P MBD5 chr2 148489575 148489575 Missense_Mutation G G T TCGA-24-0979-01A-01W-0486-08 ENST00000407073 p.D1082Y PIKFYVE chr2 208335872 208335872 Nonsense_Mutation A A T TCGA-24-0979-01A-01W-0486-08 ENST00000264380 p.K1446* SPHKAP chr2 228016693 228016693 Silent C C T TCGA-24-0979-01A-01W-0486-08 ENST00000392056 p.L1387L GRM7 chr3 7415119 7415119 Missense_Mutation C C T TCGA-24-0979-01A-01W-0486-08 ENST00000357716 p.T377M FGD5 chr3 14820653 14820653 Missense_Mutation G G C TCGA-24-0979-01A-01W-0486-08 ENST00000285046 p.G528R TLR9 chr3 52225535 52225535 5'UTR G G A TCGA-24-0979-01A-01W-0486-08 ENST00000360658 DPPA4 chr3 109330504 109330504 Intron G G A TCGA-24-0979-01A-01W-0486-08 ENST00000335658 PARP15 chr3 122635177 122635177 Missense_Mutation G G A TCGA-24-0979-01A-01W-0486-08 ENST00000464300 p.S577N PARP14 chr3 122703885 122703885 Silent A A T TCGA-24-0979-01A-01W-0486-08 ENST00000474629 p.T1075T RPN1 chr3 128625568 128625568 Missense_Mutation A A G TCGA-24-0979-01A-01W-0486-08 ENST00000296255 p.I454T LPP chr3 188874518 188874518 3'UTR C C G TCGA-24-0979-01A-01W-0486-08 ENST00000617246 KIAA0232 chr4 6861265 6861265 Missense_Mutation G G T TCGA-24-0979-01A-01W-0486-08 ENST00000307659 p.A295S GRXCR1 chr4 43020361 43020364 Frame_Shift_Del AGAA AGAA - TCGA-24-0979-01A-01W-0486-08 ENST00000399770 p.K213Ffs*4 HERC5 chr4 88504302 88504302 Missense_Mutation C C T TCGA-24-0979-01A-01W-0486-08 ENST00000264350 p.R885W CCRN4L chr4 139043353 139043353 Intron A A C TCGA-24-0979-01A-01W-0486-08 ENST00000280614 MAML3 chr4 139890174 139890174 Missense_Mutation G G C TCGA-24-0979-01A-01W-0486-08 ENST00000509479 p.P421R RXFP1 chr4 158521943 158521943 5'UTR C C T TCGA-24-0979-01A-01W-0486-08 ENST00000307765 ADAMTS12 chr5 33624328 33624328 Silent G G A TCGA-24-0979-01A-01W-0486-08 ENST00000504830 p.I682I PLCXD3 chr5 41382139 41382139 Missense_Mutation C C T TCGA-24-0979-01A-01W-0486-08 ENST00000328457 p.G167R NSA2 chr5 74770693 74770693 Silent T T C TCGA-24-0979-01A-01W-0486-08 ENST00000610426 p.V135V POLK chr5 75569378 75569378 Silent T T C TCGA-24-0979-01A-01W-0486-08 ENST00000241436 p.N98N GABRA6 chr5 161690303 161690303 Missense_Mutation A A G TCGA-24-0979-01A-01W-0486-08 ENST00000274545 p.Q259R TENM2 chr5 168247812 168247812 Missense_Mutation C C G TCGA-24-0979-01A-01W-0486-08 ENST00000518659 p.N2291K PANK3 chr5 168564002 168564002 Missense_Mutation C C G TCGA-24-0979-01A-01W-0486-08 ENST00000239231 p.E233D MSH5 chr6 31759946 31759946 Silent A A G TCGA-24-0979-01A-01W-0486-08 ENST00000375750 p.Q552Q ITPR3 chr6 33680664 33680664 Missense_Mutation A A G TCGA-24-0979-01A-01W-0486-08 ENST00000374316 p.N1487S HTR1E chr6 87015480 87015480 Missense_Mutation C C A TCGA-24-0979-01A-01W-0486-08 ENST00000305344 p.T49N PDE10A chr6 165413541 165413541 Missense_Mutation A A C TCGA-24-0979-01A-01W-0486-08 ENST00000366882 p.M403R PSMA2 chr7 42924788 42924788 Silent C C T TCGA-24-0979-01A-01W-0486-08 ENST00000223321 p.V87V URGCP chr7 43878287 43878287 Silent C C T TCGA-24-0979-01A-01W-0486-08 ENST00000453200 p.G392G RABGEF1 chr7 66805258 66805258 Silent T T C TCGA-24-0979-01A-01W-0486-08 ENST00000380828 p.D327D PTPRZ1 chr7 122038834 122038834 Frame_Shift_Del G G - TCGA-24-0979-01A-01W-0486-08 ENST00000393386 p.E1817Nfs*9 RP1L1 chr8 10608673 10608673 Missense_Mutation C C T TCGA-24-0979-01A-01W-0486-08 ENST00000382483 p.G1809R ZNF705D chr8 12113202 12113202 3'Flank T T A TCGA-24-0979-01A-01W-0486-08 ENST00000400078 IDO2 chr8 39949237 39949237 Missense_Mutation G G T TCGA-24-0979-01A-01W-0486-08 ENST00000389060 p.E24D PXDNL chr8 51408247 51408247 Missense_Mutation A A G TCGA-24-0979-01A-01W-0486-08 ENST00000356297 p.L1126P KCNQ3 chr8 132186131 132186131 Missense_Mutation T T G TCGA-24-0979-01A-01W-0486-08 ENST00000388996 p.K146T PHF2 chr9 93654559 93654559 Silent C C T TCGA-24-0979-01A-01W-0486-08 ENST00000359246 p.T312T PIK3AP1 chr10 96620441 96620441 Missense_Mutation C C T TCGA-24-0979-01A-01W-0486-08 ENST00000339364 p.G618S AHNAK chr11 62526450 62526450 Missense_Mutation G G A TCGA-24-0979-01A-01W-0486-08 ENST00000378024 p.P2656L MRPL49 chr11 65125767 65125767 Silent G G T TCGA-24-0979-01A-01W-0486-08 ENST00000279242 p.L132L C2CD3 chr11 74123061 74123061 Missense_Mutation A A G TCGA-24-0979-01A-01W-0486-08 ENST00000334126 p.V431A FAT3 chr11 92844147 92844147 Missense_Mutation A A T TCGA-24-0979-01A-01W-0486-08 ENST00000525166 p.S3444C TMPRSS4 chr11 118107856 118107856 Missense_Mutation C C T TCGA-24-0979-01A-01W-0486-08 ENST00000437212 p.R175C TECTA chr11 121160297 121160297 Missense_Mutation G G T TCGA-24-0979-01A-01W-0486-08 ENST00000264037 p.V1618L SLC38A4 chr12 46776933 46776933 Missense_Mutation G G A TCGA-24-0979-01A-01W-0486-08 ENST00000266579 p.A382V KMT2D chr12 49043870 49043870 Nonsense_Mutation G G A TCGA-24-0979-01A-01W-0486-08 ENST00000301067 p.Q1773* SCN8A chr12 51807148 51807148 Missense_Mutation A A T TCGA-24-0979-01A-01W-0486-08 ENST00000354534 p.T1888S ACVR1B chr12 51984167 51984167 Splice_Site G G C TCGA-24-0979-01A-01W-0486-08 ENST00000257963 p.X327_splice NCKAP1L chr12 54517560 54517560 Missense_Mutation T T C TCGA-24-0979-01A-01W-0486-08 ENST00000293373 p.F375L NACA chr12 56718130 56718130 Intron G G A TCGA-24-0979-01A-01W-0486-08 ENST00000356769 XPOT chr12 64420481 64420481 Missense_Mutation G G C TCGA-24-0979-01A-01W-0486-08 ENST00000332707 p.C268S LRRC43 chr12 122203360 122203360 Missense_Mutation C C T TCGA-24-0979-01A-01W-0486-08 ENST00000339777 p.P630L GOLGA3 chr12 132789038 132789038 Missense_Mutation T T C TCGA-24-0979-01A-01W-0486-08 ENST00000204726 p.T934A ELF1 chr13 40943085 40943085 Missense_Mutation G G C TCGA-24-0979-01A-01W-0486-08 ENST00000239882 p.P225A OXGR1 chr13 96986886 96986886 Missense_Mutation C C A TCGA-24-0979-01A-01W-0486-08 ENST00000298440 p.A292S EDDM3B chr14 20770226 20770226 Missense_Mutation A A G TCGA-24-0979-01A-01W-0486-08 ENST00000326783 p.K26E SLC39A2 chr14 21001253 21001253 Missense_Mutation C C T TCGA-24-0979-01A-01W-0486-08 ENST00000298681 p.H202Y KLHDC2 chr14 49777866 49777866 Missense_Mutation G G A TCGA-24-0979-01A-01W-0486-08 ENST00000298307 p.D127N MLH3 chr14 75048184 75048184 Missense_Mutation A A G TCGA-24-0979-01A-01W-0486-08 ENST00000355774 p.F491S CACNA1H chr16 1200529 1200529 Silent C C T TCGA-24-0979-01A-01W-0486-08 ENST00000348261 p.I359I SRRM2 chr16 2763697 2763698 Frame_Shift_Ins - - TG TCGA-24-0979-01A-01W-0486-08 ENST00000301740 p.K1058* DPEP2 chr16 67991797 67991797 Intron C C T TCGA-24-0979-01A-01W-0486-08 ENST00000393847 FBXO39 chr17 6780372 6780372 Missense_Mutation C C A TCGA-24-0979-01A-01W-0486-08 ENST00000321535 p.N168K TP53 chr17 7674220 7674220 Missense_Mutation C C T TCGA-24-0979-01A-01W-0486-08 ENST00000269305 p.R248Q EFNB3 chr17 7705621 7705622 Frame_Shift_Ins - - G TCGA-24-0979-01A-01W-0486-08 ENST00000226091 p.V11Rfs*30 KRT16P2 chr17 16832445 16832445 RNA C C A TCGA-24-0979-01A-01W-0486-08 ENST00000414673 SLC47A2 chr17 19706730 19706730 Silent G G T TCGA-24-0979-01A-01W-0486-08 ENST00000325411 p.G289G FAM134C chr17 42585215 42585215 Missense_Mutation C C T TCGA-24-0979-01A-01W-0486-08 ENST00000309428 p.D213N WNK4 chr17 42796542 42796542 Missense_Mutation C C G TCGA-24-0979-01A-01W-0486-08 ENST00000246914 p.S1231R HDAC5 chr17 44087549 44087549 Missense_Mutation G G C TCGA-24-0979-01A-01W-0486-08 ENST00000586802 p.Q583E COIL chr17 56942125 56942125 Splice_Site T T A TCGA-24-0979-01A-01W-0486-08 ENST00000240316 p.X520_splice LAMA1 chr18 7033076 7033076 Missense_Mutation C C A TCGA-24-0979-01A-01W-0486-08 ENST00000389658 p.D691Y LAMA3 chr18 23858801 23858801 Missense_Mutation G G A TCGA-24-0979-01A-01W-0486-08 ENST00000313654 p.C1465Y SYT4 chr18 43277367 43277367 5'UTR G G C TCGA-24-0979-01A-01W-0486-08 ENST00000255224 MALT1 chr18 58747638 58747638 Silent C C T TCGA-24-0979-01A-01W-0486-08 ENST00000348428 p.F757F INSR chr19 7117312 7117312 Missense_Mutation A A G TCGA-24-0979-01A-01W-0486-08 ENST00000302850 p.F1298S GADD45GIP1 chr19 12954388 12954388 Silent G G C TCGA-24-0979-01A-01W-0486-08 ENST00000316939 p.L163L EPS15L1 chr19 16417947 16417947 Splice_Site C C A TCGA-24-0979-01A-01W-0486-08 ENST00000248070 p.X369_splice CPAMD8 chr19 16980686 16980686 Missense_Mutation C C A TCGA-24-0979-01A-01W-0486-08 ENST00000443236 p.V513F ZNF492 chr19 22653348 22653348 5'UTR G G T TCGA-24-0979-01A-01W-0486-08 ENST00000456783 ZNF99 chr19 22758444 22758444 Missense_Mutation C C A TCGA-24-0979-01A-01W-0486-08 ENST00000596209 p.A489S RYR1 chr19 38525497 38525497 Missense_Mutation G G A TCGA-24-0979-01A-01W-0486-08 ENST00000359596 p.A3541T DTD1 chr20 18596171 18596171 Silent G G A TCGA-24-0979-01A-01W-0486-08 ENST00000377452 p.E100E ZNF341 chr20 33783835 33783835 Missense_Mutation A A G TCGA-24-0979-01A-01W-0486-08 ENST00000375200 p.Y608C RBM12 chr20 35654260 35654260 Missense_Mutation C C T TCGA-24-0979-01A-01W-0486-08 ENST00000359646 p.D355N HNF4A chr20 44428384 44428384 Silent G G A TCGA-24-0979-01A-01W-0486-08 ENST00000316099 p.L393L PREX1 chr20 48708342 48708342 Missense_Mutation C C A TCGA-24-0979-01A-01W-0486-08 ENST00000371941 p.C234F RSPH1 chr21 42472848 42472848 Silent T T C TCGA-24-0979-01A-01W-0486-08 ENST00000291536 p.E300E TRIOBP chr22 37724993 37724993 Missense_Mutation G G A TCGA-24-0979-01A-01W-0486-08 ENST00000406386 p.D813N PHF8 chrX 53984999 53984999 Missense_Mutation C C G TCGA-24-0979-01A-01W-0486-08 ENST00000357988 p.W822C TRO chrX 54923712 54923712 Missense_Mutation C C A TCGA-24-0979-01A-01W-0486-08 ENST00000173898 p.L394M BEX2 chrX 103309953 103309953 Silent C C T TCGA-24-0979-01A-01W-0486-08 ENST00000372674 p.A8A DUSP9 chrX 153650145 153650145 Missense_Mutation A T T TCGA-24-0979-01A-01W-0486-08 ENST00000342782 p.N332I IFNLR1 chr1 24157561 24157561 Missense_Mutation C C T TCGA-61-1899-01A-01W-0639-09 ENST00000327535 p.E378K RPAP2 chr1 92380832 92380837 In_Frame_Del AAGTCT AAGTCT - TCGA-61-1899-01A-01W-0639-09 ENST00000610020 p.S600_L601del RNF115 chr1 145753048 145753048 Missense_Mutation T T C TCGA-61-1899-01A-01W-0639-09 ENST00000582693 p.I144V PRRC2C chr1 171535530 171535530 Missense_Mutation C C T TCGA-61-1899-01A-01W-0639-09 ENST00000338920 p.P657L NPHS2 chr1 179559694 179559694 Silent C C T TCGA-61-1899-01A-01W-0639-09 ENST00000367615 p.E173E RGS1 chr1 192576832 192576832 Missense_Mutation C C A TCGA-61-1899-01A-01W-0639-09 ENST00000367459 p.Q93K OR2M4 chr1 248238971 248238971 Silent C C T TCGA-61-1899-01A-01W-0639-09 ENST00000306687 p.L15L SLC5A6 chr2 27204862 27204862 Silent G G C TCGA-61-1899-01A-01W-0639-09 ENST00000310574 p.L268L EHD3 chr2 31261645 31261645 Missense_Mutation A A G TCGA-61-1899-01A-01W-0639-09 ENST00000322054 p.I338V LRP1B chr2 140903155 140903155 Silent C C G TCGA-61-1899-01A-01W-0639-09 ENST00000389484 p.S1177S CCDC141 chr2 178837443 178837443 Missense_Mutation C C A TCGA-61-1899-01A-01W-0639-09 ENST00000420890 p.G1259V GPR1 chr2 206176803 206176803 Nonsense_Mutation G G A TCGA-61-1899-01A-01W-0639-09 ENST00000407325 p.R149* MARCH4 chr2 216259410 216259410 Missense_Mutation A A G TCGA-61-1899-01A-01W-0639-09 ENST00000273067 p.Y379H CCR3 chr3 46266026 46266026 Missense_Mutation G G A TCGA-61-1899-01A-01W-0639-09 ENST00000357422 p.A290T SPICE1 chr3 113457208 113457208 Missense_Mutation T T C TCGA-61-1899-01A-01W-0639-09 ENST00000295872 p.I529V PIK3CB chr3 138665082 138665082 Missense_Mutation A A G TCGA-61-1899-01A-01W-0639-09 ENST00000289153 p.F876L KCNAB1 chr3 156459868 156459868 Nonsense_Mutation G G A TCGA-61-1899-01A-01W-0639-09 ENST00000490337 p.W160* IL12A-AS1 chr3 160101098 160101098 Intron G G A TCGA-61-1899-01A-01W-0639-09 ENST00000497452 LYAR chr4 4268556 4268556 Frame_Shift_Del T T - TCGA-61-1899-01A-01W-0639-09 ENST00000343470 p.I327* CYTL1 chr4 5017179 5017179 Nonsense_Mutation C C A TCGA-61-1899-01A-01W-0639-09 ENST00000307746 p.E52* CDH10 chr5 24492829 24492829 Missense_Mutation G G C TCGA-61-1899-01A-01W-0639-09 ENST00000264463 p.Q538E AGXT2 chr5 35025864 35025864 Intron G G C TCGA-61-1899-01A-01W-0639-09 ENST00000231420 F2R chr5 76732757 76732757 Missense_Mutation G G A TCGA-61-1899-01A-01W-0639-09 ENST00000319211 p.V178I PCDHB8 chr5 141179134 141179134 Missense_Mutation C C A TCGA-61-1899-01A-01W-0639-09 ENST00000239444 p.A367E FNDC9 chr5 157343185 157343185 Missense_Mutation C C A TCGA-61-1899-01A-01W-0639-09 ENST00000312349 p.A118S SH3PXD2B chr5 172338663 172338664 Frame_Shift_Ins - - C TCGA-61-1899-01A-01W-0639-09 ENST00000311601 p.Q815Pfs*3 SYCP2L chr6 10907610 10907610 Missense_Mutation C C A TCGA-61-1899-01A-01W-0639-09 ENST00000283141 p.L249I KIFC1 chr6 33406831 33406831 Missense_Mutation G G A TCGA-61-1899-01A-01W-0639-09 ENST00000428849 p.E645K TRERF1 chr6 42228201 42228201 3'UTR T T - TCGA-61-1899-01A-01W-0639-09 ENST00000372922 SEMA3C chr7 80745237 80745237 Missense_Mutation T T A TCGA-61-1899-01A-01W-0639-09 ENST00000265361 p.Q638L GPR37 chr7 124746612 124746612 Silent G G A TCGA-61-1899-01A-01W-0639-09 ENST00000303921 p.N585N CTAGE4 chr7 144184545 144184545 Missense_Mutation A A T TCGA-61-1899-01A-01W-0639-09 ENST00000486333 p.T348S PAXIP1 chr7 154946624 154946624 Intron G G A TCGA-61-1899-01A-01W-0639-09 ENST00000397192 PTPRN2 chr7 158133832 158133832 Silent G G A TCGA-61-1899-01A-01W-0639-09 ENST00000389418 p.A467A RIPK2 chr8 89786635 89786635 Missense_Mutation C C G TCGA-61-1899-01A-01W-0639-09 ENST00000220751 p.P358A CSMD3 chr8 112263811 112263811 Splice_Region A A T TCGA-61-1899-01A-01W-0639-09 ENST00000297405 p.A3230A FREM1 chr9 14769773 14769773 Missense_Mutation C C T TCGA-61-1899-01A-01W-0639-09 ENST00000380880 p.V1719M ABCA1 chr9 104792853 104792853 Missense_Mutation C C T TCGA-61-1899-01A-01W-0639-09 ENST00000374736 p.R1897Q FAM208B chr10 5749772 5749772 Silent A A G TCGA-61-1899-01A-01W-0639-09 ENST00000328090 p.E2117E ZNF25 chr10 37952316 37952316 Silent T T C TCGA-61-1899-01A-01W-0639-09 ENST00000302609 p.G394G LDB1 chr10 102110649 102110650 Frame_Shift_Ins - - C TCGA-61-1899-01A-01W-0639-09 ENST00000425280 p.A136Cfs*9 BUB3 chr10 123163924 123163924 3'UTR G G T TCGA-61-1899-01A-01W-0639-09 ENST00000368865 TRIM44 chr11 35806414 35806414 3'UTR C C A TCGA-61-1899-01A-01W-0639-09 ENST00000299413 OR5M3 chr11 56469618 56469618 Missense_Mutation C C T TCGA-61-1899-01A-01W-0639-09 ENST00000312240 p.D294N MYF5 chr12 80717459 80717459 Missense_Mutation G G C TCGA-61-1899-01A-01W-0639-09 ENST00000228644 p.E132D SETDB2 chr13 49461129 49461129 Missense_Mutation G G T TCGA-61-1899-01A-01W-0639-09 ENST00000354234 p.A59S SETDB2 chr13 49461130 49461130 Missense_Mutation C C T TCGA-61-1899-01A-01W-0639-09 ENST00000354234 p.A59V KPNA3 chr13 49722028 49722028 Missense_Mutation C C T TCGA-61-1899-01A-01W-0639-09 ENST00000261667 p.R218Q OR4N2 chr14 19828317 19828317 Missense_Mutation G G A TCGA-61-1899-01A-01W-0639-09 ENST00000315947 p.R290H C14orf37 chr14 58139299 58139299 Silent G G A TCGA-61-1899-01A-01W-0639-09 ENST00000267485 p.S20S C15orf43 chr15 44973909 44973909 Silent G G A TCGA-61-1899-01A-01W-0639-09 ENST00000340827 p.Q159Q USP7 chr16 8921221 8921221 Missense_Mutation C C G TCGA-61-1899-01A-01W-0639-09 ENST00000344836 p.R153P ITGAL chr16 30521608 30521608 Silent C C T TCGA-61-1899-01A-01W-0639-09 ENST00000356798 p.P1152P ZNF423 chr16 49730804 49730804 Silent G G A TCGA-61-1899-01A-01W-0639-09 ENST00000262383 p.L82L VAC14 chr16 70783072 70783072 Missense_Mutation C C T TCGA-61-1899-01A-01W-0639-09 ENST00000261776 p.E258K ZNF778 chr16 89227334 89227334 Missense_Mutation T T C TCGA-61-1899-01A-01W-0639-09 ENST00000620195 p.L321P TP53 chr17 7673534 7673534 Splice_Site C T T TCGA-61-1899-01A-01W-0639-09 ENST00000269305 p.X331_splice MYH13 chr17 10316026 10316026 Splice_Site C C T TCGA-61-1899-01A-01W-0639-09 ENST00000252172 p.X1247_splice GOSR2 chr17 46935433 46935433 Intron A A G TCGA-61-1899-01A-01W-0639-09 ENST00000393456 ST6GALNAC2 chr17 76561127 76561127 3'Flank C C T TCGA-61-1899-01A-01W-0639-09 ENST00000225276 MYO5B chr18 49962948 49962948 Splice_Site C C G TCGA-61-1899-01A-01W-0639-09 ENST00000285039 p.X468_splice DOCK6 chr19 11243094 11243094 Missense_Mutation G G A TCGA-61-1899-01A-01W-0639-09 ENST00000294618 p.P482L PSG6 chr19 42917826 42917826 5'UTR G G T TCGA-61-1899-01A-01W-0639-09 ENST00000292125 MIR519E chr19 53679964 53679964 RNA G G A TCGA-61-1899-01A-01W-0639-09 ENST00000385075 MIR519E chr19 53679965 53679965 RNA G G A TCGA-61-1899-01A-01W-0639-09 ENST00000385075 LILRB4 chr19 54666705 54666705 Missense_Mutation G G A TCGA-61-1899-01A-01W-0639-09 ENST00000391736 p.V333M AC016629.3 chr19 58599170 58599170 RNA A A C TCGA-61-1899-01A-01W-0639-09 ENST00000596427 ZNF341 chr20 33745177 33745177 Missense_Mutation C C T TCGA-61-1899-01A-01W-0639-09 ENST00000375200 p.R73W RALY chr20 34072226 34072227 Frame_Shift_Ins - - T TCGA-61-1899-01A-01W-0639-09 ENST00000246194 p.S52Ffs*14 PHF20 chr20 35871056 35871056 Missense_Mutation C C T TCGA-61-1899-01A-01W-0639-09 ENST00000374012 p.P342S NCAM2 chr21 21284300 21284300 Silent C C T TCGA-61-1899-01A-01W-0639-09 ENST00000400546 p.T79T BRWD1 chr21 39296279 39296279 Missense_Mutation G G A TCGA-61-1899-01A-01W-0639-09 ENST00000333229 p.S145F C2CD2 chr21 41899246 41899246 Silent C C T TCGA-61-1899-01A-01W-0639-09 ENST00000380486 p.P559P LRRC7 chr1 70038999 70038999 Missense_Mutation G G T TCGA-24-0966-01A-01W-0420-08 ENST00000035383 p.A1021S NOTCH2 chr1 119948472 119948472 Silent T T C TCGA-24-0966-01A-01W-0420-08 ENST00000256646 p.E898E TP53BP2 chr1 223792519 223792519 Missense_Mutation C C G TCGA-24-0966-01A-01W-0420-08 ENST00000343537 p.D956H UBBP1 chr2 136329800 136329800 RNA C C T TCGA-24-0966-01A-01W-0420-08 ENST00000392399 NYAP2 chr2 225408974 225408974 Missense_Mutation G G A TCGA-24-0966-01A-01W-0420-08 ENST00000272907 p.D32N N4BP2 chr4 40123153 40123153 Missense_Mutation G G A TCGA-24-0966-01A-01W-0420-08 ENST00000261435 p.V1409I TWISTNB chr7 19698386 19698386 Missense_Mutation C C G TCGA-24-0966-01A-01W-0420-08 ENST00000222567 p.S316T C7orf66 chr7 108884464 108884464 RNA T T C TCGA-24-0966-01A-01W-0420-08 ENST00000624695 TET1 chr10 68686421 68686421 Missense_Mutation T T A TCGA-24-0966-01A-01W-0420-08 ENST00000373644 p.H1706Q CCDC73 chr11 32614683 32614683 Silent T T G TCGA-24-0966-01A-01W-0420-08 ENST00000335185 p.I545I APLP2 chr11 130109505 130109505 Missense_Mutation T T C TCGA-24-0966-01A-01W-0420-08 ENST00000263574 p.M61T RNF10 chr12 120557418 120557418 Missense_Mutation G G A TCGA-24-0966-01A-01W-0420-08 ENST00000325954 p.S261N TP53 chr17 7674229 7674229 Missense_Mutation C A A TCGA-24-0966-01A-01W-0420-08 ENST00000269305 p.G245V ZNF236 chr18 76959816 76959816 Missense_Mutation G A A TCGA-24-0966-01A-01W-0420-08 ENST00000253159 p.G1746R CBLN4 chr20 55998658 55998658 Missense_Mutation G G T TCGA-24-0966-01A-01W-0420-08 ENST00000064571 p.L169I TENM1 chrX 124384332 124384332 Missense_Mutation G G C TCGA-24-0966-01A-01W-0420-08 ENST00000371130 p.P2193R FGF13 chrX 138632913 138632913 Silent C C T TCGA-24-0966-01A-01W-0420-08 ENST00000315930 p.K225K KIAA2013 chr1 11923345 11923345 Missense_Mutation G G A TCGA-20-1686-01A-01W-0633-09 ENST00000376572 p.T393M PADI1 chr1 17228702 17228702 Nonsense_Mutation G G T TCGA-20-1686-01A-01W-0633-09 ENST00000375471 p.E244* CSMD2 chr1 34089114 34089114 Silent G G A TCGA-20-1686-01A-01W-0633-09 ENST00000241312 p.Y49Y C1orf87 chr1 60001157 60001157 Splice_Site C C G TCGA-20-1686-01A-01W-0633-09 ENST00000371201 p.X398_splice ADAMTSL4 chr1 150560149 150560149 Missense_Mutation C C T TCGA-20-1686-01A-01W-0633-09 ENST00000271643 p.R1060C UBE2Q1 chr1 154551491 154551491 Missense_Mutation C C T TCGA-20-1686-01A-01W-0633-09 ENST00000292211 p.G359D DAP3 chr1 155727685 155727685 Missense_Mutation G G T TCGA-20-1686-01A-01W-0633-09 ENST00000343043 p.A184S ASPM chr1 197104095 197104095 Missense_Mutation G G A TCGA-20-1686-01A-01W-0633-09 ENST00000367409 p.A1719V CRB1 chr1 197438653 197438653 Missense_Mutation C C G TCGA-20-1686-01A-01W-0633-09 ENST00000367400 p.R1286G SIPA1L2 chr1 232483893 232483893 Missense_Mutation T T C TCGA-20-1686-01A-01W-0633-09 ENST00000262861 p.N627S ZNF638 chr2 71426484 71426484 Missense_Mutation G G C TCGA-20-1686-01A-01W-0633-09 ENST00000264447 p.D1539H LRP1B chr2 140536636 140536636 Silent G G T TCGA-20-1686-01A-01W-0633-09 ENST00000389484 p.T2529T SGOL2 chr2 200535136 200535136 Nonsense_Mutation G G T TCGA-20-1686-01A-01W-0633-09 ENST00000357799 p.E92* COL4A4 chr2 227051053 227051053 Missense_Mutation G G C TCGA-20-1686-01A-01W-0633-09 ENST00000396625 p.P1025R DHX30 chr3 47848386 47848386 Frame_Shift_Del G G - TCGA-20-1686-01A-01W-0633-09 ENST00000445061 ARHGAP31 chr3 119415152 119415152 Missense_Mutation G G A TCGA-20-1686-01A-01W-0633-09 ENST00000264245 p.V1075M GYG1 chr3 149026460 149026460 Missense_Mutation C C A TCGA-20-1686-01A-01W-0633-09 ENST00000345003 p.D279E LAMP3 chr3 183124022 183124022 3'UTR C C A TCGA-20-1686-01A-01W-0633-09 ENST00000265598 CRMP1 chr4 5866723 5866723 Missense_Mutation T T C TCGA-20-1686-01A-01W-0633-09 ENST00000397890 p.I25V SLIT2 chr4 20550831 20550831 Missense_Mutation C C G TCGA-20-1686-01A-01W-0633-09 ENST00000504154 p.L832V GUF1 chr4 44680790 44680800 Frame_Shift_Del TCTTTTACAAT TCTTTTACAAT - TCGA-20-1686-01A-01W-0633-09 ENST00000281543 p.F126* UGT2B27P chr4 69018253 69018254 RNA TG TG - TCGA-20-1686-01A-01W-0633-09 ENST00000505092 FRAS1 chr4 78466349 78466349 Missense_Mutation G G A TCGA-20-1686-01A-01W-0633-09 ENST00000512123 p.G2391S ANXA5 chr4 121668518 121668518 Missense_Mutation A A T TCGA-20-1686-01A-01W-0633-09 ENST00000296511 p.S305T FAT1 chr4 186589000 186589000 Silent G G T TCGA-20-1686-01A-01W-0633-09 ENST00000441802 p.P4453P SEMA5A chr5 9042964 9042964 Missense_Mutation G G A TCGA-20-1686-01A-01W-0633-09 ENST00000382496 p.P1053L CDH18 chr5 19839029 19839029 5'UTR G G T TCGA-20-1686-01A-01W-0633-09 ENST00000274170 ADAMTS12 chr5 33683048 33683048 Silent C C T TCGA-20-1686-01A-01W-0633-09 ENST00000504830 p.V295V NQO2 chr6 3015595 3015595 Silent G G A TCGA-20-1686-01A-01W-0633-09 ENST00000338130 p.Q123Q MUC21 chr6 30986757 30986757 Silent T T A TCGA-20-1686-01A-01W-0633-09 ENST00000376296 p.T194T DST chr6 56553148 56553148 Missense_Mutation A A G TCGA-20-1686-01A-01W-0633-09 ENST00000312431 p.M2958T DST chr6 56607173 56607173 Intron T T A TCGA-20-1686-01A-01W-0633-09 ENST00000312431 Unknown chr6 60499362 60499362 IGR T T A TCGA-20-1686-01A-01W-0633-09 COL19A1 chr6 69932851 69932851 Missense_Mutation A A G TCGA-20-1686-01A-01W-0633-09 ENST00000620364 p.I245M EEF1A1 chr6 73519043 73519043 Silent A A G TCGA-20-1686-01A-01W-0633-09 ENST00000309268 p.I170I RAB32 chr6 146554675 146554675 3'UTR C C A TCGA-20-1686-01A-01W-0633-09 ENST00000367495 FNDC1 chr6 159215078 159215078 Silent C C T TCGA-20-1686-01A-01W-0633-09 ENST00000297267 p.Y198Y C7orf31 chr7 25136575 25136575 Silent A A G TCGA-20-1686-01A-01W-0633-09 ENST00000283905 p.H390H CACNA2D1 chr7 81959345 81959345 Missense_Mutation T T C TCGA-20-1686-01A-01W-0633-09 ENST00000356253 p.N1042S MUC17 chr7 101037769 101037769 Missense_Mutation A A G TCGA-20-1686-01A-01W-0633-09 ENST00000306151 p.E2118G DOCK4 chr7 111778274 111778274 Splice_Site A A T TCGA-20-1686-01A-01W-0633-09 ENST00000437633 p.X1218_splice STRIP2 chr7 129456535 129456535 Missense_Mutation G G C TCGA-20-1686-01A-01W-0633-09 ENST00000249344 p.V311L OR4F21 chr8 166636 166636 Missense_Mutation A A C TCGA-20-1686-01A-01W-0633-09 ENST00000320901 p.L130R CHD7 chr8 60861056 60861056 Silent A A G TCGA-20-1686-01A-01W-0633-09 ENST00000423902 p.K2587K EBAG9 chr8 109550895 109550895 Missense_Mutation G G C TCGA-20-1686-01A-01W-0633-09 ENST00000337573 p.R24T CSMD3 chr8 112336793 112336793 Missense_Mutation G G T TCGA-20-1686-01A-01W-0633-09 ENST00000297405 p.T2293N KDM4C chr9 7013853 7013853 Silent G G A TCGA-20-1686-01A-01W-0633-09 ENST00000381309 p.S678S SPATA31E1 chr9 87886478 87886478 Missense_Mutation C C G TCGA-20-1686-01A-01W-0633-09 ENST00000325643 p.P664R ASPN chr9 92474648 92474648 Nonsense_Mutation G G A TCGA-20-1686-01A-01W-0633-09 ENST00000375544 p.R84* BRINP1 chr9 119167656 119167656 Missense_Mutation A A C TCGA-20-1686-01A-01W-0633-09 ENST00000265922 p.S572A FAM21C chr10 45769489 45769489 Missense_Mutation C C T TCGA-20-1686-01A-01W-0633-09 ENST00000374362 p.S637F FRMPD2 chr10 48184618 48184618 Missense_Mutation C C G TCGA-20-1686-01A-01W-0633-09 ENST00000374201 p.R844S TRIM5 chr11 5678435 5678435 Splice_Site C C T TCGA-20-1686-01A-01W-0633-09 ENST00000380034 p.X172_splice NLRP14 chr11 7058385 7058385 Silent T T A TCGA-20-1686-01A-01W-0633-09 ENST00000299481 p.G856G PRG2 chr11 57388698 57388698 Missense_Mutation C C T TCGA-20-1686-01A-01W-0633-09 ENST00000311862 p.R126Q PYGM chr11 64751984 64751984 Missense_Mutation G G A TCGA-20-1686-01A-01W-0633-09 ENST00000164139 p.R570W DPP3 chr11 66492872 66492872 Missense_Mutation C C A TCGA-20-1686-01A-01W-0633-09 ENST00000541961 p.A382D PYROXD1 chr12 21470173 21470173 3'UTR G G T TCGA-20-1686-01A-01W-0633-09 ENST00000240651 FMNL3 chr12 49643619 49643619 3'UTR G G C TCGA-20-1686-01A-01W-0633-09 ENST00000335154 MAP3K12 chr12 53487277 53487277 Missense_Mutation C C T TCGA-20-1686-01A-01W-0633-09 ENST00000267079 p.E39K USP15 chr12 62355341 62355341 Missense_Mutation T T C TCGA-20-1686-01A-01W-0633-09 ENST00000280377 p.S261P FICD chr12 108518884 108518884 Missense_Mutation C C G TCGA-20-1686-01A-01W-0633-09 ENST00000552695 p.N262K CIT chr12 119876163 119876163 Silent C C T TCGA-20-1686-01A-01W-0633-09 ENST00000261833 p.L2L SPTB chr14 64773353 64773353 Missense_Mutation C C T TCGA-20-1686-01A-01W-0633-09 ENST00000389721 p.R1682H RYR3 chr15 33813531 33813531 Missense_Mutation G G A TCGA-20-1686-01A-01W-0633-09 ENST00000389232 p.R3485Q NDUFAF1 chr15 41394969 41394969 Missense_Mutation G G A TCGA-20-1686-01A-01W-0633-09 ENST00000260361 p.R217W SNUPN chr15 75609606 75609606 Missense_Mutation A A C TCGA-20-1686-01A-01W-0633-09 ENST00000308588 p.F152V PEAK1 chr15 77114128 77114128 3'UTR T T G TCGA-20-1686-01A-01W-0633-09 ENST00000312493 SLCO3A1 chr15 92120626 92120626 Missense_Mutation C C G TCGA-20-1686-01A-01W-0633-09 ENST00000318445 p.L391V ALDOA chr16 30070139 30070139 Missense_Mutation G G A TCGA-20-1686-01A-01W-0633-09 ENST00000338110 p.G341E TP53 chr17 7674221 7674221 Missense_Mutation G G A TCGA-20-1686-01A-01W-0633-09 ENST00000269305 p.R248W IGF2BP1 chr17 48997782 48997782 Missense_Mutation G G A TCGA-20-1686-01A-01W-0633-09 ENST00000290341 p.V13M DLGAP1 chr18 3879421 3879421 Silent G G A TCGA-20-1686-01A-01W-0633-09 ENST00000315677 p.H216H DCC chr18 53386119 53386119 Silent C C T TCGA-20-1686-01A-01W-0633-09 ENST00000442544 p.A812A RLN3 chr19 14030920 14030943 In_Frame_Del GCAAAAGTGAAATCAGTAGCCTTT GCAAAAGTGAAATCAGTAGCCTTT - TCGA-20-1686-01A-01W-0633-09 ENST00000431365 p.K135_C142del ZNF324B chr19 58456131 58456131 Missense_Mutation C C T TCGA-20-1686-01A-01W-0633-09 ENST00000336614 p.P396L CBFA2T2 chr20 33640397 33640397 Missense_Mutation G G A TCGA-20-1686-01A-01W-0633-09 ENST00000346541 p.A461T PREX1 chr20 48708378 48708378 Missense_Mutation G G A TCGA-20-1686-01A-01W-0633-09 ENST00000371941 p.A222V SALL4 chr20 51784054 51784054 3'UTR T T - TCGA-20-1686-01A-01W-0633-09 ENST00000217086 POTED chr21 13610741 13610741 Silent G G A TCGA-20-1686-01A-01W-0633-09 ENST00000299443 p.K171K N6AMT1 chr21 28878248 28878248 Missense_Mutation T T C TCGA-20-1686-01A-01W-0633-09 ENST00000303775 p.D161G LTN1 chr21 28932584 28932584 Silent C C T TCGA-20-1686-01A-01W-0633-09 ENST00000361371 p.L1652L MAGED2 chrX 54813160 54813160 Missense_Mutation G G T TCGA-20-1686-01A-01W-0633-09 ENST00000218439 p.G403V VDAC1P1 chrX 80929628 80929628 RNA C C G TCGA-20-1686-01A-01W-0633-09 ENST00000439229 CYLC1 chrX 83872993 83872993 Silent G G A TCGA-20-1686-01A-01W-0633-09 ENST00000329312 p.R95R TRMT2B chrX 101022042 101022044 In_Frame_Del CTT CTT - TCGA-20-1686-01A-01W-0633-09 ENST00000372935 p.K259del IRS4 chrX 108732637 108732639 In_Frame_Del GTC GTC - TCGA-20-1686-01A-01W-0633-09 ENST00000372129 p.D1236del ACSL4 chrX 109669046 109669046 Missense_Mutation G G A TCGA-20-1686-01A-01W-0633-09 ENST00000340800 p.P418L PAK3 chrX 111192503 111192503 Splice_Region C C G TCGA-20-1686-01A-01W-0633-09 ENST00000262836 SPANXN2 chrX 143712477 143712477 Missense_Mutation A A C TCGA-20-1686-01A-01W-0633-09 ENST00000598475 p.V34G CNGA2 chrX 151738506 151738506 Missense_Mutation T T C TCGA-20-1686-01A-01W-0633-09 ENST00000329903 p.V8A G6PD chrX 154532639 154532639 Missense_Mutation C C T TCGA-20-1686-01A-01W-0633-09 ENST00000393564 p.M405I WRAP73 chr1 3630992 3630992 Silent G G A TCGA-23-1118-01A-01W-0486-08 ENST00000270708 p.L456L HIVEP3 chr1 41511167 41511167 Missense_Mutation G G C TCGA-23-1118-01A-01W-0486-08 ENST00000247584 p.L2169V ZNF644 chr1 91024716 91024716 5'Flank C C T TCGA-23-1118-01A-01W-0486-08 ENST00000337393 HSD3B1 chr1 119514568 119514568 Missense_Mutation G G T TCGA-23-1118-01A-01W-0486-08 ENST00000369413 p.A349S PIP5K1A chr1 151198887 151198887 5'UTR G G A TCGA-23-1118-01A-01W-0486-08 ENST00000368888 ZNF687 chr1 151291074 151291074 Silent G G A TCGA-23-1118-01A-01W-0486-08 ENST00000324048 p.L1193L PGLYRP3 chr1 153310617 153310617 Missense_Mutation C C T TCGA-23-1118-01A-01W-0486-08 ENST00000290722 p.A17T INSRR chr1 156853910 156853910 Missense_Mutation G G C TCGA-23-1118-01A-01W-0486-08 ENST00000368195 p.P160R ARHGAP30 chr1 161049521 161049521 Missense_Mutation T T A TCGA-23-1118-01A-01W-0486-08 ENST00000368013 p.E530V LAMB3 chr1 209617445 209617445 Nonsense_Mutation C C A TCGA-23-1118-01A-01W-0486-08 ENST00000356082 p.E1065* CAPN9 chr1 230792875 230792875 Missense_Mutation A A T TCGA-23-1118-01A-01W-0486-08 ENST00000271971 p.D606V PELI1 chr2 64094915 64094915 Silent T T A TCGA-23-1118-01A-01W-0486-08 ENST00000358912 p.G348G PELI1 chr2 64094916 64094916 Missense_Mutation C C T TCGA-23-1118-01A-01W-0486-08 ENST00000358912 p.G348E GGCX chr2 85558507 85558520 Frame_Shift_Del TCCATGATGTCTTG TCCATGATGTCTTG - TCGA-23-1118-01A-01W-0486-08 ENST00000233838 p.D153Efs*33 CNTNAP5 chr2 124242348 124242348 Missense_Mutation C C A TCGA-23-1118-01A-01W-0486-08 ENST00000431078 p.D112E PKP4 chr2 158621331 158621331 Missense_Mutation G G C TCGA-23-1118-01A-01W-0486-08 ENST00000389759 p.K171N ASNSD1 chr2 189667117 189667117 Missense_Mutation G G T TCGA-23-1118-01A-01W-0486-08 ENST00000260952 p.G329C CRBN chr3 3174081 3174081 Missense_Mutation T T C TCGA-23-1118-01A-01W-0486-08 ENST00000231948 p.T119A ARIH2 chr3 48927501 48927502 5'UTR - - G TCGA-23-1118-01A-01W-0486-08 ENST00000356401 FAM208A chr3 56641669 56641669 Missense_Mutation C C G TCGA-23-1118-01A-01W-0486-08 ENST00000493960 p.D767H CORIN chr4 47665221 47665221 Missense_Mutation G G C TCGA-23-1118-01A-01W-0486-08 ENST00000273857 p.P467R FGF2 chr4 122892393 122892393 Missense_Mutation C C G TCGA-23-1118-01A-01W-0486-08 ENST00000614010 p.S288R SYNGAP1 chr6 33437968 33437968 Missense_Mutation G G A TCGA-23-1118-01A-01W-0486-08 ENST00000629380 p.G355R RBBP4P4 chr6 58119860 58119860 RNA G G T TCGA-23-1118-01A-01W-0486-08 ENST00000398588 ME1 chr6 83216584 83216584 Missense_Mutation G G T TCGA-23-1118-01A-01W-0486-08 ENST00000369705 p.Q488K VNN1 chr6 132683225 132683225 Nonsense_Mutation G G C TCGA-23-1118-01A-01W-0486-08 ENST00000367928 p.S486* RAET1K chr6 150000896 150000896 RNA A A T TCGA-23-1118-01A-01W-0486-08 ENST00000533735 HGF chr7 81752095 81752095 Intron C C A TCGA-23-1118-01A-01W-0486-08 ENST00000222390 TRRAP chr7 98994655 98994655 Silent G G T TCGA-23-1118-01A-01W-0486-08 ENST00000359863 p.V3358V ZKSCAN1 chr7 100024305 100024305 Missense_Mutation G G A TCGA-23-1118-01A-01W-0486-08 ENST00000324306 p.R193Q PENK chr8 56441430 56441430 Missense_Mutation T T C TCGA-23-1118-01A-01W-0486-08 ENST00000314922 p.R216G MELK chr9 36671032 36671032 Missense_Mutation C C T TCGA-23-1118-01A-01W-0486-08 ENST00000298048 p.H514Y SPATA31A1 chr9 39359903 39359903 Missense_Mutation C C T TCGA-23-1118-01A-01W-0486-08 ENST00000625870 p.S713L SPTAN1 chr9 128594242 128594242 Missense_Mutation A A G TCGA-23-1118-01A-01W-0486-08 ENST00000372731 p.M1095V CRTAC1 chr10 97895887 97895893 Frame_Shift_Del GATTGCC GATTGCC - TCGA-23-1118-01A-01W-0486-08 ENST00000370597 p.G437Rfs*36 CRTAC1 chr10 97895895 97895895 Missense_Mutation C C A TCGA-23-1118-01A-01W-0486-08 ENST00000370597 p.R436L COL17A1 chr10 104058183 104058183 Silent C C T TCGA-23-1118-01A-01W-0486-08 ENST00000353479 p.L410L PNLIPRP3 chr10 116476722 116476722 Missense_Mutation A A T TCGA-23-1118-01A-01W-0486-08 ENST00000369230 p.S415C IGSF22 chr11 18709386 18709386 Splice_Site C C T TCGA-23-1118-01A-01W-0486-08 ENST00000319338 p.X899_splice CKAP5 chr11 46796941 46796941 Splice_Site C C T TCGA-23-1118-01A-01W-0486-08 ENST00000529230 p.X447_splice SUV420H1 chr11 68158338 68158338 Missense_Mutation G G T TCGA-23-1118-01A-01W-0486-08 ENST00000304363 p.P670T NPAT chr11 108170003 108170003 Silent G G T TCGA-23-1118-01A-01W-0486-08 ENST00000278612 p.L942L ERC1 chr12 1490235 1490235 3'UTR G G T TCGA-23-1118-01A-01W-0486-08 ENST00000360905 CNTN1 chr12 41025301 41025301 Missense_Mutation C C A TCGA-23-1118-01A-01W-0486-08 ENST00000347616 p.P892Q MARS chr12 57514722 57514722 Missense_Mutation C C T TCGA-23-1118-01A-01W-0486-08 ENST00000262027 p.A657V CCDC60 chr12 119500123 119500123 Missense_Mutation C C A TCGA-23-1118-01A-01W-0486-08 ENST00000327554 p.D201E DNAH10 chr12 123785938 123785938 Splice_Site T T C TCGA-23-1118-01A-01W-0486-08 ENST00000409039 p.X413_splice TMEM132B chr12 125583865 125583865 Missense_Mutation G G T TCGA-23-1118-01A-01W-0486-08 ENST00000299308 p.L431F STARD13 chr13 33142329 33142329 Missense_Mutation A A T TCGA-23-1118-01A-01W-0486-08 ENST00000336934 p.V123E TPT1 chr13 45340045 45340045 Missense_Mutation G G C TCGA-23-1118-01A-01W-0486-08 ENST00000530705 p.T81R CEBPE chr14 23119034 23119034 Missense_Mutation A A T TCGA-23-1118-01A-01W-0486-08 ENST00000206513 p.F20I RTN1 chr14 59745836 59745836 Missense_Mutation G G T TCGA-23-1118-01A-01W-0486-08 ENST00000267484 p.T296N VSX2 chr14 74245214 74245214 Missense_Mutation G G A TCGA-23-1118-01A-01W-0486-08 ENST00000261980 p.E169K THBS1 chr15 39582633 39582633 Missense_Mutation G G T TCGA-23-1118-01A-01W-0486-08 ENST00000260356 p.D170Y THBS1 chr15 39582634 39582634 Missense_Mutation A A T TCGA-23-1118-01A-01W-0486-08 ENST00000260356 p.D170V VPS18 chr15 40900874 40900874 Missense_Mutation G G A TCGA-23-1118-01A-01W-0486-08 ENST00000220509 p.A686T SEMA6D chr15 47765063 47765063 Splice_Region A A G TCGA-23-1118-01A-01W-0486-08 ENST00000316364 ZNF774 chr15 90360515 90360515 Silent C C A TCGA-23-1118-01A-01W-0486-08 ENST00000354377 p.T228T GPR139 chr16 20031911 20031911 Missense_Mutation C C A TCGA-23-1118-01A-01W-0486-08 ENST00000570682 p.A296S GPR139 chr16 20032031 20032031 Missense_Mutation G G A TCGA-23-1118-01A-01W-0486-08 ENST00000570682 p.P256S FBRS chr16 30669403 30669403 Missense_Mutation G G T TCGA-23-1118-01A-01W-0486-08 ENST00000287468 p.G381C ITGAX chr16 31363267 31363267 Missense_Mutation A A C TCGA-23-1118-01A-01W-0486-08 ENST00000268296 p.K535Q RBL2 chr16 53490149 53490149 Missense_Mutation G G T TCGA-23-1118-01A-01W-0486-08 ENST00000262133 p.S1090I HYDIN chr16 71069457 71069457 Missense_Mutation A A T TCGA-23-1118-01A-01W-0486-08 ENST00000393567 p.I595N TP53 chr17 7675161 7675161 Missense_Mutation G G A TCGA-23-1118-01A-01W-0486-08 ENST00000269305 p.P151S KRT16P6 chr17 16818915 16818915 RNA C C T TCGA-23-1118-01A-01W-0486-08 ENST00000417510 TOP2A chr17 40412935 40412935 Nonsense_Mutation C C A TCGA-23-1118-01A-01W-0486-08 ENST00000423485 p.E205* TOP2A chr17 40412971 40412974 Splice_Site TCTA TCTA - TCGA-23-1118-01A-01W-0486-08 ENST00000423485 p.X193_splice ITGB4 chr17 75727816 75727835 Frame_Shift_Del GATGATCTGGACAACCTCAA GATGATCTGGACAACCTCAA - TCGA-23-1118-01A-01W-0486-08 ENST00000200181 p.D144Efs*38 RNF213 chr17 80389079 80389079 Intron G G C TCGA-23-1118-01A-01W-0486-08 ENST00000582970 GALNT1 chr18 35692219 35692219 Missense_Mutation G G A TCGA-23-1118-01A-01W-0486-08 ENST00000269195 p.V400I SLC14A2 chr18 45682411 45682411 Silent G G A TCGA-23-1118-01A-01W-0486-08 ENST00000255226 p.P885P OR10H5 chr19 15794170 15794170 Missense_Mutation G G A TCGA-23-1118-01A-01W-0486-08 ENST00000308940 p.G41D DDA1 chr19 17314361 17314361 Silent G G T TCGA-23-1118-01A-01W-0486-08 ENST00000359866 p.L36L ZNF222 chr19 44031926 44031926 Missense_Mutation A A C TCGA-23-1118-01A-01W-0486-08 ENST00000187879 p.Q84H ZNF813 chr19 53491748 53491748 Missense_Mutation C C T TCGA-23-1118-01A-01W-0486-08 ENST00000396403 p.R506W LILRA2 chr19 54574913 54574913 Missense_Mutation A A G TCGA-23-1118-01A-01W-0486-08 ENST00000251377 p.I179V NLRP8 chr19 55966381 55966381 Splice_Site G G T TCGA-23-1118-01A-01W-0486-08 ENST00000291971 p.X794_splice ZSWIM3 chr20 45876830 45876830 Missense_Mutation T T A TCGA-23-1118-01A-01W-0486-08 ENST00000255152 p.L91Q NCOA3 chr20 47634159 47634159 Missense_Mutation A A T TCGA-23-1118-01A-01W-0486-08 ENST00000371998 p.D359V RIPK4 chr21 41741270 41741270 Silent C C T TCGA-23-1118-01A-01W-0486-08 ENST00000352483 p.L689L MYO18B chr22 25992464 25992464 Missense_Mutation A A C TCGA-23-1118-01A-01W-0486-08 ENST00000536101 p.E2086D SEC14L6 chr22 30525853 30525853 Silent G G A TCGA-23-1118-01A-01W-0486-08 ENST00000402034 p.P248P FBLN1 chr22 45574511 45574511 Splice_Region G G C TCGA-23-1118-01A-01W-0486-08 ENST00000327858 p.T566T HCFC1 chrX 153957443 153957443 Missense_Mutation T T C TCGA-23-1118-01A-01W-0486-08 ENST00000310441 p.S742G PRAMEF15 chr1 13322480 13322480 3'UTR T T G TCGA-29-1698-01A-01W-0633-09 ENST00000376152 PRAMEF19 chr1 13371200 13371200 Missense_Mutation C C A TCGA-29-1698-01A-01W-0633-09 ENST00000376101 p.M36I MACF1 chr1 39410701 39410701 Intron G G A TCGA-29-1698-01A-01W-0633-09 ENST00000372915 MMACHC chr1 45511301 45511301 3'UTR G G C TCGA-29-1698-01A-01W-0633-09 ENST00000401061 NBPF9 chr1 149055467 149055467 3'UTR A A C TCGA-29-1698-01A-01W-0633-09 ENST00000613595 NBPF9 chr1 149057481 149057481 Intron A A G TCGA-29-1698-01A-01W-0633-09 ENST00000613595 USH2A chr1 215628987 215628987 Missense_Mutation G G A TCGA-29-1698-01A-01W-0633-09 ENST00000307340 p.R5116C SUSD4 chr1 223222156 223222156 3'UTR G G A TCGA-29-1698-01A-01W-0633-09 ENST00000343846 PSEN2 chr1 226889025 226889025 Missense_Mutation A A T TCGA-29-1698-01A-01W-0633-09 ENST00000366783 p.I255F RGS7 chr1 240813705 240813705 Missense_Mutation T T G TCGA-29-1698-01A-01W-0633-09 ENST00000366565 p.Y290S GREB1 chr2 11620907 11620907 Splice_Region C C T TCGA-29-1698-01A-01W-0633-09 ENST00000234142 p.I1349I RGPD4 chr2 107861737 107861737 Silent G G A TCGA-29-1698-01A-01W-0633-09 ENST00000408999 p.K734K PSD4 chr2 113185459 113185459 Intron G G T TCGA-29-1698-01A-01W-0633-09 ENST00000245796 SAP130 chr2 127942018 127942018 Missense_Mutation C C G TCGA-29-1698-01A-01W-0633-09 ENST00000259235 p.K1045N CCDC108 chr2 219035551 219035551 Missense_Mutation C C A TCGA-29-1698-01A-01W-0633-09 ENST00000341552 p.E157D SLMAP chr3 57861963 57861963 Missense_Mutation T T A TCGA-29-1698-01A-01W-0633-09 ENST00000428312 p.N281K FLNB chr3 58008782 58008782 Missense_Mutation G G T TCGA-29-1698-01A-01W-0633-09 ENST00000295956 p.R73L GK5 chr3 142198913 142198913 Silent T T C TCGA-29-1698-01A-01W-0633-09 ENST00000392993 p.R144R CP chr3 149209213 149209213 Missense_Mutation T T C TCGA-29-1698-01A-01W-0633-09 ENST00000264613 p.Y260C RPL22L1 chr3 170870161 170870161 Missense_Mutation G G A TCGA-29-1698-01A-01W-0633-09 ENST00000295830 p.P3S ZNF311 chr6 28995376 28995376 Missense_Mutation C C G TCGA-29-1698-01A-01W-0633-09 ENST00000377179 p.L542F MSH5 chr6 31760173 31760173 Missense_Mutation T T A TCGA-29-1698-01A-01W-0633-09 ENST00000375750 p.I590N NELFE chr6 31958429 31958429 Frame_Shift_Del G G - TCGA-29-1698-01A-01W-0633-09 ENST00000375429 p.G7Dfs*2 CYB5R4 chr6 83936244 83936244 Missense_Mutation T T C TCGA-29-1698-01A-01W-0633-09 ENST00000369681 p.Y326H TBRG4 chr7 45105652 45105652 Missense_Mutation C C T TCGA-29-1698-01A-01W-0633-09 ENST00000258770 p.R175H WNT2 chr7 117277990 117277991 3'UTR - - C TCGA-29-1698-01A-01W-0633-09 ENST00000265441 PRSS58 chr7 142252270 142252270 Missense_Mutation T T A TCGA-29-1698-01A-01W-0633-09 ENST00000547058 p.K226I PTGS1 chr9 122392489 122392489 Missense_Mutation C C T TCGA-29-1698-01A-01W-0633-09 ENST00000362012 p.P582L OR1L4 chr9 122724195 122724195 Missense_Mutation T T C TCGA-29-1698-01A-01W-0633-09 ENST00000259466 p.F69S ZNF79 chr9 127444311 127444311 Missense_Mutation A A G TCGA-29-1698-01A-01W-0633-09 ENST00000342483 p.Y204C C9orf114 chr9 128827161 128827161 Missense_Mutation G G A TCGA-29-1698-01A-01W-0633-09 ENST00000361256 p.P80L USP6NL chr10 11463529 11463529 Missense_Mutation C C A TCGA-29-1698-01A-01W-0633-09 ENST00000609104 p.A467S ERCC6 chr10 49493196 49493196 Nonsense_Mutation C C T TCGA-29-1698-01A-01W-0633-09 ENST00000355832 p.W581* LDB3 chr10 86687139 86687139 Intron G G A TCGA-29-1698-01A-01W-0633-09 ENST00000361373 COPB1 chr11 14479688 14479690 In_Frame_Del GTT GTT - TCGA-29-1698-01A-01W-0633-09 ENST00000249923 p.N413del COMMD9 chr11 36274772 36274772 Missense_Mutation T T G TCGA-29-1698-01A-01W-0633-09 ENST00000263401 p.I153L C11orf49 chr11 46936822 46936822 Missense_Mutation G G T TCGA-29-1698-01A-01W-0633-09 ENST00000278460 p.R6L PTPRJ chr11 48167602 48167602 3'UTR T T - TCGA-29-1698-01A-01W-0633-09 ENST00000418331 SPTBN2 chr11 66688188 66688188 Missense_Mutation A A T TCGA-29-1698-01A-01W-0633-09 ENST00000309996 p.S2119T NUMA1 chr11 72013212 72013212 Missense_Mutation C C T TCGA-29-1698-01A-01W-0633-09 ENST00000393695 p.A1431T C2CD3 chr11 74084935 74084935 Missense_Mutation A A T TCGA-29-1698-01A-01W-0633-09 ENST00000334126 p.Y1316N C2CD3 chr11 74084937 74084939 In_Frame_Del TCT TCT - TCGA-29-1698-01A-01W-0633-09 ENST00000334126 p.E1315del NOP2 chr12 6557456 6557456 Nonsense_Mutation G G T TCGA-29-1698-01A-01W-0633-09 ENST00000322166 p.S659* ACRBP chr12 6640096 6640096 Silent C C T TCGA-29-1698-01A-01W-0633-09 ENST00000229243 p.E463E KRT72 chr12 52585835 52585835 3'UTR C C A TCGA-29-1698-01A-01W-0633-09 ENST00000293745 MYL6 chr12 56160665 56160665 3'UTR G G C TCGA-29-1698-01A-01W-0633-09 ENST00000548293 FGD6 chr12 95091806 95091806 Missense_Mutation C C G TCGA-29-1698-01A-01W-0633-09 ENST00000343958 p.V1251L ISCU chr12 108565421 108565421 Missense_Mutation A A C TCGA-29-1698-01A-01W-0633-09 ENST00000311893 p.K110T RNASEH2B chr13 50945497 50945503 Frame_Shift_Del TTTTCTC TTTTCTC - TCGA-29-1698-01A-01W-0633-09 ENST00000336617 p.F194Lfs*20 SLITRK1 chr13 83881668 83881669 5'UTR - - C TCGA-29-1698-01A-01W-0633-09 ENST00000377084 TFDP1 chr13 113634021 113634021 Silent T T C TCGA-29-1698-01A-01W-0633-09 ENST00000375370 p.C202C BAZ1A chr14 34758770 34758770 Silent T T C TCGA-29-1698-01A-01W-0633-09 ENST00000360310 p.Q1440Q SMOC1 chr14 69953440 69953440 Missense_Mutation C C T TCGA-29-1698-01A-01W-0633-09 ENST00000381280 p.R96C CLMN chr14 95203256 95203256 Missense_Mutation T T A TCGA-29-1698-01A-01W-0633-09 ENST00000298912 p.E698V PAK6 chr15 40275932 40275932 Silent C C T TCGA-29-1698-01A-01W-0633-09 ENST00000260404 p.S628S KIAA0556 chr16 27777713 27777713 Missense_Mutation C C A TCGA-29-1698-01A-01W-0633-09 ENST00000261588 p.T1552N VPS53 chr17 655915 655915 Silent G G A TCGA-29-1698-01A-01W-0633-09 ENST00000571805 p.H137H TP53 chr17 7674954 7674954 Missense_Mutation G G A TCGA-29-1698-01A-01W-0633-09 ENST00000269305 p.H193Y RAPGEFL1 chr17 40188966 40188966 Missense_Mutation G G T TCGA-29-1698-01A-01W-0633-09 ENST00000264644 p.G106C HSPB9 chr17 42123309 42123309 Silent G G A TCGA-29-1698-01A-01W-0633-09 ENST00000565659 p.K153K LRRC37A2 chr17 46513289 46513289 Missense_Mutation G G A TCGA-29-1698-01A-01W-0633-09 ENST00000333412 p.G193S GGA3 chr17 75243565 75243565 Silent C C A TCGA-29-1698-01A-01W-0633-09 ENST00000537686 p.L102L DSG4 chr18 31388918 31388918 Missense_Mutation G G T TCGA-29-1698-01A-01W-0633-09 ENST00000308128 p.R139S MIER2 chr19 334516 334516 Nonsense_Mutation G G A TCGA-29-1698-01A-01W-0633-09 ENST00000264819 p.Q43* MCOLN1 chr19 7527557 7527558 Frame_Shift_Ins - - C TCGA-29-1698-01A-01W-0633-09 ENST00000264079 p.S206Qfs*36 COPE chr19 18911007 18911007 Missense_Mutation C C T TCGA-29-1698-01A-01W-0633-09 ENST00000262812 p.R85H MAP4K1 chr19 38597479 38597479 Splice_Region C C - TCGA-29-1698-01A-01W-0633-09 ENST00000591517 MAP4K1 chr19 38597480 38597480 Splice_Region T T G TCGA-29-1698-01A-01W-0633-09 ENST00000591517 CLC chr19 39731319 39731319 3'UTR G G A TCGA-29-1698-01A-01W-0633-09 ENST00000221804 SIGLEC7 chr19 51145907 51145907 Silent T T C TCGA-29-1698-01A-01W-0633-09 ENST00000317643 p.S271S RAB36 chr22 23153047 23153047 Missense_Mutation T T G TCGA-29-1698-01A-01W-0633-09 ENST00000263116 p.V147G IL1RAPL1 chrX 29920086 29920086 Missense_Mutation A A C TCGA-29-1698-01A-01W-0633-09 ENST00000378993 p.H350P XIST chrX 73843177 73843177 RNA G G T TCGA-29-1698-01A-01W-0633-09 ENST00000429829 DCX chrX 111410176 111410176 Missense_Mutation C C T TCGA-29-1698-01A-01W-0633-09 ENST00000338081 p.D156N DNAJC11 chr1 6637329 6637329 Missense_Mutation C C T TCGA-13-1409-01A-01W-0492-08 ENST00000377577 p.V465I ALPL chr1 21563209 21563209 Missense_Mutation G G A TCGA-13-1409-01A-01W-0492-08 ENST00000374832 p.A133T FAM183A chr1 43156283 43156283 Silent G G A TCGA-13-1409-01A-01W-0492-08 ENST00000335282 p.T125T SOX13 chr1 204124764 204124764 Missense_Mutation C C T TCGA-13-1409-01A-01W-0492-08 ENST00000367204 p.T500I RCOR3 chr1 211312771 211312771 Missense_Mutation A A G TCGA-13-1409-01A-01W-0492-08 ENST00000367005 p.N318S USH2A chr1 215634612 215634612 Silent C C T TCGA-13-1409-01A-01W-0492-08 ENST00000307340 p.A5048A SPOPL chr2 138569087 138569087 3'UTR C C T TCGA-13-1409-01A-01W-0492-08 ENST00000280098 ZSWIM2 chr2 186848989 186848989 Nonsense_Mutation C C A TCGA-13-1409-01A-01W-0492-08 ENST00000295131 p.E48* PAX3 chr2 222293646 222293646 Intron A A T TCGA-13-1409-01A-01W-0492-08 ENST00000350526 COL4A3 chr2 227282449 227282449 Missense_Mutation C C T TCGA-13-1409-01A-01W-0492-08 ENST00000396578 p.P858L SP100 chr2 230444313 230444313 Missense_Mutation G G A TCGA-13-1409-01A-01W-0492-08 ENST00000264052 p.D136N BSN chr3 49642901 49642901 Nonsense_Mutation G G T TCGA-13-1409-01A-01W-0492-08 ENST00000296452 p.G423* MON1A chr3 49910522 49910522 Missense_Mutation G G A TCGA-13-1409-01A-01W-0492-08 ENST00000296473 p.R423C ROPN1 chr3 123976920 123976920 Missense_Mutation C C A TCGA-13-1409-01A-01W-0492-08 ENST00000184183 p.A60S EIF2B5 chr3 184142818 184142818 Missense_Mutation G G C TCGA-13-1409-01A-01W-0492-08 ENST00000273783 p.S529T ADH5 chr4 99072437 99072437 Nonsense_Mutation G G A TCGA-13-1409-01A-01W-0492-08 ENST00000296412 p.R369* CXXC4 chr4 104491148 104491148 Missense_Mutation A A G TCGA-13-1409-01A-01W-0492-08 ENST00000394767 p.C219R CDH6 chr5 31299547 31299547 Missense_Mutation G G A TCGA-13-1409-01A-01W-0492-08 ENST00000265071 p.G243S PRLR chr5 35070220 35070220 Missense_Mutation G G A TCGA-13-1409-01A-01W-0492-08 ENST00000618457 p.H197Y SPZ1 chr5 80321266 80321266 Missense_Mutation G G C TCGA-13-1409-01A-01W-0492-08 ENST00000296739 p.E351Q GEMIN5 chr5 154899294 154899294 Missense_Mutation C C G TCGA-13-1409-01A-01W-0492-08 ENST00000285873 p.A1011P RNF145 chr5 159161275 159161275 Silent G G A TCGA-13-1409-01A-01W-0492-08 ENST00000424310 p.I539I PGBD1 chr6 28296889 28296889 Missense_Mutation G G A TCGA-13-1409-01A-01W-0492-08 ENST00000259883 p.R239Q DDO chr6 110408339 110408339 Silent T T C TCGA-13-1409-01A-01W-0492-08 ENST00000368924 p.V120V PPP1R3A chr7 113878448 113878448 Missense_Mutation G G T TCGA-13-1409-01A-01W-0492-08 ENST00000284601 p.L882I ANK1 chr8 41758132 41758132 Missense_Mutation A A T TCGA-13-1409-01A-01W-0492-08 ENST00000347528 p.D11E CSMD3 chr8 112380426 112380426 Missense_Mutation G G T TCGA-13-1409-01A-01W-0492-08 ENST00000297405 p.T2021K ACO1 chr9 32448992 32448992 Missense_Mutation A A C TCGA-13-1409-01A-01W-0492-08 ENST00000309951 p.N823H MYO3A chr10 26026392 26026392 Missense_Mutation T T G TCGA-13-1409-01A-01W-0492-08 ENST00000265944 p.D271E UNC5B chr10 71286773 71286773 Missense_Mutation C C T TCGA-13-1409-01A-01W-0492-08 ENST00000335350 p.R213C C10orf32 chr10 102862907 102862908 In_Frame_Ins - - ATC TCGA-13-1409-01A-01W-0492-08 ENST00000339834 p.H103dup HABP2 chr10 113578103 113578103 Missense_Mutation T T G TCGA-13-1409-01A-01W-0492-08 ENST00000351270 p.C176G OR51F1 chr11 4769710 4769710 Missense_Mutation C C T TCGA-13-1409-01A-01W-0492-08 ENST00000380383 p.A77T OR51Q1 chr11 5422463 5422463 Missense_Mutation G G T TCGA-13-1409-01A-01W-0492-08 ENST00000300778 p.W88L FSHB chr11 30231974 30231974 Silent C C A TCGA-13-1409-01A-01W-0492-08 ENST00000254122 p.T24T QSER1 chr11 32934092 32934092 Missense_Mutation G G A TCGA-13-1409-01A-01W-0492-08 ENST00000399302 p.S816N OR8K1 chr11 56346345 56346345 Missense_Mutation T T C TCGA-13-1409-01A-01W-0492-08 ENST00000279783 p.Y103H DPF2 chr11 65340999 65340999 Missense_Mutation C C A TCGA-13-1409-01A-01W-0492-08 ENST00000528416 p.A76D OR8D2 chr11 124319417 124319417 Missense_Mutation T T C TCGA-13-1409-01A-01W-0492-08 ENST00000357438 p.K261E PUS3 chr11 125895261 125895261 Missense_Mutation G G T TCGA-13-1409-01A-01W-0492-08 ENST00000227474 p.L303M CCNT1 chr12 48694143 48694143 Silent A A C TCGA-13-1409-01A-01W-0492-08 ENST00000261900 p.L357L DIP2B chr12 50698355 50698355 Silent A A G TCGA-13-1409-01A-01W-0492-08 ENST00000301180 p.P692P NDUFA4L2 chr12 57237145 57237145 5'UTR T T A TCGA-13-1409-01A-01W-0492-08 ENST00000393825 LATS2 chr13 20975173 20975173 Silent G G T TCGA-13-1409-01A-01W-0492-08 ENST00000382592 p.P988P FRY chr13 32078850 32078850 Silent C C T TCGA-13-1409-01A-01W-0492-08 ENST00000542859 p.N29N ELMSAN1 chr14 73739585 73739585 Missense_Mutation A A C TCGA-13-1409-01A-01W-0492-08 ENST00000286523 p.Y142D NTRK3 chr15 87940673 87940673 Nonsense_Mutation C C A TCGA-13-1409-01A-01W-0492-08 ENST00000360948 p.E556* CDH8 chr16 61654071 61654071 Missense_Mutation C C T TCGA-13-1409-01A-01W-0492-08 ENST00000577390 p.R646Q CENPT chr16 67828183 67828184 3'UTR - - G TCGA-13-1409-01A-01W-0492-08 ENST00000440851 ZFHX3 chr16 72788638 72788638 Missense_Mutation G G T TCGA-13-1409-01A-01W-0492-08 ENST00000268489 p.P3213Q ANKRD11 chr16 89285135 89285135 Silent G G A TCGA-13-1409-01A-01W-0492-08 ENST00000301030 p.F469F TP53 chr17 7674180 7674180 Splice_Site C A A TCGA-13-1409-01A-01W-0492-08 ENST00000269305 p.X261_splice ANKRD30B chr18 14784524 14784524 Missense_Mutation C C T TCGA-13-1409-01A-01W-0492-08 ENST00000358984 p.T554I ZNF560 chr19 9471301 9471301 Nonsense_Mutation G G A TCGA-13-1409-01A-01W-0492-08 ENST00000301480 p.Q106* ZNF257 chr19 22088294 22088294 Missense_Mutation T T C TCGA-13-1409-01A-01W-0492-08 ENST00000594947 p.F182L SIPA1L3 chr19 38082858 38082858 Silent C C T TCGA-13-1409-01A-01W-0492-08 ENST00000222345 p.R431R FAM83E chr19 48613166 48613166 Silent C C T TCGA-13-1409-01A-01W-0492-08 ENST00000263266 p.A69A KIF16B chr20 16515626 16515626 Silent T T A TCGA-13-1409-01A-01W-0492-08 ENST00000354981 p.A90A PLXNB2 chr22 50285824 50285824 Silent C C T TCGA-13-1409-01A-01W-0492-08 ENST00000359337 p.Q688Q PLXNB2 chr22 50286204 50286204 Missense_Mutation G G T TCGA-13-1409-01A-01W-0492-08 ENST00000359337 p.R616S GPKOW chrX 49119714 49119714 Missense_Mutation G G T TCGA-13-1409-01A-01W-0492-08 ENST00000156109 p.T186N TCEAL1 chrX 103630406 103630406 3'UTR C C G TCGA-13-1409-01A-01W-0492-08 ENST00000372625 BRCC3 chrX 155071627 155071627 Missense_Mutation G G A TCGA-13-1409-01A-01W-0492-08 ENST00000369462 p.V34I NPHP4 chr1 5877116 5877116 Missense_Mutation C C T TCGA-25-1326-01A-01W-0492-08 ENST00000378156 p.G932S EPHA2 chr1 16138155 16138155 Missense_Mutation G G C TCGA-25-1326-01A-01W-0492-08 ENST00000358432 p.A337G EPB41 chr1 29065085 29065085 Missense_Mutation G G C TCGA-25-1326-01A-01W-0492-08 ENST00000343067 p.W704S NKAIN1 chr1 31181859 31181859 Splice_Site C C G TCGA-25-1326-01A-01W-0492-08 ENST00000373736 p.X205_splice RNF19B chr1 32944091 32944091 Missense_Mutation C C A TCGA-25-1326-01A-01W-0492-08 ENST00000373456 p.G445C DLGAP3 chr1 34885055 34885055 Silent C C A TCGA-25-1326-01A-01W-0492-08 ENST00000235180 p.T641T PCSK9 chr1 55046623 55046623 Missense_Mutation G G T TCGA-25-1326-01A-01W-0492-08 ENST00000302118 p.R167L S1PR1 chr1 101239867 101239867 Missense_Mutation T T C TCGA-25-1326-01A-01W-0492-08 ENST00000305352 p.Y295H MAGI3 chr1 113649291 113649291 Missense_Mutation G G C TCGA-25-1326-01A-01W-0492-08 ENST00000307546 p.G737A CHD1L chr1 147280170 147280170 Missense_Mutation A A T TCGA-25-1326-01A-01W-0492-08 ENST00000369258 p.S562C SV2A chr1 149909496 149909496 Missense_Mutation G G A TCGA-25-1326-01A-01W-0492-08 ENST00000369146 p.R419C ASH1L chr1 155479190 155479190 Missense_Mutation A A G TCGA-25-1326-01A-01W-0492-08 ENST00000368346 p.F1227S SLC25A44 chr1 156210278 156210278 Missense_Mutation G G C TCGA-25-1326-01A-01W-0492-08 ENST00000359511 p.Q264H LGR6 chr1 202314841 202314841 Missense_Mutation A A G TCGA-25-1326-01A-01W-0492-08 ENST00000367278 p.D536G RASSF5 chr1 206586820 206586820 Splice_Region T T G TCGA-25-1326-01A-01W-0492-08 ENST00000579436 EIF2D chr1 206599583 206599583 Missense_Mutation G G T TCGA-25-1326-01A-01W-0492-08 ENST00000271764 p.S361Y MARK1 chr1 220635462 220635462 Silent C C G TCGA-25-1326-01A-01W-0492-08 ENST00000366917 p.S403S GALNT2 chr1 230203156 230203156 Silent C C T TCGA-25-1326-01A-01W-0492-08 ENST00000366672 p.D80D SLC35F3 chr1 234316617 234316617 Missense_Mutation C C A TCGA-25-1326-01A-01W-0492-08 ENST00000366617 p.L213I SLC5A7 chr2 108010250 108010250 Missense_Mutation G G A TCGA-25-1326-01A-01W-0492-08 ENST00000264047 p.V378I MAP3K19 chr2 134981198 134981198 Nonsense_Mutation A A T TCGA-25-1326-01A-01W-0492-08 ENST00000375845 p.C1181* NEB chr2 151642610 151642610 Silent G G T TCGA-25-1326-01A-01W-0492-08 ENST00000172853 p.I2779I TTN chr2 178564515 178564515 Missense_Mutation A A G TCGA-25-1326-01A-01W-0492-08 ENST00000591111 p.I25565T NCKAP1 chr2 182925787 182925787 Missense_Mutation T T C TCGA-25-1326-01A-01W-0492-08 ENST00000361354 p.D1101G HECW2 chr2 196319795 196319795 Missense_Mutation C C G TCGA-25-1326-01A-01W-0492-08 ENST00000260983 p.Q365H CFLAR chr2 201137602 201137602 Intron C C T TCGA-25-1326-01A-01W-0492-08 ENST00000309955 ZNF142 chr2 218656467 218656467 Splice_Region A A C TCGA-25-1326-01A-01W-0492-08 ENST00000411696 SPEG chr2 219484075 219484076 Frame_Shift_Ins - - C TCGA-25-1326-01A-01W-0492-08 ENST00000312358 p.A2207Rfs*116 ASIC4 chr2 219538046 219538046 Nonstop_Mutation G G T TCGA-25-1326-01A-01W-0492-08 ENST00000347842 p.*648Yext*108 SP140 chr2 230284392 230284392 Frame_Shift_Del G G - TCGA-25-1326-01A-01W-0492-08 ENST00000392045 p.E516Kfs*24 CAPN10 chr2 240589398 240589398 Missense_Mutation A A C TCGA-25-1326-01A-01W-0492-08 ENST00000391984 p.K66T FARP2 chr2 241463389 241463389 Silent C C T TCGA-25-1326-01A-01W-0492-08 ENST00000264042 p.L578L RPL14 chr3 40462279 40462279 3'UTR A A T TCGA-25-1326-01A-01W-0492-08 ENST00000338970 LSMEM2 chr3 50287157 50287157 Missense_Mutation C C G TCGA-25-1326-01A-01W-0492-08 ENST00000316436 p.S150R PTPRG chr3 62203504 62203504 Missense_Mutation C C T TCGA-25-1326-01A-01W-0492-08 ENST00000474889 p.P570L EOGT chr3 69008503 69008503 Missense_Mutation C C T TCGA-25-1326-01A-01W-0492-08 ENST00000383701 p.C79Y GPR27 chr3 71754925 71754925 Silent C C T TCGA-25-1326-01A-01W-0492-08 ENST00000304411 p.L292L SNORA7B chr3 129396305 129396305 3'Flank T T C TCGA-25-1326-01A-01W-0492-08 ENST00000384360 SLC9A9 chr3 143266621 143266621 3'UTR C C A TCGA-25-1326-01A-01W-0492-08 ENST00000316549 ERICH6 chr3 150660014 150660014 Nonsense_Mutation T T A TCGA-25-1326-01A-01W-0492-08 ENST00000295910 p.K624* IGSF10 chr3 151448402 151448402 Missense_Mutation G G A TCGA-25-1326-01A-01W-0492-08 ENST00000282466 p.R527W SI chr3 165032692 165032692 Missense_Mutation T T C TCGA-25-1326-01A-01W-0492-08 ENST00000264382 p.N856D SPATA16 chr3 173049013 173049013 Missense_Mutation T T C TCGA-25-1326-01A-01W-0492-08 ENST00000351008 p.T232A KNG1 chr3 186741645 186741645 Missense_Mutation C C T TCGA-25-1326-01A-01W-0492-08 ENST00000265023 p.R417W DLG1 chr3 197116078 197116078 Missense_Mutation G G C TCGA-25-1326-01A-01W-0492-08 ENST00000419354 p.P464R SH3BP2 chr4 2830040 2830041 Frame_Shift_Ins - - C TCGA-25-1326-01A-01W-0492-08 ENST00000356331 p.V381Rfs*14 LYAR chr4 4274403 4274403 Missense_Mutation C C T TCGA-25-1326-01A-01W-0492-08 ENST00000343470 p.V266M CD38 chr4 15816633 15816633 Missense_Mutation G G C TCGA-25-1326-01A-01W-0492-08 ENST00000226279 p.C119S STIM2 chr4 27017948 27017948 Missense_Mutation A A T TCGA-25-1326-01A-01W-0492-08 ENST00000467087 p.E576V DCUN1D4 chr4 51874280 51874280 Missense_Mutation G G C TCGA-25-1326-01A-01W-0492-08 ENST00000334635 p.R49P ADH7 chr4 99419074 99419074 Silent A A C TCGA-25-1326-01A-01W-0492-08 ENST00000209665 p.V303V ALPK1 chr4 112435190 112435190 Missense_Mutation C C T TCGA-25-1326-01A-01W-0492-08 ENST00000177648 p.T1026M PAPD7 chr5 6754950 6754950 3'UTR T T A TCGA-25-1326-01A-01W-0492-08 ENST00000230859 PDZD2 chr5 32077741 32077741 Intron G G C TCGA-25-1326-01A-01W-0492-08 ENST00000438447 MTMR12 chr5 32248121 32248121 Missense_Mutation T T A TCGA-25-1326-01A-01W-0492-08 ENST00000382142 p.Y301F C1QTNF3 chr5 34042976 34042976 Intron G G C TCGA-25-1326-01A-01W-0492-08 ENST00000231338 DDX4 chr5 55738995 55738995 Missense_Mutation A A C TCGA-25-1326-01A-01W-0492-08 ENST00000505374 p.N11T TMEM171 chr5 73123829 73123829 Silent C C T TCGA-25-1326-01A-01W-0492-08 ENST00000454765 p.D152D C5orf24 chr5 134855469 134855469 3'UTR T T C TCGA-25-1326-01A-01W-0492-08 ENST00000338051 REEP2 chr5 138440948 138440948 Intron T T G TCGA-25-1326-01A-01W-0492-08 ENST00000254901 PCDHA2 chr5 140797069 140797069 Missense_Mutation T T C TCGA-25-1326-01A-01W-0492-08 ENST00000526136 p.I702T KIAA0141 chr5 141929658 141929658 Silent C C T TCGA-25-1326-01A-01W-0492-08 ENST00000194118 p.G163G KCNMB1 chr5 170385358 170385358 Silent G G C TCGA-25-1326-01A-01W-0492-08 ENST00000274629 p.T30T RMND5B chr5 178142772 178142772 Intron A A C TCGA-25-1326-01A-01W-0492-08 ENST00000313386 HIST1H1A chr6 26017228 26017228 Missense_Mutation G G C TCGA-25-1326-01A-01W-0492-08 ENST00000244573 p.P169A UHRF1BP1 chr6 34858339 34858339 Silent G G C TCGA-25-1326-01A-01W-0492-08 ENST00000192788 p.L661L PTCRA chr6 42923123 42923123 Missense_Mutation T T A TCGA-25-1326-01A-01W-0492-08 ENST00000304672 p.V52D CAPN11 chr6 44177352 44177352 Nonsense_Mutation C C T TCGA-25-1326-01A-01W-0492-08 ENST00000398776 p.Q450* PKHD1 chr6 51618946 51618946 3'UTR G G C TCGA-25-1326-01A-01W-0492-08 ENST00000371117 TTK chr6 80035403 80035403 Missense_Mutation C C G TCGA-25-1326-01A-01W-0492-08 ENST00000369798 p.T637R DOPEY1 chr6 83138045 83138045 Missense_Mutation T T C TCGA-25-1326-01A-01W-0492-08 ENST00000349129 p.Y1335H AKIRIN2 chr6 87677879 87677879 Missense_Mutation C C G TCGA-25-1326-01A-01W-0492-08 ENST00000257787 p.L156F PM20D2 chr6 89162282 89162282 3'UTR A A G TCGA-25-1326-01A-01W-0492-08 ENST00000275072 FRK chr6 116003908 116003908 Missense_Mutation A A T TCGA-25-1326-01A-01W-0492-08 ENST00000606080 p.S145R THEMIS chr6 127829635 127829635 Missense_Mutation G G C TCGA-25-1326-01A-01W-0492-08 ENST00000368248 p.L184V ARG1 chr6 131576675 131576675 Missense_Mutation G G T TCGA-25-1326-01A-01W-0492-08 ENST00000368087 p.V24L MED23 chr6 131604232 131604232 Missense_Mutation T T G TCGA-25-1326-01A-01W-0492-08 ENST00000368068 p.S568R TAAR6 chr6 132570505 132570505 Missense_Mutation C C A TCGA-25-1326-01A-01W-0492-08 ENST00000275198 p.Q62K FNDC1 chr6 159233001 159233001 Missense_Mutation G G T TCGA-25-1326-01A-01W-0492-08 ENST00000297267 p.R830M TNRC18 chr7 5370503 5370503 Missense_Mutation C C G TCGA-25-1326-01A-01W-0492-08 ENST00000430969 p.G1364A AOAH chr7 36513206 36513206 3'UTR G G T TCGA-25-1326-01A-01W-0492-08 ENST00000617537 ZNF107 chr7 64706888 64706888 Missense_Mutation A A G TCGA-25-1326-01A-01W-0492-08 ENST00000344930 p.K195R PTCD1 chr7 99423955 99423955 Splice_Region C C T TCGA-25-1326-01A-01W-0492-08 ENST00000292478 p.K580K ZKSCAN5 chr7 99526051 99526051 Missense_Mutation G G C TCGA-25-1326-01A-01W-0492-08 ENST00000326775 p.K337N MUC17 chr7 101037962 101037962 Silent A A T TCGA-25-1326-01A-01W-0492-08 ENST00000306151 p.S2182S SRPK2 chr7 105167420 105167420 Silent G G A TCGA-25-1326-01A-01W-0492-08 ENST00000357311 p.V146V SSPO chr7 149778014 149778014 Silent G G A TCGA-25-1326-01A-01W-0492-08 ENST00000378016 p.L268L LGI3 chr8 22153990 22153990 Missense_Mutation G G T TCGA-25-1326-01A-01W-0492-08 ENST00000306317 p.P158T XKR4 chr8 55454340 55454340 Intron T T A TCGA-25-1326-01A-01W-0492-08 ENST00000327381 CYP7A1 chr8 58496770 58496770 Nonsense_Mutation G G A TCGA-25-1326-01A-01W-0492-08 ENST00000301645 p.Q248* VCPIP1 chr8 66665521 66665521 Missense_Mutation C C G TCGA-25-1326-01A-01W-0492-08 ENST00000310421 p.V480L ARFGEF1 chr8 67227140 67227140 Missense_Mutation C C T TCGA-25-1326-01A-01W-0492-08 ENST00000262215 p.V1305I ZC2HC1A chr8 78698464 78698464 Missense_Mutation C C T TCGA-25-1326-01A-01W-0492-08 ENST00000263849 p.L219F PARP10 chr8 143984713 143984713 Missense_Mutation A A C TCGA-25-1326-01A-01W-0492-08 ENST00000313028 p.V430G RMI1 chr9 84002108 84002108 Missense_Mutation T T A TCGA-25-1326-01A-01W-0492-08 ENST00000325875 p.S374R RMI1 chr9 84002109 84002109 Nonsense_Mutation G G T TCGA-25-1326-01A-01W-0492-08 ENST00000325875 p.E375* CENPP chr9 92332246 92332246 Missense_Mutation C C A TCGA-25-1326-01A-01W-0492-08 ENST00000375587 p.H62N PTCH1 chr9 95456281 95456281 Missense_Mutation C C A TCGA-25-1326-01A-01W-0492-08 ENST00000331920 p.A1101S NCBP1 chr9 97650515 97650515 Missense_Mutation C C T TCGA-25-1326-01A-01W-0492-08 ENST00000375147 p.P304S GALNT12 chr9 98823341 98823341 Missense_Mutation C C G TCGA-25-1326-01A-01W-0492-08 ENST00000375011 p.L153V INVS chr9 100273063 100273063 Missense_Mutation G G T TCGA-25-1326-01A-01W-0492-08 ENST00000262457 p.D591Y INVS chr9 100273064 100273064 Missense_Mutation A A T TCGA-25-1326-01A-01W-0492-08 ENST00000262457 p.D591V CTNNAL1 chr9 108976991 108976991 Missense_Mutation T T G TCGA-25-1326-01A-01W-0492-08 ENST00000325551 p.S387R C9orf43 chr9 113425386 113425386 Missense_Mutation A A G TCGA-25-1326-01A-01W-0492-08 ENST00000288462 p.Q303R OR1K1 chr9 122800516 122800516 Missense_Mutation C C T TCGA-25-1326-01A-01W-0492-08 ENST00000277309 p.P132S C9orf106 chr9 129322323 129322323 RNA C C T TCGA-25-1326-01A-01W-0492-08 ENST00000316786 PRDM12 chr9 130666764 130666764 Missense_Mutation T T G TCGA-25-1326-01A-01W-0492-08 ENST00000253008 p.V127G GATA3 chr10 8058659 8058659 Missense_Mutation C C T TCGA-25-1326-01A-01W-0492-08 ENST00000346208 p.S199F EPC1 chr10 32271797 32271797 Missense_Mutation T T G TCGA-25-1326-01A-01W-0492-08 ENST00000263062 p.H732P ARHGAP22 chr10 48446489 48446489 Missense_Mutation C C G TCGA-25-1326-01A-01W-0492-08 ENST00000249601 p.E667Q ADK chr10 74224593 74224593 Splice_Site T T G TCGA-25-1326-01A-01W-0492-08 ENST00000286621 p.X65_splice SORCS3 chr10 104915934 104915934 Splice_Site T T C TCGA-25-1326-01A-01W-0492-08 ENST00000369699 p.X265_splice PTPRE chr10 128069738 128069738 Missense_Mutation A A G TCGA-25-1326-01A-01W-0492-08 ENST00000254667 p.M352V NR1H3 chr11 47261418 47261418 Missense_Mutation G G A TCGA-25-1326-01A-01W-0492-08 ENST00000441012 p.R226Q MYBPC3 chr11 47337576 47337576 Missense_Mutation T G G TCGA-25-1326-01A-01W-0492-08 ENST00000545968 p.Y806S OOSP2 chr11 60047038 60047038 Missense_Mutation T T A TCGA-25-1326-01A-01W-0492-08 ENST00000278855 p.L148I SPTBN2 chr11 66687581 66687581 Frame_Shift_Del C C - TCGA-25-1326-01A-01W-0492-08 ENST00000309996 p.A2190Pfs*127 ARAP1 chr11 72711019 72711019 Splice_Site A G G TCGA-25-1326-01A-01W-0492-08 ENST00000393609 p.X405_splice PHC1 chr12 8930781 8930781 Missense_Mutation C C T TCGA-25-1326-01A-01W-0492-08 ENST00000543824 p.T320I ABCC9 chr12 21859616 21859616 Silent C C T TCGA-25-1326-01A-01W-0492-08 ENST00000261201 p.A825A LRRK2 chr12 40322132 40322132 Missense_Mutation C C A TCGA-25-1326-01A-01W-0492-08 ENST00000298910 p.D1756E HOXC6 chr12 54028748 54028748 Missense_Mutation C C A TCGA-25-1326-01A-01W-0492-08 ENST00000243108 p.S76Y ESYT1 chr12 56137573 56137573 Silent G G A TCGA-25-1326-01A-01W-0492-08 ENST00000394048 p.K671K BAZ2A chr12 56604589 56604589 Missense_Mutation T T G TCGA-25-1326-01A-01W-0492-08 ENST00000551812 p.I989L NAV3 chr12 78122268 78122268 Missense_Mutation A A T TCGA-25-1326-01A-01W-0492-08 ENST00000397909 p.T1360S ELK3 chr12 96247068 96247068 Silent C C T TCGA-25-1326-01A-01W-0492-08 ENST00000228741 p.C112C CDK17 chr12 96289256 96289256 Missense_Mutation C C G TCGA-25-1326-01A-01W-0492-08 ENST00000261211 p.K343N B3GNT4 chr12 122206521 122206521 Silent T T C TCGA-25-1326-01A-01W-0492-08 ENST00000324189 p.P90P SBNO1 chr12 123311099 123311099 Missense_Mutation A A G TCGA-25-1326-01A-01W-0492-08 ENST00000420886 p.L1084P CENPJ chr13 24912659 24912659 Missense_Mutation T T A TCGA-25-1326-01A-01W-0492-08 ENST00000381884 p.N123Y PROSER1 chr13 39026313 39026313 Silent G G C TCGA-25-1326-01A-01W-0492-08 ENST00000352251 p.P148P STK24 chr13 98463691 98463691 Missense_Mutation G G C TCGA-25-1326-01A-01W-0492-08 ENST00000376547 p.A322G COL4A2 chr13 110307914 110307914 Missense_Mutation A A C TCGA-25-1326-01A-01W-0492-08 ENST00000360467 p.D4A MDGA2 chr14 46873499 46873499 Missense_Mutation G G T TCGA-25-1326-01A-01W-0492-08 ENST00000399232 p.P827T SYNE2 chr14 64075984 64075984 Missense_Mutation G G C TCGA-25-1326-01A-01W-0492-08 ENST00000344113 p.E3636Q PGF chr14 74946813 74946813 Silent G G A TCGA-25-1326-01A-01W-0492-08 ENST00000405431 p.S176S THBS1 chr15 39592673 39592673 Missense_Mutation G G C TCGA-25-1326-01A-01W-0492-08 ENST00000260356 p.A880P THBS1 chr15 39592784 39592784 Missense_Mutation G G A TCGA-25-1326-01A-01W-0492-08 ENST00000260356 p.D917N EPB42 chr15 43208654 43208654 Silent G G C TCGA-25-1326-01A-01W-0492-08 ENST00000441366 p.G318G FBN1 chr15 48526180 48526180 Missense_Mutation C C G TCGA-25-1326-01A-01W-0492-08 ENST00000316623 p.C313S RORA chr15 60497514 60497514 Missense_Mutation G G C TCGA-25-1326-01A-01W-0492-08 ENST00000335670 p.P505A ARIH1 chr15 72555364 72555364 Splice_Site G G A TCGA-25-1326-01A-01W-0492-08 ENST00000379887 p.X227_splice ZNF710 chr15 90074214 90074214 Missense_Mutation G G T TCGA-25-1326-01A-01W-0492-08 ENST00000268154 p.K583N NOMO1 chr16 14863088 14863088 Silent C C T TCGA-25-1326-01A-01W-0492-08 ENST00000287667 p.V432V SRCAP chr16 30720314 30720314 Silent C C G TCGA-25-1326-01A-01W-0492-08 ENST00000262518 p.V990V C16orf58 chr16 31493647 31493647 Missense_Mutation A A T TCGA-25-1326-01A-01W-0492-08 ENST00000327237 p.V305E NLRC5 chr16 57077774 57077774 Missense_Mutation G G T TCGA-25-1326-01A-01W-0492-08 ENST00000262510 p.V1659F NQO1 chr16 69711264 69711264 Silent G G A TCGA-25-1326-01A-01W-0492-08 ENST00000320623 p.F179F AARS chr16 70252742 70252742 Silent G G C TCGA-25-1326-01A-01W-0492-08 ENST00000261772 p.R962R ZNF232 chr17 5106498 5106498 Nonsense_Mutation C C A TCGA-25-1326-01A-01W-0492-08 ENST00000250076 p.E221* SCIMP chr17 5210873 5210873 Silent T T G TCGA-25-1326-01A-01W-0492-08 ENST00000574081 p.P122P TP53 chr17 7673764 7673764 Missense_Mutation C C T TCGA-25-1326-01A-01W-0492-08 ENST00000269305 p.E286K FAM222B chr17 28758605 28758605 Missense_Mutation G G C TCGA-25-1326-01A-01W-0492-08 ENST00000452648 p.P452A EVI2B chr17 31305161 31305161 Missense_Mutation G G A TCGA-25-1326-01A-01W-0492-08 ENST00000330927 p.S150L STARD3 chr17 39662808 39662808 Missense_Mutation G G T TCGA-25-1326-01A-01W-0492-08 ENST00000336308 p.R413L KRT28 chr17 40793895 40793895 Missense_Mutation A A G TCGA-25-1326-01A-01W-0492-08 ENST00000306658 p.L377P KLHL11 chr17 41855160 41855160 Missense_Mutation A A G TCGA-25-1326-01A-01W-0492-08 ENST00000319121 p.I236T DNAJC7 chr17 41989505 41989505 Missense_Mutation G G C TCGA-25-1326-01A-01W-0492-08 ENST00000457167 p.L218V KPNB1 chr17 47680589 47680589 Silent G G T TCGA-25-1326-01A-01W-0492-08 ENST00000290158 p.G850G ABCA5 chr17 69270663 69270663 Missense_Mutation G G T TCGA-25-1326-01A-01W-0492-08 ENST00000392676 p.H994N TRIM47 chr17 75875971 75875971 Silent G G A TCGA-25-1326-01A-01W-0492-08 ENST00000254816 p.C377C BAIAP2 chr17 81108516 81108516 Splice_Region G G C TCGA-25-1326-01A-01W-0492-08 ENST00000321300 HGS chr17 81695027 81695027 Missense_Mutation A A T TCGA-25-1326-01A-01W-0492-08 ENST00000329138 p.Q360L MYOM1 chr18 3126834 3126834 Missense_Mutation C C T TCGA-25-1326-01A-01W-0492-08 ENST00000356443 p.G953E ST8SIA5 chr18 46688843 46688843 Missense_Mutation G G T TCGA-25-1326-01A-01W-0492-08 ENST00000315087 p.L130I MALT1 chr18 58723106 58723106 Silent C C T TCGA-25-1326-01A-01W-0492-08 ENST00000348428 p.L359L GALR1 chr18 77268718 77268718 Missense_Mutation A A G TCGA-25-1326-01A-01W-0492-08 ENST00000299727 p.H289R COL5A3 chr19 9980844 9980844 Missense_Mutation T T A TCGA-25-1326-01A-01W-0492-08 ENST00000264828 p.R841W S1PR5 chr19 10513892 10513892 Missense_Mutation C C T TCGA-25-1326-01A-01W-0492-08 ENST00000333430 p.D374N TSPAN16 chr19 11298213 11298213 Silent C C T TCGA-25-1326-01A-01W-0492-08 ENST00000316737 p.L47L BEST2 chr19 12755454 12755454 Nonsense_Mutation C C T TCGA-25-1326-01A-01W-0492-08 ENST00000042931 p.Q238* ZNF14 chr19 19714092 19714092 Splice_Region T T G TCGA-25-1326-01A-01W-0492-08 ENST00000344099 p.R64R PRKD2 chr19 46681734 46681734 Missense_Mutation C C G TCGA-25-1326-01A-01W-0492-08 ENST00000291281 p.L662F DHX34 chr19 47353477 47353477 Missense_Mutation T T G TCGA-25-1326-01A-01W-0492-08 ENST00000328771 p.F149L MAMSTR chr19 48713915 48713915 Missense_Mutation C C T TCGA-25-1326-01A-01W-0492-08 ENST00000318083 p.G285D SIGLEC6 chr19 51530509 51530509 Intron T T C TCGA-25-1326-01A-01W-0492-08 ENST00000425629 ZNF766 chr19 52269588 52269588 5'UTR G G C TCGA-25-1326-01A-01W-0492-08 ENST00000439461 ZNF525 chr19 53381355 53381355 Missense_Mutation C C G TCGA-25-1326-01A-01W-0492-08 ENST00000474037 p.A259G ZBTB45 chr19 58516699 58516699 Silent T C C TCGA-25-1326-01A-01W-0492-08 ENST00000354590 p.P325P PLCB4 chr20 9459640 9459640 Silent A A G TCGA-25-1326-01A-01W-0492-08 ENST00000278655 p.K1014K SPAG4 chr20 35617217 35617217 Missense_Mutation C C G TCGA-25-1326-01A-01W-0492-08 ENST00000374273 p.P129R KIAA1755 chr20 38241794 38241794 Missense_Mutation C C T TCGA-25-1326-01A-01W-0492-08 ENST00000279024 p.E113K GNAS chr20 58909784 58909784 Missense_Mutation C C G TCGA-25-1326-01A-01W-0492-08 ENST00000371085 p.F273L ADAMTS5 chr21 26966049 26966049 Missense_Mutation G G T TCGA-25-1326-01A-01W-0492-08 ENST00000284987 p.P115T AF064858.6 chr21 38878902 38878902 RNA A A T TCGA-25-1326-01A-01W-0492-08 ENST00000380931 MCM3AP chr21 46272756 46272756 Missense_Mutation T T C TCGA-25-1326-01A-01W-0492-08 ENST00000291688 p.H757R PIWIL3 chr22 24719546