Hugo_Symbol Chromosome Start_Position End_Position Variant_Classification Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 Tumor_Sample_Barcode transcript_name amino_acid_change NLGN1 chr3 174279389 174279389 Missense_Mutation A A G TCGA-S9-A6TY-01A-12D-A32B-08 ENST00000457714 p.H463R ADAMTS6 chr5 65273407 65273407 Missense_Mutation C C A TCGA-S9-A6TY-01A-12D-A32B-08 ENST00000381055 p.R518L SPRY4 chr5 142314301 142314301 Missense_Mutation G G A TCGA-S9-A6TY-01A-12D-A32B-08 ENST00000434127 p.R270C DMTN chr8 22080811 22080811 Missense_Mutation G G A TCGA-S9-A6TY-01A-12D-A32B-08 ENST00000265800 p.E322K SVEP1 chr9 110408793 110408793 Silent C C T TCGA-S9-A6TY-01A-12D-A32B-08 ENST00000374469 p.P2269P SIRT1 chr10 67909426 67909426 Silent A A G TCGA-S9-A6TY-01A-12D-A32B-08 ENST00000212015 p.P447P OR5L1 chr11 55811924 55811924 Missense_Mutation C C T TCGA-S9-A6TY-01A-12D-A32B-08 ENST00000333973 p.T153M OR5T1 chr11 56276200 56276200 Missense_Mutation C C T TCGA-S9-A6TY-01A-12D-A32B-08 ENST00000313033 p.H188Y GANAB chr11 62634339 62634339 Intron T T C TCGA-S9-A6TY-01A-12D-A32B-08 ENST00000356638 APAF1 chr12 98703420 98703420 Missense_Mutation A A G TCGA-S9-A6TY-01A-12D-A32B-08 ENST00000551964 p.H839R THBS1 chr15 39593171 39593171 Missense_Mutation G G A TCGA-S9-A6TY-01A-12D-A32B-08 ENST00000260356 p.R980H ZFYVE19 chr15 40813375 40813375 Silent C C T TCGA-S9-A6TY-01A-12D-A32B-08 ENST00000355341 p.D356D IDH2 chr15 90088606 90088606 Missense_Mutation C C T TCGA-S9-A6TY-01A-12D-A32B-08 ENST00000330062 p.R172K ASGR2 chr17 7108779 7108779 Silent C C T TCGA-S9-A6TY-01A-12D-A32B-08 ENST00000355035 p.G78G ANKRD29 chr18 23601198 23601198 3'UTR C C A TCGA-S9-A6TY-01A-12D-A32B-08 ENST00000592179 CXXC1 chr18 50283731 50283731 Missense_Mutation G G A TCGA-S9-A6TY-01A-12D-A32B-08 ENST00000285106 p.R500C SERPINB13 chr18 63595125 63595125 Missense_Mutation A A G TCGA-S9-A6TY-01A-12D-A32B-08 ENST00000344731 p.K238E MAP2K7 chr19 7911003 7911003 Silent G G A TCGA-S9-A6TY-01A-12D-A32B-08 ENST00000397979 p.L233L TMPRSS15 chr21 18398264 18398264 Missense_Mutation T T A TCGA-S9-A6TY-01A-12D-A32B-08 ENST00000284885 p.N71Y ST13 chr22 40827192 40827192 Silent T T C TCGA-S9-A6TY-01A-12D-A32B-08 ENST00000216218 p.G295G SRSF10 chr1 23978816 23978816 Missense_Mutation A A G TCGA-HT-7483-01A-11D-2024-08 ENST00000492112 p.S23P HIVEP3 chr1 41583528 41583528 Nonsense_Mutation G G A TCGA-HT-7483-01A-11D-2024-08 ENST00000247584 p.R424* FLAD1 chr1 154992770 154992770 Missense_Mutation A A G TCGA-HT-7483-01A-11D-2024-08 ENST00000292180 p.I538V IDH1 chr2 208248389 208248389 Missense_Mutation G G C TCGA-HT-7483-01A-11D-2024-08 ENST00000345146 p.R132G KCNH8 chr3 19347947 19347947 Missense_Mutation G G A TCGA-HT-7483-01A-11D-2024-08 ENST00000328405 p.E265K CASR chr3 122283764 122283764 Missense_Mutation G G A TCGA-HT-7483-01A-11D-2024-08 ENST00000490131 p.E604K TLR3 chr4 186083211 186083211 Missense_Mutation A A G TCGA-HT-7483-01A-11D-2024-08 ENST00000296795 p.T509A FGD6 chr12 95211131 95211131 Silent T T G TCGA-HT-7483-01A-11D-2024-08 ENST00000343958 p.A51A CDR2 chr16 22347753 22347753 Missense_Mutation C C G TCGA-HT-7483-01A-11D-2024-08 ENST00000268383 p.E193Q TP53 chr17 7674233 7674233 Missense_Mutation C G G TCGA-HT-7483-01A-11D-2024-08 ENST00000269305 p.G244R C17orf47 chr17 58542923 58542923 Missense_Mutation C C T TCGA-HT-7483-01A-11D-2024-08 ENST00000321691 p.G422R PAPL chr19 39100637 39100637 Missense_Mutation G G C TCGA-HT-7483-01A-11D-2024-08 ENST00000331256 p.W229C ADRA1D chr20 4221780 4221780 Silent G G T TCGA-HT-7483-01A-11D-2024-08 ENST00000379453 p.R488R CDH4 chr20 61844702 61844702 Missense_Mutation G G A TCGA-HT-7483-01A-11D-2024-08 ENST00000614565 p.R204Q ABHD16B chr20 63862254 63862254 Silent C C T TCGA-HT-7483-01A-11D-2024-08 ENST00000369916 p.P238P SRSF11 chr1 70221838 70221838 Missense_Mutation G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000370950 p.D68N ABCA4 chr1 94021311 94021311 Silent G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000370225 p.P1649P PPM1J chr1 112710245 112710245 Missense_Mutation C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000309276 p.R479H AIM2 chr1 159062712 159062714 In_Frame_Del TAA TAA - TCGA-DU-5852-01A-11D-1705-08 ENST00000368130 p.I337del SLAMF7 chr1 160749822 160749822 Splice_Region G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000368043 p.E126E F5 chr1 169542955 169542955 Missense_Mutation C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000367797 p.R712H SLC35F3 chr1 233905621 233905621 Missense_Mutation C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000366618 p.A49V OR14C36 chr1 248349052 248349052 Missense_Mutation C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000317861 p.A93V OR2T3 chr1 248473763 248473763 Missense_Mutation C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000359594 p.P138L NDUFAF7 chr2 37241689 37241689 Missense_Mutation G G T TCGA-DU-5852-01A-11D-1705-08 ENST00000002125 p.V174F USP34 chr2 61241575 61241575 Silent C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000398571 p.S2254S RNF149 chr2 101277229 101277229 3'UTR G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000295317 PAX8 chr2 113244624 113244624 Missense_Mutation C C A TCGA-DU-5852-01A-11D-1705-08 ENST00000263334 p.R64S HRH1 chr3 11259327 11259327 Missense_Mutation G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000397056 p.R97H PBRM1 chr3 52617414 52617414 Missense_Mutation G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000296302 p.P556S PCDHA8 chr5 140842255 140842255 Nonsense_Mutation C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000531613 p.Q312* BRD2 chr6 32980012 32980012 Missense_Mutation T T A TCGA-DU-5852-01A-11D-1705-08 ENST00000374825 p.L676I PACSIN1 chr6 34530588 34530588 Splice_Site G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000244458 p.X346_splice ADGRF4 chr6 47712423 47712423 Nonsense_Mutation C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000283303 p.R123* LGSN chr6 63279887 63279887 3'UTR A A - TCGA-DU-5852-01A-11D-1705-08 ENST00000370657 FILIP1 chr6 75314908 75314908 Silent C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000237172 p.S308S HACE1 chr6 104784988 104784988 Missense_Mutation G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000262903 p.P469L SLC35F1 chr6 118314165 118314165 Missense_Mutation A A C TCGA-DU-5852-01A-11D-1705-08 ENST00000360388 p.L380F EGFR chr7 55154017 55154017 Missense_Mutation C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000275493 p.R252C AUTS2 chr7 70766274 70766274 Missense_Mutation C C A TCGA-DU-5852-01A-11D-1705-08 ENST00000342771 p.F543L STAG3 chr7 100198104 100198104 Missense_Mutation G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000317296 p.M394I CUL1 chr7 148753993 148753993 Missense_Mutation G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000325222 p.C53Y LZTS1 chr8 20255189 20255189 5'UTR C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000265801 LETM2 chr8 38392923 38392923 Silent C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000379957 p.D143D DCAF4L2 chr8 87872972 87872972 Missense_Mutation G G C TCGA-DU-5852-01A-11D-1705-08 ENST00000319675 p.Q334E SLC45A4 chr8 141218791 141218791 Silent G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000517878 p.F283F SECISBP2 chr9 89339883 89339883 Missense_Mutation A A G TCGA-DU-5852-01A-11D-1705-08 ENST00000375807 p.N411S YME1L1 chr10 27122907 27122907 Missense_Mutation C C A TCGA-DU-5852-01A-11D-1705-08 ENST00000326799 p.R447I RET chr10 43100524 43100524 Missense_Mutation G A A TCGA-DU-5852-01A-11D-1705-08 ENST00000355710 p.G47S C10orf71 chr10 49323180 49323180 Missense_Mutation C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000374144 p.P212L COL17A1 chr10 104043555 104043555 Missense_Mutation C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000353479 p.G821S MUC5B chr11 1247467 1247467 Silent C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000529681 p.T3529T OR51A4 chr11 4946493 4946493 Missense_Mutation A A G TCGA-DU-5852-01A-11D-1705-08 ENST00000380373 p.F203S POLR2G chr11 62762898 62762898 Missense_Mutation G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000301788 p.D52N SLC22A10 chr11 63297310 63297310 Nonsense_Mutation C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000332793 p.R172* DPP3 chr11 66509149 66509149 Silent C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000541961 p.F704F GAB2 chr11 78220393 78220393 Missense_Mutation G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000361507 p.P605S HTR3A chr11 113989518 113989518 Missense_Mutation C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000504030 p.P398S OR6M1 chr11 123805546 123805546 Missense_Mutation G G C TCGA-DU-5852-01A-11D-1705-08 ENST00000309154 p.D268E GDF3 chr12 7690637 7690637 Silent G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000329913 p.N112N DPPA3 chr12 7715333 7715333 Nonsense_Mutation G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000345088 p.W78* KLRAP1 chr12 10593927 10593927 RNA C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000535939 EPS8 chr12 15621278 15621278 3'UTR A A G TCGA-DU-5852-01A-11D-1705-08 ENST00000281172 STAT6 chr12 57107730 57107730 Missense_Mutation C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000300134 p.G44S UGGT2 chr13 95970109 95970109 Splice_Region T T C TCGA-DU-5852-01A-11D-1705-08 ENST00000376747 YLPM1 chr14 74763925 74763925 Missense_Mutation C C A TCGA-DU-5852-01A-11D-1705-08 ENST00000325680 p.P146T HERC2P3 chr15 20431118 20431118 RNA G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000426501 DAPK2 chr15 63911868 63911868 Intron C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000261891 CEMIP chr15 80889483 80889483 Missense_Mutation C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000220244 p.T326M ALPK3 chr15 84857271 84857271 Frame_Shift_Del G G - TCGA-DU-5852-01A-11D-1705-08 ENST00000258888 p.G1048Efs*12 SLCO3A1 chr15 92162963 92162963 Missense_Mutation G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000318445 p.R654H SLC12A3 chr16 56894556 56894556 Silent C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000563236 p.L849L NUDT7 chr16 77741739 77741739 Missense_Mutation G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000268533 p.R169H CDH13 chr16 83217381 83217381 Missense_Mutation C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000567109 p.R174W OVCA2 chr17 2042948 2042948 Silent G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000572195 p.G176G RANGRF chr17 8289579 8289579 Missense_Mutation A A G TCGA-DU-5852-01A-11D-1705-08 ENST00000226105 p.N143S MYOCD chr17 12752690 12752690 Missense_Mutation G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000343344 p.A468T SREBF1 chr17 17818277 17818277 Missense_Mutation G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000261646 p.T389I FAM83G chr17 18978297 18978297 Missense_Mutation C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000345041 p.A457T CXADRP3 chr18 14478283 14478283 RNA C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000581457 LAMA3 chr18 23822319 23822319 Missense_Mutation A A T TCGA-DU-5852-01A-11D-1705-08 ENST00000313654 p.Y791F LAMA3 chr18 23822320 23822320 Silent C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000313654 p.Y791Y EPG5 chr18 45916180 45916180 Silent G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000282041 p.P1137P USE1 chr19 17216238 17216238 Missense_Mutation G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000263897 p.E101K CTC-260F20.3 chr19 19534952 19534952 Intron C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000555938 LRRC4B chr19 50517698 50517698 Missense_Mutation G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000389201 p.A672V KLK1 chr19 50819984 50819984 Missense_Mutation T T G TCGA-DU-5852-01A-11D-1705-08 ENST00000301420 p.D183A KLK15 chr19 50827044 50827044 Silent G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000598239 p.N105N LILRA2 chr19 54575314 54575314 Silent G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000251377 p.E238E PTPRH chr19 55202134 55202134 Missense_Mutation C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000376350 p.G359R PROKR2 chr20 5302416 5302416 Missense_Mutation G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000217270 p.T260M ITCH chr20 34481108 34481108 Silent C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000262650 p.S706S PLCG1 chr20 41173744 41173744 Missense_Mutation G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000373271 p.E1163K TTC3 chr21 37164128 37164128 Missense_Mutation T T G TCGA-DU-5852-01A-11D-1705-08 ENST00000354749 p.L1083R ACE2 chrX 15561956 15561956 Silent T T C TCGA-DU-5852-01A-11D-1705-08 ENST00000252519 p.G789G FAM47C chrX 37009838 37009838 Silent G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000358047 p.P476P CACNA1F chrX 49231714 49231714 Missense_Mutation G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000376265 p.P80L ATRX chrX 77508578 77508578 Missense_Mutation A A T TCGA-DU-5852-01A-11D-1705-08 ENST00000373344 p.Y2418N TGIF2LX chrX 89922202 89922202 Missense_Mutation T T A TCGA-DU-5852-01A-11D-1705-08 ENST00000283891 p.D39E PCDH11X chrX 91878713 91878713 Missense_Mutation G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000373094 p.V825I BTK chrX 101358425 101358425 Silent C C A TCGA-DU-5852-01A-11D-1705-08 ENST00000308731 p.G329G CXorf57 chrX 106612062 106612062 5'UTR G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000372548 SLC9A6 chrX 136030137 136030137 Missense_Mutation G G C TCGA-DU-5852-01A-11D-1705-08 ENST00000370698 p.G509A ADGRG4 chrX 136323332 136323332 Missense_Mutation G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000370652 p.E209K SPANXN1 chrX 145255703 145255703 Silent C C T TCGA-DU-5852-01A-11D-1705-08 ENST00000370493 p.P36P F8 chrX 154837677 154837677 Nonsense_Mutation G G A TCGA-DU-5852-01A-11D-1705-08 ENST00000360256 p.R2326* OR10Z1 chr1 158606654 158606654 Nonsense_Mutation C C A TCGA-DU-7013-01A-11D-2024-08 ENST00000361284 p.C72* KCNH1 chr1 210683623 210683623 Missense_Mutation C C G TCGA-DU-7013-01A-11D-2024-08 ENST00000271751 p.K876N MYT1L chr2 1839307 1839307 Silent G G A TCGA-DU-7013-01A-11D-2024-08 ENST00000399161 p.S974S NLRC4 chr2 32251602 32251602 Splice_Site C C T TCGA-DU-7013-01A-11D-2024-08 ENST00000360906 p.X88_splice EDAR chr2 108911001 108911001 Missense_Mutation C C T TCGA-DU-7013-01A-11D-2024-08 ENST00000258443 p.A201T LCT chr2 135809061 135809061 Missense_Mutation C C T TCGA-DU-7013-01A-11D-2024-08 ENST00000264162 p.A1096T PDE11A chr2 177817869 177817869 Nonsense_Mutation G G A TCGA-DU-7013-01A-11D-2024-08 ENST00000286063 p.R545* FGD5 chr3 14820252 14820252 Missense_Mutation G G C TCGA-DU-7013-01A-11D-2024-08 ENST00000285046 p.C394S DNAH1 chr3 52394553 52394553 Missense_Mutation G G A TCGA-DU-7013-01A-11D-2024-08 ENST00000420323 p.R3572Q DGKG chr3 186320467 186320468 5'UTR - - T TCGA-DU-7013-01A-11D-2024-08 ENST00000265022 TMPRSS11F chr4 68059428 68059428 Frame_Shift_Del G G - TCGA-DU-7013-01A-11D-2024-08 ENST00000356291 p.I353* GK2 chr4 79406750 79406750 Missense_Mutation A A G TCGA-DU-7013-01A-11D-2024-08 ENST00000358842 p.M484T ADH1A chr4 99284742 99284742 Silent C C T TCGA-DU-7013-01A-11D-2024-08 ENST00000209668 p.P107P NDST3 chr4 118054350 118054350 Missense_Mutation G G A TCGA-DU-7013-01A-11D-2024-08 ENST00000296499 p.R147Q FGA chr4 154586506 154586506 Missense_Mutation C C T TCGA-DU-7013-01A-11D-2024-08 ENST00000302053 p.R308Q NUP155 chr5 37363975 37363975 Missense_Mutation C C G TCGA-DU-7013-01A-11D-2024-08 ENST00000231498 p.C102S ZSCAN31 chr6 28326810 28326810 Missense_Mutation C C G TCGA-DU-7013-01A-11D-2024-08 ENST00000344279 p.E193Q TAAR5 chr6 132589406 132589406 Missense_Mutation C C T TCGA-DU-7013-01A-11D-2024-08 ENST00000258034 p.R94H EGFR chr7 55165350 55165350 Missense_Mutation G T T TCGA-DU-7013-01A-11D-2024-08 ENST00000275493 p.G598V LUC7L2 chr7 139345555 139345555 Missense_Mutation A A C TCGA-DU-7013-01A-11D-2024-08 ENST00000541515 p.T65P PLAG1 chr8 56166648 56166648 Silent G G A TCGA-DU-7013-01A-11D-2024-08 ENST00000316981 p.G366G TLR4 chr9 117713280 117713280 Silent C C A TCGA-DU-7013-01A-11D-2024-08 ENST00000355622 p.G384G SETX chr9 132326985 132326985 Missense_Mutation C C T TCGA-DU-7013-01A-11D-2024-08 ENST00000224140 p.R1538Q CEL chr9 133069138 133069138 Missense_Mutation G G A TCGA-DU-7013-01A-11D-2024-08 ENST00000372080 p.E392K CYP2C19 chr10 94852865 94852865 Missense_Mutation G A A TCGA-DU-7013-01A-11D-2024-08 ENST00000371321 p.G475E OR9G1 chr11 56700961 56700961 Missense_Mutation G G A TCGA-DU-7013-01A-11D-2024-08 ENST00000312153 p.G192S KRT6B chr12 52448963 52448963 Missense_Mutation T T C TCGA-DU-7013-01A-11D-2024-08 ENST00000252252 p.E361G NOS1 chr12 117286140 117286140 Silent C C T TCGA-DU-7013-01A-11D-2024-08 ENST00000317775 p.S418S ZMYM2 chr13 20061114 20061114 Missense_Mutation T T C TCGA-DU-7013-01A-11D-2024-08 ENST00000382871 p.I934T POTEM chr14 18977708 18977708 Intron T T G TCGA-DU-7013-01A-11D-2024-08 ENST00000547889 MYH6 chr14 23386066 23386066 Silent G G A TCGA-DU-7013-01A-11D-2024-08 ENST00000356287 p.I1675I MDGA2 chr14 46957398 46957398 Missense_Mutation C C T TCGA-DU-7013-01A-11D-2024-08 ENST00000399232 p.G620R SPTB chr14 64791796 64791796 Silent G G A TCGA-DU-7013-01A-11D-2024-08 ENST00000389721 p.L909L MSLNL chr16 773215 773215 Missense_Mutation A A G TCGA-DU-7013-01A-11D-2024-08 ENST00000442466 p.C334R CASKIN1 chr16 2180408 2180408 Missense_Mutation C C T TCGA-DU-7013-01A-11D-2024-08 ENST00000343516 p.S987N CCNF chr16 2449350 2449350 Missense_Mutation C C A TCGA-DU-7013-01A-11D-2024-08 ENST00000397066 p.H429Q NPIPB15 chr16 74385416 74385416 Missense_Mutation G G T TCGA-DU-7013-01A-11D-2024-08 ENST00000429990 p.W108C NUP88 chr17 5388759 5388759 Intron A T T TCGA-DU-7013-01A-11D-2024-08 ENST00000573584 AIPL1 chr17 6425823 6425823 Silent C T T TCGA-DU-7013-01A-11D-2024-08 ENST00000381129 p.V264V TP53 chr17 7674885 7674885 Missense_Mutation C T T TCGA-DU-7013-01A-11D-2024-08 ENST00000269305 p.V216M SLC16A3 chr17 82237685 82237685 Silent C C T TCGA-DU-7013-01A-11D-2024-08 ENST00000392339 p.N305N POLR2E chr19 1090944 1090944 Silent C C T TCGA-DU-7013-01A-11D-2024-08 ENST00000586746 p.L131L NLRP9 chr19 55733406 55733406 Missense_Mutation G G A TCGA-DU-7013-01A-11D-2024-08 ENST00000332836 p.A142V R3HDML chr20 44350686 44350686 Missense_Mutation A A G TCGA-DU-7013-01A-11D-2024-08 ENST00000217043 p.Y219C IGLV3-22 chr22 22704691 22704691 Missense_Mutation C C T TCGA-DU-7013-01A-11D-2024-08 ENST00000390307 p.R72W P2RY10 chrX 78961449 78961449 Nonsense_Mutation C A A TCGA-DU-7013-01A-11D-2024-08 ENST00000171757 p.S310* PGLYRP4 chr1 153345249 153345249 Missense_Mutation G G T TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000359650 p.D91E HMCN1 chr1 186088270 186088270 Missense_Mutation C C T TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000271588 p.R3191C KDM5B chr1 202758439 202758439 Silent C C A TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000367265 p.G383G C4BPA chr1 207115446 207115446 Missense_Mutation G G A TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000367070 p.R120H GEN1 chr2 17773288 17773290 In_Frame_Del TTA TTA - TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000317402 p.L355del PPP1R21 chr2 48471307 48471307 Nonsense_Mutation C C G TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000294952 p.S343* TTN chr2 178575901 178575901 Missense_Mutation C C T TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000591111 p.G21770S IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000345146 p.R132H GUF1 chr4 44698682 44698682 3'UTR T T C TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000281543 TDO2 chr4 155907757 155907757 Missense_Mutation T T A TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000536354 p.L90M DIAPH1 chr5 141580861 141580861 Missense_Mutation T T C TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000389054 p.E236G SF3B5 chr6 144095568 144095571 5'UTR GAGA GAGA - TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000367569 C7orf31 chr7 25155138 25155138 Silent G G A TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000283905 p.R156R GRM3 chr7 86786284 86786284 Missense_Mutation C C G TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000361669 p.F164L WAC chr10 28617717 28617717 Missense_Mutation A A G TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000354911 p.T603A TNNT3 chr11 1923566 1923566 Missense_Mutation G G A TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000397301 p.E15K DENND5A chr11 9142050 9142050 Missense_Mutation G G C TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000328194 p.N1190K RP11-574M7.2 chr11 50416195 50416195 RNA T T A TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000532521 OR5R1 chr11 56417592 56417592 Missense_Mutation A A G TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000312253 p.V214A MS4A4E chr11 60229938 60229938 Missense_Mutation A A G TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000398984 p.F40L PRKAG1 chr12 49018833 49018833 5'UTR C C T TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000548065 FMNL3 chr12 49662041 49662041 Missense_Mutation C C T TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000335154 p.R126Q TP53 chr17 7674218 7674218 Missense_Mutation T C C TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000269305 p.R249G SPTBN4 chr19 40501946 40501946 Missense_Mutation G G C TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000352632 p.E270D ZNF432 chr19 52034916 52034916 Missense_Mutation G G C TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000221315 p.H255D NLRP5 chr19 56004028 56004028 Silent G A A TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000390649 p.T125T ATRX chrX 77682249 77682252 Frame_Shift_Del TTAC TTAC - TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000373344 p.V1002Lfs*30 ARMCX1 chrX 101553819 101553820 Frame_Shift_Ins - - TC TCGA-TM-A84Q-01A-11D-A36O-08 ENST00000372829 p.C298Sfs*13 DOCK7 chr1 62529403 62529403 Silent A A G TCGA-DU-7301-01A-11D-2086-08 ENST00000251157 p.L1219L PPFIA4 chr1 203056810 203056810 Missense_Mutation C C G TCGA-DU-7301-01A-11D-2086-08 ENST00000447715 p.P734R USH2A chr1 216422443 216422443 5'UTR C C T TCGA-DU-7301-01A-11D-2086-08 ENST00000307340 OR2C3 chr1 247531511 247531511 3'UTR G G A TCGA-DU-7301-01A-11D-2086-08 ENST00000366487 NEB chr2 151526947 151526947 Missense_Mutation C C T TCGA-DU-7301-01A-11D-2086-08 ENST00000172853 p.A5605T IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-DU-7301-01A-11D-2086-08 ENST00000345146 p.R132H GOLGA4 chr3 37327618 37327618 Missense_Mutation A A G TCGA-DU-7301-01A-11D-2086-08 ENST00000361924 p.H1911R DHX30 chr3 47846531 47846533 In_Frame_Del ATC ATC - TCGA-DU-7301-01A-11D-2086-08 ENST00000445061 p.I488del FSTL5 chr4 161775937 161775937 Frame_Shift_Del T T - TCGA-DU-7301-01A-11D-2086-08 ENST00000306100 p.M183Cfs*13 AMACR chr5 33989274 33989274 Missense_Mutation A A G TCGA-DU-7301-01A-11D-2086-08 ENST00000335606 p.V323A OR10C1 chr6 29440293 29440293 Missense_Mutation G G A TCGA-DU-7301-01A-11D-2086-08 ENST00000623086 p.R93H EEF1A1 chr6 73518444 73518444 Missense_Mutation C C A TCGA-DU-7301-01A-11D-2086-08 ENST00000309268 p.K313N TUBBP6 chr7 55645853 55645853 RNA G G C TCGA-DU-7301-01A-11D-2086-08 ENST00000416519 FBXO43 chr8 100134230 100134230 Silent T T C TCGA-DU-7301-01A-11D-2086-08 ENST00000428847 p.G603G PDE6C chr10 93625608 93625608 Nonsense_Mutation G G T TCGA-DU-7301-01A-11D-2086-08 ENST00000371447 p.E300* CFAP43 chr10 104230656 104230656 Missense_Mutation G G A TCGA-DU-7301-01A-11D-2086-08 ENST00000357060 p.R85W CTSC chr11 88293886 88293886 3'UTR A A G TCGA-DU-7301-01A-11D-2086-08 ENST00000227266 TRPC6 chr11 101504751 101504751 Missense_Mutation C C T TCGA-DU-7301-01A-11D-2086-08 ENST00000344327 p.R73H NLRX1 chr11 119180249 119180249 Missense_Mutation G G A TCGA-DU-7301-01A-11D-2086-08 ENST00000292199 p.R743H GOLGA6L9 chr15 82434226 82434226 Missense_Mutation G G A TCGA-DU-7301-01A-11D-2086-08 ENST00000618348 p.R209H TP53 chr17 7675206 7675206 Missense_Mutation G C C TCGA-DU-7301-01A-11D-2086-08 ENST00000269305 p.Q136E FAM117A chr17 49764050 49764050 Missense_Mutation G G A TCGA-DU-7301-01A-11D-2086-08 ENST00000240364 p.A13V ARHGEF1 chr19 41892108 41892108 Silent C C T TCGA-DU-7301-01A-11D-2086-08 ENST00000354532 p.F103F MEGF8 chr19 42353499 42353499 Silent G G A TCGA-DU-7301-01A-11D-2086-08 ENST00000251268 p.R1195R DHX35 chr20 38962386 38962386 Frame_Shift_Del C C - TCGA-DU-7301-01A-11D-2086-08 ENST00000252011 p.P7Rfs*2 CHEK2 chr22 28694055 28694055 Missense_Mutation C C T TCGA-DU-7301-01A-11D-2086-08 ENST00000328354 p.A480T MAPK12 chr22 50255288 50255288 Missense_Mutation G G C TCGA-DU-7301-01A-11D-2086-08 ENST00000215659 p.F311L ATRX chrX 77682779 77682780 Frame_Shift_Del TT - - TCGA-DU-7301-01A-11D-2086-08 ENST00000373344 p.K826Efs*4 FUBP1 chr1 77960184 77960184 Missense_Mutation C C G TCGA-EZ-7264-01A-11D-2024-08 ENST00000370768 p.A526P NBPF25P chr1 145578886 145578886 RNA T T C TCGA-EZ-7264-01A-11D-2024-08 ENST00000619932 APOB chr2 21011831 21011831 Silent C C T TCGA-EZ-7264-01A-11D-2024-08 ENST00000233242 p.G1679G OTOF chr2 26474025 26474025 Missense_Mutation C C G TCGA-EZ-7264-01A-11D-2024-08 ENST00000272371 p.G1125A ARHGEF4 chr2 131045422 131045422 Missense_Mutation C C A TCGA-EZ-7264-01A-11D-2024-08 ENST00000326016 p.Q633K IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-EZ-7264-01A-11D-2024-08 ENST00000345146 p.R132H CPS1 chr2 210606825 210606825 Silent C C T TCGA-EZ-7264-01A-11D-2024-08 ENST00000233072 p.G692G CCDC108 chr2 219035569 219035569 Silent C C T TCGA-EZ-7264-01A-11D-2024-08 ENST00000341552 p.L151L HK3 chr5 176883844 176883844 Missense_Mutation A A G TCGA-EZ-7264-01A-11D-2024-08 ENST00000292432 p.I660T ATXN1 chr6 16327487 16327487 Missense_Mutation G G A TCGA-EZ-7264-01A-11D-2024-08 ENST00000244769 p.T275M THEMIS chr6 127813042 127813042 Silent T T C TCGA-EZ-7264-01A-11D-2024-08 ENST00000368248 p.E533E STOM chr9 121349159 121349159 Missense_Mutation C C A TCGA-EZ-7264-01A-11D-2024-08 ENST00000286713 p.Q162H PRRC2B chr9 131474587 131474587 Missense_Mutation A A G TCGA-EZ-7264-01A-11D-2024-08 ENST00000357304 p.I820V JMJD1C chr10 63215443 63215443 Missense_Mutation G G A TCGA-EZ-7264-01A-11D-2024-08 ENST00000399262 p.R279C PDZD7 chr10 101030101 101030101 Missense_Mutation G G A TCGA-EZ-7264-01A-11D-2024-08 ENST00000370215 p.T40M PRMT5 chr14 22920957 22920957 Missense_Mutation C C T TCGA-EZ-7264-01A-11D-2024-08 ENST00000324366 p.V621I FUS chr16 31189138 31189140 In_Frame_Del ACA ACA - TCGA-EZ-7264-01A-11D-2024-08 ENST00000254108 p.N285del FAM64A chr17 6445321 6445321 Missense_Mutation C C T TCGA-EZ-7264-01A-11D-2024-08 ENST00000250056 p.R71C MYO15A chr17 18149248 18149248 Missense_Mutation A A G TCGA-EZ-7264-01A-11D-2024-08 ENST00000205890 p.D2330G SLFN12 chr17 35411533 35411533 Silent C C T TCGA-EZ-7264-01A-11D-2024-08 ENST00000304905 p.S514S ZNF439 chr19 11868660 11868660 3'UTR G G A TCGA-EZ-7264-01A-11D-2024-08 ENST00000304030 KLHL26 chr19 18668459 18668459 Silent G G A TCGA-EZ-7264-01A-11D-2024-08 ENST00000300976 p.T354T ANKRD27 chr19 32605928 32605928 Silent A A G TCGA-EZ-7264-01A-11D-2024-08 ENST00000306065 p.N800N CIC chr19 42294726 42294726 Missense_Mutation T T G TCGA-EZ-7264-01A-11D-2024-08 ENST00000575354 p.F1484V ZNF347 chr19 53140364 53140364 Missense_Mutation C C T TCGA-EZ-7264-01A-11D-2024-08 ENST00000334197 p.V822M PCSK2 chr20 17260304 17260304 Missense_Mutation G G A TCGA-EZ-7264-01A-11D-2024-08 ENST00000262545 p.R81H HUWE1 chrX 53591122 53591122 Missense_Mutation G G C TCGA-EZ-7264-01A-11D-2024-08 ENST00000262854 p.L1325V ACRC chrX 71604163 71604163 Missense_Mutation G G A TCGA-EZ-7264-01A-11D-2024-08 ENST00000373695 p.D296N EIF3I chr1 32222624 32222624 Silent G G A TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000373586 p.K30K ARHGAP29 chr1 94190079 94190079 Missense_Mutation G G C TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000260526 p.T429R NBPF25P chr1 145578886 145578886 RNA T T C TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000619932 RAB3GAP2 chr1 220170901 220170903 In_Frame_Del CTT CTT - TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000358951 p.E932del TANK chr2 161179697 161179697 Missense_Mutation C C T TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000259075 p.A12V IDH1 chr2 208248389 208248389 Missense_Mutation G G A TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000345146 p.R132C SRPRB chr3 133806654 133806656 In_Frame_Del TTC TTC - TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000466490 p.L69del TMPRSS11F chr4 68053817 68053817 3'UTR G G A TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000356291 PRMT9 chr4 147654536 147654536 Missense_Mutation A A G TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000322396 p.M454T GIN1 chr5 103104808 103104809 Frame_Shift_Del TG TG - TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000399004 p.T124Sfs*22 MZB1 chr5 139387763 139387763 3'UTR G G A TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000302125 MAML1 chr5 179774422 179774422 Missense_Mutation T T C TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000292599 p.F866L HLA-F chr6 29726984 29726984 3'Flank A A G TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000334668 MIR5692C2 chr7 97966931 97966931 5'Flank G G A TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000577959 TRIM55 chr8 66174511 66174511 Missense_Mutation C C T TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000315962 p.A522V KIAA1161 chr9 34371511 34371511 Missense_Mutation C C T TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000297625 p.R478Q CCIN chr9 36170048 36170048 Silent C C A TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000335119 p.R182R LDLRAD3 chr11 36036101 36036102 Splice_Site AG AG - TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000315571 p.X17_splice SCN4B chr11 118143863 118143863 Missense_Mutation C C T TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000324727 p.A145T CAND1 chr12 67310314 67310314 Frame_Shift_Del A A - TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000545606 p.K1120Rfs*3 DEPDC4 chr12 100262400 100262400 Nonsense_Mutation A A C TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000378244 p.Y188* OR4Q3 chr14 19747702 19747702 Missense_Mutation G G T TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000331723 p.S92I NPTN chr15 73633268 73633268 5'UTR G G A TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000345330 CYLD chr16 50786762 50786762 Intron A A - TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000311559 DRC7 chr16 57698939 57698939 Missense_Mutation C C T TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000360716 p.A98V CHMP1A chr16 89646592 89646592 Silent C C T TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000397901 p.L168L TP53 chr17 7674953 7674953 Missense_Mutation T C C TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000269305 p.H193R KRTAP17-1 chr17 41315491 41315491 Missense_Mutation C C T TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000334202 p.G54R ZNF525 chr19 53381080 53381080 Silent T T C TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000474037 p.S167S VSIG4 chrX 66033510 66033510 Missense_Mutation C C T TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000374737 p.V126M F8 chrX 154966470 154966470 Silent C C T TCGA-DB-A4XF-01A-11D-A27K-08 ENST00000360256 p.E409E PANK4 chr1 2508891 2508891 Missense_Mutation G G A TCGA-FG-6690-01A-11D-1893-08 ENST00000378466 p.R760W ZZZ3 chr1 77576144 77576144 Missense_Mutation G G A TCGA-FG-6690-01A-11D-1893-08 ENST00000370801 p.P752L IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-FG-6690-01A-11D-1893-08 ENST00000345146 p.R132H HSP90AB2P chr4 13337681 13337681 RNA A A T TCGA-FG-6690-01A-11D-1893-08 ENST00000507090 DNAH8 chr6 39008870 39008870 Missense_Mutation A A G TCGA-FG-6690-01A-11D-1893-08 ENST00000359357 p.K4207R SYNE1 chr6 152337005 152337006 Frame_Shift_Ins - - A TCGA-FG-6690-01A-11D-1893-08 ENST00000367255 p.L4122Sfs*20 SEPT7 chr7 35904301 35904301 3'UTR A A G TCGA-FG-6690-01A-11D-1893-08 ENST00000350320 TNFSF15 chr9 114790601 114790601 Missense_Mutation C C T TCGA-FG-6690-01A-11D-1893-08 ENST00000374045 p.E203K KRT76 chr12 52775517 52775517 Missense_Mutation C C T TCGA-FG-6690-01A-11D-1893-08 ENST00000332411 p.S229N REM2 chr14 22884860 22884860 Missense_Mutation C C T TCGA-FG-6690-01A-11D-1893-08 ENST00000267396 p.S97L CDC42BPB chr14 102964522 102964522 Silent G G A TCGA-FG-6690-01A-11D-1893-08 ENST00000361246 p.D902D ITGA11 chr15 68350758 68350758 Missense_Mutation C C T TCGA-FG-6690-01A-11D-1893-08 ENST00000315757 p.G307R ATXN2L chr16 28835653 28835653 Silent T T C TCGA-FG-6690-01A-11D-1893-08 ENST00000336783 p.P930P TP53 chr17 7674250 7674250 Missense_Mutation C C T TCGA-FG-6690-01A-11D-1893-08 ENST00000269305 p.C238Y TP53 chr17 7674945 7674945 Nonsense_Mutation G G A TCGA-FG-6690-01A-11D-1893-08 ENST00000269305 p.R196* MYH2 chr17 10547789 10547789 Missense_Mutation T T A TCGA-FG-6690-01A-11D-1893-08 ENST00000245503 p.K44N BPTF chr17 67903797 67903797 Missense_Mutation G G A TCGA-FG-6690-01A-11D-1893-08 ENST00000321892 p.R977Q RIOK3 chr18 23477226 23477226 Missense_Mutation C C A TCGA-FG-6690-01A-11D-1893-08 ENST00000339486 p.H434Q SMARCA4 chr19 10987824 10987824 Missense_Mutation G G A TCGA-FG-6690-01A-11D-1893-08 ENST00000344626 p.A340T ATP4A chr19 35563619 35563619 Missense_Mutation G G A TCGA-FG-6690-01A-11D-1893-08 ENST00000262623 p.A4V ZNF831 chr20 59194605 59194605 Missense_Mutation G G A TCGA-FG-6690-01A-11D-1893-08 ENST00000371030 p.A1196T GAB4 chr22 16966456 16966456 Intron C C T TCGA-FG-6690-01A-11D-1893-08 ENST00000400588 ATRX chrX 77684030 77684030 Nonsense_Mutation A T T TCGA-FG-6690-01A-11D-1893-08 ENST00000373344 p.L409* GBP1 chr1 89054727 89054727 Silent G G C TCGA-CS-4943-01A-01D-1468-08 ENST00000370473 p.V540V RSBN1 chr1 113768309 113768309 Missense_Mutation C C G TCGA-CS-4943-01A-01D-1468-08 ENST00000261441 p.R580T ROCK2 chr2 11215391 11215391 Missense_Mutation A A T TCGA-CS-4943-01A-01D-1468-08 ENST00000315872 p.L540H LIMS2 chr2 127642055 127642055 Silent G G A TCGA-CS-4943-01A-01D-1468-08 ENST00000355119 p.H218H CALCRL chr2 187360662 187360662 Silent T T G TCGA-CS-4943-01A-01D-1468-08 ENST00000392370 p.T239T ALS2 chr2 201744340 201744340 Silent G G A TCGA-CS-4943-01A-01D-1468-08 ENST00000264276 p.H696H IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-CS-4943-01A-01D-1468-08 ENST00000345146 p.R132H KCNH8 chr3 19533595 19533595 Silent C C T TCGA-CS-4943-01A-01D-1468-08 ENST00000328405 p.G940G ROS1 chr6 117288549 117288549 Silent A A G TCGA-CS-4943-01A-01D-1468-08 ENST00000368508 p.P2329P NKAIN2 chr6 124658358 124658358 Missense_Mutation C C T TCGA-CS-4943-01A-01D-1468-08 ENST00000368417 p.A149V EIF3B chr7 2364393 2364393 Missense_Mutation C C T TCGA-CS-4943-01A-01D-1468-08 ENST00000360876 p.R341C CDKN2A chr9 21974685 21974685 Missense_Mutation G G C TCGA-CS-4943-01A-01D-1468-08 ENST00000304494 p.P48R NUP214 chr9 131197826 131197826 Silent A A G TCGA-CS-4943-01A-01D-1468-08 ENST00000359428 p.Q1444Q GLYAT chr11 58710062 58710062 Missense_Mutation G G A TCGA-CS-4943-01A-01D-1468-08 ENST00000344743 p.R199C C2CD3 chr11 74118283 74118283 Missense_Mutation C C G TCGA-CS-4943-01A-01D-1468-08 ENST00000334126 p.V489L HOXC13 chr12 53945049 53945049 Silent G G A TCGA-CS-4943-01A-01D-1468-08 ENST00000243056 p.K262K SLC22A17 chr14 23349211 23349211 Intron G G C TCGA-CS-4943-01A-01D-1468-08 ENST00000206544 SNORD114-14 chr14 100972110 100972110 RNA A A G TCGA-CS-4943-01A-01D-1468-08 ENST00000362723 DOC2A chr16 30007206 30007208 In_Frame_Del CTT CTT - TCGA-CS-4943-01A-01D-1468-08 ENST00000350119 p.K207del PLCG2 chr16 81936342 81936342 Missense_Mutation G G A TCGA-CS-4943-01A-01D-1468-08 ENST00000564138 p.G1006S TP53 chr17 7674872 7674872 Missense_Mutation T C C TCGA-CS-4943-01A-01D-1468-08 ENST00000269305 p.Y220C DDX5 chr17 64502184 64502184 Missense_Mutation T T G TCGA-CS-4943-01A-01D-1468-08 ENST00000225792 p.Q378H RYR1 chr19 38580085 38580085 Missense_Mutation C C T TCGA-CS-4943-01A-01D-1468-08 ENST00000359596 p.T4823M RYR1 chr19 38580403 38580403 Missense_Mutation G G T TCGA-CS-4943-01A-01D-1468-08 ENST00000359596 p.V4849F USP25 chr21 15866328 15866328 Missense_Mutation A A G TCGA-CS-4943-01A-01D-1468-08 ENST00000285679 p.N860S RSPH14 chr22 23061827 23061827 Missense_Mutation C C T TCGA-CS-4943-01A-01D-1468-08 ENST00000216036 p.A258T FBXO7 chr22 32483940 32483940 Missense_Mutation A A G TCGA-CS-4943-01A-01D-1468-08 ENST00000266087 p.N154S ATRX chrX 77574295 77574295 Nonsense_Mutation G C C TCGA-CS-4943-01A-01D-1468-08 ENST00000373344 p.S2094* VPS13D chr1 12497626 12497626 Silent C C T TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000620676 p.D4263D TXNDC12 chr1 52041563 52041563 Silent T T C TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000371626 p.E44E WDR78 chr1 66826906 66826906 Silent G G A TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000371026 p.Y751Y HRNR chr1 152215572 152215572 Missense_Mutation A A C TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000368801 p.H2019Q CR1L chr1 207694506 207694506 Missense_Mutation A A T TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000508064 p.Y206F CCDC185 chr1 223393878 223393878 Missense_Mutation T T A TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000366875 p.C135S DNMT3A chr2 25240652 25240652 Missense_Mutation T T C TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000264709 p.K721E CFAP36 chr2 55523740 55523740 Missense_Mutation G G T TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000349456 p.G67V SAP130 chr2 127989566 127989566 Nonsense_Mutation G G C TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000259235 p.S619* IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000345146 p.R132H FGD5 chr3 14880602 14880602 Missense_Mutation G G A TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000285046 p.A897T USP19 chr3 49115771 49115771 Missense_Mutation T T A TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000398888 p.T446S ZBTB38 chr3 141443009 141443009 Silent C C T TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000321464 p.D207D TMEM33 chr4 41939224 41939224 Missense_Mutation C C T TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000325094 p.R57C TMPRSS11B chr4 68229452 68229452 Missense_Mutation G G A TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000332644 p.R251W PRDM9 chr5 23526828 23526828 Nonsense_Mutation T T G TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000296682 p.Y580* NAIP chr5 71012667 71012667 Silent G G A TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000194097 p.A83A ZNF366 chr5 72456425 72456425 Silent G G A TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000318442 p.D501D PAQR8 chr6 52404008 52404008 Silent C C T TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000360726 p.P265P TRIM50 chr7 73318893 73318893 Missense_Mutation G G A TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000333149 p.R219W LIMK1 chr7 74099231 74099231 Missense_Mutation G G T TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000336180 p.V201F OR2AE1 chr7 99876575 99876575 Silent G G A TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000316368 p.S153S ZNF7 chr8 144842909 144842909 Missense_Mutation G G A TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000528372 p.R601K USP20 chr9 129858055 129858055 Silent C C T TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000315480 p.A47A GBGT1 chr9 133153823 133153823 Silent C C T TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000372040 p.G266G CHST3 chr10 72007504 72007506 In_Frame_Del TCT TCT - TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000373115 p.F159del OR5M9 chr11 56463089 56463089 Missense_Mutation C C T TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000279791 p.V105I CDKN1B chr12 12717994 12717995 Frame_Shift_Ins - - GGAAGAGGCG TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000228872 p.S56Gfs*72 NT5DC3 chr12 103793952 103793952 Missense_Mutation T T C TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000392876 p.I267V SYT16 chr14 62075390 62075390 Missense_Mutation A A G TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000568344 p.E331G SERPINA5 chr14 94590807 94590807 Missense_Mutation G G T TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000329597 p.V317F PELP1 chr17 4676438 4676438 Missense_Mutation C C T TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000574876 p.E258K TP53 chr17 7674893 7674893 Missense_Mutation C T T TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000269305 p.R213Q OSCAR chr19 54097130 54097130 Silent C C T TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000611261 p.L39L PRPF31 chr19 54124629 54124629 Silent C C T TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000321030 p.H276H CRYZL1 chr21 33599264 33599264 Intron A A T TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000381554 TRABD chr22 50197916 50197916 Silent C C T TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000303434 p.I255I ZMYM3 chrX 71249536 71249536 Silent A A G TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000314425 p.P465P ATRX chrX 77684064 77684065 Frame_Shift_Ins - - A TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000373344 p.V398Cfs*4 MUM1L1 chrX 106206242 106206242 Silent T T C TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000337685 p.S270S MTMR1 chrX 150736642 150736642 Missense_Mutation A A T TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000370390 p.E368D PLXNB3 chrX 153767536 153767536 Missense_Mutation G G C TCGA-S9-A7QW-01A-11D-A34A-08 ENST00000361971 p.A237P ALG6 chr1 63411187 63411187 Missense_Mutation T T C TCGA-HT-7684-01A-11D-2253-08 ENST00000371108 p.L179P OR14A16 chr1 247815024 247815024 Missense_Mutation A A G TCGA-HT-7684-01A-11D-2253-08 ENST00000357627 p.Y236H ABHD1 chr2 27123931 27123931 5'UTR G G A TCGA-HT-7684-01A-11D-2253-08 ENST00000316470 MAP4K3 chr2 39436927 39436927 Missense_Mutation G G A TCGA-HT-7684-01A-11D-2253-08 ENST00000263881 p.R21C LRP2 chr2 169182238 169182238 Silent C C T TCGA-HT-7684-01A-11D-2253-08 ENST00000263816 p.Q3309Q ANKAR chr2 189720640 189720640 Missense_Mutation A A C TCGA-HT-7684-01A-11D-2253-08 ENST00000313581 p.N830H IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-HT-7684-01A-11D-2253-08 ENST00000345146 p.R132H CCDC54 chr3 107378254 107378254 Missense_Mutation C C T TCGA-HT-7684-01A-11D-2253-08 ENST00000261058 p.R223C SLC9C1 chr3 112168923 112168923 Missense_Mutation C C T TCGA-HT-7684-01A-11D-2253-08 ENST00000305815 p.R1064Q TRPC7 chr5 136225332 136225332 Missense_Mutation A A G TCGA-HT-7684-01A-11D-2253-08 ENST00000513104 p.M762T XXbac-BPG32J3.19 chr6 31717622 31717622 Missense_Mutation G G A TCGA-HT-7684-01A-11D-2253-08 ENST00000503322 p.A323T DST chr6 56618731 56618731 Intron G G A TCGA-HT-7684-01A-11D-2253-08 ENST00000312431 EEF1A1 chr6 73519945 73519945 Missense_Mutation T T C TCGA-HT-7684-01A-11D-2253-08 ENST00000309268 p.I28V POM121C chr7 75415753 75415753 3'Flank C C T TCGA-HT-7684-01A-11D-2253-08 ENST00000615331 SSPO chr7 149785635 149785635 Missense_Mutation C C G TCGA-HT-7684-01A-11D-2253-08 ENST00000378016 p.L1048V NOL8 chr9 92314730 92314730 Missense_Mutation T T C TCGA-HT-7684-01A-11D-2253-08 ENST00000442668 p.H632R TBC1D2 chr9 98229032 98229032 Missense_Mutation G G A TCGA-HT-7684-01A-11D-2253-08 ENST00000465784 p.R300W OR13D1 chr9 104694537 104694537 Missense_Mutation C C G TCGA-HT-7684-01A-11D-2253-08 ENST00000318763 p.S39C MUSK chr9 110800502 110800502 Missense_Mutation G G C TCGA-HT-7684-01A-11D-2253-08 ENST00000374448 p.Q708H PTGS1 chr9 122392389 122392389 Missense_Mutation T T G TCGA-HT-7684-01A-11D-2253-08 ENST00000362012 p.F549V SERPING1 chr11 57600293 57600293 Missense_Mutation G G A TCGA-HT-7684-01A-11D-2253-08 ENST00000278407 p.A156T MS4A14 chr11 60415880 60415880 Silent T T C TCGA-HT-7684-01A-11D-2253-08 ENST00000300187 p.F304F TMTC1 chr12 29506892 29506892 Missense_Mutation C C T TCGA-HT-7684-01A-11D-2253-08 ENST00000539277 p.R868H DCLK1 chr13 36112110 36112110 Missense_Mutation C C T TCGA-HT-7684-01A-11D-2253-08 ENST00000360631 p.R161Q DIS3 chr13 72772199 72772199 Missense_Mutation T T C TCGA-HT-7684-01A-11D-2253-08 ENST00000377767 p.D488G FOXG1 chr14 28767828 28767828 Silent G G A TCGA-HT-7684-01A-11D-2253-08 ENST00000313071 p.P183P KLHL28 chr14 44945875 44945875 Frame_Shift_Del A A - TCGA-HT-7684-01A-11D-2253-08 ENST00000396128 p.E19Nfs*7 SYNE2 chr14 64210084 64210084 Missense_Mutation A A G TCGA-HT-7684-01A-11D-2253-08 ENST00000344113 p.N6228S ISM2 chr14 77475896 77475896 Missense_Mutation G G A TCGA-HT-7684-01A-11D-2253-08 ENST00000342219 p.A472V IQGAP1 chr15 90491357 90491357 Nonsense_Mutation C C T TCGA-HT-7684-01A-11D-2253-08 ENST00000268182 p.Q1425* EFTUD2 chr17 44854626 44854626 Missense_Mutation C C T TCGA-HT-7684-01A-11D-2253-08 ENST00000426333 p.R730H USP32 chr17 60301613 60301614 Frame_Shift_Del TC TC - TCGA-HT-7684-01A-11D-2253-08 ENST00000300896 p.E93Rfs*8 TTYH2 chr17 74253210 74253210 Silent G G A TCGA-HT-7684-01A-11D-2253-08 ENST00000269346 p.Q463Q SEC1P chr19 48680353 48680353 RNA G G A TCGA-HT-7684-01A-11D-2253-08 ENST00000430145 DLGAP4 chr20 36432558 36432558 Missense_Mutation G G T TCGA-HT-7684-01A-11D-2253-08 ENST00000339266 p.G281W HCCS chrX 11117372 11117372 Missense_Mutation T T C TCGA-HT-7684-01A-11D-2253-08 ENST00000321143 p.Y120H ACTL8 chr1 17825919 17825919 Silent C C T TCGA-FG-7643-01A-11D-2086-08 ENST00000375406 p.P167P UROD chr1 45014294 45014295 Intron - - T TCGA-FG-7643-01A-11D-2086-08 ENST00000246337 PI4KB chr1 151292951 151292952 Frame_Shift_Ins - - T TCGA-FG-7643-01A-11D-2086-08 ENST00000368873 p.L785Afs*22 CFAP45 chr1 159873086 159873086 Missense_Mutation G G A TCGA-FG-7643-01A-11D-2086-08 ENST00000368099 p.R479W HMCN1 chr1 185977895 185977895 Missense_Mutation G G A TCGA-FG-7643-01A-11D-2086-08 ENST00000271588 p.R827Q ZSWIM2 chr2 186833950 186833950 Missense_Mutation C C T TCGA-FG-7643-01A-11D-2086-08 ENST00000295131 p.R275H PDE12 chr3 57557029 57557030 Frame_Shift_Ins - - T TCGA-FG-7643-01A-11D-2086-08 ENST00000311180 p.P218Sfs*10 C3orf14 chr3 62331376 62331376 Missense_Mutation C C T TCGA-FG-7643-01A-11D-2086-08 ENST00000232519 p.R77W WDR1 chr4 10075408 10075408 Silent G G A TCGA-FG-7643-01A-11D-2086-08 ENST00000382452 p.A597A GABRG1 chr4 46058545 46058545 Silent A A G TCGA-FG-7643-01A-11D-2086-08 ENST00000295452 p.L235L POLR2B chr4 57006983 57006983 Missense_Mutation C C T TCGA-FG-7643-01A-11D-2086-08 ENST00000314595 p.A462V C5orf42 chr5 37169083 37169083 Missense_Mutation T T C TCGA-FG-7643-01A-11D-2086-08 ENST00000425232 p.H2314R C7 chr5 40934449 40934449 Missense_Mutation G G A TCGA-FG-7643-01A-11D-2086-08 ENST00000313164 p.R88H PCDHB8 chr5 141178799 141178799 Missense_Mutation C C G TCGA-FG-7643-01A-11D-2086-08 ENST00000239444 p.D255E PCDHGC4 chr5 141486277 141486277 Silent G G A TCGA-FG-7643-01A-11D-2086-08 ENST00000306593 p.V368V SPINK5 chr5 148111787 148111787 Missense_Mutation G G A TCGA-FG-7643-01A-11D-2086-08 ENST00000256084 p.R571H FAM71B chr5 157162791 157162791 Nonsense_Mutation G G A TCGA-FG-7643-01A-11D-2086-08 ENST00000302938 p.R492* CDSN chr6 31116175 31116175 Silent G G A TCGA-FG-7643-01A-11D-2086-08 ENST00000376288 p.S480S ROS1 chr6 117365075 117365075 Nonsense_Mutation G G A TCGA-FG-7643-01A-11D-2086-08 ENST00000368508 p.R1035* KIF13B chr8 29124071 29124071 Missense_Mutation C C T TCGA-FG-7643-01A-11D-2086-08 ENST00000524189 p.R1102H RTKN2 chr10 62198072 62198072 Missense_Mutation T T C TCGA-FG-7643-01A-11D-2086-08 ENST00000373789 p.M556V PLEKHA1 chr10 122397939 122397939 Missense_Mutation C C T TCGA-FG-7643-01A-11D-2086-08 ENST00000368990 p.R55C EBF3 chr10 129963464 129963464 Missense_Mutation G G T TCGA-FG-7643-01A-11D-2086-08 ENST00000355311 p.S65Y NLRP6 chr11 281299 281299 Missense_Mutation C C T TCGA-FG-7643-01A-11D-2086-08 ENST00000312165 p.A522V OR52M1 chr11 4545770 4545770 Missense_Mutation G G A TCGA-FG-7643-01A-11D-2086-08 ENST00000360213 p.D194N OR51E1 chr11 4653256 4653256 Missense_Mutation G G A TCGA-FG-7643-01A-11D-2086-08 ENST00000396952 p.V244I OR5D18 chr11 55820010 55820010 Silent T T A TCGA-FG-7643-01A-11D-2086-08 ENST00000333976 p.I127I ROM1 chr11 62614418 62614418 Nonsense_Mutation C C T TCGA-FG-7643-01A-11D-2086-08 ENST00000278833 p.Q251* TAS2R8 chr12 10806822 10806822 Silent G G A TCGA-FG-7643-01A-11D-2086-08 ENST00000240615 p.I53I GRIN2B chr12 13562753 13562753 3'UTR G G A TCGA-FG-7643-01A-11D-2086-08 ENST00000609686 CFAP54 chr12 96688964 96688964 Silent G G A TCGA-FG-7643-01A-11D-2086-08 ENST00000524981 p.L2021L IL16 chr15 81300099 81300099 Missense_Mutation C C G TCGA-FG-7643-01A-11D-2086-08 ENST00000302987 p.P925A UBBP4 chr17 22204746 22204746 Intron C C A TCGA-FG-7643-01A-11D-2086-08 ENST00000578713 KRT27 chr17 40777597 40777597 Missense_Mutation C C T TCGA-FG-7643-01A-11D-2086-08 ENST00000301656 p.E370K MAP3K3 chr17 63688575 63688575 Silent C C T TCGA-FG-7643-01A-11D-2086-08 ENST00000361733 p.D253D ZNF831 chr20 59191739 59191739 Silent C C T TCGA-FG-7643-01A-11D-2086-08 ENST00000371030 p.G240G IL22RA1 chr1 24134315 24134315 Missense_Mutation G G C TCGA-HT-8111-01A-11D-2395-08 ENST00000270800 p.P143A SPAG17 chr1 118012241 118012251 Frame_Shift_Del ATCTGGCAGAA ATCTGGCAGAA - TCGA-HT-8111-01A-11D-2395-08 ENST00000336338 p.I1470Rfs*33 NEB chr2 151677700 151677700 Silent G G A TCGA-HT-8111-01A-11D-2395-08 ENST00000172853 p.V1213V IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-HT-8111-01A-11D-2395-08 ENST00000345146 p.R132H USP17L18 chr4 9248788 9248788 Silent T T C TCGA-HT-8111-01A-11D-2395-08 ENST00000504209 p.D53D KIAA1109 chr4 122186065 122186065 Missense_Mutation A A G TCGA-HT-8111-01A-11D-2395-08 ENST00000264501 p.T130A ETFDH chr4 158682421 158682421 Silent G G A TCGA-HT-8111-01A-11D-2395-08 ENST00000511912 p.K134K TRPA1 chr8 72056934 72056934 Nonsense_Mutation G G A TCGA-HT-8111-01A-11D-2395-08 ENST00000262209 p.R393* GLIS3 chr9 4286194 4286194 Missense_Mutation G G T TCGA-HT-8111-01A-11D-2395-08 ENST00000381971 p.R78S CALHM2 chr10 103449521 103449521 Missense_Mutation G G A TCGA-HT-8111-01A-11D-2395-08 ENST00000260743 p.L141F KMT2D chr12 49031287 49031287 Missense_Mutation T T G TCGA-HT-8111-01A-11D-2395-08 ENST00000301067 p.Q4473P TP53 chr17 7675131 7675131 Missense_Mutation C C T TCGA-HT-8111-01A-11D-2395-08 ENST00000269305 p.A161T HIVEP3 chr1 41583422 41583422 Missense_Mutation G G A TCGA-FG-6691-01A-11D-1893-08 ENST00000247584 p.T459M VIT chr2 36805540 36805540 Missense_Mutation C C T TCGA-FG-6691-01A-11D-1893-08 ENST00000389975 p.T407M DYNC2LI1 chr2 43805257 43805257 Intron A A G TCGA-FG-6691-01A-11D-1893-08 ENST00000260605 BZW1 chr2 200813205 200813205 Splice_Region T T G TCGA-FG-6691-01A-11D-1893-08 ENST00000409600 IDH1 chr2 208248389 208248389 Missense_Mutation G G T TCGA-FG-6691-01A-11D-1893-08 ENST00000345146 p.R132S LONRF1 chr8 12738065 12738065 Missense_Mutation T T C TCGA-FG-6691-01A-11D-1893-08 ENST00000398246 p.K348R IGHV2-26 chr14 106301525 106301525 Silent G G A TCGA-FG-6691-01A-11D-1893-08 ENST00000390611 p.D76D SEMA7A chr15 74417620 74417620 Missense_Mutation G G A TCGA-FG-6691-01A-11D-1893-08 ENST00000261918 p.P174L TP53 chr17 7675126 7675131 In_Frame_Del GATGGC GATGGC - TCGA-FG-6691-01A-11D-1893-08 ENST00000269305 p.A161_I162del CD209 chr19 7741848 7741848 3'UTR C C T TCGA-FG-6691-01A-11D-1893-08 ENST00000315599 EPS8L1 chr19 55080469 55080469 Intron T T C TCGA-FG-6691-01A-11D-1893-08 ENST00000201647 ATRX chrX 77684181 77684182 Frame_Shift_Ins - - T TCGA-FG-6691-01A-11D-1893-08 ENST00000373344 p.L359Tfs*3 F5 chr1 169549812 169549812 Nonsense_Mutation G G A TCGA-HT-7610-01A-21D-2086-08 ENST00000367797 p.R534* ABCG5 chr2 43819936 43819936 Missense_Mutation A A G TCGA-HT-7610-01A-21D-2086-08 ENST00000260645 p.L543P IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-HT-7610-01A-21D-2086-08 ENST00000345146 p.R132H TRIP12 chr2 229804195 229804195 Nonsense_Mutation G G A TCGA-HT-7610-01A-21D-2086-08 ENST00000283943 p.R820* ASTE1 chr3 131014087 131014087 Silent C C T TCGA-HT-7610-01A-21D-2086-08 ENST00000264992 p.E670E ADGRL3 chr4 61948151 61948151 Missense_Mutation C C T TCGA-HT-7610-01A-21D-2086-08 ENST00000514591 p.R826C ADGRA2 chr8 37841173 37841173 Silent C C T TCGA-HT-7610-01A-21D-2086-08 ENST00000412232 p.C945C PAPOLA chr14 96565002 96565002 Missense_Mutation T T G TCGA-HT-7610-01A-21D-2086-08 ENST00000216277 p.N730K DNM1P47 chr15 101759755 101759755 RNA C C G TCGA-HT-7610-01A-21D-2086-08 ENST00000561463 HBZ chr16 152927 152927 Silent T T C TCGA-HT-7610-01A-21D-2086-08 ENST00000252951 p.T6T SENP3 chr17 7570723 7570723 Nonsense_Mutation C C T TCGA-HT-7610-01A-21D-2086-08 ENST00000321337 p.R508* TP53 chr17 7674275 7674275 Missense_Mutation T T G TCGA-HT-7610-01A-21D-2086-08 ENST00000269305 p.T230P TP53 chr17 7675189 7675189 Missense_Mutation G G C TCGA-HT-7610-01A-21D-2086-08 ENST00000269305 p.C141W KRT27 chr17 40779841 40779841 Silent G G A TCGA-HT-7610-01A-21D-2086-08 ENST00000301656 p.C235C ZNF547 chr19 57378235 57378235 3'UTR T T C TCGA-HT-7610-01A-21D-2086-08 ENST00000282282 BCOR chrX 40072437 40072437 Missense_Mutation G G A TCGA-HT-7610-01A-21D-2086-08 ENST00000378444 p.A970V ATRX chrX 77634592 77634592 Splice_Site A A C TCGA-HT-7610-01A-21D-2086-08 ENST00000373344 p.X1603_splice STAG2 chrX 124063117 124063117 Missense_Mutation A A T TCGA-HT-7610-01A-21D-2086-08 ENST00000371144 p.Y578F RYR2 chr1 237727118 237727118 Missense_Mutation T T C TCGA-P5-A736-01A-11D-A32B-08 ENST00000366574 p.V3586A GPR75 chr2 53853896 53853896 Silent T T C TCGA-P5-A736-01A-11D-A32B-08 ENST00000394705 p.G287G IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-P5-A736-01A-11D-A32B-08 ENST00000345146 p.R132H WNT7A chr3 13875077 13875077 Silent G G A TCGA-P5-A736-01A-11D-A32B-08 ENST00000285018 p.P56P UGT3A2 chr5 36035864 36035864 Missense_Mutation G G A TCGA-P5-A736-01A-11D-A32B-08 ENST00000282507 p.T469M F2RL1 chr5 76833701 76833701 Missense_Mutation G G A TCGA-P5-A736-01A-11D-A32B-08 ENST00000296677 p.R365H ZNF273 chr7 64928587 64928588 Frame_Shift_Del AT AT - TCGA-P5-A736-01A-11D-A32B-08 ENST00000476120 p.H420Qfs*6 PCLO chr7 82966375 82966375 Missense_Mutation G G T TCGA-P5-A736-01A-11D-A32B-08 ENST00000333891 p.P1138H STEAP4 chr7 88284209 88284210 Frame_Shift_Del TC TC - TCGA-P5-A736-01A-11D-A32B-08 ENST00000380079 p.E20Dfs*9 DAB2IP chr9 121768589 121768589 Missense_Mutation A A G TCGA-P5-A736-01A-11D-A32B-08 ENST00000408936 p.S619G ANKRD30A chr10 37165125 37165125 Silent G G A TCGA-P5-A736-01A-11D-A32B-08 ENST00000611781 p.K678K MGAT4C chr12 85979522 85979522 Nonsense_Mutation G G A TCGA-P5-A736-01A-11D-A32B-08 ENST00000548651 p.Q402* NUDT4 chr12 93399299 93399300 Frame_Shift_Del AC AC - TCGA-P5-A736-01A-11D-A32B-08 ENST00000415493 p.T155Sfs*7 TRIM13 chr13 50012587 50012587 Missense_Mutation A A C TCGA-P5-A736-01A-11D-A32B-08 ENST00000378182 p.D216A THSD4 chr15 71728569 71728569 Missense_Mutation C C T TCGA-P5-A736-01A-11D-A32B-08 ENST00000355327 p.R460C TP53 chr17 7674944 7674944 Missense_Mutation C C G TCGA-P5-A736-01A-11D-A32B-08 ENST00000269305 p.R196P CAMSAP3 chr19 7612126 7612126 Missense_Mutation G G A TCGA-P5-A736-01A-11D-A32B-08 ENST00000160298 p.E545K ZNF442 chr19 12349986 12349986 Silent G G A TCGA-P5-A736-01A-11D-A32B-08 ENST00000242804 p.V533V FAM129C chr19 17530857 17530857 Missense_Mutation C C T TCGA-P5-A736-01A-11D-A32B-08 ENST00000335393 p.P84L NLRP8 chr19 55954586 55954588 In_Frame_Del CTT CTT - TCGA-P5-A736-01A-11D-A32B-08 ENST00000291971 p.F178del VCX3A chrX 6533732 6533732 3'UTR A A T TCGA-P5-A736-01A-11D-A32B-08 ENST00000381089 MTMR8 chrX 64359419 64359419 Missense_Mutation G G A TCGA-P5-A736-01A-11D-A32B-08 ENST00000374852 p.R45W ATRX chrX 77574295 77574295 Nonsense_Mutation G G C TCGA-P5-A736-01A-11D-A32B-08 ENST00000373344 p.S2094* TIE1 chr1 43306885 43306885 Missense_Mutation G G A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000372476 p.R177Q CA14 chr1 150262588 150262588 Missense_Mutation C C A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000369111 p.Q155K JTB chr1 153974740 153974740 Missense_Mutation C C T TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000271843 p.R127H SEMA4A chr1 156175086 156175086 Missense_Mutation G G A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000355014 p.G479S SLC35F3 chr1 234316620 234316620 Missense_Mutation G G A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000366617 p.A214T KIF26B chr1 245698930 245698930 Missense_Mutation G G A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000407071 p.R2024H AGBL5 chr2 27055795 27055795 Missense_Mutation G G A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000360131 p.R341H LY75 chr2 159835596 159835596 Missense_Mutation C C T TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000263636 p.R1186H C2orf69 chr2 199925293 199925305 Frame_Shift_Del ATGTTATTAGTTA ATGTTATTAGTTA - TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000319974 p.V192Ifs*2 ZBTB11 chr3 101651414 101651414 Missense_Mutation T T G TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000312938 p.M972L TRAT1 chr3 108830774 108830774 Nonsense_Mutation C C T TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000295756 p.R38* PRR27 chr4 70158474 70158474 Silent G G A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000344526 p.S74S LRBA chr4 150315585 150315585 Missense_Mutation G G T TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000357115 p.P2568T DCHS2 chr4 154255539 154255539 Silent G G A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000623607 p.Y1852Y SETD9 chr5 56913026 56913027 Frame_Shift_Del AG AG - TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000285947 p.K161Ifs*2 UNC5A chr5 176877912 176877912 Missense_Mutation G G A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000329542 p.E552K CAP2 chr6 17556457 17556457 3'UTR G G A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000229922 LRFN2 chr6 40392007 40392007 Missense_Mutation C C A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000338305 p.S769I ROS1 chr6 117317162 117317162 Missense_Mutation C C T TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000368508 p.R2039H EGFR chr7 55165350 55165350 Missense_Mutation G T T TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000275493 p.G598V AKAP9 chr7 92098206 92098206 Missense_Mutation G G T TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000356239 p.G3569C COL1A2 chr7 94408820 94408820 Silent C C T TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000297268 p.P263P RELN chr7 103497906 103497906 Missense_Mutation C C T TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000428762 p.R2955H RELN chr7 103989298 103989298 Missense_Mutation G G A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000428762 p.T20M MKRN1 chr7 140454664 140454664 Silent G G A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000255977 p.N434N KEL chr7 142961802 142961802 Missense_Mutation C C A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000355265 p.S25I PRSS55 chr8 10531328 10531328 Silent C C T TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000328655 p.N127N EQTN chr9 27284735 27284735 Silent C C T TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000380032 p.S291S FAM214B chr9 35107995 35107995 Missense_Mutation C C T TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000322813 p.E94K TRPM6 chr9 74800410 74800410 Silent C C T TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000360774 p.L694L CLIC3 chr9 136994739 136994739 Missense_Mutation G G A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000494426 p.T218M A1CF chr10 50816207 50816207 Nonsense_Mutation G G A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000373993 p.R314* LUZP2 chr11 24914479 24914479 Missense_Mutation A A G TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000336930 p.K155E MTMR2 chr11 95836288 95836289 Frame_Shift_Del TG TG - TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000346299 p.I544Kfs*9 CLEC9A chr12 10065583 10065583 Missense_Mutation C C T TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000355819 p.T226M GLS2 chr12 56479861 56479861 Missense_Mutation A A C TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000311966 p.L108R ARGLU1 chr13 106557211 106557211 Intron A A T TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000400198 TRDV1 chr14 22096555 22096555 Missense_Mutation G G A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000390452 p.A95T NID2 chr14 52068854 52068854 Silent G G C TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000216286 p.L47L MIR543 chr14 101032042 101032042 RNA C C T TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000390751 HERC1 chr15 63677981 63677981 Nonsense_Mutation C C A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000443617 p.G2312* SPNS3 chr17 4449269 4449269 Missense_Mutation G G A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000355530 p.A269T USP6 chr17 5132250 5132250 Intron C C T TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000250066 ZNF594 chr17 5182052 5182053 Frame_Shift_Del AA AA - TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000399604 p.L735Rfs*4 DNAH2 chr17 7807266 7807266 Missense_Mutation G G A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000389173 p.G3187S GAS7 chr17 9926668 9926668 Silent G G A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000432992 p.L329L MYH13 chr17 10345261 10345261 Missense_Mutation C C T TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000252172 p.E509K CACNA1G chr17 50605908 50605908 Missense_Mutation G G A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000359106 p.G1436E STXBP4 chr17 55073075 55073078 Splice_Site AAGT AAGT - TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000376352 p.X396_splice LAMA1 chr18 6985311 6985311 Missense_Mutation C C A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000389658 p.R1862S DSC3 chr18 31018801 31018801 Splice_Site C C T TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000360428 p.X315_splice DCC chr18 53486869 53486869 Missense_Mutation G G A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000442544 p.C1270Y ZNF43 chr19 21836119 21836119 5'UTR C C T TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000354959 PSG7 chr19 42929632 42929632 Silent A A G TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000406070 p.T173T KLK5 chr19 50949911 50949911 Silent G G A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000336334 p.C93C USP29 chr19 57131204 57131204 Silent C C T TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000254181 p.S843S TGM6 chr20 2394495 2394495 Silent C C T TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000202625 p.G17G MEI1 chr22 41770854 41770854 Missense_Mutation G G A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000401548 p.E813K TBC1D22A chr22 46793610 46793610 Missense_Mutation G G A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000337137 p.D77N PLCXD1 chrX 293127 293127 Silent G G A TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000381657 p.L214L DCAF8L2 chrX 27747618 27747618 Silent C G G TCGA-QH-A6XC-01A-12D-A32B-08 ENST00000451261 p.T241T SLC30A2 chr1 26045168 26045168 Missense_Mutation G G C TCGA-DB-5273-01A-01D-1468-08 ENST00000374278 p.P34A ROR1 chr1 64049920 64049920 Silent C C T TCGA-DB-5273-01A-01D-1468-08 ENST00000371079 p.C131C HFM1 chr1 91352563 91352563 Silent A A G TCGA-DB-5273-01A-01D-1468-08 ENST00000370425 p.F640F GPR45 chr2 105242521 105242521 Silent G G A TCGA-DB-5273-01A-01D-1468-08 ENST00000258456 p.T221T YWHAEP5 chr2 138288157 138288157 RNA T T A TCGA-DB-5273-01A-01D-1468-08 ENST00000431545 IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-DB-5273-01A-01D-1468-08 ENST00000345146 p.R132H SNED1 chr2 241030470 241030470 Missense_Mutation G G A TCGA-DB-5273-01A-01D-1468-08 ENST00000310397 p.V134I RUFY1 chr5 179589594 179589594 Nonsense_Mutation C C T TCGA-DB-5273-01A-01D-1468-08 ENST00000319449 p.Q359* ARMC2 chr6 108973418 108973418 Silent T T C TCGA-DB-5273-01A-01D-1468-08 ENST00000392644 p.H836H CEP85L chr6 118502462 118502462 Intron C C T TCGA-DB-5273-01A-01D-1468-08 ENST00000368491 ADAM32 chr8 39233971 39233971 Silent G G C TCGA-DB-5273-01A-01D-1468-08 ENST00000379907 p.V569V SESN3 chr11 95189939 95189939 Missense_Mutation G G A TCGA-DB-5273-01A-01D-1468-08 ENST00000536441 p.S122F TMEM132D chr12 129700545 129700545 Missense_Mutation C C T TCGA-DB-5273-01A-01D-1468-08 ENST00000422113 p.R78Q TP53 chr17 7673802 7673802 Missense_Mutation C T T TCGA-DB-5273-01A-01D-1468-08 ENST00000269305 p.R273H TCEB3B chr18 47035130 47035130 Silent C C T TCGA-DB-5273-01A-01D-1468-08 ENST00000332567 p.A45A PPP1R12C chr19 55096125 55096125 Missense_Mutation G G C TCGA-DB-5273-01A-01D-1468-08 ENST00000263433 p.S360C ATRX chrX 77684472 77684472 Nonsense_Mutation G G A TCGA-DB-5273-01A-01D-1468-08 ENST00000373344 p.Q262* KLHDC7A chr1 18482679 18482679 Silent G G A TCGA-HT-7873-01B-11D-2395-08 ENST00000400664 p.T566T SLC9A1 chr1 27114189 27114189 Silent G G A TCGA-HT-7873-01B-11D-2395-08 ENST00000263980 p.G150G ADGRL2 chr1 81969271 81969271 Missense_Mutation T T C TCGA-HT-7873-01B-11D-2395-08 ENST00000370717 p.F869L ETV3 chr1 157135675 157135675 Missense_Mutation T T A TCGA-HT-7873-01B-11D-2395-08 ENST00000368192 p.E27V SIPA1L2 chr1 232402417 232402417 Missense_Mutation C C T TCGA-HT-7873-01B-11D-2395-08 ENST00000262861 p.R1666Q TANC1 chr2 159194359 159194359 Missense_Mutation G G A TCGA-HT-7873-01B-11D-2395-08 ENST00000263635 p.E949K IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-HT-7873-01B-11D-2395-08 ENST00000345146 p.R132H FEV chr2 218982248 218982248 Missense_Mutation G G C TCGA-HT-7873-01B-11D-2395-08 ENST00000295727 p.Q46E SP140 chr2 230285787 230285787 Missense_Mutation G G A TCGA-HT-7873-01B-11D-2395-08 ENST00000392045 p.E534K ALDH7A1 chr5 126550206 126550206 Missense_Mutation G G A TCGA-HT-7873-01B-11D-2395-08 ENST00000409134 p.R469C MRAP2 chr6 84089352 84089352 Silent G G A TCGA-HT-7873-01B-11D-2395-08 ENST00000257776 p.K163K ABCA13 chr7 48295728 48295728 Missense_Mutation A A C TCGA-HT-7873-01B-11D-2395-08 ENST00000435803 p.N2995T TRPA1 chr8 72034317 72034317 Missense_Mutation C C A TCGA-HT-7873-01B-11D-2395-08 ENST00000262209 p.R872S WWP1 chr8 86431461 86431461 Silent A A C TCGA-HT-7873-01B-11D-2395-08 ENST00000265428 p.T481T KLHL9 chr9 21332938 21332938 3'UTR A A C TCGA-HT-7873-01B-11D-2395-08 ENST00000359039 PPP1R26 chr9 135487336 135487336 Silent C C T TCGA-HT-7873-01B-11D-2395-08 ENST00000356818 p.T942T A1CF chr10 50836241 50836242 Frame_Shift_Ins - - T TCGA-HT-7873-01B-11D-2395-08 ENST00000373993 p.T146Nfs*16 MAB21L1 chr13 35475097 35475097 Missense_Mutation C C G TCGA-HT-7873-01B-11D-2395-08 ENST00000379919 p.E348Q ADCY4 chr14 24318514 24318514 Missense_Mutation G G A TCGA-HT-7873-01B-11D-2395-08 ENST00000310677 p.R1046W MYO9A chr15 71880431 71880431 Silent G G A TCGA-HT-7873-01B-11D-2395-08 ENST00000356056 p.N1842N ALDH1A3 chr15 100885290 100885290 Silent C C T TCGA-HT-7873-01B-11D-2395-08 ENST00000329841 p.H41H NFAT5 chr16 69692310 69692310 Missense_Mutation G G A TCGA-HT-7873-01B-11D-2395-08 ENST00000354436 p.V811I TP53 chr17 7670678 7670685 Frame_Shift_Del AGCTCTCG AGCTCTCG - TCGA-HT-7873-01B-11D-2395-08 ENST00000269305 p.R342Efs*2 B9D1 chr17 19343194 19343194 3'UTR A A G TCGA-HT-7873-01B-11D-2395-08 ENST00000261499 LPO chr17 58264786 58264786 Missense_Mutation C C T TCGA-HT-7873-01B-11D-2395-08 ENST00000262290 p.P444L PCSK4 chr19 1481916 1481916 Missense_Mutation C C T TCGA-HT-7873-01B-11D-2395-08 ENST00000300954 p.R704H ZNF256 chr19 57942442 57942442 Silent T T C TCGA-HT-7873-01B-11D-2395-08 ENST00000282308 p.A122A SSTR4 chr20 23036438 23036438 Missense_Mutation C C T TCGA-HT-7873-01B-11D-2395-08 ENST00000255008 p.R319C ST13 chr22 40856648 40856648 5'UTR G G A TCGA-HT-7873-01B-11D-2395-08 ENST00000216218 ATRX chrX 77682537 77682537 Frame_Shift_Del G - - TCGA-HT-7873-01B-11D-2395-08 ENST00000373344 p.R907Dfs*63 EPHA10 chr1 37762055 37762055 Missense_Mutation T T C TCGA-DU-8165-01A-11D-2253-08 ENST00000373048 p.H67R ADGRL2 chr1 81952991 81952991 Frame_Shift_Del A A - TCGA-DU-8165-01A-11D-2253-08 ENST00000370717 p.K597Nfs*21 SLC39A1 chr1 153962340 153962350 Frame_Shift_Del CTGGCGGGAAG CTGGCGGGAAG - TCGA-DU-8165-01A-11D-2253-08 ENST00000310483 p.A63Efs*25 TDRD10 chr1 154544033 154544033 Missense_Mutation G G A TCGA-DU-8165-01A-11D-2253-08 ENST00000368480 p.V192I COLGALT2 chr1 183969369 183969369 Silent C C T TCGA-DU-8165-01A-11D-2253-08 ENST00000361927 p.R244R KIF26B chr1 245698929 245698929 Missense_Mutation C C T TCGA-DU-8165-01A-11D-2253-08 ENST00000407071 p.R2024C OR11L1 chr1 247841139 247841139 Missense_Mutation C C A TCGA-DU-8165-01A-11D-2253-08 ENST00000355784 p.G253V OR2G6 chr1 248522347 248522347 Missense_Mutation G G A TCGA-DU-8165-01A-11D-2253-08 ENST00000343414 p.R234H IGKV1-35 chr2 89286932 89286932 RNA C C T TCGA-DU-8165-01A-11D-2253-08 ENST00000517744 C2orf40 chr2 106073992 106073992 Silent C C G TCGA-DU-8165-01A-11D-2253-08 ENST00000238044 p.P78P SCN1A chr2 166045067 166045067 Silent T T C TCGA-DU-8165-01A-11D-2253-08 ENST00000303395 p.E546E SCN7A chr2 166432478 166432478 Missense_Mutation C C T TCGA-DU-8165-01A-11D-2253-08 ENST00000409855 p.S811N LRP2 chr2 169204137 169204137 Missense_Mutation C C T TCGA-DU-8165-01A-11D-2253-08 ENST00000263816 p.R2617Q LRP2 chr2 169259083 169259083 Missense_Mutation G G A TCGA-DU-8165-01A-11D-2253-08 ENST00000263816 p.R819C MARS2 chr2 197705419 197705419 Missense_Mutation C C T TCGA-DU-8165-01A-11D-2253-08 ENST00000282276 p.S5F DCLK3 chr3 36737723 36737723 Missense_Mutation G G C TCGA-DU-8165-01A-11D-2253-08 ENST00000416516 p.L313V PARP15 chr3 122615700 122615700 Intron C C A TCGA-DU-8165-01A-11D-2253-08 ENST00000464300 SLC7A14 chr3 170501271 170501271 Missense_Mutation C C A TCGA-DU-8165-01A-11D-2253-08 ENST00000231706 p.V127F SLIT2 chr4 20595748 20595748 Silent C C T TCGA-DU-8165-01A-11D-2253-08 ENST00000504154 p.D1078D DCHS2 chr4 154333164 154333164 Missense_Mutation C C A TCGA-DU-8165-01A-11D-2253-08 ENST00000623607 p.R516L CCDC110 chr4 185459435 185459435 Missense_Mutation G G C TCGA-DU-8165-01A-11D-2253-08 ENST00000307588 p.F384L ITGA2 chr5 53048465 53048465 Missense_Mutation C C A TCGA-DU-8165-01A-11D-2253-08 ENST00000296585 p.P164T PCDHA7 chr5 140834713 140834713 Silent G G T TCGA-DU-8165-01A-11D-2253-08 ENST00000525929 p.V110V SH3RF2 chr5 146013881 146013881 Silent G G A TCGA-DU-8165-01A-11D-2253-08 ENST00000359120 p.R293R TIGD6 chr5 149996082 149996082 Silent G G T TCGA-DU-8165-01A-11D-2253-08 ENST00000296736 p.I89I FAM83B chr6 54941465 54941465 Missense_Mutation C C A TCGA-DU-8165-01A-11D-2253-08 ENST00000306858 p.H832N POM121L12 chr7 53035885 53035885 Missense_Mutation G G T TCGA-DU-8165-01A-11D-2253-08 ENST00000408890 p.V72L CALCR chr7 93435995 93435995 Missense_Mutation C C T TCGA-DU-8165-01A-11D-2253-08 ENST00000359558 p.G403E BAIAP2L1 chr7 98293595 98293595 Missense_Mutation C C T TCGA-DU-8165-01A-11D-2253-08 ENST00000005260 p.G488R FLNC chr7 128854057 128854057 Missense_Mutation C C T TCGA-DU-8165-01A-11D-2253-08 ENST00000325888 p.R2190C ZFHX4 chr8 76705664 76705664 Missense_Mutation T T G TCGA-DU-8165-01A-11D-2253-08 ENST00000521891 p.S526A MATN2 chr8 98007552 98007552 Missense_Mutation T T G TCGA-DU-8165-01A-11D-2253-08 ENST00000254898 p.C508W SAMD12 chr8 118621801 118621802 Splice_Region - - A TCGA-DU-8165-01A-11D-2253-08 ENST00000314727 COL22A1 chr8 138780945 138780945 Silent G G A TCGA-DU-8165-01A-11D-2253-08 ENST00000303045 p.D544D SPATA31E1 chr9 87885172 87885172 Frame_Shift_Del C C - TCGA-DU-8165-01A-11D-2253-08 ENST00000325643 p.L229Ffs*3 SPATA31E1 chr9 87885175 87885175 Missense_Mutation C C T TCGA-DU-8165-01A-11D-2253-08 ENST00000325643 p.P230S SPATA31C1 chr9 87919306 87919306 RNA A A T TCGA-DU-8165-01A-11D-2253-08 ENST00000420021 OR52I2 chr11 4587117 4587117 Missense_Mutation T T C TCGA-DU-8165-01A-11D-2253-08 ENST00000312614 p.V102A OR51A2 chr11 4955244 4955244 Missense_Mutation A A T TCGA-DU-8165-01A-11D-2253-08 ENST00000380371 p.L157Q OR52E8 chr11 5857420 5857420 Missense_Mutation T T C TCGA-DU-8165-01A-11D-2253-08 ENST00000537935 p.T95A ANO1 chr11 70104120 70104120 Missense_Mutation C C T TCGA-DU-8165-01A-11D-2253-08 ENST00000355303 p.S221F SHANK2 chr11 70473210 70473210 Missense_Mutation G G C TCGA-DU-8165-01A-11D-2253-08 ENST00000423696 p.L1358V MMP8 chr11 102716362 102716362 Missense_Mutation G G T TCGA-DU-8165-01A-11D-2253-08 ENST00000236826 p.P281H OR9K2 chr12 55130591 55130591 Missense_Mutation G G A TCGA-DU-8165-01A-11D-2253-08 ENST00000305377 p.V275M LRRIQ1 chr12 85127979 85127979 Missense_Mutation A A T TCGA-DU-8165-01A-11D-2253-08 ENST00000393217 p.R1385S ATP6V0A2 chr12 123744257 123744257 Missense_Mutation G G A TCGA-DU-8165-01A-11D-2253-08 ENST00000330342 p.G416R ERO1L chr14 52671696 52671696 Missense_Mutation T T C TCGA-DU-8165-01A-11D-2253-08 ENST00000395686 p.T148A POTEB3 chr15 21430315 21430315 Missense_Mutation T T C TCGA-DU-8165-01A-11D-2253-08 ENST00000611217 p.D335G DMXL2 chr15 51481482 51481482 Missense_Mutation T T C TCGA-DU-8165-01A-11D-2253-08 ENST00000251076 p.D1875G USP31 chr16 23073878 23073878 Missense_Mutation A A G TCGA-DU-8165-01A-11D-2253-08 ENST00000219689 p.Y727H TP53 chr17 7673803 7673803 Missense_Mutation G G A TCGA-DU-8165-01A-11D-2253-08 ENST00000269305 p.R273C TP53 chr17 7675140 7675140 Missense_Mutation G G T TCGA-DU-8165-01A-11D-2253-08 ENST00000269305 p.R158S CFAP52 chr17 9643056 9643056 Missense_Mutation A A G TCGA-DU-8165-01A-11D-2253-08 ENST00000352665 p.Y574C HNF1B chr17 37733620 37733620 Missense_Mutation G G T TCGA-DU-8165-01A-11D-2253-08 ENST00000617811 p.A249D PTPRM chr18 8113638 8113638 Missense_Mutation T T A TCGA-DU-8165-01A-11D-2253-08 ENST00000332175 p.L670H DSG1 chr18 31355149 31355149 Missense_Mutation G G T TCGA-DU-8165-01A-11D-2253-08 ENST00000257192 p.G985C KLHL26 chr19 18669276 18669276 3'UTR C C T TCGA-DU-8165-01A-11D-2253-08 ENST00000300976 ZNF536 chr19 30549379 30549379 Missense_Mutation G G T TCGA-DU-8165-01A-11D-2253-08 ENST00000355537 p.G1254W PSG11 chr19 43015192 43015192 Silent A A G TCGA-DU-8165-01A-11D-2253-08 ENST00000320078 p.N296N LILRA4 chr19 54338533 54338533 Missense_Mutation T T A TCGA-DU-8165-01A-11D-2253-08 ENST00000291759 p.K73I PLCB1 chr20 8757100 8757100 Missense_Mutation G G T TCGA-DU-8165-01A-11D-2253-08 ENST00000338037 p.A860S DZANK1 chr20 18451925 18451925 Intron A A G TCGA-DU-8165-01A-11D-2253-08 ENST00000262547 ATP9A chr20 51607552 51607552 Missense_Mutation T T C TCGA-DU-8165-01A-11D-2253-08 ENST00000338821 p.I926M GAB4 chr22 16992149 16992149 Missense_Mutation G G A TCGA-DU-8165-01A-11D-2253-08 ENST00000400588 p.R68W CXorf23 chrX 19937529 19937529 Missense_Mutation A A C TCGA-DU-8165-01A-11D-2253-08 ENST00000379682 p.D583E FAM47C chrX 37009028 37009028 Silent G G A TCGA-DU-8165-01A-11D-2253-08 ENST00000358047 p.P206P HUWE1 chrX 53557241 53557241 Intron C C A TCGA-DU-8165-01A-11D-2253-08 ENST00000262854 DGAT2L6 chrX 70201955 70201955 Missense_Mutation G G A TCGA-DU-8165-01A-11D-2253-08 ENST00000333026 p.V180M SYTL4 chrX 100676051 100676051 Missense_Mutation C C A TCGA-DU-8165-01A-11D-2253-08 ENST00000263033 p.A665S RP1-241P17.4 chrX 115719185 115719185 RNA G G A TCGA-DU-8165-01A-11D-2253-08 ENST00000536192 HS6ST2 chrX 132628830 132628830 Missense_Mutation T T A TCGA-DU-8165-01A-11D-2253-08 ENST00000370836 p.N404I ARHGAP29 chr1 94185450 94185450 Silent T T G TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000260526 p.T604T LYPLAL1 chr1 219173868 219173868 5'UTR C C T TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000366928 C2orf16 chr2 27581751 27581751 Missense_Mutation C C T TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000408964 p.R1727C TTN chr2 178740734 178740734 Missense_Mutation G G C TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000591111 p.L3850V IDH1 chr2 208248389 208248389 Missense_Mutation G G C TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000345146 p.R132G RFTN1 chr3 16370175 16370178 Frame_Shift_Del CTGT CTGT - TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000334133 p.T310* LEKR1 chr3 157028108 157028108 Silent T T C TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000470811 p.S154S C4orf19 chr4 37590987 37590987 Missense_Mutation A A C TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000284437 p.D311A RPS3A chr4 151103872 151103874 Intron AAC AAC - TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000274065 KLHL2 chr4 165317963 165317963 Missense_Mutation T T G TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000226725 p.Y583D RAD50 chr5 132579981 132579981 Missense_Mutation G G A TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000378823 p.R224H GPER1 chr7 1092015 1092015 Missense_Mutation T T C TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000297469 p.L96P FKBP9 chr7 32974601 32974601 Intron C C - TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000242209 SPATA31A6 chr9 42188558 42188558 Silent A A G TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000332857 p.P952P COL5A1 chr9 134699994 134699994 Silent C C T TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000371817 p.N121N ALOX5 chr10 45445622 45445624 In_Frame_Del AAG AAG - TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000374391 p.K656del CTSLP2 chr10 46759300 46759300 RNA T T - TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000626319 OR4A5 chr11 54707654 54707654 Missense_Mutation G G C TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000319760 p.R257T OR5T1 chr11 56276238 56276238 Silent T T C TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000313033 p.S200S LRRIQ1 chr12 85229590 85229590 Silent C C T TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000393217 p.Y1632Y C12orf29 chr12 88048297 88048299 In_Frame_Del GTT GTT - TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000356891 p.V285del G2E3 chr14 30605566 30605566 Nonsense_Mutation A A T TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000206595 p.K358* TP53 chr17 7674230 7674230 Missense_Mutation C T T TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000269305 p.G245S WFIKKN2 chr17 50839843 50839843 Frame_Shift_Del C C - TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000311378 p.P187Hfs*41 SLC1A6 chr19 14950365 14950365 Missense_Mutation C C T TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000221742 p.V509I CPAMD8 chr19 16928009 16928009 Missense_Mutation C C T TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000443236 p.G1171R MXRA5 chrX 3317665 3317665 Missense_Mutation C C T TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000217939 p.E2006K ATRX chrX 77654124 77654124 Nonsense_Mutation G A A TCGA-TQ-A7RK-01A-11D-A33T-08 ENST00000373344 p.Q1431* INSRR chr1 156853837 156853837 Silent C C T TCGA-HT-7680-01A-11D-2253-08 ENST00000368195 p.L184L CD244 chr1 160841370 160841370 Silent G G A TCGA-HT-7680-01A-11D-2253-08 ENST00000368033 p.Y170Y PRR12 chr19 49601827 49601827 Missense_Mutation C C T TCGA-HT-7680-01A-11D-2253-08 ENST00000615927 p.T740M VCX3B chrX 8466180 8466180 Missense_Mutation G G C TCGA-HT-7680-01A-11D-2253-08 ENST00000381032 p.V180L DCST1 chr1 155040570 155040570 Silent C C T TCGA-DU-5853-01A-11D-1893-08 ENST00000295542 p.R159R IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-DU-5853-01A-11D-1893-08 ENST00000345146 p.R132H UNC93A chr6 167303917 167303917 Splice_Site A A G TCGA-DU-5853-01A-11D-1893-08 ENST00000230256 p.X209_splice NOS3 chr7 150996788 150996788 Missense_Mutation C C T TCGA-DU-5853-01A-11D-1893-08 ENST00000297494 p.R149W KMT2C chr7 152145186 152145186 Missense_Mutation T T G TCGA-DU-5853-01A-11D-1893-08 ENST00000262189 p.K4714T FAM178A chr10 100924073 100924073 Missense_Mutation G G C TCGA-DU-5853-01A-11D-1893-08 ENST00000238961 p.E358Q KRT8 chr12 52899851 52899851 Missense_Mutation C C T TCGA-DU-5853-01A-11D-1893-08 ENST00000293308 p.R302H ATP5B chr12 56642688 56642688 Silent G G C TCGA-DU-5853-01A-11D-1893-08 ENST00000262030 p.T312T SLC5A8 chr12 101184201 101184201 Missense_Mutation C C A TCGA-DU-5853-01A-11D-1893-08 ENST00000536262 p.D329Y SERPINA9 chr14 94463289 94463289 Missense_Mutation T T A TCGA-DU-5853-01A-11D-1893-08 ENST00000380365 p.H353L MT1M chr16 56636455 56636455 3'Flank C C T TCGA-DU-5853-01A-11D-1893-08 ENST00000379818 TP53 chr17 7673803 7673803 Missense_Mutation G A A TCGA-DU-5853-01A-11D-1893-08 ENST00000269305 p.R273C MUC16 chr19 8936071 8936071 Silent T T A TCGA-DU-5853-01A-11D-1893-08 ENST00000397910 p.P11628P NKX2-2 chr20 21512328 21512328 Missense_Mutation C C G TCGA-DU-5853-01A-11D-1893-08 ENST00000377142 p.Q139H PATZ1 chr22 31344752 31344752 Missense_Mutation C C T TCGA-DU-5853-01A-11D-1893-08 ENST00000266269 p.G284E ATRX chrX 77589941 77589941 Splice_Site C T T TCGA-DU-5853-01A-11D-1893-08 ENST00000373344 p.X2037_splice GABRD chr1 2028214 2028214 Missense_Mutation G G A TCGA-P5-A72U-01A-31D-A32B-08 ENST00000378585 p.G205R KLHDC8A chr1 205339242 205339242 Missense_Mutation G G A TCGA-P5-A72U-01A-31D-A32B-08 ENST00000367155 p.R237W PROKR1 chr2 68655182 68655182 Missense_Mutation C C T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000303786 p.A263V RANBP2 chr2 108767662 108767662 Missense_Mutation G G A TCGA-P5-A72U-01A-31D-A32B-08 ENST00000283195 p.D2375N LRP2 chr2 169181615 169181615 Nonsense_Mutation G G T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000263816 p.Y3334* ATF2 chr2 175114870 175114870 Splice_Site T T A TCGA-P5-A72U-01A-31D-A32B-08 ENST00000264110 p.X150_splice SP140 chr2 230285797 230285797 Missense_Mutation C C T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000392045 p.A537V THRB chr3 24152475 24152475 Missense_Mutation T T C TCGA-P5-A72U-01A-31D-A32B-08 ENST00000356447 p.Y100C PLCXD2 chr3 111675384 111675384 Missense_Mutation C C T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000477665 p.P47S SH3TC1 chr4 8227338 8227338 Silent G G A TCGA-P5-A72U-01A-31D-A32B-08 ENST00000245105 p.G548G ADAMTS3 chr4 72290997 72290997 Missense_Mutation G G T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000286657 p.T930N DKK2 chr4 106924654 106924654 Silent C C T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000285311 p.P140P CDH18 chr5 19747114 19747114 Missense_Mutation G G T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000274170 p.D117E F2R chr5 76732371 76732371 Missense_Mutation A A G TCGA-P5-A72U-01A-31D-A32B-08 ENST00000319211 p.N49S PCDHGA3 chr5 141345486 141345486 Missense_Mutation G G A TCGA-P5-A72U-01A-31D-A32B-08 ENST00000253812 p.A485T ABLIM3 chr5 149252803 149252803 Missense_Mutation G G A TCGA-P5-A72U-01A-31D-A32B-08 ENST00000309868 p.R635Q ITPR3 chr6 33675745 33675745 Silent C C T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000374316 p.R1057R TFAP2B chr6 50823560 50823560 Missense_Mutation T T G TCGA-P5-A72U-01A-31D-A32B-08 ENST00000393655 p.Y79D KDELR2 chr7 6466253 6466253 Missense_Mutation G G A TCGA-P5-A72U-01A-31D-A32B-08 ENST00000258739 p.T141I PCLO chr7 82952085 82952085 Silent C C T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000333891 p.Q2956Q SNX31 chr8 100608544 100608544 Missense_Mutation C C T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000311812 p.D211N NANS chr9 98080837 98080837 Missense_Mutation G G T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000210444 p.D209Y FAM129B chr9 127523694 127523694 Missense_Mutation G G A TCGA-P5-A72U-01A-31D-A32B-08 ENST00000373312 p.R192W EGFL7 chr9 136668596 136668596 Silent C C T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000308874 p.V40V MYO3A chr10 26088387 26088387 Missense_Mutation G G A TCGA-P5-A72U-01A-31D-A32B-08 ENST00000265944 p.R515Q DMBT1 chr10 122633204 122633204 Silent C C T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000338354 p.C2008C CUZD1 chr10 122834831 122834831 Silent G G A TCGA-P5-A72U-01A-31D-A32B-08 ENST00000368904 p.N419N RIC8A chr11 210610 210610 Missense_Mutation C C T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000526104 p.R256W RRM1 chr11 4123270 4123270 Silent C C T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000300738 p.T402T ZDHHC13 chr11 19175860 19175860 Missense_Mutation G G A TCGA-P5-A72U-01A-31D-A32B-08 ENST00000446113 p.C590Y MADD chr11 47290229 47290229 Silent C C T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000311027 p.H1028H DTX4 chr11 59204760 59204760 Missense_Mutation G G A TCGA-P5-A72U-01A-31D-A32B-08 ENST00000227451 p.V571I PGR chr11 101128176 101128176 Missense_Mutation T T C TCGA-P5-A72U-01A-31D-A32B-08 ENST00000325455 p.T299A ABCC9 chr12 21852381 21852381 Missense_Mutation G G A TCGA-P5-A72U-01A-31D-A32B-08 ENST00000261201 p.T877M MED13L chr12 115980799 115980800 Frame_Shift_Ins - - T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000281928 p.T1772Nfs*10 CABP1 chr12 120650621 120650621 Intron G G A TCGA-P5-A72U-01A-31D-A32B-08 ENST00000316803 TMEM132D chr12 129084539 129084539 Missense_Mutation T T C TCGA-P5-A72U-01A-31D-A32B-08 ENST00000422113 p.N536S RCBTB1 chr13 49549561 49549561 Silent C C T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000258646 p.R314R CLEC14A chr14 38254497 38254497 3'UTR G G A TCGA-P5-A72U-01A-31D-A32B-08 ENST00000342213 IDH2 chr15 90088387 90088388 In_Frame_Ins - - TGCCCT TCGA-P5-A72U-01A-31D-A32B-08 ENST00000330062 p.V217delinsEGM NUP93 chr16 56758588 56758588 Missense_Mutation G G T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000308159 p.R77L AARS chr16 70253990 70253990 Missense_Mutation C C T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000261772 p.E817K SGSM2 chr17 2364948 2364948 Missense_Mutation C C T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000426855 p.P351L LAMA3 chr18 23904071 23904071 Missense_Mutation G G T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000313654 p.A2153S DENND1C chr19 6468886 6468886 Missense_Mutation C C T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000381480 p.R492H INSL3 chr19 17816786 17816786 3'UTR G G A TCGA-P5-A72U-01A-31D-A32B-08 ENST00000317306 PPP1R15A chr19 48873981 48873981 Missense_Mutation C C T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000200453 p.P250S NLRP12 chr19 53810828 53810828 Silent C C T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000324134 p.A277A ZNF135 chr19 58067451 58067451 Missense_Mutation G G A TCGA-P5-A72U-01A-31D-A32B-08 ENST00000313434 p.E323K PLCB1 chr20 8881735 8881735 Silent C C T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000338037 p.H1179H MX2 chr21 41402074 41402074 Nonsense_Mutation C C T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000330714 p.Q507* LZTR1 chr22 20994728 20994728 Splice_Site G G A TCGA-P5-A72U-01A-31D-A32B-08 ENST00000215739 p.X595_splice SREBF2 chr22 41870994 41870994 Missense_Mutation G G A TCGA-P5-A72U-01A-31D-A32B-08 ENST00000361204 p.A276T MAGEB4 chrX 30242916 30242916 Missense_Mutation C C A TCGA-P5-A72U-01A-31D-A32B-08 ENST00000378982 p.P261T TAB3 chrX 30855187 30855187 Missense_Mutation G G T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000378933 p.P160T PGAM4 chrX 77969274 77969274 Missense_Mutation G G C TCGA-P5-A72U-01A-31D-A32B-08 ENST00000458128 p.P122R HDX chrX 84321996 84321996 Missense_Mutation G G T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000297977 p.P656T CSTF2 chrX 100820445 100820445 Missense_Mutation C C T TCGA-P5-A72U-01A-31D-A32B-08 ENST00000372972 p.A10V DVL1 chr1 1339660 1339660 Intron G G C TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000378888 UROD chr1 45012203 45012204 5'UTR - - G TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000246337 FCER1A chr1 159307754 159307754 Missense_Mutation G G A TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000368115 p.R199H DYNC1I2 chr2 171747803 171747803 Missense_Mutation T T C TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000397119 p.W611R IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000345146 p.R132H EPHA4 chr2 221430126 221430126 Missense_Mutation T T C TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000281821 p.Y841C ISL1 chr5 51387502 51387502 Silent C C A TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000230658 p.I77I PKHD1 chr6 52025281 52025281 Missense_Mutation G G A TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000371117 p.A1510V ZNF716 chr7 57468882 57468882 Missense_Mutation G G T TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000420713 p.G141C RBM12B chr8 93734566 93734566 Missense_Mutation C C G TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000399300 p.R615S PTCHD3 chr10 27413441 27413441 Silent G G A TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000438700 p.Y270Y MYOF chr10 93431441 93431441 Silent G G T TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000359263 p.I104I NUP98 chr11 3679612 3679612 Missense_Mutation G G C TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000359171 p.S1689C TUB chr11 8094116 8094116 Missense_Mutation G G C TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000299506 p.K108N TUB chr11 8095527 8095527 Missense_Mutation G G C TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000299506 p.D143H MS4A4A chr11 60292276 60292276 Silent A A G TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000337908 p.P31P MEN1 chr11 64804474 64804474 Silent G G A TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000337652 p.L570L LHFP chr13 39343967 39343967 Missense_Mutation G G A TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000379589 p.S191L MYO9A chr15 72032545 72032545 Missense_Mutation C C T TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000356056 p.R295H ABCC6 chr16 16182520 16182520 Silent G G A TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000205557 p.F713F TP53 chr17 7675994 7675994 Splice_Region C C T TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000269305 p.T125T SERPINB8 chr18 63987380 63987380 3'UTR A A - TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000353706 SMARCA4 chr19 11013030 11013030 Missense_Mutation A A G TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000344626 p.T786A OR7A17 chr19 14880653 14880653 Missense_Mutation A A T TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000327462 p.Y235N APOC1P1 chr19 44927005 44927005 RNA G G A TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000574565 SYNJ1 chr21 32656895 32656895 Missense_Mutation C C T TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000433931 p.V902I KCNJ6 chr21 37625466 37625466 Missense_Mutation C C T TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000609713 p.R322Q MAPK8IP2 chr22 50605713 50605713 Missense_Mutation G G A TCGA-S9-A7R4-01A-12D-A34J-08 ENST00000329492 p.G665S PADI2 chr1 17086601 17086601 Missense_Mutation C C T TCGA-HT-7467-01A-11D-2024-08 ENST00000375486 p.V252M AGO1 chr1 35914253 35914254 Frame_Shift_Ins - - A TCGA-HT-7467-01A-11D-2024-08 ENST00000373204 p.P607Tfs*32 EDEM3 chr1 184754535 184754535 Missense_Mutation T T C TCGA-HT-7467-01A-11D-2024-08 ENST00000318130 p.T38A PLA2G4A chr1 186894152 186894152 Missense_Mutation T T G TCGA-HT-7467-01A-11D-2024-08 ENST00000367466 p.F107V EPHX1 chr1 225845202 225845202 Missense_Mutation C C T TCGA-HT-7467-01A-11D-2024-08 ENST00000272167 p.T408M TRIM58 chr1 247864730 247864730 Missense_Mutation G G A TCGA-HT-7467-01A-11D-2024-08 ENST00000366481 p.R181H IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-HT-7467-01A-11D-2024-08 ENST00000345146 p.R132H SLCO4C1 chr5 102257187 102257187 Missense_Mutation G G A TCGA-HT-7467-01A-11D-2024-08 ENST00000310954 p.T466M ADGRF1 chr6 47009685 47009685 Missense_Mutation C C T TCGA-HT-7467-01A-11D-2024-08 ENST00000371253 p.V584I DOCK5 chr8 25323860 25323860 Missense_Mutation C C T TCGA-HT-7467-01A-11D-2024-08 ENST00000276440 p.S543L UBR5 chr8 102285673 102285673 Missense_Mutation C C T TCGA-HT-7467-01A-11D-2024-08 ENST00000520539 p.S1775N SLC30A8 chr8 117157825 117157825 Missense_Mutation G G A TCGA-HT-7467-01A-11D-2024-08 ENST00000456015 p.A185T ENPP2 chr8 119616268 119616268 Missense_Mutation T T A TCGA-HT-7467-01A-11D-2024-08 ENST00000075322 p.Q258H SAXO1 chr9 18928831 18928831 Missense_Mutation C C T TCGA-HT-7467-01A-11D-2024-08 ENST00000380534 p.V216M ANKRD30A chr10 37153593 37153593 Missense_Mutation C C A TCGA-HT-7467-01A-11D-2024-08 ENST00000611781 p.Q577K OR5A1 chr11 59443665 59443665 Missense_Mutation T T C TCGA-HT-7467-01A-11D-2024-08 ENST00000302030 p.I166T CHRM1 chr11 62909726 62909726 Nonsense_Mutation G G A TCGA-HT-7467-01A-11D-2024-08 ENST00000306960 p.Q459* AKAP3 chr12 4628355 4628355 Missense_Mutation C C T TCGA-HT-7467-01A-11D-2024-08 ENST00000228850 p.V183I ANAPC5 chr12 121331368 121331368 Silent G G A TCGA-HT-7467-01A-11D-2024-08 ENST00000261819 p.H337H REM2 chr14 22884945 22884945 Silent G G A TCGA-HT-7467-01A-11D-2024-08 ENST00000267396 p.V125V AP1G2 chr14 23566665 23566665 Missense_Mutation C C T TCGA-HT-7467-01A-11D-2024-08 ENST00000308724 p.A76T SLC43A2 chr17 1613264 1613264 Silent G G A TCGA-HT-7467-01A-11D-2024-08 ENST00000301335 p.S144S EXOC7 chr17 76081216 76081216 3'Flank C C T TCGA-HT-7467-01A-11D-2024-08 ENST00000335146 LAMA3 chr18 23784124 23784124 Missense_Mutation C C T TCGA-HT-7467-01A-11D-2024-08 ENST00000313654 p.R524C OR2Z1 chr19 8731435 8731435 Missense_Mutation T T C TCGA-HT-7467-01A-11D-2024-08 ENST00000324060 p.M136T CIC chr19 42287220 42287221 Frame_Shift_Del AG AG - TCGA-HT-7467-01A-11D-2024-08 ENST00000575354 p.S146* PCSK2 chr20 17358369 17358369 Nonsense_Mutation C C T TCGA-HT-7467-01A-11D-2024-08 ENST00000262545 p.R109* TMEM189-UBE2V1 chr20 50084177 50084177 Silent T T C TCGA-HT-7467-01A-11D-2024-08 ENST00000341698 p.R306R CTSZ chr20 59001566 59001566 Missense_Mutation G G A TCGA-HT-7467-01A-11D-2024-08 ENST00000217131 p.A129V EML4 chr2 42326190 42326190 Missense_Mutation G G T TCGA-DB-A4XG-01A-11D-A27K-08 ENST00000318522 p.R760L TNS1 chr2 217848183 217848194 In_Frame_Del CTGCTGCTGCCA CTGCTGCTGCCA - TCGA-DB-A4XG-01A-11D-A27K-08 ENST00000171887 p.W650_Q653del FGD5 chr3 14880615 14880615 Missense_Mutation T T C TCGA-DB-A4XG-01A-11D-A27K-08 ENST00000285046 p.L901P UGT2B27P chr4 69005106 69005106 RNA C C A TCGA-DB-A4XG-01A-11D-A27K-08 ENST00000505092 NIPBL chr5 37022097 37022097 Missense_Mutation C C A TCGA-DB-A4XG-01A-11D-A27K-08 ENST00000282516 p.A1792D SIM1 chr6 100420939 100420939 Silent G G A TCGA-DB-A4XG-01A-11D-A27K-08 ENST00000262901 p.L340L ANKIB1 chr7 92352583 92352583 Silent C C T TCGA-DB-A4XG-01A-11D-A27K-08 ENST00000265742 p.L446L ZCWPW1 chr7 100417148 100417150 In_Frame_Del AAG AAG - TCGA-DB-A4XG-01A-11D-A27K-08 ENST00000398027 p.S132del MATN2 chr8 98033598 98033598 Missense_Mutation T T G TCGA-DB-A4XG-01A-11D-A27K-08 ENST00000254898 p.C918W WISP1 chr8 133213070 133213070 Silent C C T TCGA-DB-A4XG-01A-11D-A27K-08 ENST00000250160 p.I92I CDK5RAP2 chr9 120579940 120579940 Silent A A G TCGA-DB-A4XG-01A-11D-A27K-08 ENST00000349780 p.P13P NOTCH1 chr9 136517826 136517826 Missense_Mutation C C T TCGA-DB-A4XG-01A-11D-A27K-08 ENST00000277541 p.C456Y MUC5B chr11 1249176 1249176 Missense_Mutation C C T TCGA-DB-A4XG-01A-11D-A27K-08 ENST00000529681 p.T4099M SMCO3 chr12 14806637 14806637 Missense_Mutation C C T TCGA-DB-A4XG-01A-11D-A27K-08 ENST00000316048 p.R15Q VPS13C chr15 61922423 61922423 Missense_Mutation C C A TCGA-DB-A4XG-01A-11D-A27K-08 ENST00000261517 p.A2317S HERC1 chr15 63674413 63674413 Missense_Mutation G G A TCGA-DB-A4XG-01A-11D-A27K-08 ENST00000443617 p.A2592V IDH2 chr15 90088606 90088606 Missense_Mutation C C T TCGA-DB-A4XG-01A-11D-A27K-08 ENST00000330062 p.R172K CDH16 chr16 66916393 66916393 Missense_Mutation C C T TCGA-DB-A4XG-01A-11D-A27K-08 ENST00000299752 p.V56M NF1 chr17 31338734 31338737 Frame_Shift_Del ACTT ACTT - TCGA-DB-A4XG-01A-11D-A27K-08 ENST00000358273 p.Y2285Tfs*5 SYNRG chr17 37542446 37542447 Frame_Shift_Del GA GA - TCGA-DB-A4XG-01A-11D-A27K-08 ENST00000612223 p.P910Ifs*27 C3 chr19 6707812 6707812 Missense_Mutation C C T TCGA-DB-A4XG-01A-11D-A27K-08 ENST00000245907 p.A655T CD209 chr19 7745007 7745007 Silent G G A TCGA-DB-A4XG-01A-11D-A27K-08 ENST00000315599 p.H278H CD79A chr19 41877188 41877188 5'UTR C T T TCGA-DB-A4XG-01A-11D-A27K-08 ENST00000221972 NDUFA6 chr22 42090878 42090878 5'UTR G G T TCGA-DB-A4XG-01A-11D-A27K-08 ENST00000498737 MAP3K15 chrX 19362817 19362820 Frame_Shift_Del CTCT CTCT - TCGA-DB-A4XG-01A-11D-A27K-08 ENST00000338883 p.R1199Sfs*10 POF1B chrX 85331006 85331006 Missense_Mutation C T T TCGA-DB-A4XG-01A-11D-A27K-08 ENST00000262753 p.R266H COL4A5 chrX 108580543 108580543 Missense_Mutation G T T TCGA-DB-A4XG-01A-11D-A27K-08 ENST00000361603 p.G264V CCDC88A chr2 55355703 55355703 Missense_Mutation G G A TCGA-HT-8010-01A-11D-2395-08 ENST00000436346 p.H226Y IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-HT-8010-01A-11D-2395-08 ENST00000345146 p.R132H TSC22D4 chr7 100474133 100474133 Intron C C A TCGA-HT-8010-01A-11D-2395-08 ENST00000300181 AOC1 chr7 150857925 150857925 Silent C C T TCGA-HT-8010-01A-11D-2395-08 ENST00000360937 p.V485V TMEM68 chr8 55751078 55751078 Silent G G A TCGA-HT-8010-01A-11D-2395-08 ENST00000434581 p.H191H MYL6 chr12 56160548 56160548 Intron A A G TCGA-HT-8010-01A-11D-2395-08 ENST00000548293 ITGAL chr16 30489255 30489255 Missense_Mutation G G A TCGA-HT-8010-01A-11D-2395-08 ENST00000356798 p.G361D NF1 chr17 31229967 31229967 Frame_Shift_Del C C - TCGA-HT-8010-01A-11D-2395-08 ENST00000358273 p.L995Wfs*17 CIC chr19 42292429 42292431 In_Frame_Del GCC GCC - TCGA-HT-8010-01A-11D-2395-08 ENST00000575354 p.P1047del CIC chr19 42292433 42292433 Missense_Mutation A A C TCGA-HT-8010-01A-11D-2395-08 ENST00000575354 p.S1048R POFUT2 chr21 45265630 45265630 Missense_Mutation A A C TCGA-HT-8010-01A-11D-2395-08 ENST00000349485 p.F381C MFNG chr22 37486114 37486114 Silent G G A TCGA-HT-8010-01A-11D-2395-08 ENST00000356998 p.L22L JADE3 chrX 47024800 47024800 Missense_Mutation A A G TCGA-HT-8010-01A-11D-2395-08 ENST00000611250 p.T121A USP11 chrX 47242503 47242503 Missense_Mutation C C T TCGA-HT-8010-01A-11D-2395-08 ENST00000218348 p.T533M ZNF182 chrX 47977207 47977207 Missense_Mutation C C T TCGA-HT-8010-01A-11D-2395-08 ENST00000305127 p.E294K ATP11C chrX 139804516 139804516 Silent G G C TCGA-HT-8010-01A-11D-2395-08 ENST00000327569 p.T173T IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-E1-A7YY-01A-11D-A34J-08 ENST00000345146 p.R132H ACBD5 chr10 27211043 27211043 Silent C C T TCGA-E1-A7YY-01A-11D-A34J-08 ENST00000375888 p.Q334Q WDR44 chrX 118448920 118448922 In_Frame_Del TTC TTC - TCGA-E1-A7YY-01A-11D-A34J-08 ENST00000254029 p.L894del AGO1 chr1 35894137 35894138 Frame_Shift_Del CT CT - TCGA-HT-7694-01A-11D-2253-08 ENST00000373204 p.Q252Afs*29 FUBP1 chr1 77956645 77956646 Frame_Shift_Del AT AT - TCGA-HT-7694-01A-11D-2253-08 ENST00000370768 p.Y544Lfs*22 ADGRL4 chr1 78918004 78918004 Missense_Mutation G G C TCGA-HT-7694-01A-11D-2253-08 ENST00000370742 p.A503G CFH chr1 196725209 196725211 In_Frame_Del CTC CTC - TCGA-HT-7694-01A-11D-2253-08 ENST00000367429 p.S596del CENPF chr1 214620936 214620936 Silent G G A TCGA-HT-7694-01A-11D-2253-08 ENST00000366955 p.A285A RNF144A chr2 7024382 7024382 Missense_Mutation A A G TCGA-HT-7694-01A-11D-2253-08 ENST00000320892 p.M175V NBAS chr2 15383242 15383242 Silent T T C TCGA-HT-7694-01A-11D-2253-08 ENST00000281513 p.T1111T APOB chr2 21007471 21007471 Missense_Mutation G G A TCGA-HT-7694-01A-11D-2253-08 ENST00000233242 p.P3133S HZGJ chr2 68157487 68157487 Missense_Mutation C C T TCGA-HT-7694-01A-11D-2253-08 ENST00000614162 p.G394E PTCD3 chr2 86127948 86127951 Frame_Shift_Del GCTT GCTT - TCGA-HT-7694-01A-11D-2253-08 ENST00000254630 p.L369Qfs*17 IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-HT-7694-01A-11D-2253-08 ENST00000345146 p.R132H TRIP12 chr2 229859155 229859155 Missense_Mutation G G A TCGA-HT-7694-01A-11D-2253-08 ENST00000283943 p.A173V C3orf35 chr3 37417447 37417447 RNA A A G TCGA-HT-7694-01A-11D-2253-08 ENST00000328376 RFT1 chr3 53092447 53092447 Silent C C T TCGA-HT-7694-01A-11D-2253-08 ENST00000296292 p.R460R TMEM14E chr3 152340785 152340785 Silent A A G TCGA-HT-7694-01A-11D-2253-08 ENST00000408960 p.S40S ANKRD17 chr4 73098102 73098103 Frame_Shift_Del TC TC - TCGA-HT-7694-01A-11D-2253-08 ENST00000358602 p.R1664Kfs*17 PIK3R1 chr5 68293310 68293310 Missense_Mutation G G A TCGA-HT-7694-01A-11D-2253-08 ENST00000521381 p.G376R DST chr6 56607845 56607847 Intron AAG AAG - TCGA-HT-7694-01A-11D-2253-08 ENST00000312431 COQ3 chr6 99369640 99369640 Missense_Mutation G G A TCGA-HT-7694-01A-11D-2253-08 ENST00000254759 p.A357V FUCA2 chr6 143502533 143502533 Missense_Mutation C C T TCGA-HT-7694-01A-11D-2253-08 ENST00000002165 p.R262H CLIP2 chr7 74380856 74380857 Frame_Shift_Del TG TG - TCGA-HT-7694-01A-11D-2253-08 ENST00000223398 p.V825Gfs*36 MYL10 chr7 101624233 101624233 Missense_Mutation C C T TCGA-HT-7694-01A-11D-2253-08 ENST00000223167 p.G37D OLFML2A chr9 124810251 124810251 Missense_Mutation T T C TCGA-HT-7694-01A-11D-2253-08 ENST00000373580 p.Y600H VDAC2 chr10 75220860 75220860 Silent G G A TCGA-HT-7694-01A-11D-2253-08 ENST00000332211 p.E158E GLUD1 chr10 87075987 87075987 Missense_Mutation A A C TCGA-HT-7694-01A-11D-2253-08 ENST00000277865 p.I188S OTUB1 chr11 63997105 63997107 In_Frame_Del CCT CCT - TCGA-HT-7694-01A-11D-2253-08 ENST00000428192 p.S161del H3F3C chr12 31791784 31791784 Missense_Mutation C C T TCGA-HT-7694-01A-11D-2253-08 ENST00000340398 p.R128H HAUS4 chr14 22947727 22947727 Missense_Mutation A A C TCGA-HT-7694-01A-11D-2253-08 ENST00000206474 p.L238R KIAA1024 chr15 79456278 79456278 Missense_Mutation C C A TCGA-HT-7694-01A-11D-2253-08 ENST00000305428 p.A44D PDP2 chr16 66885502 66885502 Silent C C T TCGA-HT-7694-01A-11D-2253-08 ENST00000311765 p.F406F RBBP8 chr18 23022264 23022264 Missense_Mutation G G A TCGA-HT-7694-01A-11D-2253-08 ENST00000327155 p.E864K CIC chr19 42289291 42289292 Frame_Shift_Ins - - C TCGA-HT-7694-01A-11D-2253-08 ENST00000575354 p.L418Afs*15 FAM217B chr20 59944985 59944985 Missense_Mutation G G A TCGA-HT-7694-01A-11D-2253-08 ENST00000358293 p.A348T PTPRC chr1 198706873 198706873 Silent A A G TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000442510 p.E275E KCNH1 chr1 211133918 211133918 Silent G G A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000271751 p.L10L HHIPL2 chr1 222522480 222522480 3'UTR G G A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000343410 C2orf48 chr2 10210499 10210499 RNA G G A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000381786 LINC01317 chr2 33727755 33727755 Intron G G A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000366209 TTN chr2 178608618 178608618 Missense_Mutation T T C TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000591111 p.K15824E TTN chr2 178631238 178631238 Missense_Mutation T T A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000591111 p.I12963F PIK3CA chr3 179230039 179230039 Missense_Mutation G G T TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000263967 p.C901F RBM47 chr4 40438508 40438508 Missense_Mutation C C T TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000295971 p.R129H IBSP chr4 87811493 87811493 Silent C C A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000226284 p.T179T TKTL2 chr4 163473113 163473113 Nonsense_Mutation C C A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000280605 p.E208* MORF4 chr4 173615980 173615980 RNA C C T TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000447135 TRIML1 chr4 188147231 188147231 Silent C C T TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000332517 p.N422N ADCY2 chr5 7626193 7626193 Missense_Mutation C C G TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000338316 p.I199M FST chr5 53483575 53483575 Missense_Mutation G G A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000256759 p.V117I ISCA1P1 chr5 62777107 62777107 RNA G G A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000426679 ETF1 chr5 138542935 138542935 Splice_Region C C G TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000360541 PCDHGA3 chr5 141345729 141345729 Missense_Mutation G G A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000253812 p.A566T UQCC2 chr6 33697683 33697683 Silent G G T TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000607484 p.P117P EGFR chr7 55173984 55173984 Missense_Mutation G G A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000275493 p.E709K OPRK1 chr8 53229591 53229591 Silent G G A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000265572 p.F283F SEC16A chr9 136477547 136477547 Silent G G A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000313050 p.S23S OR51E2 chr11 4682050 4682050 Missense_Mutation A A G TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000396950 p.I221T OR4S1 chr11 48306626 48306626 Missense_Mutation A A G TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000319988 p.D135G DCUN1D5 chr11 103066537 103066537 Silent T T C TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000260247 p.K124K MDM2 chr12 68828867 68828867 Missense_Mutation T T A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000258149 p.V207E TMEM132D chr12 129700258 129700258 Nonsense_Mutation G G A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000422113 p.R174* C1QTNF9B chr13 23891818 23891818 Missense_Mutation C C A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000382137 p.G158V ELF1 chr13 40943136 40943136 Missense_Mutation T T C TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000239882 p.I208V BAIAP3 chr16 1346249 1346249 Missense_Mutation G G A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000324385 p.G829E GRIN2A chr16 9763321 9763321 Missense_Mutation G G A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000330684 p.T1408M MIR6511A3 chr16 16371596 16371596 3'Flank C C T TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000615389 GPR139 chr16 20031926 20031926 Missense_Mutation G G A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000570682 p.R291W DDX19A chr16 70370321 70370321 Silent G G A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000302243 p.A373A MYBBP1A chr17 4539347 4539347 3'UTR A A T TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000254718 SLFN12L chr17 35475158 35475158 Missense_Mutation C C T TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000260908 p.C511Y KRTAP4-6 chr17 41140304 41140304 Missense_Mutation G G A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000345847 p.R62C KRT19 chr17 41523938 41523938 Silent C C T TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000361566 p.A336A TCEB3B chr18 47034706 47034706 Missense_Mutation C C T TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000332567 p.A187T ZNF700 chr19 11948846 11948846 Silent G G A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000254321 p.G274G MAST3 chr19 18134904 18134904 Missense_Mutation G G A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000262811 p.V569I UPF1 chr19 18847786 18847787 Frame_Shift_Ins - - A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000599848 p.T139Nfs*64 ERCC2 chr19 45354843 45354843 Missense_Mutation G G A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000391945 p.R518W TMEM143 chr19 48360135 48360135 Silent C C T TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000293261 p.A102A L3MBTL2 chr22 41225063 41225063 Missense_Mutation G G A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000216237 p.V450I DMD chrX 32816565 32816565 Nonsense_Mutation G G A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000357033 p.R145* SLC9A7 chrX 46607023 46607023 Missense_Mutation G G T TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000328306 p.L703M GLUD2 chrX 121047915 121047915 Silent C C T TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000328078 p.G77G UTP14A chrX 129926275 129926275 Missense_Mutation A A T TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000394422 p.K660I ARHGEF6 chrX 136743779 136743779 Missense_Mutation G G A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000250617 p.T156M PDZD4 chrX 153803901 153803901 Missense_Mutation C C T TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000164640 p.A588T ARHGAP4 chrX 153907829 153907829 Missense_Mutation C C T TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000350060 p.R914H HCFC1 chrX 153952531 153952531 Missense_Mutation G G A TCGA-KT-A7W1-01A-11D-A34A-08 ENST00000310441 p.A1642V TNFRSF14 chr1 2562910 2562911 Intron - - C TCGA-HT-8564-01A-11D-2395-08 ENST00000355716 MMEL1 chr1 2609797 2609797 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000378412 p.T109T DFFB chr1 3883813 3883813 3'UTR T T - TCGA-HT-8564-01A-11D-2395-08 ENST00000378209 CHD5 chr1 6142266 6142266 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000262450 p.R766R ICMT chr1 6225235 6225235 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000343813 p.V234I ZBTB48 chr1 6587291 6587294 Splice_Site AGTA AGTA - TCGA-HT-8564-01A-11D-2395-08 ENST00000377674 p.X408_splice DNAJC11 chr1 6637282 6637282 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000377577 p.S480S RERE chr1 8614616 8614616 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000337907 p.P156L AADACL4 chr1 12666790 12666790 3'UTR C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000376221 DNAJC16 chr1 15548351 15548351 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000375847 p.R316W SPEN chr1 15876483 15876483 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000375759 p.R229Q CROCCP2 chr1 16630964 16630964 RNA G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000412962 UBR4 chr1 19174967 19174967 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000375254 p.R947Q HSPG2 chr1 21839847 21839847 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000374695 p.T3228T HSPG2 chr1 21842305 21842305 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000374695 p.G2996S KDM1A chr1 23079048 23079048 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000356634 p.C618C HTR1D chr1 23193392 23193392 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000374619 p.H276H CLIC4 chr1 24840782 24840782 Frame_Shift_Del A A - TCGA-HT-8564-01A-11D-2395-08 ENST00000374379 p.K204Nfs*11 EXTL1 chr1 26022925 26022925 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000374280 p.G93G TRIM63 chr1 26061291 26061291 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000374272 p.E126K PHC2 chr1 33372352 33372352 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000257118 p.T90T CSMD2 chr1 33714650 33714650 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000241312 p.A1075T DLGAP3 chr1 34899713 34899713 Frame_Shift_Del G G - TCGA-HT-8564-01A-11D-2395-08 ENST00000235180 p.R448Gfs*20 STK40 chr1 36341694 36341694 3'UTR C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000373129 ZNF691 chr1 42851353 42851353 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000372502 p.R163Q TIE1 chr1 43313968 43313968 Splice_Region G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000372476 p.S803S PTPRF chr1 43591300 43591300 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000359947 p.S426S RNF220 chr1 44644724 44644725 Frame_Shift_Del AA AA - TCGA-HT-8564-01A-11D-2395-08 ENST00000355387 p.K385Rfs*6 UROD chr1 45013584 45013584 Intron C C - TCGA-HT-8564-01A-11D-2395-08 ENST00000246337 UROD chr1 45014295 45014295 Intron T T - TCGA-HT-8564-01A-11D-2395-08 ENST00000246337 MMACHC chr1 45511257 45511257 3'UTR A A - TCGA-HT-8564-01A-11D-2395-08 ENST00000401061 RAD54L chr1 46273738 46273738 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000371975 p.R534H DMRTB1 chr1 53459532 53459532 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000371445 p.A27T FAM73A chr1 77815166 77815166 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000370791 p.R277H LPAR3 chr1 84865807 84865807 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000370611 p.R105H RBMXL1 chr1 88983884 88983884 5'UTR G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000321792 ZNF644 chr1 90916926 90916926 Nonsense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000337393 p.R1286* ABCA4 chr1 94046975 94046975 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000370225 p.Y954Y ALG14 chr1 95027224 95027224 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000370205 p.R109W TRMT13 chr1 100140865 100140865 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000370141 p.G172D DBT chr1 100218735 100218737 In_Frame_Del TCT TCT - TCGA-HT-8564-01A-11D-2395-08 ENST00000370132 p.E148del CELSR2 chr1 109258610 109258610 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000271332 p.H1163H CHIA chr1 111315338 111315338 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000343320 p.R128H FAM46C chr1 117623813 117623813 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000369448 p.N315N ITGA10 chr1 145900142 145900142 Nonsense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000369304 p.R613* ANXA9 chr1 150994608 150994608 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000368947 p.R295H SEMA6C chr1 151133337 151133337 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000341697 p.R647H ZNF687 chr1 151288575 151288575 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000324048 p.S721S FLG chr1 152309919 152309919 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000368799 p.R1656H LCE1A chr1 152827544 152827544 Frame_Shift_Del C C - TCGA-HT-8564-01A-11D-2395-08 ENST00000335123 p.T26Lfs*44 PGLYRP3 chr1 153303934 153303934 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000290722 p.S151L RRNAD1 chr1 156732348 156732348 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000368216 p.R102W SLAMF8 chr1 159833002 159833002 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000289707 p.R165Q CCDC181 chr1 169395120 169395120 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000367806 p.R486H SLC9C2 chr1 173581913 173581913 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000367714 p.V246I DARS2 chr1 173857601 173857601 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000361951 p.D612N TNN chr1 175128604 175128604 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000239462 p.R1063H SOAT1 chr1 179341157 179341157 Silent C C G TCGA-HT-8564-01A-11D-2395-08 ENST00000367619 p.G209G PTGS2 chr1 186676560 186676560 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000367468 p.R293W PTPRC chr1 198702494 198702494 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000442510 p.R183C IGFN1 chr1 201215148 201215148 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000295591 p.V540I ELF3 chr1 202013191 202013191 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000359651 p.R233H ADIPOR1 chr1 202945059 202945059 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000340990 p.V181M FMOD chr1 203342421 203342421 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000354955 p.D351D DSTYK chr1 205169593 205169593 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000367162 p.S298S CDK18 chr1 205530218 205530218 Intron C C - TCGA-HT-8564-01A-11D-2395-08 ENST00000506784 RAB29 chr1 205771644 205771644 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000235932 p.R69H CR1 chr1 207619920 207619920 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000367051 p.S1919S CR1 chr1 207620024 207620024 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000367051 p.A1954V CR1 chr1 207645117 207645118 3'Flank TG TG - TCGA-HT-8564-01A-11D-2395-08 ENST00000367051 MARK1 chr1 220618649 220618649 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000366917 p.R268Q DISP1 chr1 223002950 223002951 Frame_Shift_Del TG TG - TCGA-HT-8564-01A-11D-2395-08 ENST00000284476 p.V520Lfs*53 IBA57 chr1 228175245 228175245 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000366711 p.R268H OBSCN chr1 228283581 228283581 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000422127 p.T2939M TRIM17 chr1 228408183 228408183 3'UTR G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000295033 EDARADD chr1 236483414 236483414 3'Flank G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000334232 KIF26B chr1 245685441 245685441 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000407071 p.E820K OR2T2 chr1 248453212 248453212 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000342927 p.R139C PXDN chr2 1680311 1680311 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000252804 p.A204A ODC1 chr2 10441880 10441880 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000234111 p.G321G PFN4 chr2 24121231 24121233 In_Frame_Del CTT CTT - TCGA-HT-8564-01A-11D-2395-08 ENST00000313213 p.E62del DNMT3A chr2 25241668 25241668 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000264709 p.R659H HADHA chr2 26191496 26191496 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000380649 p.P711P OTOF chr2 26477750 26477750 Splice_Site C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000272371 p.X739_splice TRIM54 chr2 27306248 27306248 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000380075 p.R301Q PLB1 chr2 28563069 28563069 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000327757 p.N392N SRBD1 chr2 45585722 45585722 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000263736 p.R234H MIR216A chr2 55989021 55989022 RNA CA CA - TCGA-HT-8564-01A-11D-2395-08 ENST00000385063 XPO1 chr2 61478682 61478683 3'UTR - - A TCGA-HT-8564-01A-11D-2395-08 ENST00000401558 VPS54 chr2 63972203 63972205 In_Frame_Del AGG AGG - TCGA-HT-8564-01A-11D-2395-08 ENST00000272322 p.P140del BMP10 chr2 68871368 68871368 5'UTR C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000295379 CLEC4F chr2 70816634 70816634 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000272367 p.N249N DYSF chr2 71526325 71526325 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000258104 p.R387W CYP26B1 chr2 72132554 72132554 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000001146 p.P404P ALMS1 chr2 73489964 73489964 Nonsense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000613296 p.R2669* DCTN1 chr2 74367987 74367987 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000361874 p.L667L TLX2 chr2 74515671 74515671 Missense_Mutation C C A TCGA-HT-8564-01A-11D-2395-08 ENST00000233638 p.H147N HK2 chr2 74880562 74880562 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000290573 p.D521D TCF7L1 chr2 85304315 85304315 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000282111 p.L274L SMYD1 chr2 88087871 88087871 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000419482 p.A108A FAHD2B chr2 97083988 97083988 Frame_Shift_Del G G - TCGA-HT-8564-01A-11D-2395-08 ENST00000272610 p.P281Qfs*26 REV1 chr2 99406429 99406429 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000258428 p.R837H IL18R1 chr2 102396877 102396877 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000233957 p.S539S RANBP2 chr2 108766600 108766600 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000283195 p.E2021K ZC3H6 chr2 112325004 112325006 In_Frame_Del TGT TGT - TCGA-HT-8564-01A-11D-2395-08 ENST00000343936 p.V633del POLR1B chr2 112564430 112564430 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000263331 p.D559D TMEM177 chr2 119681688 119681688 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000272521 p.V279I POTEF chr2 130115233 130115233 Frame_Shift_Del T T - TCGA-HT-8564-01A-11D-2395-08 ENST00000357462 p.K206Rfs*5 POTEE chr2 131263504 131263505 Frame_Shift_Ins - - A TCGA-HT-8564-01A-11D-2395-08 ENST00000356920 p.N687Efs*2 R3HDM1 chr2 135724047 135724047 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000264160 p.R1019W LRP2 chr2 169166022 169166022 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000263816 p.R3890W LRP2 chr2 169204097 169204097 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000263816 p.T2630T TTN chr2 178547901 178547901 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000591111 p.R29601H TTN chr2 178565577 178565577 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000591111 p.R25211H TTN chr2 178733375 178733375 Frame_Shift_Del T T - TCGA-HT-8564-01A-11D-2395-08 ENST00000591111 p.K4989Nfs*4 TTN chr2 178739712 178739712 Missense_Mutation C C A TCGA-HT-8564-01A-11D-2395-08 ENST00000591111 p.M4190I BZW1 chr2 200818781 200818781 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000409600 p.M282I CD28 chr2 203734838 203734838 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000324106 p.R197C ABCA12 chr2 214945078 214945078 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000272895 p.P2422P ATIC chr2 215344865 215344865 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000236959 p.N438N SPEG chr2 219469344 219469344 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000312358 p.R1227H HTR2B chr2 231108686 231108687 Frame_Shift_Del TT TT - TCGA-HT-8564-01A-11D-2395-08 ENST00000258400 p.K426Vfs*12 HTR2B chr2 231108711 231108711 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000258400 p.R418W DIS3L2 chr2 232263381 232263381 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000325385 p.G534R CHRNG chr2 232540691 232540691 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000389494 p.P110P DGKD chr2 233462695 233462695 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000264057 p.R1049H UGT1A8 chr2 233617735 233617735 Missense_Mutation A A G TCGA-HT-8564-01A-11D-2395-08 ENST00000373450 p.I10V UGT1A3 chr2 233743746 233743746 Intron C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000482026 HDAC4 chr2 239053530 239053530 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000345617 p.E1049K ANKMY1 chr2 240529459 240529459 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000272972 p.P88P GPR35 chr2 240630719 240630719 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000319838 p.R256H KIF1A chr2 240741316 240741316 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000320389 p.Y1133Y STK25 chr2 241497622 241497622 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000316586 p.F366F RTP5 chr2 241873209 241873209 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000343216 p.V552M NR2C2 chr3 15024130 15024130 Silent T T A TCGA-HT-8564-01A-11D-2395-08 ENST00000393102 p.L240L DCLK3 chr3 36738467 36738467 Missense_Mutation C T T TCGA-HT-8564-01A-11D-2395-08 ENST00000416516 p.E65K MLH1 chr3 36996681 36996681 Missense_Mutation A C C TCGA-HT-8564-01A-11D-2395-08 ENST00000231790 p.Q60P PRSS50 chr3 46717613 46717613 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000315170 p.P44L FBXW12 chr3 48380786 48380786 Missense_Mutation G A A TCGA-HT-8564-01A-11D-2395-08 ENST00000296438 p.A287T BSN chr3 49662552 49662552 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000296452 p.S3569S SEMA3F chr3 50186627 50186627 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000002829 p.V610M IFRD2 chr3 50288821 50288821 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000417626 p.R398R DNAH1 chr3 52346747 52346747 Silent C T T TCGA-HT-8564-01A-11D-2395-08 ENST00000420323 p.D644D FLNB chr3 58123104 58123104 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000295956 p.H1046H FAM107A chr3 58567178 58567178 Intron C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000360997 ADAMTS9 chr3 64550980 64550980 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000498707 p.R1594H SLC9C1 chr3 112286763 112286763 Frame_Shift_Del A A - TCGA-HT-8564-01A-11D-2395-08 ENST00000305815 p.F10Sfs*11 ZBTB20 chr3 114339156 114339156 Frame_Shift_Del G - - TCGA-HT-8564-01A-11D-2395-08 ENST00000474710 p.P692Lfs*43 ADCY5 chr3 123318096 123318096 Nonsense_Mutation G A A TCGA-HT-8564-01A-11D-2395-08 ENST00000462833 p.R760* ACAD11 chr3 132642738 132642738 Missense_Mutation A G G TCGA-HT-8564-01A-11D-2395-08 ENST00000264990 p.I105T NPHP3 chr3 132684656 132684658 In_Frame_Del TTC TTC - TCGA-HT-8564-01A-11D-2395-08 ENST00000337331 p.E1156del ZBTB38 chr3 141445104 141445104 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000321464 p.A906T ZBTB38 chr3 141445561 141445561 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000321464 p.R1058H AADACL2 chr3 151744126 151744126 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000356517 p.T132M MCCC1 chr3 183022518 183022518 Missense_Mutation A A G TCGA-HT-8564-01A-11D-2395-08 ENST00000265594 p.Y590H ZFYVE28 chr4 2305215 2305215 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000290974 p.A375A NOP14 chr4 2941653 2941653 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000314262 p.A710T GRK4 chr4 3035458 3035458 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000398052 p.V448M MAN2B2 chr4 6587167 6587167 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000285599 p.R188Q HTRA3 chr4 8291497 8291497 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000307358 p.R279Q DRD5 chr4 9782301 9782301 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000304374 p.A91V PACRGL chr4 20713539 20713539 Splice_Region C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000471979 p.S203S TMEM156 chr4 38988892 38988892 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000381938 p.R233H STAP1 chr4 67581471 67581471 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000265404 p.A177V UGT2B11 chr4 69214224 69214224 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000446444 p.R167W SHROOM3 chr4 76740886 76740886 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000296043 p.R905W BMP2K chr4 78872670 78872670 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000335016 p.P555P PRKG2 chr4 81105844 81105844 Nonsense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000264399 p.R678* EGF chr4 109994757 109994757 Missense_Mutation G G T TCGA-HT-8564-01A-11D-2395-08 ENST00000265171 p.R961M TRPC3 chr4 121914794 121914794 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000379645 p.A443T SLC25A31 chr4 127730722 127730722 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000281154 p.P59P LRBA chr4 150928915 150928915 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000357115 p.R123W TIGD4 chr4 152771072 152771072 5'UTR G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000304337 SFRP2 chr4 153788538 153788538 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000274063 p.A100T FGB chr4 154569775 154569775 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000302068 p.T407M LRAT chr4 154749148 154749148 3'UTR C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000336356 TLL1 chr4 165873894 165873894 5'UTR G G - TCGA-HT-8564-01A-11D-2395-08 ENST00000061240 ACSL1 chr4 184803320 184803320 Splice_Region C C A TCGA-HT-8564-01A-11D-2395-08 ENST00000281455 p.A65A CDH10 chr5 24491595 24491597 In_Frame_Del GAG GAG - TCGA-HT-8564-01A-11D-2395-08 ENST00000264463 p.L619del NPR3 chr5 32738895 32738895 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000265074 p.H308H AGXT2 chr5 34998819 34998819 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000231420 p.R482H CARD6 chr5 40854036 40854036 Missense_Mutation G G C TCGA-HT-8564-01A-11D-2395-08 ENST00000254691 p.A902P C6 chr5 41159179 41159179 Nonsense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000263413 p.R587* NIM1K chr5 43245976 43245976 Frame_Shift_Del G G - TCGA-HT-8564-01A-11D-2395-08 ENST00000326035 p.K69Nfs*3 MIER3 chr5 56935443 56935443 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000381199 p.D194N CENPK chr5 65518542 65518542 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000242872 p.R248H SLC30A5 chr5 69117381 69117381 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000396591 p.R475Q MARVELD2 chr5 69420277 69420277 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000325631 p.V298I PDE8B chr5 77353367 77353367 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000264917 p.S376S ZCCHC9 chr5 81308671 81308671 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000254037 p.H165H PPIP5K2 chr5 103201623 103201623 Frame_Shift_Del A A - TCGA-HT-8564-01A-11D-2395-08 ENST00000358359 p.K1242Rfs*31 MCC chr5 113027338 113027340 In_Frame_Del CTC CTC - TCGA-HT-8564-01A-11D-2395-08 ENST00000302475 p.E818del KIF3A chr5 132715877 132715877 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000378746 p.R337W KDM3B chr5 138386058 138386060 In_Frame_Del AAG AAG - TCGA-HT-8564-01A-11D-2395-08 ENST00000314358 p.K275del PSD2 chr5 139809712 139809713 Frame_Shift_Del AA AA - TCGA-HT-8564-01A-11D-2395-08 ENST00000274710 p.E91Gfs*28 TMCO6 chr5 140641972 140641972 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000394671 p.E139E PCDHA6 chr5 140830232 140830232 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000529310 p.T714M PCDHA12 chr5 140876012 140876016 Frame_Shift_Del TAAAA TAAAA - TCGA-HT-8564-01A-11D-2395-08 ENST00000398631 p.I182Nfs*5 ARAP3 chr5 141655703 141655703 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000239440 p.R1343H SYNPO chr5 150649888 150649888 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000394243 p.R782Q SLC36A1 chr5 151476662 151476662 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000243389 p.V299I TENM2 chr5 168262233 168262233 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000518659 p.T2583M HIGD2A chr5 176388915 176388916 Frame_Shift_Del AG AG - TCGA-HT-8564-01A-11D-2395-08 ENST00000274787 p.S34Ffs*106 GPRIN1 chr5 176598904 176598904 Nonsense_Mutation C C A TCGA-HT-8564-01A-11D-2395-08 ENST00000303991 p.G311* SNCB chr5 176629599 176629599 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000310112 p.A19V ADAMTS2 chr5 179139909 179139909 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000251582 p.R586C HNRNPH1 chr5 179616154 179616154 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000356731 p.Y424Y MAPK9 chr5 180249062 180249062 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000452135 p.A176V FLT4 chr5 180619723 180619723 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000261937 p.S863S TRIM41 chr5 181233359 181233360 Intron AC AC - TCGA-HT-8564-01A-11D-2395-08 ENST00000315073 TMEM14C chr6 10724992 10724992 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000229563 p.A18T JARID2 chr6 15520285 15520285 3'UTR T T A TCGA-HT-8564-01A-11D-2395-08 ENST00000341776 ABCF1 chr6 30584550 30584550 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000326195 p.R459C FGD2 chr6 37010990 37010990 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000274963 p.I106I PTK7 chr6 43076520 43076520 Missense_Mutation C C A TCGA-HT-8564-01A-11D-2395-08 ENST00000230419 p.P11H HSP90AB1 chr6 44253814 44253818 3'UTR TTTAT TTTAT - TCGA-HT-8564-01A-11D-2395-08 ENST00000353801 TDRD6 chr6 46688545 46688545 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000316081 p.C139C SNAP91 chr6 83707843 83707844 Frame_Shift_Ins - - T TCGA-HT-8564-01A-11D-2395-08 ENST00000369694 p.A29Sfs*5 PEX3 chr6 143472227 143472227 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000367591 p.V216I LATS1 chr6 149684379 149684379 Frame_Shift_Del G G - TCGA-HT-8564-01A-11D-2395-08 ENST00000253339 p.P237Hfs*6 WTAP chr6 159755421 159755421 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000358372 p.A334V LPAL2 chr6 160467547 160467547 RNA G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000454031 FRMD1 chr6 168062943 168062943 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000283309 p.R274H GPR146 chr7 1058541 1058541 3'UTR C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000297468 GPER1 chr7 1092515 1092515 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000297469 p.A263T AP5Z1 chr7 4785011 4785011 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000348624 p.F298F FBXL18 chr7 5501130 5501130 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000382368 p.A380V HOXA1 chr7 27095629 27095629 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000343060 p.C95Y GGCT chr7 30498836 30498836 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000275428 p.Y130Y PDE1C chr7 31790174 31790176 Intron AGG AGG - TCGA-HT-8564-01A-11D-2395-08 ENST00000321453 FKBP9 chr7 32975192 32975192 Frame_Shift_Del C C - TCGA-HT-8564-01A-11D-2395-08 ENST00000242209 p.N129Ifs*10 HECW1 chr7 43445134 43445134 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000395891 p.T654T TMED4 chr7 44580955 44580958 Intron AACA AACA - TCGA-HT-8564-01A-11D-2395-08 ENST00000457408 INTS4P2 chr7 65695073 65695073 RNA G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000609420 TMEM248 chr7 66950978 66950978 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000341567 p.T208M TYW1B chr7 72810554 72810554 Nonsense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000620995 p.R117* FKBP6 chr7 73340697 73340697 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000252037 p.A216A MLXIPL chr7 73599533 73599533 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000313375 p.R355H ELN chr7 74057454 74057454 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000358929 p.T477M PCLO chr7 82955120 82955120 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000333891 p.P1945S SEMA3A chr7 84194501 84194501 Missense_Mutation A A G TCGA-HT-8564-01A-11D-2395-08 ENST00000265362 p.V29A AKAP9 chr7 92108493 92108493 Splice_Site G G T TCGA-HT-8564-01A-11D-2395-08 ENST00000356239 p.X3849_splice PON1 chr7 95302234 95302236 In_Frame_Del AGA AGA - TCGA-HT-8564-01A-11D-2395-08 ENST00000222381 p.F293del ATP5J2 chr7 99458303 99458303 3'UTR G G - TCGA-HT-8564-01A-11D-2395-08 ENST00000292475 TRIM4 chr7 99892034 99892034 3'UTR C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000355947 MCM7 chr7 100093364 100093366 In_Frame_Del TCT TCT - TCGA-HT-8564-01A-11D-2395-08 ENST00000303887 p.E628del ZAN chr7 100792503 100792503 Intron C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000613979 FBXL13 chr7 103028711 103028711 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000313221 p.V36I TFEC chr7 115950917 115950917 Nonsense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000265440 p.R158* ASZ1 chr7 117427484 117427484 5'UTR G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000284629 CADPS2 chr7 122325501 122325501 Silent C C G TCGA-HT-8564-01A-11D-2395-08 ENST00000449022 p.L1231L FLNC chr7 128843566 128843566 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000325888 p.A934T SSMEM1 chr7 130216378 130216378 Nonsense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000297819 p.R215* SLC13A4 chr7 135691229 135691229 Frame_Shift_Del C C - TCGA-HT-8564-01A-11D-2395-08 ENST00000354042 p.G472Efs*25 EPHB6 chr7 142864554 142864554 Frame_Shift_Del G G - TCGA-HT-8564-01A-11D-2395-08 ENST00000619012 p.A254Pfs*21 NOBOX chr7 144399066 144399066 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000467773 p.A451A CNTNAP2 chr7 147903704 147903704 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000361727 p.D746D SLC4A2 chr7 151064650 151064650 Frame_Shift_Del G G - TCGA-HT-8564-01A-11D-2395-08 ENST00000413384 p.T115Lfs*130 SLC4A2 chr7 151075113 151075113 Intron G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000413384 HTR5A chr7 155071208 155071208 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000287907 p.S103S RBM33 chr7 155665207 155665207 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000401878 p.A26T MCPH1 chr8 6621495 6621495 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000344683 p.R752R PRSS55 chr8 10525704 10525704 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000328655 p.R40H FAM167A chr8 11444449 11444449 5'UTR C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000284486 DMTN chr8 22069438 22069438 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000265800 p.S105L BMP1 chr8 22180474 22180474 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000306385 p.P356P CLU chr8 27610558 27610559 Frame_Shift_Del AG AG - TCGA-HT-8564-01A-11D-2395-08 ENST00000316403 p.L5Afs*25 KIF13B chr8 29132323 29132323 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000524189 p.R976H HTRA4 chr8 38982504 38982504 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000302495 p.A374V ANK1 chr8 41696506 41696506 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000347528 p.P939P MTFR1 chr8 65707962 65707962 Frame_Shift_Del A A - TCGA-HT-8564-01A-11D-2395-08 ENST00000262146 p.G297Efs*21 PI15 chr8 74825344 74825344 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000260113 p.P32L RUNX1T1 chr8 91960498 91960498 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000265814 p.R520H VPS13B chr8 99784474 99784474 Frame_Shift_Del C C - TCGA-HT-8564-01A-11D-2395-08 ENST00000358544 p.Q2672Sfs*70 TBC1D31 chr8 123093646 123093646 Frame_Shift_Del T T - TCGA-HT-8564-01A-11D-2395-08 ENST00000287380 p.F193Lfs*30 COL22A1 chr8 138878235 138878235 Missense_Mutation C C A TCGA-HT-8564-01A-11D-2395-08 ENST00000303045 p.R58L AGO2 chr8 140585289 140585289 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000220592 p.P15P GPR20 chr8 141357103 141357103 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000377741 p.T274M ARC chr8 142613111 142613111 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000356613 p.S387S PLEC chr8 143917228 143917228 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000322810 p.R4335H PLEC chr8 143925253 143925253 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000322810 p.R1696Q PARP10 chr8 143984066 143984066 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000313028 p.N573N MROH1 chr8 144260779 144260779 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000326134 p.G1495R KANK1 chr9 732195 732196 Intron AA AA - TCGA-HT-8564-01A-11D-2395-08 ENST00000382297 KDM4C chr9 6990511 6990511 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000381309 p.A591A PTPRD chr9 8636794 8636794 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000356435 p.G39R CCIN chr9 36170735 36170735 Frame_Shift_Del C C - TCGA-HT-8564-01A-11D-2395-08 ENST00000335119 p.M413Wfs*6 APBA1 chr9 69431230 69431230 3'UTR C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000265381 TRPM6 chr9 74762080 74762080 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000360774 p.R1531C TRPM6 chr9 74775911 74775911 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000360774 p.H1125H RP11-383M4.6 chr9 81933074 81933074 Intron C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000585776 SPATA31D1 chr9 81992836 81992836 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000344803 p.P789L KIF27 chr9 83850135 83850135 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000297814 p.E1174K ZCCHC6 chr9 86352939 86352939 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000375963 p.P87P SEMA4D chr9 89378719 89378719 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000356444 p.D858D FGD3 chr9 92976697 92976697 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000337352 p.A147A HEMGN chr9 97927327 97927327 3'UTR C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000259456 PTPN3 chr9 109404472 109404472 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000374541 p.S643S PALM2-AKAP2 chr9 110138202 110138202 Silent G G C TCGA-HT-8564-01A-11D-2395-08 ENST00000374530 p.G886G C9orf152 chr9 110201311 110201311 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000400613 p.T119T RGS3 chr9 113484224 113484226 In_Frame_Del CTT CTT - TCGA-HT-8564-01A-11D-2395-08 ENST00000350696 p.F207del ZNF618 chr9 114049147 114049147 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000374126 p.Y615Y PAPPA chr9 116335003 116335003 Silent C C A TCGA-HT-8564-01A-11D-2395-08 ENST00000328252 p.S1180S CDK5RAP2 chr9 120453608 120453608 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000349780 p.D881N CDK5RAP2 chr9 120491319 120491319 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000349780 p.D490D PHF19 chr9 120862716 120862718 In_Frame_Del CTT CTT - TCGA-HT-8564-01A-11D-2395-08 ENST00000373896 p.K334del CNTRL chr9 121096528 121096528 Nonsense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000238341 p.R196* OR5C1 chr9 122788954 122788954 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000373680 p.R8W CRB2 chr9 123366358 123366358 Missense_Mutation G G T TCGA-HT-8564-01A-11D-2395-08 ENST00000373631 p.C249F TRUB2 chr9 128309770 128309770 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000372890 p.R259H SPTAN1 chr9 128626590 128626590 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000372731 p.R2155H USP20 chr9 129868912 129868912 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000315480 p.V396I FIBCD1 chr9 130905265 130905265 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000372338 p.P365P BRD3 chr9 134045391 134045391 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000303407 p.A373T PPP1R26 chr9 135487197 135487197 Frame_Shift_Del G G - TCGA-HT-8564-01A-11D-2395-08 ENST00000356818 p.V898Sfs*56 NOTCH1 chr9 136506954 136506954 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000277541 p.N1221N CLIC3 chr9 136994726 136994726 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000494426 p.S222S TUBB4B chr9 137243074 137243074 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000340384 p.V286M EHMT1 chr9 137811614 137811614 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000460843 p.V956I TAF3 chr10 7965464 7965464 Frame_Shift_Del C C - TCGA-HT-8564-01A-11D-2395-08 ENST00000344293 p.P653Hfs*44 DHTKD1 chr10 12100227 12100227 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000263035 p.A574V ANKRD26 chr10 27033330 27033330 Frame_Shift_Del T T - TCGA-HT-8564-01A-11D-2395-08 ENST00000376087 p.K1234Nfs*19 MKX chr10 27734658 27734658 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000375790 p.Y212Y SVIL chr10 29471187 29471187 Frame_Shift_Del C C - TCGA-HT-8564-01A-11D-2395-08 ENST00000355867 p.M1863Wfs*44 SVIL chr10 29533073 29533075 In_Frame_Del CTT CTT - TCGA-HT-8564-01A-11D-2395-08 ENST00000355867 p.E431del RN7SL248P chr10 46650449 46650449 3'Flank G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000615117 ARHGAP22 chr10 48479750 48479750 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000249601 p.R113W STOX1 chr10 68886042 68886042 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000298596 p.R749H TSPAN15 chr10 69498396 69498396 Splice_Region G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000373290 p.T190T CDH23 chr10 71702196 71702196 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000224721 p.V908I CYP2C18 chr10 94720481 94720481 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000285979 p.T302M DNTT chr10 96304553 96304553 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000371174 p.T19M CRTAC1 chr10 97936306 97936306 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000370597 p.I95I GBF1 chr10 102382216 102382216 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000369983 p.G1820G PDCD11 chr10 103425061 103425061 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000369797 p.T947T CALHM2 chr10 103449409 103449409 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000260743 p.R178H SLK chr10 103967751 103967753 In_Frame_Del CTT CTT - TCGA-HT-8564-01A-11D-2395-08 ENST00000369755 p.F4del EIF3A chr10 119037240 119037240 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000369144 p.D1266D GPR26 chr10 123666771 123666771 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000284674 p.D122N GPR26 chr10 123666893 123666893 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000284674 p.R162R CHST15 chr10 124044740 124044740 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000346248 p.H242H MMP21 chr10 125766656 125766658 3'UTR TTC TTC - TCGA-HT-8564-01A-11D-2395-08 ENST00000368808 PWWP2B chr10 132404871 132404871 Frame_Shift_Del C C - TCGA-HT-8564-01A-11D-2395-08 ENST00000305233 p.F126Sfs*60 INPP5A chr10 132782052 132782052 3'UTR G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000368594 TUBGCP2 chr10 133288295 133288295 Missense_Mutation T T C TCGA-HT-8564-01A-11D-2395-08 ENST00000252936 p.Y519C TUBGCP2 chr10 133289912 133289914 In_Frame_Del GTT GTT - TCGA-HT-8564-01A-11D-2395-08 ENST00000252936 p.N424del IFITM1 chr11 314210 314210 Frame_Shift_Del C C - TCGA-HT-8564-01A-11D-2395-08 ENST00000328221 p.S16Afs*9 DEAF1 chr11 654033 654033 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000382409 p.G508S PIDD1 chr11 800359 800359 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000347755 p.R712W MUC5B chr11 1244235 1244235 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000529681 p.T2452M DUSP8 chr11 1557301 1557301 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000331588 p.P365P TRPM5 chr11 2404853 2404853 3'UTR G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000155858 TRPM5 chr11 2407295 2407295 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000155858 p.T981M OR51B4 chr11 5301441 5301441 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000380224 p.R169H ZNF143 chr11 9501164 9501164 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000396602 p.H347H TSG101 chr11 18481705 18481705 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000251968 p.N336N TMEM86A chr11 18701613 18701613 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000280734 p.S109S ELP4 chr11 31783461 31783461 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000350638 p.S404S QSER1 chr11 32976348 32976349 Frame_Shift_Ins - - A TCGA-HT-8564-01A-11D-2395-08 ENST00000399302 p.N1697Kfs*2 CSTF3 chr11 33098761 33098761 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000323959 p.R353C HIPK3 chr11 33287344 33287345 Frame_Shift_Ins - - A TCGA-HT-8564-01A-11D-2395-08 ENST00000303296 p.L313Ifs*10 KIAA1549L chr11 33583400 33583400 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000321505 p.V1192M EXT2 chr11 44234190 44234190 Missense_Mutation G G C TCGA-HT-8564-01A-11D-2395-08 ENST00000343631 p.D628H CKAP5 chr11 46808133 46808133 Frame_Shift_Del T T - TCGA-HT-8564-01A-11D-2395-08 ENST00000529230 p.K292Nfs*12 FADS3 chr11 61873755 61873755 3'UTR C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000278829 MTA2 chr11 62595441 62595444 Frame_Shift_Del GAGA GAGA - TCGA-HT-8564-01A-11D-2395-08 ENST00000278823 p.S435Lfs*26 SLC3A2 chr11 62882057 62882057 Frame_Shift_Del A A - TCGA-HT-8564-01A-11D-2395-08 ENST00000377890 p.K300Rfs*31 RASGRP2 chr11 64739380 64739380 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000354024 p.V265I SF1 chr11 64765503 64765503 3'UTR G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000377390 EHD1 chr11 64854275 64854275 3'UTR C C - TCGA-HT-8564-01A-11D-2395-08 ENST00000320631 VPS51 chr11 65108204 65108204 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000279281 p.G245S EFEMP2 chr11 65867895 65867895 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000307998 p.R379H PELI3 chr11 66476050 66476050 Silent C C A TCGA-HT-8564-01A-11D-2395-08 ENST00000320740 p.A431A CTD-3074O7.11 chr11 66529863 66529863 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000419755 p.R499C SPTBN2 chr11 66693406 66693406 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000309996 p.A1545V RCE1 chr11 66845223 66845225 In_Frame_Del TCT TCT - TCGA-HT-8564-01A-11D-2395-08 ENST00000309657 p.F227del KDM2A chr11 67245321 67245321 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000529006 p.R566W TBX10 chr11 67634902 67634902 Frame_Shift_Del G G - TCGA-HT-8564-01A-11D-2395-08 ENST00000335385 p.F98Sfs*3 SUV420H1 chr11 68157805 68157805 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000304363 p.D847D MRGPRD chr11 68980866 68980866 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000309106 p.G41R ARAP1 chr11 72713070 72713070 Intron C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000393609 PRCP chr11 82839334 82839334 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000313010 p.S338L PCF11 chr11 83166297 83166298 Frame_Shift_Del AG AG - TCGA-HT-8564-01A-11D-2395-08 ENST00000298281 p.Q467Rfs*10 AMOTL1 chr11 94821600 94821600 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000433060 p.A398T AASDHPPT chr11 106096887 106096887 Nonsense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000278618 p.R304* PCSK7 chr11 117229424 117229424 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000320934 p.R141C DSCAML1 chr11 117481977 117481977 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000321322 p.V909I ABCG4 chr11 119158918 119158918 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000615496 p.V476M ZNF202 chr11 123726282 123726282 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000336139 p.A554A KCNA1 chr12 4912224 4912224 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000382545 p.G282G CLSTN3 chr12 7157527 7157527 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000266546 p.V856M KLRC2 chr12 10432113 10432113 Missense_Mutation T T C TCGA-HT-8564-01A-11D-2395-08 ENST00000381902 p.K193E LRP6 chr12 12149111 12149111 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000261349 p.E1013K LINC00477 chr12 24583404 24583404 RNA C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000483544 ASUN chr12 26916177 26916177 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000261191 p.R358H CACNB3 chr12 48827719 48827721 In_Frame_Del GGA GGA - TCGA-HT-8564-01A-11D-2395-08 ENST00000301050 p.E427del DDN chr12 48999164 48999164 Missense_Mutation A A G TCGA-HT-8564-01A-11D-2395-08 ENST00000421952 p.S42P KMT2D chr12 49029133 49029133 Missense_Mutation A A G TCGA-HT-8564-01A-11D-2395-08 ENST00000301067 p.S4727P KMT2D chr12 49051419 49051419 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000301067 p.R755Q KMT2D chr12 49052138 49052138 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000301067 p.L515L POU6F1 chr12 51192402 51192402 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000333640 p.A107T KRT83 chr12 52319229 52319229 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000293670 p.V174M ITGA7 chr12 55700326 55700326 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000555728 p.Y246Y SMARCC2 chr12 56174727 56174727 Nonsense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000267064 p.R474* TIMELESS chr12 56421968 56421968 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000553532 p.R858Q MARCH9 chr12 57758744 57758744 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000266643 p.T296T USP15 chr12 62321564 62321564 Silent T T C TCGA-HT-8564-01A-11D-2395-08 ENST00000280377 p.N192N XPOT chr12 64418091 64418091 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000332707 p.T82T XPOT chr12 64431762 64431762 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000332707 p.C734Y LEMD3 chr12 65243458 65243458 Silent T T C TCGA-HT-8564-01A-11D-2395-08 ENST00000308330 p.F792F BEST3 chr12 69655204 69655204 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000330891 p.S570S CCER1 chr12 90954228 90954228 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000358859 p.P172L NT5DC3 chr12 103814966 103814966 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000392876 p.A122T TDG chr12 103982910 103982910 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000392872 p.T197M KCTD10 chr12 109451648 109451648 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000228495 p.V297M OAS1 chr12 112916688 112916689 Frame_Shift_Ins - - A TCGA-HT-8564-01A-11D-2395-08 ENST00000202917 p.N280Kfs*5 CIT chr12 119690385 119690385 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000261833 p.A1942A CIT chr12 119752135 119752135 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000261833 p.A898V RNF10 chr12 120562952 120562952 Missense_Mutation A A G TCGA-HT-8564-01A-11D-2395-08 ENST00000325954 p.E379G PITPNM2 chr12 122988817 122988817 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000320201 p.D929D NCOR2 chr12 124342025 124342025 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000405201 p.P1662P TMEM132D chr12 129081960 129081960 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000422113 p.H574H RIMBP2 chr12 130436975 130436975 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000261655 p.P641L RIMBP2 chr12 130442576 130442576 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000261655 p.T242M POLE chr12 132638057 132638057 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000320574 p.R1879C POLE chr12 132673653 132673653 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000320574 p.A427A POLE chr12 132677581 132677581 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000320574 p.H239H TEP1 chr14 20378061 20378061 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000262715 p.A1895V METTL17 chr14 20992723 20992723 Intron T T - TCGA-HT-8564-01A-11D-2395-08 ENST00000339374 RNF31 chr14 24160560 24160560 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000324103 p.R1069H RABGGTA chr14 24268590 24268590 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000216840 p.N310N KHNYN chr14 24432438 24432438 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000251343 p.A393T FBXO34 chr14 55352266 55352266 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000313833 p.R626C C14orf37 chr14 58138646 58138646 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000267485 p.G238D SPTB chr14 64787053 64787053 Missense_Mutation G A A TCGA-HT-8564-01A-11D-2395-08 ENST00000389721 p.T971M PAPLN chr14 73259352 73259352 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000554301 p.D598N GPATCH2L chr14 76201826 76201830 Frame_Shift_Del AAGAA AAGAA - TCGA-HT-8564-01A-11D-2395-08 ENST00000261530 p.K477Pfs*15 ESRRB chr14 76439483 76439483 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000380887 p.G44S RIN3 chr14 92652013 92652013 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000216487 p.V322I UNC79 chr14 93497269 93497269 Frame_Shift_Del G G - TCGA-HT-8564-01A-11D-2395-08 ENST00000393151 p.L296Cfs*25 PPP4R4 chr14 94278747 94278747 3'UTR T T - TCGA-HT-8564-01A-11D-2395-08 ENST00000304338 AK7 chr14 96398247 96398247 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000267584 p.A93V TDRD9 chr14 104024595 104024595 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000409874 p.T878M CEP170B chr14 104887760 104887760 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000414716 p.R1174Q IGHG4 chr14 105626045 105626045 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000390543 p.V8I SNORD116-19 chr15 25086531 25086531 RNA C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000384729 TJP1 chr15 29710868 29710868 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000346128 p.A1445A ZNF770 chr15 34982420 34982420 Frame_Shift_Del T T - TCGA-HT-8564-01A-11D-2395-08 ENST00000356321 p.I339Sfs*13 SQRDL chr15 45682648 45682648 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000260324 p.T345T PIGB chr15 55355392 55355392 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000164305 p.R542Q ADAMTSL3 chr15 83982554 83982554 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000286744 p.D976N ALPK3 chr15 84839701 84839701 Splice_Site G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000258888 p.X343_splice ALPK3 chr15 84859810 84859810 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000258888 p.V1536M AGBL1 chr15 86256897 86256897 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000441037 p.V214V KIF7 chr15 89633170 89633170 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000394412 p.G897S MAN2A2 chr15 90912166 90912166 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000360468 p.V745I CHD2 chr15 92946161 92946161 Missense_Mutation T T C TCGA-HT-8564-01A-11D-2395-08 ENST00000394196 p.I441T DNM1P46 chr15 99799644 99799644 RNA G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000341853 MSLN chr16 764961 764961 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000382862 p.T145T RPUSD1 chr16 786114 786114 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000007264 p.D259N TPSAB1 chr16 1242147 1242147 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000338844 p.G245G TSR3 chr16 1350177 1350179 In_Frame_Del AAG AAG - TCGA-HT-8564-01A-11D-2395-08 ENST00000007390 p.F194del RAB26 chr16 2152853 2152853 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000210187 p.H168Y ABCA3 chr16 2317754 2317754 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000301732 p.R295H NTN3 chr16 2472003 2472003 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000293973 p.A101V NTN3 chr16 2472179 2472179 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000293973 p.R160C ZNF205 chr16 3119668 3119668 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000219091 p.Y336Y TIGD7 chr16 3300677 3300677 5'UTR A A - TCGA-HT-8564-01A-11D-2395-08 ENST00000396862 ABAT chr16 8764801 8764801 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000268251 p.A171T KIAA0430 chr16 15617459 15617459 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000396368 p.R933W NDE1 chr16 15664844 15664844 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000396355 p.A22A IL21R chr16 27434393 27434393 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000337929 p.T32T SEZ6L2 chr16 29888691 29888691 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000308713 p.P296P C16orf92 chr16 30024050 30024050 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000300575 p.A114V TRIM72 chr16 31219299 31219299 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000322122 p.R166H C16orf58 chr16 31500710 31500710 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000327237 p.R146H CTD-2014E2.5 chr16 31569104 31569104 5'Flank G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000565692 CHD9 chr16 53156166 53156166 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000398510 p.A26V CHD9 chr16 53226394 53226395 Frame_Shift_Ins - - A TCGA-HT-8564-01A-11D-2395-08 ENST00000398510 p.Y645Ifs*11 CDH5 chr16 66390557 66390557 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000341529 p.P312P TRADD chr16 67154752 67154752 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000345057 p.R279H SLC9A5 chr16 67255466 67255466 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000299798 p.G243E FAM65A chr16 67538670 67538672 In_Frame_Del AGG AGG - TCGA-HT-8564-01A-11D-2395-08 ENST00000379312 p.R39del CENPT chr16 67829811 67829811 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000440851 p.D380D DDX19A chr16 70366660 70366660 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000302243 p.S273S MARVELD3 chr16 71640911 71640911 3'Flank G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000268485 PHLPP2 chr16 71648784 71648784 3'UTR A A - TCGA-HT-8564-01A-11D-2395-08 ENST00000568954 DHX38 chr16 72096889 72096889 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000268482 p.R131C DHX38 chr16 72099812 72099812 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000268482 p.Y347Y NUDT7 chr16 77741847 77741847 Frame_Shift_Del A A - TCGA-HT-8564-01A-11D-2395-08 ENST00000268533 p.K207Nfs*14 ATMIN chr16 81043195 81043196 Frame_Shift_Del TG TG - TCGA-HT-8564-01A-11D-2395-08 ENST00000299575 p.A234Tfs*11 BCO1 chr16 81290630 81290631 3'UTR AT AT - TCGA-HT-8564-01A-11D-2395-08 ENST00000258168 CDT1 chr16 88807354 88807354 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000301019 p.R450H CBFA2T3 chr16 88892256 88892256 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000268679 p.V203V CDH15 chr16 89190405 89190405 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000289746 p.R381W SGSM2 chr17 2362216 2362216 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000426855 p.A135V OR1D2 chr17 3092482 3092482 Missense_Mutation C T T TCGA-HT-8564-01A-11D-2395-08 ENST00000331459 p.R172Q ZZEF1 chr17 4096690 4096690 Silent C T T TCGA-HT-8564-01A-11D-2395-08 ENST00000381638 p.T561T CHRNE chr17 4901104 4901104 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000293780 p.V230I GPS2 chr17 7313613 7313616 Frame_Shift_Del AGTG AGTG - TCGA-HT-8564-01A-11D-2395-08 ENST00000380728 p.H196Mfs*148 TP53 chr17 7673820 7673820 Missense_Mutation C T T TCGA-HT-8564-01A-11D-2395-08 ENST00000269305 p.R267Q TP53 chr17 7675145 7675145 Missense_Mutation C T T TCGA-HT-8564-01A-11D-2395-08 ENST00000269305 p.R156H ALOX12B chr17 8080990 8080990 Intron C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000319144 PFAS chr17 8264333 8264333 Missense_Mutation G A A TCGA-HT-8564-01A-11D-2395-08 ENST00000314666 p.R638Q MYH8 chr17 10396552 10396552 Splice_Site C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000403437 p.X1510_splice DNAH9 chr17 11757564 11757564 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000262442 p.P2289P TRPV2 chr17 16433652 16433652 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000338560 p.V690I TRPV2 chr17 16436995 16436998 3'UTR ACTA ACTA - TCGA-HT-8564-01A-11D-2395-08 ENST00000338560 ALDH3A1 chr17 19738336 19738336 Frame_Shift_Del G G - TCGA-HT-8564-01A-11D-2395-08 ENST00000225740 p.P445Rfs*6 NEK8 chr17 28738171 28738171 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000268766 p.R383H NF1 chr17 31235639 31235642 Frame_Shift_Del TGTT TGTT - TCGA-HT-8564-01A-11D-2395-08 ENST00000358273 p.F1247Ifs*18 FBXL20 chr17 39264217 39264218 Frame_Shift_Del AT AT - TCGA-HT-8564-01A-11D-2395-08 ENST00000264658 p.Y387* ERBB2 chr17 39709845 39709845 Missense_Mutation C T T TCGA-HT-8564-01A-11D-2395-08 ENST00000269571 p.R203C KRT10 chr17 40822329 40822329 Missense_Mutation C T T TCGA-HT-8564-01A-11D-2395-08 ENST00000269576 p.R86H KRTAP4-11 chr17 41118055 41118055 Silent G G T TCGA-HT-8564-01A-11D-2395-08 ENST00000391413 p.P87P KLHL11 chr17 41855293 41855293 Frame_Shift_Del A A - TCGA-HT-8564-01A-11D-2395-08 ENST00000319121 p.C192Vfs*20 TUBG1 chr17 42614549 42614549 Silent G A A TCGA-HT-8564-01A-11D-2395-08 ENST00000251413 p.P350P PLEKHH3 chr17 42668224 42668226 In_Frame_Del GGA GGA - TCGA-HT-8564-01A-11D-2395-08 ENST00000591022 p.P762del FMNL1 chr17 45237576 45237576 Silent G G T TCGA-HT-8564-01A-11D-2395-08 ENST00000331495 p.A277A ZNF652 chr17 49298396 49298396 3'UTR C T T TCGA-HT-8564-01A-11D-2395-08 ENST00000362063 ITGA3 chr17 50080372 50080372 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000320031 p.I939I EPN3 chr17 50539240 50539240 Silent C T T TCGA-HT-8564-01A-11D-2395-08 ENST00000268933 p.A272A USP32 chr17 60181672 60181672 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000300896 p.R1400R ERN1 chr17 64066706 64066706 Silent C T T TCGA-HT-8564-01A-11D-2395-08 ENST00000433197 p.P269P COG1 chr17 73208244 73208245 Intron CG CG - TCGA-HT-8564-01A-11D-2395-08 ENST00000299886 BTBD17 chr17 74356885 74356885 Silent G A A TCGA-HT-8564-01A-11D-2395-08 ENST00000375366 p.D403D BTBD17 chr17 74357215 74357215 Silent G A A TCGA-HT-8564-01A-11D-2395-08 ENST00000375366 p.H293H QRICH2 chr17 76293249 76293249 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000262765 p.R327H DNAH17 chr17 78561925 78561925 Missense_Mutation G A A TCGA-HT-8564-01A-11D-2395-08 ENST00000389840 p.A542V HGS chr17 81693685 81693687 In_Frame_Del AGG AGG - TCGA-HT-8564-01A-11D-2395-08 ENST00000329138 p.E262del EPB41L3 chr18 5423407 5423407 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000341928 p.R437H NPC1 chr18 23534488 23534488 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000269228 p.R1183R RNF125 chr18 32068328 32068328 Nonsense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000217740 p.R215* ZNF516 chr18 76442001 76442001 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000443185 p.A352T ADNP2 chr18 80138543 80138543 Frame_Shift_Del A A - TCGA-HT-8564-01A-11D-2395-08 ENST00000262198 p.K1045Nfs*29 PALM chr19 746408 746408 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000338448 p.A253V CSNK1G2 chr19 1954181 1954181 Intron G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000255641 SHD chr19 4290597 4290597 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000543264 p.L329L PTPRS chr19 5244098 5244098 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000357368 p.R458H PTPRS chr19 5286151 5286151 5'UTR G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000357368 DUS3L chr19 5786839 5786839 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000309061 p.G466S ACSBG2 chr19 6190717 6190717 Intron C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000586696 VAV1 chr19 6772856 6772856 Missense_Mutation C C G TCGA-HT-8564-01A-11D-2395-08 ENST00000602142 p.L17V MCOLN1 chr19 7529184 7529186 In_Frame_Del CTT CTT - TCGA-HT-8564-01A-11D-2395-08 ENST00000264079 p.F408del PNPLA6 chr19 7554588 7554588 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000414982 p.A843A FBN3 chr19 8123531 8123531 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000270509 p.T1005T FBN3 chr19 8136301 8136301 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000270509 p.E452K MYO1F chr19 8536365 8536365 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000338257 p.R644W ZNF559 chr19 9342979 9342979 Nonsense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000393883 p.R510* ZGLP1 chr19 10308576 10308576 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000403903 p.R36C CNN1 chr19 11549753 11549753 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000252456 p.P284P MAN2B1 chr19 12657488 12657488 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000456935 p.N459N TNPO2 chr19 12706303 12706303 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000425528 p.D521N SLC1A6 chr19 14962048 14962048 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000221742 p.D297N PGLYRP2 chr19 15469645 15469645 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000340880 p.P543L OR10H1 chr19 15807846 15807846 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000334920 p.C64C KCNN1 chr19 17982111 17982111 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000222249 p.V301M TSSK6 chr19 19514894 19514894 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000585580 p.A178A CILP2 chr19 19544373 19544373 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000291495 p.V610M AC078899.1 chr19 20257753 20257753 RNA G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000521432 CCNE1 chr19 29823851 29823851 3'UTR G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000262643 CD22 chr19 35332871 35332871 Missense_Mutation G G T TCGA-HT-8564-01A-11D-2395-08 ENST00000085219 p.R120M KMT2B chr19 35725763 35725763 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000420124 p.P1277L CAPNS1 chr19 36149857 36149857 3'UTR G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000246533 GGN chr19 38385726 38385726 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000334928 p.S512S LGALS4 chr19 38808942 38808942 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000307751 p.F47F NCCRP1 chr19 39200710 39200710 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000339852 p.R261Q PRX chr19 40407917 40407917 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000324001 p.R6W RPS19 chr19 41871392 41871392 3'UTR G G T TCGA-HT-8564-01A-11D-2395-08 ENST00000593863 LIPE chr19 42408257 42408257 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000244289 p.H495H PSG8 chr19 42755113 42755113 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000306511 p.R288Q PPP1R13L chr19 45382569 45382569 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000360957 p.A802A PGLYRP1 chr19 46019629 46019629 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000008938 p.D102D GRIN2D chr19 48405316 48405316 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000263269 p.A350T SPIB chr19 50422887 50422887 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000595883 p.P63P ZNF841 chr19 52066273 52066273 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000426391 p.G421R BIRC8 chr19 53290616 53290616 5'UTR G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000426466 LILRB4 chr19 54663859 54663859 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000391736 p.R59H NLRP7 chr19 54940062 54940062 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000340844 p.D253N NLRP2 chr19 54982267 54982267 Missense_Mutation A A T TCGA-HT-8564-01A-11D-2395-08 ENST00000448584 p.K190M NLRP2 chr19 54983514 54983514 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000448584 p.L606F SBK2 chr19 55529934 55529934 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000344158 p.A282A ZNF416 chr19 57573502 57573502 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000196489 p.A134A ZSCAN18 chr19 58084781 58084781 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000240727 p.P479P PCED1A chr20 2839881 2839881 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000360652 p.R11H MAVS chr20 3864392 3864394 In_Frame_Del CTC CTC - TCGA-HT-8564-01A-11D-2395-08 ENST00000428216 p.S258del BFSP1 chr20 17508983 17508983 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000377873 p.T214M PLAGL2 chr20 32202084 32202084 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000246229 p.R32Q DNMT3B chr20 32780455 32780455 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000328111 p.P44P BPIFB4 chr20 33083872 33083872 Splice_Region G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000375483 p.T225T DYNLRB1 chr20 34534756 34534756 Nonsense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000357156 p.R70* DHX35 chr20 39030711 39030711 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000252011 p.R631C GTSF1L chr20 43726332 43726332 Frame_Shift_Del A A - TCGA-HT-8564-01A-11D-2395-08 ENST00000373003 p.P122Lfs*50 CDH22 chr20 46210354 46210354 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000372262 p.V413V SLC13A3 chr20 46589190 46589190 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000279027 p.R329Q PREX1 chr20 48650141 48650141 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000371941 p.P961P ZNF831 chr20 59194085 59194085 Frame_Shift_Del G G - TCGA-HT-8564-01A-11D-2395-08 ENST00000371030 p.D1025Tfs*40 CDH4 chr20 61928251 61928251 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000614565 p.N611N CDH4 chr20 61929632 61929632 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000614565 p.R677C TAF4 chr20 61999009 61999009 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000252996 p.R963W SLCO4A1 chr20 62657000 62657000 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000217159 p.T182T HELZ2 chr20 63564166 63564166 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000467148 p.L1552L RTEL1-TNFRSF6B chr20 63697062 63697064 In_Frame_Del GAG GAG - TCGA-HT-8564-01A-11D-2395-08 ENST00000622743 p.E101del ABHD16B chr20 63861862 63861862 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000369916 p.R108C SON chr21 33551261 33551261 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000356577 p.S677L PRDM15 chr21 41810179 41810179 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000269844 p.R1242Q SLC19A1 chr21 45531617 45531617 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000311124 p.A241T SLC19A1 chr21 45531908 45531908 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000311124 p.V144M COL6A1 chr21 46003536 46003536 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000361866 p.D870D DIP2A chr21 46497082 46497082 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000417564 p.S126S DIP2A chr21 46534613 46534614 Frame_Shift_Ins - - G TCGA-HT-8564-01A-11D-2395-08 ENST00000417564 p.V525Gfs*25 IL17RA chr22 17108927 17108927 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000319363 p.A570T MICAL3 chr22 17904728 17904728 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000441493 p.V126I ARVCF chr22 19973003 19973003 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000263207 p.H824H PI4KA chr22 20727818 20727818 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000255882 p.R1577W PPIL2 chr22 21693829 21693829 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000335025 p.R385C CABIN1 chr22 24083275 24083275 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000263119 p.T932T SUSD2 chr22 24185119 24185119 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000358321 p.D270N ADRBK2 chr22 25722368 25722368 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000324198 p.P662L MYO18B chr22 25768613 25768613 Missense_Mutation A A G TCGA-HT-8564-01A-11D-2395-08 ENST00000536101 p.K233E INPP5J chr22 31126457 31126457 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000331075 p.D451D YWHAH chr22 31956181 31956183 In_Frame_Del CTC CTC - TCGA-HT-8564-01A-11D-2395-08 ENST00000248975 p.L45del CSF2RB chr22 36937504 36937504 Frame_Shift_Del C C - TCGA-HT-8564-01A-11D-2395-08 ENST00000403662 p.S568Afs*130 ELFN2 chr22 37374293 37374293 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000402918 p.A414A MFNG chr22 37486041 37486041 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000356998 p.P46L SH3BP1 chr22 37655653 37655653 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000357436 p.R692H CACNA1I chr22 39647863 39647863 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000402142 p.G502R TNRC6B chr22 40266436 40266436 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000454349 p.R736C SGSM3 chr22 40407283 40407283 Silent C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000248929 p.R441R L3MBTL2 chr22 41224132 41224132 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000216237 p.R352H CELSR1 chr22 46380828 46380828 Nonsense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000262738 p.R2406* CELSR1 chr22 46410450 46410450 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000262738 p.D1627D PPP6R2 chr22 50444115 50444115 Splice_Region C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000216061 p.D950D TYMP chr22 50529227 50529227 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000252029 p.R109H SLC25A6 chrX 1386594 1386594 3'UTR C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000381401 ASMTL chrX 1418083 1418083 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000381317 p.R471H SHROOM2 chrX 9932813 9932813 Frame_Shift_Del C C - TCGA-HT-8564-01A-11D-2395-08 ENST00000380913 p.Q1179Rfs*3 FANCB chrX 14865149 14865149 Missense_Mutation C T T TCGA-HT-8564-01A-11D-2395-08 ENST00000324138 p.R121H ACOT9 chrX 23705580 23705581 Frame_Shift_Ins - - A TCGA-HT-8564-01A-11D-2395-08 ENST00000336430 p.N308Qfs*14 MAGEB6 chrX 26194233 26194233 Silent C T T TCGA-HT-8564-01A-11D-2395-08 ENST00000379034 p.N129N FAM47A chrX 34131415 34131415 Silent G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000346193 p.D288D RGN chrX 47092174 47092174 Missense_Mutation G A A TCGA-HT-8564-01A-11D-2395-08 ENST00000336169 p.E270K CACNA1F chrX 49231805 49231805 Nonsense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000376265 p.R50* GAGE2E chrX 49345911 49345911 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000621907 p.T107M DGKK chrX 50404118 50404118 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000611977 p.R337W ARHGEF9 chrX 63638083 63638083 Missense_Mutation C C T TCGA-HT-8564-01A-11D-2395-08 ENST00000253401 p.R499H HEPH chrX 66207296 66207296 Missense_Mutation G G A TCGA-HT-8564-01A-11D-2395-08 ENST00000343002 p.R798Q ZMYM3 chrX 71244360 71244360 Missense_Mutation C C A TCGA-HT-8564-01A-11D-2395-08 ENST00000314425 p.W1074C POF1B chrX 85308159 85308159 Missense_Mutation G A A TCGA-HT-8564-01A-11D-2395-08 ENST00000262753 p.R339W IL1RAPL2 chrX 105755276 105755276 Missense_Mutation T T A TCGA-HT-8564-01A-11D-2395-08 ENST00000372582 p.L431Q SLC6A14 chrX 116451604 116451605 Frame_Shift_Ins - - T TCGA-HT-8564-01A-11D-2395-08 ENST00000598581 p.S367Ffs*23 WDR44 chrX 118346435 118346437 5'UTR GAG GAG - TCGA-HT-8564-01A-11D-2395-08 ENST00000254029 STK26 chrX 132074147 132074147 Silent C T T TCGA-HT-8564-01A-11D-2395-08 ENST00000394334 p.D413D USP26 chrX 133027177 133027177 Frame_Shift_Del A A - TCGA-HT-8564-01A-11D-2395-08 ENST00000370832 p.F348Lfs*7 ZNF449 chrX 135348993 135348993 Intron A A - TCGA-HT-8564-01A-11D-2395-08 ENST00000339249 ATP11C chrX 139787173 139787175 In_Frame_Del TCT TCT - TCGA-HT-8564-01A-11D-2395-08 ENST00000327569 p.E534del GDI1 chrX 154442424 154442424 Missense_Mutation G A A TCGA-HT-8564-01A-11D-2395-08 ENST00000447750 p.S396N FAM50A chrX 154450087 154450089 In_Frame_Del GGA GGA - TCGA-HT-8564-01A-11D-2395-08 ENST00000393600 p.E297del TGIF2LY chrY 3579442 3579442 Silent C T T TCGA-HT-8564-01A-11D-2395-08 ENST00000321217 p.R66R KANK4 chr1 62263274 62263274 Missense_Mutation C C T TCGA-HT-8013-01A-11D-2395-08 ENST00000371153 p.R786H RYR2 chr1 237566750 237566750 Missense_Mutation G G A TCGA-HT-8013-01A-11D-2395-08 ENST00000366574 p.R1133H RGPD3 chr2 106424727 106424727 Silent C C T TCGA-HT-8013-01A-11D-2395-08 ENST00000409886 p.R1080R TTN chr2 178579196 178579196 Missense_Mutation C C T TCGA-HT-8013-01A-11D-2395-08 ENST00000591111 p.D20971N IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-HT-8013-01A-11D-2395-08 ENST00000345146 p.R132H POLQ chr3 121440041 121440041 Missense_Mutation C C T TCGA-HT-8013-01A-11D-2395-08 ENST00000264233 p.R2447H ESYT3 chr3 138473586 138473586 Missense_Mutation G G A TCGA-HT-8013-01A-11D-2395-08 ENST00000389567 p.R763H CNTNAP2 chr7 147132250 147132250 Frame_Shift_Del T T - TCGA-HT-8013-01A-11D-2395-08 ENST00000361727 p.L364* SMIM19 chr8 42546502 42546502 Silent C C T TCGA-HT-8013-01A-11D-2395-08 ENST00000414154 p.D10D RBM12B chr8 93733451 93733451 Missense_Mutation T T C TCGA-HT-8013-01A-11D-2395-08 ENST00000399300 p.N987S ZNF438 chr10 30845500 30845500 Missense_Mutation C C G TCGA-HT-8013-01A-11D-2395-08 ENST00000361310 p.G650R ZNF215 chr11 6956245 6956245 Missense_Mutation C C T TCGA-HT-8013-01A-11D-2395-08 ENST00000278319 p.T423I MON2 chr12 62592703 62592703 Missense_Mutation A A G TCGA-HT-8013-01A-11D-2395-08 ENST00000393630 p.D1703G SETD3 chr14 99398882 99398882 Missense_Mutation C C T TCGA-HT-8013-01A-11D-2395-08 ENST00000331768 p.E528K ERN2 chr16 23692244 23692244 Missense_Mutation G G A TCGA-HT-8013-01A-11D-2395-08 ENST00000256797 p.R778C OR1A2 chr17 3197566 3197566 Silent A A G TCGA-HT-8013-01A-11D-2395-08 ENST00000381951 p.G16G TP53 chr17 7673803 7673803 Missense_Mutation G G A TCGA-HT-8013-01A-11D-2395-08 ENST00000269305 p.R273C TP53 chr17 7674227 7674227 Missense_Mutation T T C TCGA-HT-8013-01A-11D-2395-08 ENST00000269305 p.M246V SLC25A52 chr18 31760048 31760048 Missense_Mutation G G A TCGA-HT-8013-01A-11D-2395-08 ENST00000269205 p.T215M DBNDD2 chr20 45408801 45408801 Missense_Mutation C C A TCGA-HT-8013-01A-11D-2395-08 ENST00000372720 p.P145H ATRX chrX 77683743 77683743 Nonsense_Mutation C C A TCGA-HT-8013-01A-11D-2395-08 ENST00000373344 p.E505* PGK1 chrX 78124998 78124998 Missense_Mutation C C T TCGA-HT-8013-01A-11D-2395-08 ENST00000373316 p.A354V MAMLD1 chrX 150469857 150469857 Missense_Mutation T T A TCGA-HT-8013-01A-11D-2395-08 ENST00000262858 p.M95K IL9R chrX 156004488 156004488 Missense_Mutation A A G TCGA-HT-8013-01A-11D-2395-08 ENST00000244174 p.I168V NBPF14 chr1 148572586 148572586 Missense_Mutation T T C TCGA-HT-7692-01A-12D-2253-08 ENST00000619423 p.E872G NES chr1 156672559 156672559 Silent T T C TCGA-HT-7692-01A-12D-2253-08 ENST00000368223 p.K543K OR2C3 chr1 247531770 247531770 Missense_Mutation C C T TCGA-HT-7692-01A-12D-2253-08 ENST00000366487 p.V248M IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-HT-7692-01A-12D-2253-08 ENST00000345146 p.R132H PTX3 chr3 157436940 157436942 In_Frame_Del CTC CTC - TCGA-HT-7692-01A-12D-2253-08 ENST00000295927 p.L4del PIK3CA chr3 179218307 179218307 Missense_Mutation A A G TCGA-HT-7692-01A-12D-2253-08 ENST00000263967 p.Q546R SH3RF1 chr4 169096532 169096539 Frame_Shift_Del ACAAAGCT ACAAAGCT - TCGA-HT-7692-01A-12D-2253-08 ENST00000284637 p.S883Gfs*46 BNIP1 chr5 173160002 173160002 Silent G G A TCGA-HT-7692-01A-12D-2253-08 ENST00000351486 p.R147R SPATA31E1 chr9 87886928 87886928 Missense_Mutation G G A TCGA-HT-7692-01A-12D-2253-08 ENST00000325643 p.G814E FBXO18 chr10 5937165 5937165 Missense_Mutation G G A TCGA-HT-7692-01A-12D-2253-08 ENST00000362091 p.R1006H FGFR2 chr10 121496653 121496653 Missense_Mutation G G T TCGA-HT-7692-01A-12D-2253-08 ENST00000358487 p.P581Q MUC5B chr11 1249686 1249686 Missense_Mutation C C T TCGA-HT-7692-01A-12D-2253-08 ENST00000529681 p.P4269L SAA2-SAA4 chr11 18231662 18231662 Missense_Mutation C C T TCGA-HT-7692-01A-12D-2253-08 ENST00000524555 p.R156H FSHB chr11 30231887 30231887 Intron T T C TCGA-HT-7692-01A-12D-2253-08 ENST00000254122 OR5A1 chr11 59443949 59443949 Missense_Mutation G G A TCGA-HT-7692-01A-12D-2253-08 ENST00000302030 p.V261M PPP6R3 chr11 68569889 68569889 Silent T T C TCGA-HT-7692-01A-12D-2253-08 ENST00000393800 p.L424L PFDN5 chr12 53295451 53295451 5'Flank G G A TCGA-HT-7692-01A-12D-2253-08 ENST00000334478 SHBG chr17 7632012 7632012 Silent T T C TCGA-HT-7692-01A-12D-2253-08 ENST00000380450 p.D283D TNFRSF13B chr17 16948834 16948834 Missense_Mutation C C T TCGA-HT-7692-01A-12D-2253-08 ENST00000261652 p.E117K PPAN-P2RY11 chr19 10113638 10113638 Nonsense_Mutation A A T TCGA-HT-7692-01A-12D-2253-08 ENST00000393796 p.K429* FDX1L chr19 10310938 10310938 Missense_Mutation C C T TCGA-HT-7692-01A-12D-2253-08 ENST00000393708 p.A104T CSRP2BP chr20 18187444 18187444 Silent G G A TCGA-HT-7692-01A-12D-2253-08 ENST00000435364 p.L778L CNBD2 chr20 36030577 36030577 Missense_Mutation T T C TCGA-HT-7692-01A-12D-2253-08 ENST00000373973 p.Y554H SLC5A3 chr21 34095933 34095933 Silent A A G TCGA-HT-7692-01A-12D-2253-08 ENST00000381151 p.K245K PIGP chr21 37072626 37072626 5'UTR C C G TCGA-HT-7692-01A-12D-2253-08 ENST00000464265 LRRC7 chr1 70038491 70038491 Silent G A A TCGA-DB-5279-01A-01D-1468-08 ENST00000035383 p.P851P NEGR1 chr1 72282427 72282427 Missense_Mutation C C T TCGA-DB-5279-01A-01D-1468-08 ENST00000357731 p.S23N ENSA chr1 150627488 150627488 Silent G G A TCGA-DB-5279-01A-01D-1468-08 ENST00000369014 p.L54L NUP210L chr1 154089458 154089458 Missense_Mutation G G A TCGA-DB-5279-01A-01D-1468-08 ENST00000368559 p.A775V FCRL5 chr1 157521289 157521289 Missense_Mutation G G A TCGA-DB-5279-01A-01D-1468-08 ENST00000361835 p.P748L NCF2 chr1 183574488 183574488 Nonsense_Mutation C C T TCGA-DB-5279-01A-01D-1468-08 ENST00000367535 p.W167* ESRRG chr1 216651011 216651011 Missense_Mutation C C T TCGA-DB-5279-01A-01D-1468-08 ENST00000408911 p.R184H REG3G chr2 79026791 79026791 Missense_Mutation A A G TCGA-DB-5279-01A-01D-1468-08 ENST00000272324 p.Y52C SPOPL chr2 138550912 138550912 Silent G G A TCGA-DB-5279-01A-01D-1468-08 ENST00000280098 p.R70R ITGA6 chr2 172501872 172501872 Intron A A T TCGA-DB-5279-01A-01D-1468-08 ENST00000442250 IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-DB-5279-01A-01D-1468-08 ENST00000345146 p.R132H SUMF1 chr3 4449326 4449326 Silent G G A TCGA-DB-5279-01A-01D-1468-08 ENST00000272902 p.G153G RBM6 chr3 50061979 50061979 Silent C C T TCGA-DB-5279-01A-01D-1468-08 ENST00000266022 p.P819P MCCC1 chr3 183041742 183041742 Silent T T C TCGA-DB-5279-01A-01D-1468-08 ENST00000265594 p.A364A LRCH3 chr3 197832309 197832309 Missense_Mutation A A G TCGA-DB-5279-01A-01D-1468-08 ENST00000425562 p.N365S KIAA1109 chr4 122271109 122271109 Missense_Mutation G G A TCGA-DB-5279-01A-01D-1468-08 ENST00000264501 p.V2529M PIK3R1 chr5 68293310 68293310 Missense_Mutation G G A TCGA-DB-5279-01A-01D-1468-08 ENST00000521381 p.G376R ZCCHC9 chr5 81311248 81311251 Frame_Shift_Del AAAG AAAG - TCGA-DB-5279-01A-01D-1468-08 ENST00000254037 p.K224Ifs*21 NREP chr5 111730852 111730852 3'UTR T T A TCGA-DB-5279-01A-01D-1468-08 ENST00000257435 PCDHB3 chr5 141102255 141102255 Missense_Mutation C C T TCGA-DB-5279-01A-01D-1468-08 ENST00000231130 p.R536C PCDHGA1 chr5 141332260 141332260 Missense_Mutation C C T TCGA-DB-5279-01A-01D-1468-08 ENST00000517417 p.R526W GRPEL2 chr5 149348279 149348279 Missense_Mutation C C T TCGA-DB-5279-01A-01D-1468-08 ENST00000329271 p.P29S NEDD9 chr6 11190764 11190764 Missense_Mutation A A G TCGA-DB-5279-01A-01D-1468-08 ENST00000379446 p.S369P GPX6 chr6 28504328 28504328 Silent G G A TCGA-DB-5279-01A-01D-1468-08 ENST00000361902 p.D210D PAQR8 chr6 52403503 52403503 Missense_Mutation C C T TCGA-DB-5279-01A-01D-1468-08 ENST00000360726 p.A97V SIM1 chr6 100393755 100393755 Silent G G A TCGA-DB-5279-01A-01D-1468-08 ENST00000262901 p.C434C CCDC126 chr7 23611188 23611188 5'UTR C C A TCGA-DB-5279-01A-01D-1468-08 ENST00000307471 SLA chr8 133038610 133038610 Nonsense_Mutation G G A TCGA-DB-5279-01A-01D-1468-08 ENST00000338087 p.R249* JAK2 chr9 5090496 5090496 Nonsense_Mutation C T T TCGA-DB-5279-01A-01D-1468-08 ENST00000381652 p.R938* CDKN2B chr9 22008681 22008681 Intron C T T TCGA-DB-5279-01A-01D-1468-08 ENST00000276925 CKS2 chr9 89311312 89311312 Missense_Mutation A A G TCGA-DB-5279-01A-01D-1468-08 ENST00000314355 p.Y7C RPL7A chr9 133350301 133350301 Silent C C T TCGA-DB-5279-01A-01D-1468-08 ENST00000323345 p.H159H PTEN chr10 87965537 87965537 3'UTR T T - TCGA-DB-5279-01A-01D-1468-08 ENST00000371953 MRVI1 chr11 10593575 10593575 Missense_Mutation C C T TCGA-DB-5279-01A-01D-1468-08 ENST00000423302 p.V698I HTR3A chr11 113981309 113981309 Missense_Mutation A A T TCGA-DB-5279-01A-01D-1468-08 ENST00000504030 p.E124V MIPEP chr13 23837606 23837606 Missense_Mutation T T C TCGA-DB-5279-01A-01D-1468-08 ENST00000382172 p.M497V FRY chr13 32237621 32237621 Missense_Mutation C C G TCGA-DB-5279-01A-01D-1468-08 ENST00000542859 p.T2018S NBEA chr13 35349106 35349106 Splice_Site A A G TCGA-DB-5279-01A-01D-1468-08 ENST00000400445 p.X1968_splice RTN1 chr14 59630590 59630590 Intron G G A TCGA-DB-5279-01A-01D-1468-08 ENST00000267484 SNORD115-16 chr15 25199528 25199528 RNA C C A TCGA-DB-5279-01A-01D-1468-08 ENST00000363887 TJP1 chr15 29732694 29732694 Missense_Mutation C C T TCGA-DB-5279-01A-01D-1468-08 ENST00000346128 p.D620N ZNF592 chr15 84783381 84783381 Nonsense_Mutation C C T TCGA-DB-5279-01A-01D-1468-08 ENST00000299927 p.R236* GNG13 chr16 798693 798693 3'UTR G G A TCGA-DB-5279-01A-01D-1468-08 ENST00000248150 CIITA chr16 10903880 10903880 Nonsense_Mutation C C T TCGA-DB-5279-01A-01D-1468-08 ENST00000324288 p.R308* TRPV3 chr17 3554746 3554746 Silent G G A TCGA-DB-5279-01A-01D-1468-08 ENST00000576742 p.T35T ATP8B3 chr19 1785267 1785267 Silent G G A TCGA-DB-5279-01A-01D-1468-08 ENST00000310127 p.L1142L SAFB2 chr19 5587928 5587928 Missense_Mutation G G A TCGA-DB-5279-01A-01D-1468-08 ENST00000252542 p.R860C MAG chr19 35311939 35311939 Silent C T T TCGA-DB-5279-01A-01D-1468-08 ENST00000392213 p.P546P ZNF546 chr19 40014804 40014804 Missense_Mutation C C G TCGA-DB-5279-01A-01D-1468-08 ENST00000347077 p.L512V SLC17A7 chr19 49430588 49430588 Silent C C T TCGA-DB-5279-01A-01D-1468-08 ENST00000221485 p.P538P CYP24A1 chr20 54162800 54162800 Missense_Mutation A A T TCGA-DB-5279-01A-01D-1468-08 ENST00000216862 p.C303S TPST2 chr22 26541316 26541316 Silent G G A TCGA-DB-5279-01A-01D-1468-08 ENST00000338754 p.R105R MICALL1 chr22 37927445 37927445 Silent G G A TCGA-DB-5279-01A-01D-1468-08 ENST00000215957 p.P500P RNPEP chr1 202003304 202003304 Silent G G T TCGA-DU-8166-01A-11D-2253-08 ENST00000295640 p.G498G USH2A chr1 215813831 215813831 Missense_Mutation A A G TCGA-DU-8166-01A-11D-2253-08 ENST00000307340 p.V3215A IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-DU-8166-01A-11D-2253-08 ENST00000345146 p.R132H KIF1A chr2 240743942 240743942 Missense_Mutation C C T TCGA-DU-8166-01A-11D-2253-08 ENST00000320389 p.S1094N TRIM15 chr6 30170518 30170518 Missense_Mutation T T C TCGA-DU-8166-01A-11D-2253-08 ENST00000376694 p.F250S CD109 chr6 73762420 73762420 Silent G G A TCGA-DU-8166-01A-11D-2253-08 ENST00000287097 p.T265T WBSCR17 chr7 71421080 71421080 Missense_Mutation G G A TCGA-DU-8166-01A-11D-2253-08 ENST00000333538 p.A313T CHCHD7 chr8 56212824 56212824 Intron G G T TCGA-DU-8166-01A-11D-2253-08 ENST00000355315 SLIT1 chr10 97164852 97164852 Missense_Mutation T T C TCGA-DU-8166-01A-11D-2253-08 ENST00000266058 p.N79S ARHGAP32 chr11 128970429 128970429 Missense_Mutation C C T TCGA-DU-8166-01A-11D-2253-08 ENST00000310343 p.R1581Q GPR180 chr13 94623183 94623183 Silent G G C TCGA-DU-8166-01A-11D-2253-08 ENST00000376958 p.G323G SLC9A5 chr16 67271010 67271010 Silent C C T TCGA-DU-8166-01A-11D-2253-08 ENST00000299798 p.L831L TP53 chr17 7673803 7673803 Missense_Mutation G A A TCGA-DU-8166-01A-11D-2253-08 ENST00000269305 p.R273C TTLL9 chr20 31898565 31898565 Missense_Mutation A A C TCGA-DU-8166-01A-11D-2253-08 ENST00000375938 p.D69A PAXBP1 chr21 32741559 32741560 Intron - - T TCGA-DU-8166-01A-11D-2253-08 ENST00000331923 SEZ6L chr22 26311863 26311863 Missense_Mutation A A G TCGA-DU-8166-01A-11D-2253-08 ENST00000248933 p.T593A FAM47C chrX 37011604 37011604 3'UTR T T A TCGA-DU-8166-01A-11D-2253-08 ENST00000358047 ATRX chrX 77684595 77684595 Splice_Site T T C TCGA-DU-8166-01A-11D-2253-08 ENST00000373344 p.X221_splice CT55 chrX 135169771 135169771 Silent G G C TCGA-DU-8166-01A-11D-2253-08 ENST00000276241 p.T34T PRAMEF8 chr1 13281662 13281662 Silent G G T TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000357367 p.L378L SLC1A7 chr1 53105729 53105729 Splice_Region C C A TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000371494 LRRC7 chr1 70023257 70023257 Missense_Mutation G G T TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000035383 p.Q521H FLG chr1 152309491 152309491 Missense_Mutation C C A TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000368799 p.D1799Y PTPN14 chr1 214383389 214383389 Missense_Mutation T T A TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000366956 p.K822N LTBP1 chr2 33187033 33187033 Nonsense_Mutation C C G TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000404816 p.S460* EPM2AIP1 chr3 36991382 36991382 Nonsense_Mutation G G A TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000322716 p.R566* FSTL1 chr3 120404894 120404894 Silent A A G TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000295633 p.N180N UGT2A1 chr4 69594550 69594550 Missense_Mutation C C A TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000503640 p.V411L CSN3 chr4 70249143 70249143 Missense_Mutation G G A TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000304954 p.R78H KIAA1109 chr4 122229956 122229956 Missense_Mutation G G A TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000264501 p.C1023Y ICE1 chr5 5463681 5463681 Silent T T A TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000296564 p.P1449P EMB chr5 50428160 50428160 Missense_Mutation A A T TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000303221 p.H60Q ATF6B chr6 32121344 32121344 Silent G G C TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000375203 p.V161V IL17F chr6 52237035 52237035 Missense_Mutation C C T TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000336123 p.V130I HMGCLL1 chr6 55541835 55541835 Missense_Mutation A A G TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000398661 p.V94A EPB41L2 chr6 130890368 130890368 Missense_Mutation C C G TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000337057 p.S529T UTRN chr6 144488747 144488747 Missense_Mutation G G C TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000367545 p.L1349F UNC93A chr6 167291487 167291487 5'UTR A A G TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000230256 HECW1 chr7 43552257 43552257 Silent C C T TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000395891 p.A1477A EGFR chr7 55142382 55142382 Missense_Mutation T T G TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000275493 p.L62R ZNF479 chr7 57120147 57120147 Missense_Mutation G G T TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000319636 p.T423N ZNF479 chr7 57126702 57126702 Missense_Mutation C C G TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000319636 p.R19T NCF1B chr7 73225918 73225918 Intron G G A TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000423083 ZAN chr7 100752070 100752070 Silent C C T TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000613979 p.T655T ARHGEF34P chr7 144276379 144276379 RNA C C A TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000483587 ADAM2 chr8 39788251 39788251 Missense_Mutation T T C TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000265708 p.I215V RGS22 chr8 99977932 99977932 Silent G G A TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000360863 p.D1168D SPATA31A1 chr9 39358822 39358822 Nonsense_Mutation C C T TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000625870 p.R353* GRIN1 chr9 137145867 137145867 Missense_Mutation C C T TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000371561 p.R179C OR4C6 chr11 55665898 55665898 Silent G G T TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000314259 p.V244V KRT2 chr12 52651724 52651724 Missense_Mutation C C T TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000309680 p.G140D AGAP2 chr12 57742020 57742020 5'Flank G A A TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000547588 NAA25 chr12 112061276 112061276 Missense_Mutation G G A TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000261745 p.T421M RALGAPA1 chr14 35678097 35678097 Nonsense_Mutation C C A TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000389698 p.E987* SIPA1L1 chr14 71588823 71588823 Silent A A G TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000555818 p.R317R CKMT1A chr15 43698749 43698749 Nonsense_Mutation C C T TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000413453 p.R374* MYO5C chr15 52239841 52239841 Silent G G A TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000261839 p.Y865Y GOLGA6C chr15 75264001 75264001 Missense_Mutation G G A TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000300576 p.R161H CCDC64B chr16 3035530 3035530 5'UTR C C T TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000389347 CDYL2 chr16 80612797 80612797 Silent G G A TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000570137 p.I349I ALOX12 chr17 7010353 7010353 Missense_Mutation G G A TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000251535 p.R641Q KRT15 chr17 41516942 41516942 Missense_Mutation G G A TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000254043 p.R202C CD300C chr17 74544888 74544888 Missense_Mutation C C T TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000330793 p.V41M ANKRD30B chr18 14791433 14791433 Silent G G C TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000358984 p.V589V TBC1D10A chr22 30292403 30292403 Missense_Mutation G G C TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000215790 p.S500C FAM47C chrX 37011388 37011388 Missense_Mutation T T C TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000358047 p.M993T DOCK11 chrX 118605337 118605337 Missense_Mutation G G A TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000276202 p.V888I RBMY1E chrY 21906457 21906457 Missense_Mutation C C T TCGA-S9-A7R2-01A-21D-A34J-08 ENST00000382659 p.S261N FPGT chr1 74205215 74205215 Missense_Mutation C C A TCGA-DU-6407-01A-13D-1705-08 ENST00000370898 p.P403T CYP26B1 chr2 72132457 72132457 Missense_Mutation C C T TCGA-DU-6407-01A-13D-1705-08 ENST00000001146 p.G437S PDK1 chr2 172558797 172558797 Missense_Mutation C C G TCGA-DU-6407-01A-13D-1705-08 ENST00000282077 p.L96V IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-DU-6407-01A-13D-1705-08 ENST00000345146 p.R132H LMCD1 chr3 8548753 8548753 Silent C C T TCGA-DU-6407-01A-13D-1705-08 ENST00000157600 p.S191S MRPL47 chr3 179604625 179604625 5'UTR G G A TCGA-DU-6407-01A-13D-1705-08 ENST00000476781 FAM134B chr5 16475065 16475065 Silent C C T TCGA-DU-6407-01A-13D-1705-08 ENST00000306320 p.T390T IGF2R chr6 160080210 160080210 Missense_Mutation C C T TCGA-DU-6407-01A-13D-1705-08 ENST00000356956 p.A1923V GATA3 chr10 8058474 8058474 Silent G G A TCGA-DU-6407-01A-13D-1705-08 ENST00000346208 p.S137S CAMK1D chr10 12761042 12761042 Missense_Mutation G G A TCGA-DU-6407-01A-13D-1705-08 ENST00000619168 p.V132M RN7SL248P chr10 46650917 46650917 3'Flank T T G TCGA-DU-6407-01A-13D-1705-08 ENST00000615117 HPS1 chr10 98425676 98425676 Missense_Mutation A A C TCGA-DU-6407-01A-13D-1705-08 ENST00000325103 p.D400E CBX5 chr12 54241852 54241852 Missense_Mutation C C T TCGA-DU-6407-01A-13D-1705-08 ENST00000209875 p.C160Y MIPEP chr13 23870060 23870060 Missense_Mutation C C T TCGA-DU-6407-01A-13D-1705-08 ENST00000382172 p.D247N ZDHHC7 chr16 84976440 84976440 Missense_Mutation C C T TCGA-DU-6407-01A-13D-1705-08 ENST00000313732 p.G277E TP53 chr17 7676044 7676044 Missense_Mutation A C C TCGA-DU-6407-01A-13D-1705-08 ENST00000269305 p.F109V ACACA chr17 37283272 37283272 Missense_Mutation T T C TCGA-DU-6407-01A-13D-1705-08 ENST00000616317 p.N202S HNF1B chr17 37699190 37699190 Silent G G A TCGA-DU-6407-01A-13D-1705-08 ENST00000617811 p.Y513Y HELZ chr17 67109561 67109561 Silent A A G TCGA-DU-6407-01A-13D-1705-08 ENST00000358691 p.A1348A HOMER3 chr19 18929290 18929290 3'UTR G G A TCGA-DU-6407-01A-13D-1705-08 ENST00000392351 USP25 chr21 15874500 15874500 Missense_Mutation T T C TCGA-DU-6407-01A-13D-1705-08 ENST00000285679 p.S925P CFAP47 chrX 36073238 36073238 Missense_Mutation C C A TCGA-DU-6407-01A-13D-1705-08 ENST00000378653 p.S1437Y ATRX chrX 77683848 77683851 Frame_Shift_Del CTAC CTAC - TCGA-DU-6407-01A-13D-1705-08 ENST00000373344 p.V469Ifs*44 CASQ2 chr1 115768541 115768541 Translation_Start_Site T T C TCGA-CS-6667-01A-12D-2024-08 ENST00000261448 p.M1? WARS2 chr1 119033310 119033310 Silent C C T TCGA-CS-6667-01A-12D-2024-08 ENST00000235521 p.S228S IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-CS-6667-01A-12D-2024-08 ENST00000345146 p.R132H ABCA12 chr2 214958452 214958452 Missense_Mutation A A G TCGA-CS-6667-01A-12D-2024-08 ENST00000272895 p.I1981T CCDC108 chr2 219030827 219030827 Silent G G A TCGA-CS-6667-01A-12D-2024-08 ENST00000341552 p.C341C UGT1A3 chr2 233743747 233743747 Intron G G A TCGA-CS-6667-01A-12D-2024-08 ENST00000482026 FAM208A chr3 56660958 56660958 Missense_Mutation G G A TCGA-CS-6667-01A-12D-2024-08 ENST00000493960 p.P407L EPHA5 chr4 65335941 65335941 Missense_Mutation G G A TCGA-CS-6667-01A-12D-2024-08 ENST00000273854 p.A948V ALPK1 chr4 112441227 112441227 3'UTR G G C TCGA-CS-6667-01A-12D-2024-08 ENST00000177648 FAT4 chr4 125318174 125318174 Missense_Mutation A A G TCGA-CS-6667-01A-12D-2024-08 ENST00000394329 p.Y588C GEMIN5 chr5 154891337 154891337 Missense_Mutation T T C TCGA-CS-6667-01A-12D-2024-08 ENST00000285873 p.Q1389R GRM4 chr6 34028282 34028282 Missense_Mutation A A C TCGA-CS-6667-01A-12D-2024-08 ENST00000538487 p.Y843D RARRES2 chr7 150340103 150340103 Silent A A G TCGA-CS-6667-01A-12D-2024-08 ENST00000223271 p.N92N ASAH2 chr10 50218565 50218565 Missense_Mutation C C A TCGA-CS-6667-01A-12D-2024-08 ENST00000395526 p.G320V RAG2 chr11 36592696 36592696 Silent G G A TCGA-CS-6667-01A-12D-2024-08 ENST00000311485 p.P491P OPCML chr11 132657151 132657151 Silent C C T TCGA-CS-6667-01A-12D-2024-08 ENST00000331898 p.P112P FREM2 chr13 38880290 38880290 Missense_Mutation C C G TCGA-CS-6667-01A-12D-2024-08 ENST00000280481 p.L3005V TSC22D1 chr13 44436756 44436756 Intron G G C TCGA-CS-6667-01A-12D-2024-08 ENST00000458659 TMX1 chr14 51247137 51247137 Missense_Mutation G G C TCGA-CS-6667-01A-12D-2024-08 ENST00000457354 p.K120N VPS13C chr15 62010562 62010577 Frame_Shift_Del CATGTAGAGTTTTGCA CATGTAGAGTTTTGCA - TCGA-CS-6667-01A-12D-2024-08 ENST00000261517 p.A303Ifs*17 TP53 chr17 7674890 7674890 Missense_Mutation T T C TCGA-CS-6667-01A-12D-2024-08 ENST00000269305 p.H214R CASP14 chr19 15055256 15055256 Missense_Mutation G G A TCGA-CS-6667-01A-12D-2024-08 ENST00000427043 p.V168I WDR62 chr19 36081554 36081554 Missense_Mutation A A T TCGA-CS-6667-01A-12D-2024-08 ENST00000270301 p.K452I IL17REL chr22 49997370 49997370 Silent G G A TCGA-CS-6667-01A-12D-2024-08 ENST00000341280 p.S308S WWC3 chrX 10138839 10138839 Missense_Mutation G G A TCGA-CS-6667-01A-12D-2024-08 ENST00000380861 p.R996Q POLA1 chrX 24735444 24735444 Missense_Mutation T T A TCGA-CS-6667-01A-12D-2024-08 ENST00000379059 p.F621I DCAF8L1 chrX 27980971 27980971 Nonsense_Mutation G G A TCGA-CS-6667-01A-12D-2024-08 ENST00000441525 p.R122* ZNF157 chrX 47412850 47412850 Silent A A C TCGA-CS-6667-01A-12D-2024-08 ENST00000377073 p.A259A KCND1 chrX 48969683 48969683 Missense_Mutation C C T TCGA-CS-6667-01A-12D-2024-08 ENST00000218176 p.A197T ADAR chr1 154601644 154601644 Missense_Mutation A A C TCGA-RY-A83X-01A-11D-A36O-08 ENST00000368474 p.V333G ZNF638 chr2 71431371 71431371 Missense_Mutation C C T TCGA-RY-A83X-01A-11D-A36O-08 ENST00000264447 p.R1899C CCDC150 chr2 196676660 196676660 Nonsense_Mutation C C T TCGA-RY-A83X-01A-11D-A36O-08 ENST00000389175 p.R457* IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-RY-A83X-01A-11D-A36O-08 ENST00000345146 p.R132H ARMC9 chr2 231276738 231276738 Silent G G T TCGA-RY-A83X-01A-11D-A36O-08 ENST00000611582 p.S479S NEU2 chr2 233032851 233032851 Silent C C T TCGA-RY-A83X-01A-11D-A36O-08 ENST00000233840 p.D60D IGF2BP3 chr7 23342154 23342154 Silent G G A TCGA-RY-A83X-01A-11D-A36O-08 ENST00000258729 p.N371N AGFG2 chr7 100563870 100563870 Missense_Mutation T T C TCGA-RY-A83X-01A-11D-A36O-08 ENST00000300176 p.F403S PKHD1L1 chr8 109518246 109518246 Silent G G A TCGA-RY-A83X-01A-11D-A36O-08 ENST00000378402 p.L3923L OR13D1 chr9 104694605 104694605 Missense_Mutation C C G TCGA-RY-A83X-01A-11D-A36O-08 ENST00000318763 p.L62V ABCA1 chr9 104796397 104796397 Missense_Mutation C C T TCGA-RY-A83X-01A-11D-A36O-08 ENST00000374736 p.V1717I SVIL chr10 29533421 29533421 Missense_Mutation C C G TCGA-RY-A83X-01A-11D-A36O-08 ENST00000355867 p.A316P OR10Q1 chr11 58228281 58228281 Missense_Mutation C C T TCGA-RY-A83X-01A-11D-A36O-08 ENST00000316770 p.V199M LRIG3 chr12 58880675 58880675 Silent G G A TCGA-RY-A83X-01A-11D-A36O-08 ENST00000320743 p.R569R KRR1 chr12 75498614 75498614 3'UTR A A G TCGA-RY-A83X-01A-11D-A36O-08 ENST00000229214 UBC chr12 124912665 124912665 Silent G G A TCGA-RY-A83X-01A-11D-A36O-08 ENST00000339647 p.S369S EVPL chr17 76008126 76008126 Silent C C T TCGA-RY-A83X-01A-11D-A36O-08 ENST00000301607 p.T1693T OR10H5 chr19 15794408 15794408 Silent C C T TCGA-RY-A83X-01A-11D-A36O-08 ENST00000308940 p.Y120Y CIC chr19 42290937 42290937 Frame_Shift_Del G G - TCGA-RY-A83X-01A-11D-A36O-08 ENST00000575354 p.G724Vfs*4 PHF6 chrX 134377620 134377620 Translation_Start_Site G G C TCGA-RY-A83X-01A-11D-A36O-08 ENST00000332070 p.M1? OR2L13 chr1 248039233 248039233 Intron C C T TCGA-HT-7879-01A-11D-2395-08 ENST00000366478 STAM2 chr2 152147171 152147171 Silent T T C TCGA-HT-7879-01A-11D-2395-08 ENST00000263904 p.A146A IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-HT-7879-01A-11D-2395-08 ENST00000345146 p.R132H TBC1D9 chr4 140756011 140756011 Missense_Mutation T T C TCGA-HT-7879-01A-11D-2395-08 ENST00000442267 p.N12S RXFP1 chr4 158521914 158521914 5'UTR C C T TCGA-HT-7879-01A-11D-2395-08 ENST00000307765 CDC20B chr5 55133448 55133448 Missense_Mutation C C T TCGA-HT-7879-01A-11D-2395-08 ENST00000381375 p.V221M SCGN chr6 25652485 25652485 Missense_Mutation G G A TCGA-HT-7879-01A-11D-2395-08 ENST00000377961 p.E28K PKHD1 chr6 52033150 52033150 Missense_Mutation T T C TCGA-HT-7879-01A-11D-2395-08 ENST00000371117 p.I1082V PTBP3 chr9 112227426 112227426 Missense_Mutation T T C TCGA-HT-7879-01A-11D-2395-08 ENST00000374255 p.H478R CACNB2 chr10 18401096 18401096 Intron T T C TCGA-HT-7879-01A-11D-2395-08 ENST00000324631 GAD2 chr10 26300876 26300876 Missense_Mutation G G A TCGA-HT-7879-01A-11D-2395-08 ENST00000259271 p.R558H PMEL chr12 55956962 55956962 Silent C C T TCGA-HT-7879-01A-11D-2395-08 ENST00000548493 p.T447T CACNA1H chr16 1215549 1215549 Missense_Mutation G G A TCGA-HT-7879-01A-11D-2395-08 ENST00000348261 p.G1734S TP53 chr17 7673832 7673833 Frame_Shift_Del TT TT - TCGA-HT-7879-01A-11D-2395-08 ENST00000269305 p.N263Sfs*8 TP53 chr17 7674953 7674953 Missense_Mutation T T A TCGA-HT-7879-01A-11D-2395-08 ENST00000269305 p.H193L MLLT1 chr19 6270672 6270672 Missense_Mutation C C A TCGA-HT-7879-01A-11D-2395-08 ENST00000252674 p.V34L EWSR1 chr22 29298867 29298867 Nonsense_Mutation C C T TCGA-HT-7879-01A-11D-2395-08 ENST00000397938 p.R518* OGT chrX 71547963 71547963 Missense_Mutation T G G TCGA-HT-7879-01A-11D-2395-08 ENST00000373719 p.N196K ATRX chrX 77682509 77682509 Frame_Shift_Del G - - TCGA-HT-7879-01A-11D-2395-08 ENST00000373344 p.A916Vfs*54 IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-HW-7489-01A-11D-2024-08 ENST00000345146 p.R132H MECOM chr3 169116622 169116622 Missense_Mutation G G A TCGA-HW-7489-01A-11D-2024-08 ENST00000468789 p.T229M ZNF876P chr4 254593 254593 RNA A A C TCGA-HW-7489-01A-11D-2024-08 ENST00000356347 FAM193A chr4 2695093 2695093 Silent C C T TCGA-HW-7489-01A-11D-2024-08 ENST00000324666 p.C789C KDM3B chr5 138372750 138372750 Missense_Mutation T T A TCGA-HW-7489-01A-11D-2024-08 ENST00000314358 p.L90H GRK6 chr5 177430876 177430876 Silent C C T TCGA-HW-7489-01A-11D-2024-08 ENST00000355472 p.G19G ADAMTSL1 chr9 18776971 18776971 Silent C C T TCGA-HW-7489-01A-11D-2024-08 ENST00000380548 p.D914D MCM10 chr10 13189079 13189079 Missense_Mutation A A G TCGA-HW-7489-01A-11D-2024-08 ENST00000484800 p.I473V FAT3 chr11 92867077 92867077 Nonsense_Mutation C C T TCGA-HW-7489-01A-11D-2024-08 ENST00000525166 p.Q3849* SLCO1B1 chr12 21239159 21239159 Silent T T C TCGA-HW-7489-01A-11D-2024-08 ENST00000256958 p.S682S TRIM13 chr13 50011934 50011934 Splice_Site G G A TCGA-HW-7489-01A-11D-2024-08 ENST00000378182 TM9SF2 chr13 99562815 99562815 3'UTR A A G TCGA-HW-7489-01A-11D-2024-08 ENST00000376387 CPPED1 chr16 12704756 12704756 Missense_Mutation G G A TCGA-HW-7489-01A-11D-2024-08 ENST00000381774 p.R195W CDH16 chr16 66916164 66916164 Missense_Mutation G G A TCGA-HW-7489-01A-11D-2024-08 ENST00000299752 p.P109S C3 chr19 6709682 6709682 Splice_Site A A G TCGA-HW-7489-01A-11D-2024-08 ENST00000245907 p.X615_splice SIM2 chr21 36726226 36726226 Silent G G A TCGA-HW-7489-01A-11D-2024-08 ENST00000290399 p.L217L FRMPD4 chrX 12716145 12716145 Silent C C T TCGA-HW-7489-01A-11D-2024-08 ENST00000380682 p.G562G ATRX chrX 77683162 77683163 Frame_Shift_Ins - - T TCGA-HW-7489-01A-11D-2024-08 ENST00000373344 p.D699Gfs*2 SPAG17 chr1 118016168 118016169 Frame_Shift_Del TT TT - TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000336338 p.Q1363Vfs*6 AHCTF1 chr1 246850308 246850308 Missense_Mutation T T C TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000326225 p.S1909G VIT chr2 36808687 36808687 Missense_Mutation C C G TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000389975 p.N520K CCDC88A chr2 55334176 55334176 Missense_Mutation C C T TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000436346 p.R882H TTN chr2 178554900 178554900 Frame_Shift_Del C C - TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000591111 p.G27879Afs*27 IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000345146 p.R132H TRANK1 chr3 36838454 36838454 Missense_Mutation T T C TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000429976 p.K1768R TBL1XR1 chr3 177034216 177034216 Missense_Mutation G G C TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000430069 p.A411G UGT2B4 chr4 69489560 69489560 Missense_Mutation T T A TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000305107 p.E294V AFM chr4 73485863 73485863 Missense_Mutation A A T TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000226355 p.N91I TRIML1 chr4 188139836 188139836 Missense_Mutation G G T TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000332517 p.G93V HCN1 chr5 45645199 45645199 Missense_Mutation G G A TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000303230 p.H279Y PAM chr5 102960038 102960038 Missense_Mutation A A C TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000438793 p.M357L SYCP2L chr6 10930422 10930422 Frame_Shift_Del C C - TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000283141 p.S515Vfs*14 LMBRD1 chr6 69790426 69790426 Missense_Mutation C C T TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000370577 p.R39Q RIMS1 chr6 72179631 72179631 Silent G G C TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000521978 p.G176G SNX14 chr6 85505906 85505906 3'UTR A A G TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000314673 ROS1 chr6 117321338 117321338 Missense_Mutation T T C TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000368508 p.I1900V DFNA5 chr7 24744657 24744657 Silent C C A TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000342947 p.L103L SSC4D chr7 76404323 76404323 Silent A A T TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000275560 p.L39L FASTK chr7 151078642 151078642 Missense_Mutation G G A TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000297532 p.R249W TONSL chr8 144440453 144440453 Silent A A T TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000409379 p.I396I COL5A1 chr9 134820205 134820205 Silent C C T TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000371817 p.S1512S TRAF2 chr9 136898767 136898767 Frame_Shift_Del T T - TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000247668 p.G10Afs*76 ZNF488 chr10 47367922 47367922 Missense_Mutation G G A TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000585316 p.A303V CFAP46 chr10 132937613 132937613 Missense_Mutation G G A TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000368586 p.T200M NEU3 chr11 75006099 75006099 Silent T T A TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000294064 p.S331S TMEM126B chr11 85635799 85635799 Intron C C A TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000358867 TSPAN31 chr12 57748495 57748495 3'Flank T G G TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000257910 SPTB chr14 64766643 64766643 3'UTR C A A TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000389721 PLCB2 chr15 40302478 40302478 Silent G G A TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000260402 p.N121N PEAK1 chr15 77180057 77180057 Missense_Mutation T T C TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000312493 p.I624V DNM1P47 chr15 101752986 101752986 RNA C C T TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000561463 SCNN1G chr16 23186336 23186336 Missense_Mutation C C A TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000300061 p.A22E TP53 chr17 7673803 7673803 Missense_Mutation G A A TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000269305 p.R273C ABCA5 chr17 69253843 69253843 Missense_Mutation T T C TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000392676 p.E1424G PRR22 chr19 5783631 5783631 Silent G G A TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000419421 p.L206L PNPLA6 chr19 7550038 7550038 Silent C C A TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000414982 p.G589G OR10H5 chr19 15794565 15794565 Nonsense_Mutation G G T TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000308940 p.E173* ZNF43 chr19 21808720 21808720 Silent T T A TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000354959 p.S439S CLTCL1 chr22 19188080 19188080 Silent C C A TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000427926 p.L1445L MEI1 chr22 41718202 41718202 Missense_Mutation G G A TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000401548 p.E221K AMELX chrX 11298955 11298955 Silent G G A TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000380714 p.K184K MAOA chrX 43731266 43731266 Missense_Mutation G G C TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000338702 p.G224A ATRX chrX 77682110 77682110 Frame_Shift_Del A A - TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000373344 p.I1049Kfs*69 PCDH11X chrX 92387842 92387842 Silent C C T TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000373094 p.G1084G WDR44 chrX 118398384 118398384 Splice_Region C C G TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000254029 UBE2NL chrX 143884136 143884136 RNA C C A TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000618570 TMEM185A chrX 149608752 149608752 Missense_Mutation G G T TCGA-E1-A7YV-01A-11D-A34J-08 ENST00000600449 p.L100M GNG7 chr19 2514983 2514986 3'UTR AGAA AGAA - TCGA-FG-8189-01B-11D-A289-08 ENST00000382159 KIAA1324 chr1 109198617 109198617 Missense_Mutation C C G TCGA-HT-A616-01A-11D-A29Q-08 ENST00000369939 p.T815S BRE chr2 28310128 28310128 Intron C C G TCGA-HT-A616-01A-11D-A29Q-08 ENST00000342045 TTN chr2 178589199 178589199 Silent A A G TCGA-HT-A616-01A-11D-A29Q-08 ENST00000591111 p.Y19201Y TTN chr2 178715167 178715167 Silent G G A TCGA-HT-A616-01A-11D-A29Q-08 ENST00000591111 p.H8356H IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-HT-A616-01A-11D-A29Q-08 ENST00000345146 p.R132H CCDC54 chr3 107377770 107377770 Silent C C T TCGA-HT-A616-01A-11D-A29Q-08 ENST00000261058 p.D61D CAPN11 chr6 44176120 44176120 Missense_Mutation G G A TCGA-HT-A616-01A-11D-A29Q-08 ENST00000398776 p.G295E FAM35DP chr10 47710231 47710231 RNA A A T TCGA-HT-A616-01A-11D-A29Q-08 ENST00000323387 CCAR1 chr10 68754021 68754022 Frame_Shift_Ins - - A TCGA-HT-A616-01A-11D-A29Q-08 ENST00000265872 p.N432Kfs*6 TMX2 chr11 57712657 57712657 Silent G G A TCGA-HT-A616-01A-11D-A29Q-08 ENST00000278422 p.S13S ATG2B chr14 96311539 96311540 Splice_Site CA CA - TCGA-HT-A616-01A-11D-A29Q-08 ENST00000359933 p.X1330_splice THBS1 chr15 39592679 39592679 Nonsense_Mutation C C T TCGA-HT-A616-01A-11D-A29Q-08 ENST00000260356 p.Q882* SPINT1 chr15 40854078 40854078 Missense_Mutation G G A TCGA-HT-A616-01A-11D-A29Q-08 ENST00000344051 p.R327H ANKRD13B chr17 29612258 29612258 Missense_Mutation T T G TCGA-HT-A616-01A-11D-A29Q-08 ENST00000394859 p.F415V DSG2 chr18 31546178 31546178 Missense_Mutation G G C TCGA-HT-A616-01A-11D-A29Q-08 ENST00000261590 p.R931T RTTN chr18 70028745 70028745 Silent A A C TCGA-HT-A616-01A-11D-A29Q-08 ENST00000255674 p.L1934L PRR12 chr19 49620372 49620372 Silent C C T TCGA-HT-A616-01A-11D-A29Q-08 ENST00000615927 p.L1019L MAGEB4 chrX 30242178 30242178 Missense_Mutation C C T TCGA-HT-A616-01A-11D-A29Q-08 ENST00000378982 p.R15C ATRX chrX 77684205 77684205 Nonsense_Mutation C C A TCGA-HT-A616-01A-11D-A29Q-08 ENST00000373344 p.E351* MCF2 chrX 139629779 139629779 Missense_Mutation T T A TCGA-HT-A616-01A-11D-A29Q-08 ENST00000370576 p.E118D CD99L2 chrX 150770350 150770350 Silent G G A TCGA-HT-A616-01A-11D-A29Q-08 ENST00000370377 p.Y225Y NEGR1 chr1 72282381 72282382 Frame_Shift_Del CA CA - TCGA-DB-A64O-01A-11D-A29Q-08 ENST00000357731 p.V38Gfs*21 NLRP3 chr1 247424393 247424393 Missense_Mutation C C T TCGA-DB-A64O-01A-11D-A29Q-08 ENST00000336119 p.P317L FANCD2 chr3 10043836 10043836 Missense_Mutation A A G TCGA-DB-A64O-01A-11D-A29Q-08 ENST00000383807 p.E369G CPN2 chr3 194341791 194341791 Silent G G C TCGA-DB-A64O-01A-11D-A29Q-08 ENST00000323830 p.V304V WFS1 chr4 6302187 6302187 Missense_Mutation G G A TCGA-DB-A64O-01A-11D-A29Q-08 ENST00000226760 p.V798I GABRB2 chr5 161294223 161294223 Missense_Mutation C C T TCGA-DB-A64O-01A-11D-A29Q-08 ENST00000274547 p.R466H PHF3 chr6 63712390 63712390 Missense_Mutation A A G TCGA-DB-A64O-01A-11D-A29Q-08 ENST00000262043 p.Q1601R SPATA31A3 chr9 66988256 66988256 Missense_Mutation C C T TCGA-DB-A64O-01A-11D-A29Q-08 ENST00000428649 p.V748M HPS6 chr10 102067646 102067646 Missense_Mutation G G T TCGA-DB-A64O-01A-11D-A29Q-08 ENST00000299238 p.E724D MUC2 chr11 1082353 1082353 RNA G G A TCGA-DB-A64O-01A-11D-A29Q-08 ENST00000361558 AMOTL1 chr11 94821616 94821616 Missense_Mutation A A G TCGA-DB-A64O-01A-11D-A29Q-08 ENST00000433060 p.H403R TMEM133 chr11 100992485 100992485 Frame_Shift_Del C C - TCGA-DB-A64O-01A-11D-A29Q-08 ENST00000303130 p.K60Rfs*4 SNORD116-4 chr15 25059612 25059612 RNA G G A TCGA-DB-A64O-01A-11D-A29Q-08 ENST00000384733 CHD2 chr15 93024785 93024785 3'UTR T T G TCGA-DB-A64O-01A-11D-A29Q-08 ENST00000394196 DNM1P47 chr15 101759755 101759755 RNA C C G TCGA-DB-A64O-01A-11D-A29Q-08 ENST00000561463 MYH4 chr17 10445287 10445287 Missense_Mutation C C T TCGA-DB-A64O-01A-11D-A29Q-08 ENST00000255381 p.V1749I MYH2 chr17 10533348 10533348 Missense_Mutation C C T TCGA-DB-A64O-01A-11D-A29Q-08 ENST00000245503 p.R793Q SNORD3B-2 chr17 19064046 19064046 RNA C C T TCGA-DB-A64O-01A-11D-A29Q-08 ENST00000571722 NF1 chr17 31225198 31225198 Nonsense_Mutation T T A TCGA-DB-A64O-01A-11D-A29Q-08 ENST00000358273 p.L650* NF1 chr17 31235639 31235642 Frame_Shift_Del TGTT TGTT - TCGA-DB-A64O-01A-11D-A29Q-08 ENST00000358273 p.F1247Ifs*18 ATP9B chr18 79374067 79374067 Silent C C T TCGA-DB-A64O-01A-11D-A29Q-08 ENST00000426216 p.Y1080Y YWHAB chr20 44901762 44901762 Missense_Mutation A A C TCGA-DB-A64O-01A-11D-A29Q-08 ENST00000353703 p.K77Q SLC9A7 chrX 46651217 46651217 Missense_Mutation C C T TCGA-DB-A64O-01A-11D-A29Q-08 ENST00000328306 p.E414K AHDC1 chr1 27551460 27551460 Missense_Mutation G G A TCGA-S9-A7J3-01A-21D-A34J-08 ENST00000247087 p.T219M FUBP1 chr1 77964748 77964748 Splice_Site C C T TCGA-S9-A7J3-01A-21D-A34J-08 ENST00000370768 p.X246_splice FUBP1 chr1 77965221 77965222 Frame_Shift_Ins - - T TCGA-S9-A7J3-01A-21D-A34J-08 ENST00000370768 p.R162Tfs*8 PPIAL4A chr1 120890197 120890197 Missense_Mutation A A C TCGA-S9-A7J3-01A-21D-A34J-08 ENST00000577856 p.H126P IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-S9-A7J3-01A-21D-A34J-08 ENST00000345146 p.R132H TMEM40 chr3 12748722 12748722 Missense_Mutation G G T TCGA-S9-A7J3-01A-21D-A34J-08 ENST00000264728 p.N48K AASDH chr4 56355217 56355217 Silent A A G TCGA-S9-A7J3-01A-21D-A34J-08 ENST00000205214 p.Y356Y RBM27 chr5 146230864 146230864 Frame_Shift_Del C C - TCGA-S9-A7J3-01A-21D-A34J-08 ENST00000265271 p.N267Ifs*37 MCM7 chr7 100099619 100099619 Silent T T C TCGA-S9-A7J3-01A-21D-A34J-08 ENST00000303887 p.Q82Q KMT2C chr7 152148670 152148670 Silent T T C TCGA-S9-A7J3-01A-21D-A34J-08 ENST00000262189 p.L4419L RNF19A chr8 100274995 100274995 Missense_Mutation G G A TCGA-S9-A7J3-01A-21D-A34J-08 ENST00000341084 p.R281C USP54 chr10 73500660 73500660 Missense_Mutation A A G TCGA-S9-A7J3-01A-21D-A34J-08 ENST00000339859 p.L1497P GPAM chr10 112155796 112155796 Intron A A G TCGA-S9-A7J3-01A-21D-A34J-08 ENST00000348367 AHNAK chr11 62533559 62533559 Silent A A G TCGA-S9-A7J3-01A-21D-A34J-08 ENST00000378024 p.G286G LRRN4CL chr11 62688335 62688335 Silent C C T TCGA-S9-A7J3-01A-21D-A34J-08 ENST00000317449 p.V58V RP11-812E19.9 chr16 33844853 33844853 Missense_Mutation C C T TCGA-S9-A7J3-01A-21D-A34J-08 ENST00000569103 p.A94T CIC chr19 42287605 42287605 Missense_Mutation C C T TCGA-S9-A7J3-01A-21D-A34J-08 ENST00000575354 p.R215W ZNF334 chr20 46503051 46503052 Frame_Shift_Del AT AT - TCGA-S9-A7J3-01A-21D-A34J-08 ENST00000347606 p.H96Lfs*25 TPTE chr21 10542448 10542448 Missense_Mutation G G C TCGA-S9-A7J3-01A-21D-A34J-08 ENST00000618007 p.S40T BMX chrX 15543122 15543122 Missense_Mutation T T A TCGA-S9-A7J3-01A-21D-A34J-08 ENST00000342014 p.F555I EFHC2 chrX 44250403 44250403 Missense_Mutation C C G TCGA-S9-A7J3-01A-21D-A34J-08 ENST00000420999 p.D217H CDKN2C chr1 50970468 50970468 Nonsense_Mutation C C T TCGA-QH-A6CZ-01A-11D-A32B-08 ENST00000262662 p.Q34* FUBP1 chr1 77962814 77962814 Nonsense_Mutation G G A TCGA-QH-A6CZ-01A-11D-A32B-08 ENST00000370768 p.Q434* AC027612.6 chr2 91655465 91655465 RNA G G T TCGA-QH-A6CZ-01A-11D-A32B-08 ENST00000609777 IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-QH-A6CZ-01A-11D-A32B-08 ENST00000345146 p.R132H NEK10 chr3 27202536 27202536 Silent C C T TCGA-QH-A6CZ-01A-11D-A32B-08 ENST00000429845 p.E704E DNAH1 chr3 52363057 52363057 Silent C C G TCGA-QH-A6CZ-01A-11D-A32B-08 ENST00000420323 p.L1719L PDS5A chr4 39920400 39920400 Splice_Site C C G TCGA-QH-A6CZ-01A-11D-A32B-08 ENST00000303538 p.X219_splice PCDHGC5 chr5 141490116 141490116 Silent C C T TCGA-QH-A6CZ-01A-11D-A32B-08 ENST00000252087 p.L292L DSP chr6 7571984 7571984 Silent C C T TCGA-QH-A6CZ-01A-11D-A32B-08 ENST00000379802 p.C682C ABCA13 chr7 48643324 48643324 Silent T T C TCGA-QH-A6CZ-01A-11D-A32B-08 ENST00000435803 p.C4958C SRRT chr7 100887335 100887335 Missense_Mutation A A C TCGA-QH-A6CZ-01A-11D-A32B-08 ENST00000611405 p.K664T TRPV6 chr7 142875499 142875499 Missense_Mutation T T C TCGA-QH-A6CZ-01A-11D-A32B-08 ENST00000359396 p.D364G PRKACG chr9 69013521 69013521 Missense_Mutation C C T TCGA-QH-A6CZ-01A-11D-A32B-08 ENST00000377276 p.R191H ALDOB chr9 101421727 101421727 3'UTR A A G TCGA-QH-A6CZ-01A-11D-A32B-08 ENST00000374855 ACVR1B chr12 51986822 51986822 Missense_Mutation A A G TCGA-QH-A6CZ-01A-11D-A32B-08 ENST00000257963 p.M381V SLC28A1 chr15 84918538 84918538 Missense_Mutation T T G TCGA-QH-A6CZ-01A-11D-A32B-08 ENST00000286749 p.I270M KIAA0895L chr16 67180571 67180571 Missense_Mutation G G T TCGA-QH-A6CZ-01A-11D-A32B-08 ENST00000290881 p.P14T WDR81 chr17 1737654 1737655 Frame_Shift_Ins - - G TCGA-QH-A6CZ-01A-11D-A32B-08 ENST00000409644 p.D1933Rfs*12 ASXL3 chr18 33744868 33744868 Missense_Mutation G G A TCGA-QH-A6CZ-01A-11D-A32B-08 ENST00000269197 p.E1674K ARRDC5 chr19 4891562 4891562 Silent G G A TCGA-QH-A6CZ-01A-11D-A32B-08 ENST00000381781 p.F171F CAPN12 chr19 38734161 38734161 Frame_Shift_Del C C - TCGA-QH-A6CZ-01A-11D-A32B-08 ENST00000328867 p.G620Afs*21 CIC chr19 42287642 42287642 Missense_Mutation A T T TCGA-QH-A6CZ-01A-11D-A32B-08 ENST00000575354 p.N227I CIC chr19 42291457 42291457 Frame_Shift_Del C C - TCGA-QH-A6CZ-01A-11D-A32B-08 ENST00000575354 p.A900Pfs*24 IRF3 chr19 49662299 49662299 Missense_Mutation G G A TCGA-QH-A6CZ-01A-11D-A32B-08 ENST00000309877 p.R211W COL6A1 chr21 45992397 45992397 Missense_Mutation G G A TCGA-QH-A6CZ-01A-11D-A32B-08 ENST00000361866 p.R424Q CSF2RA chrX 1294387 1294387 Missense_Mutation C C T TCGA-QH-A6CZ-01A-11D-A32B-08 ENST00000381524 p.R236W HRNR chr1 152216733 152216733 Silent G G A TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000368801 p.G1632G NOSTRIN chr2 168856575 168856575 Intron A A - TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000317647 IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000345146 p.R132H TRPM8 chr2 233996517 233996517 Splice_Site G G C TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000324695 p.X1044_splice PIK3CA chr3 179199141 179199141 Missense_Mutation G G A TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000263967 p.G106S TSPAN5 chr4 98472342 98472342 3'UTR T T C TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000305798 EBF1 chr5 159099589 159099589 5'UTR T T - TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000313708 HIVEP1 chr6 12161465 12161465 Nonsense_Mutation C C T TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000379388 p.R2172* EHMT2 chr6 31880175 31880175 Missense_Mutation G G A TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000375537 p.A1181V DNAH8 chr6 38826268 38826268 Missense_Mutation T T A TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000359357 p.N1103K SUPT3H chr6 45105946 45105946 Silent C C T TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000371460 p.V65V STX11 chr6 144186879 144186879 Silent C C T TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000367568 p.R84R ZNF800 chr7 127373843 127373843 Missense_Mutation T T C TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000265827 p.K498R ZFPM2 chr8 105802058 105802058 Missense_Mutation A A G TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000407775 p.N659S RAD21 chr8 116854306 116854306 Missense_Mutation C C A TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000297338 p.G367V FER1L6 chr8 124066447 124066447 Missense_Mutation G G A TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000399018 p.R1192Q POLA2 chr11 65287777 65287777 Silent G G A TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000265465 p.T356T KMT2D chr12 49026938 49026938 Missense_Mutation C C T TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000301067 p.A5010T KRT6B chr12 52449612 52449612 Missense_Mutation G G A TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000252252 p.H312Y KIF26A chr14 104176835 104176835 Silent G G A TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000423312 p.K1349K TCF12 chr15 57273080 57273082 In_Frame_Del AGA AGA - TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000267811 p.K576del TCF12 chr15 57273084 57273084 Missense_Mutation G G C TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000267811 p.K576N TCF12 chr15 57273085 57273085 Nonsense_Mutation G G T TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000267811 p.E577* HCN4 chr15 73322703 73322723 In_Frame_Del CCCACTGCCCCCGCTGCCACC CCCACTGCCCCCGCTGCCACC - TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000261917 p.G1124_G1130del GOLGA6L5P chr15 84510019 84510019 RNA C C G TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000414190 MIR6859-4 chr16 16954 16954 3'Flank G G A TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000615957 ENGASE chr17 79082063 79082063 Splice_Region G G A TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000579016 p.K346K CIC chr19 42287563 42287563 Missense_Mutation C C T TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000575354 p.R201W SLC52A3 chr20 763693 763693 Missense_Mutation G G A TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000217254 p.A293V BCR chr22 23314609 23314609 Silent T T C TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000305877 p.F1207F ARHGEF9 chrX 63638119 63638119 Missense_Mutation G G T TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000253401 p.A487D ZC4H2 chrX 64976378 64976378 5'UTR A A G TCGA-S9-A6U2-01A-21D-A33T-08 ENST00000374839 USP48 chr1 21690014 21690014 Missense_Mutation C C T TCGA-HT-A74J-01A-12D-A32B-08 ENST00000308271 p.G990D MIA3 chr1 222654458 222654458 Missense_Mutation T T C TCGA-HT-A74J-01A-12D-A32B-08 ENST00000344922 p.S1483P COA6 chr1 234373752 234373752 Missense_Mutation C C T TCGA-HT-A74J-01A-12D-A32B-08 ENST00000366613 p.R12C ZDBF2 chr2 206309153 206309153 Missense_Mutation A A G TCGA-HT-A74J-01A-12D-A32B-08 ENST00000374423 p.D1542G IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-HT-A74J-01A-12D-A32B-08 ENST00000345146 p.R132H CTNNB1 chr3 41233339 41233339 Splice_Site A A G TCGA-HT-A74J-01A-12D-A32B-08 ENST00000349496 p.X361_splice MAP4 chr3 47916103 47916103 Missense_Mutation T T C TCGA-HT-A74J-01A-12D-A32B-08 ENST00000360240 p.D575G PDLIM3 chr4 185523412 185523412 Missense_Mutation C C T TCGA-HT-A74J-01A-12D-A32B-08 ENST00000284770 p.E94K PDE10A chr6 165450303 165450303 Silent C C G TCGA-HT-A74J-01A-12D-A32B-08 ENST00000366882 p.R85R TRIM56 chr7 101088837 101088837 Missense_Mutation C C T TCGA-HT-A74J-01A-12D-A32B-08 ENST00000306085 p.R509W CTSW chr11 65883333 65883333 Missense_Mutation A A C TCGA-HT-A74J-01A-12D-A32B-08 ENST00000307886 p.E310A ST3GAL4 chr11 126413589 126413589 Missense_Mutation G G A TCGA-HT-A74J-01A-12D-A32B-08 ENST00000392669 p.A286T TP53 chr17 7674894 7674894 Nonsense_Mutation G A A TCGA-HT-A74J-01A-12D-A32B-08 ENST00000269305 p.R213* ACO2 chr22 41523933 41523933 Missense_Mutation T T C TCGA-HT-A74J-01A-12D-A32B-08 ENST00000216254 p.S492P PHKA2 chrX 18895168 18895168 Silent A A T TCGA-HT-A74J-01A-12D-A32B-08 ENST00000379942 p.G1102G ATRX chrX 77682537 77682537 Nonsense_Mutation G A A TCGA-HT-A74J-01A-12D-A32B-08 ENST00000373344 p.R907* FLG chr1 152307237 152307237 Missense_Mutation C C T TCGA-FG-5963-01A-11D-1705-08 ENST00000368799 p.G2550D KIDINS220 chr2 8818764 8818764 Silent G G A TCGA-FG-5963-01A-11D-1705-08 ENST00000256707 p.A46A CCDC66 chr3 56593575 56593575 Missense_Mutation A A G TCGA-FG-5963-01A-11D-1705-08 ENST00000394672 p.T385A MYLK chr3 123725965 123725965 Missense_Mutation G G A TCGA-FG-5963-01A-11D-1705-08 ENST00000360304 p.R544W UMPS chr3 124730608 124730608 Missense_Mutation G G T TCGA-FG-5963-01A-11D-1705-08 ENST00000232607 p.R46L GTF2I chr7 74732629 74732629 Missense_Mutation T T A TCGA-FG-5963-01A-11D-1705-08 ENST00000573035 p.L424H COL22A1 chr8 138623758 138623758 Missense_Mutation C C T TCGA-FG-5963-01A-11D-1705-08 ENST00000303045 p.G1249R CCDC88B chr11 64353456 64353456 Missense_Mutation G G C TCGA-FG-5963-01A-11D-1705-08 ENST00000356786 p.E1265Q GUCY2C chr12 14641193 14641193 Missense_Mutation G G A TCGA-FG-5963-01A-11D-1705-08 ENST00000261170 p.R653C TXNDC16 chr14 52455323 52455323 Splice_Site C C T TCGA-FG-5963-01A-11D-1705-08 ENST00000281741 p.X614_splice CAPN3 chr15 42384519 42384519 Missense_Mutation G G T TCGA-FG-5963-01A-11D-1705-08 ENST00000397163 p.A116S IGF1R chr15 98891326 98891326 Missense_Mutation G G A TCGA-FG-5963-01A-11D-1705-08 ENST00000268035 p.M214I TP53 chr17 7675140 7675140 Missense_Mutation G G C TCGA-FG-5963-01A-11D-1705-08 ENST00000269305 p.R158G MYH2 chr17 10539550 10539550 Missense_Mutation G G A TCGA-FG-5963-01A-11D-1705-08 ENST00000245503 p.A387V FAM83G chr17 18971632 18971632 Silent G G A TCGA-FG-5963-01A-11D-1705-08 ENST00000345041 p.N733N NF1 chr17 31350209 31350209 Nonsense_Mutation C C T TCGA-FG-5963-01A-11D-1705-08 ENST00000358273 p.R2450* NF1 chr17 31356965 31356966 Frame_Shift_Ins - - A TCGA-FG-5963-01A-11D-1705-08 ENST00000358273 p.R2583Efs*13 ACACA chr17 37223523 37223523 Missense_Mutation C C T TCGA-FG-5963-01A-11D-1705-08 ENST00000616317 p.A1185T ITGA2B chr17 44378474 44378474 Missense_Mutation A A C TCGA-FG-5963-01A-11D-1705-08 ENST00000262407 p.V661G MAPRE2 chr18 35097575 35097575 Missense_Mutation G G T TCGA-FG-5963-01A-11D-1705-08 ENST00000300249 p.R127L DYM chr18 49286481 49286481 Missense_Mutation G G A TCGA-FG-5963-01A-11D-1705-08 ENST00000269445 p.A300V LILRA1 chr19 54596417 54596417 Missense_Mutation G G A TCGA-FG-5963-01A-11D-1705-08 ENST00000251372 p.R396K LMF2 chr22 50505460 50505460 Missense_Mutation C C A TCGA-FG-5963-01A-11D-1705-08 ENST00000474879 p.V332L ZNF630 chrX 48060828 48060828 Missense_Mutation C C A TCGA-FG-5963-01A-11D-1705-08 ENST00000409324 p.V45F GSPT2 chrX 51745159 51745159 Missense_Mutation T T A TCGA-FG-5963-01A-11D-1705-08 ENST00000340438 p.D511E ATRX chrX 77557644 77557644 Missense_Mutation C C T TCGA-FG-5963-01A-11D-1705-08 ENST00000373344 p.G2169E ARID1A chr1 26779059 26779059 Nonsense_Mutation C C T TCGA-HT-7468-01A-11D-2024-08 ENST00000324856 p.R1721* ADGRL2 chr1 81943051 81943051 Missense_Mutation C C G TCGA-HT-7468-01A-11D-2024-08 ENST00000370717 p.C160W OR2W3 chr1 247896585 247896585 3'Flank C C T TCGA-HT-7468-01A-11D-2024-08 ENST00000360358 IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-HT-7468-01A-11D-2024-08 ENST00000345146 p.R132H SCN11A chr3 38894787 38894787 Missense_Mutation G G T TCGA-HT-7468-01A-11D-2024-08 ENST00000302328 p.Q861K PIK3CA chr3 179234284 179234284 Missense_Mutation A A G TCGA-HT-7468-01A-11D-2024-08 ENST00000263967 p.M1043V NIPBL chr5 37048588 37048591 Frame_Shift_Del TCAG TCAG - TCGA-HT-7468-01A-11D-2024-08 ENST00000282516 p.V2227Ifs*2 TNXB chr6 32085918 32085918 Missense_Mutation G G A TCGA-HT-7468-01A-11D-2024-08 ENST00000375244 p.R994C CFAP69 chr7 90299939 90299939 Missense_Mutation G G A TCGA-HT-7468-01A-11D-2024-08 ENST00000389297 p.A644T SLC13A1 chr7 123128931 123128931 Silent C C T TCGA-HT-7468-01A-11D-2024-08 ENST00000194130 p.V349V C17orf53 chr17 44148060 44148060 Missense_Mutation C C T TCGA-HT-7468-01A-11D-2024-08 ENST00000319977 p.T86M JAK3 chr19 17834935 17834935 Missense_Mutation C C A TCGA-HT-7468-01A-11D-2024-08 ENST00000458235 p.A706S CIC chr19 42287605 42287605 Missense_Mutation C C T TCGA-HT-7468-01A-11D-2024-08 ENST00000575354 p.R215W DEPDC1 chr1 68481534 68481534 Missense_Mutation C C T TCGA-DU-A76L-01A-11D-A32B-08 ENST00000456315 p.R614H LCE3A chr1 152622936 152622936 Missense_Mutation C C A TCGA-DU-A76L-01A-11D-A32B-08 ENST00000335674 p.R56S PEAR1 chr1 156906831 156906831 Missense_Mutation G G A TCGA-DU-A76L-01A-11D-A32B-08 ENST00000292357 p.D199N GPA33 chr1 167073495 167073495 Missense_Mutation C C T TCGA-DU-A76L-01A-11D-A32B-08 ENST00000367868 p.V30I HMCN1 chr1 186145459 186145459 Missense_Mutation G G A TCGA-DU-A76L-01A-11D-A32B-08 ENST00000271588 p.G4775R CACNA1S chr1 201066300 201066300 Missense_Mutation C C T TCGA-DU-A76L-01A-11D-A32B-08 ENST00000362061 p.V892M OR2T8 chr1 247921768 247921768 Missense_Mutation G G A TCGA-DU-A76L-01A-11D-A32B-08 ENST00000319968 p.G251R OR2T27 chr1 248650167 248650167 Missense_Mutation T T G TCGA-DU-A76L-01A-11D-A32B-08 ENST00000344889 p.T240P EDAR chr2 108910894 108910894 Intron G G A TCGA-DU-A76L-01A-11D-A32B-08 ENST00000258443 SLC11A1 chr2 218394674 218394674 Silent C C T TCGA-DU-A76L-01A-11D-A32B-08 ENST00000233202 p.C477C RARB chr3 25174485 25174485 Missense_Mutation C C G TCGA-DU-A76L-01A-11D-A32B-08 ENST00000383772 p.P30A CX3CR1 chr3 39266084 39266084 Silent G G A TCGA-DU-A76L-01A-11D-A32B-08 ENST00000399220 p.T142T HLTF chr3 149039119 149039119 Missense_Mutation A A C TCGA-DU-A76L-01A-11D-A32B-08 ENST00000310053 p.L909R SI chr3 165039972 165039972 Splice_Site C C A TCGA-DU-A76L-01A-11D-A32B-08 ENST00000264382 p.X720_splice STATH chr4 69999790 69999790 Missense_Mutation G G A TCGA-DU-A76L-01A-11D-A32B-08 ENST00000246895 p.R28H FRAS1 chr4 78540796 78540796 Missense_Mutation C C T TCGA-DU-A76L-01A-11D-A32B-08 ENST00000512123 p.A3904V GPRIN3 chr4 89249243 89249243 Missense_Mutation G G A TCGA-DU-A76L-01A-11D-A32B-08 ENST00000333209 p.R290C CCSER1 chr4 90308475 90308475 Missense_Mutation G G A TCGA-DU-A76L-01A-11D-A32B-08 ENST00000509176 p.R64H ELMOD2 chr4 140525430 140525433 Frame_Shift_Del TGTT TGTT - TCGA-DU-A76L-01A-11D-A32B-08 ENST00000323570 p.M1_?2 HPGD chr4 174491877 174491877 3'UTR A A C TCGA-DU-A76L-01A-11D-A32B-08 ENST00000296522 C9 chr5 39308291 39308291 Silent T T C TCGA-DU-A76L-01A-11D-A32B-08 ENST00000263408 p.E393E PDE4D chr5 59988717 59988717 Missense_Mutation C C T TCGA-DU-A76L-01A-11D-A32B-08 ENST00000502484 p.A15T LVRN chr5 115983418 115983418 Missense_Mutation T T C TCGA-DU-A76L-01A-11D-A32B-08 ENST00000357872 p.M276T PCDHGB3 chr5 141371831 141371831 Silent C C T TCGA-DU-A76L-01A-11D-A32B-08 ENST00000576222 p.P479P OR5V1 chr6 29355723 29355723 Missense_Mutation A A G TCGA-DU-A76L-01A-11D-A32B-08 ENST00000377154 p.V158A GABRR1 chr6 89180426 89180426 Missense_Mutation C C T TCGA-DU-A76L-01A-11D-A32B-08 ENST00000454853 p.V338I MDN1 chr6 89762521 89762521 Silent C C T TCGA-DU-A76L-01A-11D-A32B-08 ENST00000369393 p.P718P ZNF117 chr7 64982016 64982016 5'UTR T T C TCGA-DU-A76L-01A-11D-A32B-08 ENST00000282869 FSCN3 chr7 127595455 127595455 Missense_Mutation G G A TCGA-DU-A76L-01A-11D-A32B-08 ENST00000265825 p.R98H RNF32 chr7 156644741 156644741 Silent G G A TCGA-DU-A76L-01A-11D-A32B-08 ENST00000317955 p.P86P MTPAP chr10 30313712 30313712 Missense_Mutation A A C TCGA-DU-A76L-01A-11D-A32B-08 ENST00000263063 p.F549C PSAP chr10 71819731 71819731 Missense_Mutation C C T TCGA-DU-A76L-01A-11D-A32B-08 ENST00000394936 p.R392Q MRGPRE chr11 3228451 3228451 Missense_Mutation C C T TCGA-DU-A76L-01A-11D-A32B-08 ENST00000389832 p.V117I MYO7A chr11 77192113 77192113 Silent C C T TCGA-DU-A76L-01A-11D-A32B-08 ENST00000409709 p.Y1329Y CACNA1C chr12 2504538 2504538 Intron G G A TCGA-DU-A76L-01A-11D-A32B-08 ENST00000347598 HCAR3 chr12 122716469 122716469 Missense_Mutation C C T TCGA-DU-A76L-01A-11D-A32B-08 ENST00000528880 p.R90H TMEM132D chr12 129700298 129700298 Silent G G A TCGA-DU-A76L-01A-11D-A32B-08 ENST00000422113 p.S160S FAM179B chr14 44963633 44963633 Missense_Mutation C C G TCGA-DU-A76L-01A-11D-A32B-08 ENST00000361577 p.D404E PDE8A chr15 85113391 85113391 Nonsense_Mutation C C T TCGA-DU-A76L-01A-11D-A32B-08 ENST00000310298 p.R377* PDILT chr16 20384817 20384817 Silent C C T TCGA-DU-A76L-01A-11D-A32B-08 ENST00000302451 p.A79A PRPF8 chr17 1673413 1673413 Missense_Mutation G G A TCGA-DU-A76L-01A-11D-A32B-08 ENST00000304992 p.R1201C ELP5 chr17 7257035 7257035 Frame_Shift_Del C C - TCGA-DU-A76L-01A-11D-A32B-08 ENST00000354429 p.Q213Rfs*21 ELAC2 chr17 13016873 13016873 Missense_Mutation C C T TCGA-DU-A76L-01A-11D-A32B-08 ENST00000338034 p.G119E CCDC144A chr17 16764080 16764080 Missense_Mutation G G A TCGA-DU-A76L-01A-11D-A32B-08 ENST00000360524 p.V1335I NF1 chr17 31223475 31223479 Frame_Shift_Del TTAAC TTAAC - TCGA-DU-A76L-01A-11D-A32B-08 ENST00000358273 p.L585* TNS4 chr17 40488841 40488841 Missense_Mutation C C T TCGA-DU-A76L-01A-11D-A32B-08 ENST00000254051 p.V190I PTPRM chr18 7949216 7949216 Silent C C T TCGA-DU-A76L-01A-11D-A32B-08 ENST00000332175 p.I233I EIF4G3 chr1 20855001 20855001 Missense_Mutation C C T TCGA-DU-6396-01A-11D-1705-08 ENST00000264211 p.G1081D ARHGEF11 chr1 156935974 156935974 3'UTR C C T TCGA-DU-6396-01A-11D-1705-08 ENST00000361409 RYR2 chr1 237709031 237709031 Missense_Mutation T T C TCGA-DU-6396-01A-11D-1705-08 ENST00000366574 p.F3359L NCKAP5 chr2 132731835 132731835 Missense_Mutation G G C TCGA-DU-6396-01A-11D-1705-08 ENST00000409261 p.P1782R THSD7B chr2 137642592 137642592 Missense_Mutation T T C TCGA-DU-6396-01A-11D-1705-08 ENST00000272643 p.Y1304H FASTKD1 chr2 169555143 169555143 Missense_Mutation G G A TCGA-DU-6396-01A-11D-1705-08 ENST00000453153 p.L399F ZNF385B chr2 179769589 179769589 Missense_Mutation T T A TCGA-DU-6396-01A-11D-1705-08 ENST00000410066 p.K56I IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-DU-6396-01A-11D-1705-08 ENST00000345146 p.R132H BARD1 chr2 214745811 214745811 Missense_Mutation C C T TCGA-DU-6396-01A-11D-1705-08 ENST00000260947 p.G574D UGT2B4 chr4 69486650 69486650 Missense_Mutation T T G TCGA-DU-6396-01A-11D-1705-08 ENST00000305107 p.N350T ANKRA2 chr5 73553431 73553431 Silent T T C TCGA-DU-6396-01A-11D-1705-08 ENST00000296785 p.L287L SCGN chr6 25681965 25681965 Missense_Mutation C C G TCGA-DU-6396-01A-11D-1705-08 ENST00000377961 p.D162E HLA-DOA chr6 33007462 33007462 Silent G G C TCGA-DU-6396-01A-11D-1705-08 ENST00000229829 p.V154V TFAP2D chr6 50715565 50715565 Silent G G T TCGA-DU-6396-01A-11D-1705-08 ENST00000008391 p.L163L MUC17 chr7 101036564 101036564 Missense_Mutation C C A TCGA-DU-6396-01A-11D-1705-08 ENST00000306151 p.D1716E FAM86B3P chr8 8236107 8236107 5'Flank C C T TCGA-DU-6396-01A-11D-1705-08 ENST00000310542 EEF1D chr8 143581229 143581229 Missense_Mutation C C T TCGA-DU-6396-01A-11D-1705-08 ENST00000317198 p.V97M UPF2 chr10 12035529 12035529 5'UTR G G A TCGA-DU-6396-01A-11D-1705-08 ENST00000356352 MKI67 chr10 128108188 128108188 Missense_Mutation C C T TCGA-DU-6396-01A-11D-1705-08 ENST00000368654 p.A1218T OR52M1 chr11 4546061 4546061 Missense_Mutation A A T TCGA-DU-6396-01A-11D-1705-08 ENST00000360213 p.N291Y ARAP1 chr11 72685674 72685674 Missense_Mutation C C G TCGA-DU-6396-01A-11D-1705-08 ENST00000393609 p.R1448P FGD6 chr12 95137535 95137535 Missense_Mutation A A G TCGA-DU-6396-01A-11D-1705-08 ENST00000343958 p.V994A CHST11 chr12 104757584 104757584 Missense_Mutation G G C TCGA-DU-6396-01A-11D-1705-08 ENST00000303694 p.E280D TBX5 chr12 114355613 114355613 Silent G G A TCGA-DU-6396-01A-11D-1705-08 ENST00000310346 p.G492G WDR66 chr12 121962061 121962061 Silent C C T TCGA-DU-6396-01A-11D-1705-08 ENST00000288912 p.T797T TUBA3C chr13 19177519 19177519 Missense_Mutation T T C TCGA-DU-6396-01A-11D-1705-08 ENST00000400113 p.E155G MYO5C chr15 52260932 52260932 Missense_Mutation C C T TCGA-DU-6396-01A-11D-1705-08 ENST00000261839 p.E415K IL16 chr15 81306034 81306034 Missense_Mutation C C T TCGA-DU-6396-01A-11D-1705-08 ENST00000302987 p.R1183C TP53 chr17 7673803 7673803 Missense_Mutation G G A TCGA-DU-6396-01A-11D-1705-08 ENST00000269305 p.R273C SEZ6 chr17 28959471 28959471 Splice_Region G G A TCGA-DU-6396-01A-11D-1705-08 ENST00000317338 p.A591A DCAKD chr17 45024615 45024615 Missense_Mutation C C T TCGA-DU-6396-01A-11D-1705-08 ENST00000310604 p.A172T KIF2B chr17 53823435 53823435 Missense_Mutation G G T TCGA-DU-6396-01A-11D-1705-08 ENST00000268919 p.R134S SLC38A10 chr17 81275988 81275988 Missense_Mutation G G A TCGA-DU-6396-01A-11D-1705-08 ENST00000374759 p.T298M CREB3L3 chr19 4171097 4171097 Silent C C G TCGA-DU-6396-01A-11D-1705-08 ENST00000078445 p.L299L LRFN1 chr19 39308275 39308275 Silent G G C TCGA-DU-6396-01A-11D-1705-08 ENST00000248668 p.R558R SPTBN4 chr19 40557259 40557259 Silent C C T TCGA-DU-6396-01A-11D-1705-08 ENST00000352632 p.D1842D LIM2 chr19 51382423 51382424 Frame_Shift_Ins - - A TCGA-DU-6396-01A-11D-1705-08 ENST00000596399 p.S107Ffs*59 TBX1 chr22 19764158 19764158 Silent C C T TCGA-DU-6396-01A-11D-1705-08 ENST00000329705 p.Y172Y APOL4 chr22 36191338 36191338 Nonsense_Mutation G G A TCGA-DU-6396-01A-11D-1705-08 ENST00000352371 p.R265* ADGRG2 chrX 19009741 19009741 Missense_Mutation A A T TCGA-DU-6396-01A-11D-1705-08 ENST00000379869 p.F436Y SAT1 chrX 23783861 23783861 Silent G G A TCGA-DU-6396-01A-11D-1705-08 ENST00000379270 p.P60P POLA1 chrX 24717429 24717429 Missense_Mutation G G C TCGA-DU-6396-01A-11D-1705-08 ENST00000379059 p.E276D TRO chrX 54929356 54929356 Missense_Mutation G G A TCGA-DU-6396-01A-11D-1705-08 ENST00000173898 p.V878I ARHGEF9 chrX 63754457 63754457 5'UTR C C T TCGA-DU-6396-01A-11D-1705-08 ENST00000253401 MTMR8 chrX 64268493 64268493 3'UTR G G A TCGA-DU-6396-01A-11D-1705-08 ENST00000374852 ATRX chrX 77654139 77654139 Nonsense_Mutation G G A TCGA-DU-6396-01A-11D-1705-08 ENST00000373344 p.R1426* AIM1L chr1 26345576 26345576 Missense_Mutation A A G TCGA-P5-A731-01A-11D-A32B-08 ENST00000308182 p.V361A RUSC1 chr1 155324823 155324823 Intron C C T TCGA-P5-A731-01A-11D-A32B-08 ENST00000368352 KIF5C chr2 148922180 148922180 Missense_Mutation C C T TCGA-P5-A731-01A-11D-A32B-08 ENST00000435030 p.T57M IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-P5-A731-01A-11D-A32B-08 ENST00000345146 p.R132H STAB1 chr3 52505114 52505114 Missense_Mutation G G A TCGA-P5-A731-01A-11D-A32B-08 ENST00000321725 p.A497T CLDND1 chr3 98516700 98516700 Missense_Mutation G G A TCGA-P5-A731-01A-11D-A32B-08 ENST00000341181 p.R241W DSP chr6 7579702 7579702 Missense_Mutation T T C TCGA-P5-A731-01A-11D-A32B-08 ENST00000379802 p.I1171T KMT2C chr7 152315205 152315205 Missense_Mutation C C A TCGA-P5-A731-01A-11D-A32B-08 ENST00000262189 p.D175Y CDH17 chr8 94165976 94165976 Missense_Mutation C C A TCGA-P5-A731-01A-11D-A32B-08 ENST00000027335 p.G356V OXR1 chr8 106692739 106692739 Silent C C T TCGA-P5-A731-01A-11D-A32B-08 ENST00000442977 p.V180V TMEFF1 chr9 100576582 100576582 Frame_Shift_Del G G - TCGA-P5-A731-01A-11D-A32B-08 ENST00000374879 p.S376Hfs*17 SIRT1 chr10 67909356 67909356 Missense_Mutation G G C TCGA-P5-A731-01A-11D-A32B-08 ENST00000212015 p.R424T LTA4H chr12 96006361 96006361 Missense_Mutation G G A TCGA-P5-A731-01A-11D-A32B-08 ENST00000228740 p.L495F DDX54 chr12 113177078 113177078 Silent A A G TCGA-P5-A731-01A-11D-A32B-08 ENST00000306014 p.F210F GPX2 chr14 64939800 64939801 Frame_Shift_Ins - - T TCGA-P5-A731-01A-11D-A32B-08 ENST00000389614 p.Y88Vfs*? CMIP chr16 81701734 81701734 Missense_Mutation G G C TCGA-P5-A731-01A-11D-A32B-08 ENST00000537098 p.E610D MYH8 chr17 10395287 10395287 Missense_Mutation G G A TCGA-P5-A731-01A-11D-A32B-08 ENST00000403437 p.T1603M COIL chr17 56938988 56938988 3'UTR C C T TCGA-P5-A731-01A-11D-A32B-08 ENST00000240316 MRPS23 chr17 57841217 57841217 Missense_Mutation G G T TCGA-P5-A731-01A-11D-A32B-08 ENST00000313608 p.L87I ZNF569 chr19 37412633 37412633 Silent C C T TCGA-P5-A731-01A-11D-A32B-08 ENST00000316950 p.S675S CEACAM6 chr19 41755646 41755646 Missense_Mutation C C T TCGA-P5-A731-01A-11D-A32B-08 ENST00000199764 p.P3L RSPH14 chr22 23059605 23059605 Missense_Mutation C C T TCGA-P5-A731-01A-11D-A32B-08 ENST00000216036 p.A302T FAM47C chrX 37009041 37009041 Missense_Mutation C C T TCGA-P5-A731-01A-11D-A32B-08 ENST00000358047 p.R211C HUWE1 chrX 53552441 53552441 Missense_Mutation G G C TCGA-P5-A731-01A-11D-A32B-08 ENST00000262854 p.S2917R HPRT1 chrX 134493547 134493547 Missense_Mutation T T C TCGA-P5-A731-01A-11D-A32B-08 ENST00000298556 p.S148P WDR3 chr1 117941160 117941160 Missense_Mutation C C T TCGA-DB-5276-01A-01D-1468-08 ENST00000349139 p.R276W ALMS1 chr2 73573016 73573016 Missense_Mutation G G C TCGA-DB-5276-01A-01D-1468-08 ENST00000613296 p.Q3713H XIRP2 chr2 167254035 167254035 Missense_Mutation C C G TCGA-DB-5276-01A-01D-1468-08 ENST00000628543 p.A3345G IDH1 chr2 208248389 208248389 Missense_Mutation G G A TCGA-DB-5276-01A-01D-1468-08 ENST00000345146 p.R132C CPEB4 chr5 173889973 173889974 Frame_Shift_Del AA AA - TCGA-DB-5276-01A-01D-1468-08 ENST00000265085 p.Q83Afs*26 ADAM28 chr8 24294090 24294090 5'UTR G G C TCGA-DB-5276-01A-01D-1468-08 ENST00000265769 RBP3 chr10 47349195 47349195 Silent C C T TCGA-DB-5276-01A-01D-1468-08 ENST00000584701 p.G237G CACNA1C chr12 2596031 2596031 Intron C C T TCGA-DB-5276-01A-01D-1468-08 ENST00000347598 C12orf40 chr12 39721080 39721083 Frame_Shift_Del ACAA ACAA - TCGA-DB-5276-01A-01D-1468-08 ENST00000324616 p.T598Rfs*5 TP53 chr17 7674229 7674229 Missense_Mutation C C T TCGA-DB-5276-01A-01D-1468-08 ENST00000269305 p.G245D ICT1 chr17 75020630 75020632 In_Frame_Del AAG AAG - TCGA-DB-5276-01A-01D-1468-08 ENST00000301585 p.E171del NLRP12 chr19 53824285 53824285 5'UTR C C T TCGA-DB-5276-01A-01D-1468-08 ENST00000324134 VPS16 chr20 2862731 2862731 Intron C C T TCGA-DB-5276-01A-01D-1468-08 ENST00000380445 BCOR chrX 40062778 40062779 Frame_Shift_Del CT CT - TCGA-DB-5276-01A-01D-1468-08 ENST00000378444 p.E1382Ifs*26 ATRX chrX 77683689 77683692 Frame_Shift_Del AGGA AGGA - TCGA-DB-5276-01A-01D-1468-08 ENST00000373344 p.S522Qfs*39 TBX22 chrX 80024064 80024064 Missense_Mutation C C T TCGA-DB-5276-01A-01D-1468-08 ENST00000373294 p.R120W IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-DU-7011-01A-11D-2024-08 ENST00000345146 p.R132H MAP2 chr2 209695329 209695329 Silent T T C TCGA-DU-7011-01A-11D-2024-08 ENST00000360351 p.F1053F UBR2 chr6 42663358 42663358 Missense_Mutation T T C TCGA-DU-7011-01A-11D-2024-08 ENST00000372899 p.C1213R PCLO chr7 82955178 82955178 Silent T T C TCGA-DU-7011-01A-11D-2024-08 ENST00000333891 p.T1925T LAMP1 chr13 113306541 113306541 Missense_Mutation G G A TCGA-DU-7011-01A-11D-2024-08 ENST00000332556 p.A40T CSPG4 chr15 75682936 75682936 Missense_Mutation C C T TCGA-DU-7011-01A-11D-2024-08 ENST00000308508 p.G1519R TP53 chr17 7673776 7673776 Missense_Mutation G G A TCGA-DU-7011-01A-11D-2024-08 ENST00000269305 p.R282W SERPINB11 chr18 63710349 63710349 Silent G G A TCGA-DU-7011-01A-11D-2024-08 ENST00000544088 p.E52E ADGRE1 chr19 6926454 6926454 Missense_Mutation T T C TCGA-DU-7011-01A-11D-2024-08 ENST00000312053 p.L692S SIRPB1 chr20 1605035 1605035 Intron G G A TCGA-DU-7011-01A-11D-2024-08 ENST00000381605 CLCN4 chrX 10212513 10212513 Missense_Mutation C C T TCGA-DU-7011-01A-11D-2024-08 ENST00000380833 p.A479V KLHL15 chrX 23988574 23988574 Missense_Mutation T T A TCGA-DU-7011-01A-11D-2024-08 ENST00000328046 p.T388S ATRX chrX 77599550 77599550 Frame_Shift_Del T T - TCGA-DU-7011-01A-11D-2024-08 ENST00000373344 p.D1940Ifs*15 ATRX chrX 77684004 77684004 Nonsense_Mutation G G A TCGA-DU-7011-01A-11D-2024-08 ENST00000373344 p.R418* NIT1 chr1 161118151 161118151 5'UTR C C A TCGA-P5-A5F4-01A-11D-A289-08 ENST00000368009 DQX1 chr2 74522894 74522894 Missense_Mutation A A G TCGA-P5-A5F4-01A-11D-A289-08 ENST00000393951 p.I422T IDH1 chr2 208248389 208248389 Missense_Mutation G G A TCGA-P5-A5F4-01A-11D-A289-08 ENST00000345146 p.R132C SMC4 chr3 160404338 160404338 Missense_Mutation A A C TCGA-P5-A5F4-01A-11D-A289-08 ENST00000344722 p.D174A KLHL7 chr7 23174264 23174264 Missense_Mutation C C G TCGA-P5-A5F4-01A-11D-A289-08 ENST00000339077 p.T576S ZNF117 chr7 64981398 64981398 Missense_Mutation G G A TCGA-P5-A5F4-01A-11D-A289-08 ENST00000282869 p.A8V ZKSCAN1 chr7 100033888 100033888 Silent T T C TCGA-P5-A5F4-01A-11D-A289-08 ENST00000324306 p.Y461Y GATA4 chr8 11749047 11749047 Missense_Mutation G G A TCGA-P5-A5F4-01A-11D-A289-08 ENST00000335135 p.G249S ERICH5 chr8 98090021 98090021 Missense_Mutation G G A TCGA-P5-A5F4-01A-11D-A289-08 ENST00000318528 p.R335H PALM2-AKAP2 chr9 110156451 110156451 Missense_Mutation A A G TCGA-P5-A5F4-01A-11D-A289-08 ENST00000374530 p.Y1043C PKP3 chr11 397651 397651 Missense_Mutation G G A TCGA-P5-A5F4-01A-11D-A289-08 ENST00000331563 p.A353T PRDM11 chr11 45095815 45095815 Missense_Mutation A A G TCGA-P5-A5F4-01A-11D-A289-08 ENST00000530656 p.M4V OR5D18 chr11 55819976 55819976 Nonsense_Mutation T T G TCGA-P5-A5F4-01A-11D-A289-08 ENST00000333976 p.L116* PDE2A chr11 72581892 72581892 Missense_Mutation C C A TCGA-P5-A5F4-01A-11D-A289-08 ENST00000334456 p.C636F ANO2 chr12 5599552 5599552 Missense_Mutation G G A TCGA-P5-A5F4-01A-11D-A289-08 ENST00000356134 p.P723L PEX5 chr12 7210175 7210175 Silent C C T TCGA-P5-A5F4-01A-11D-A289-08 ENST00000420616 p.D624D SLCO1B3 chr12 20875335 20875335 Silent T T C TCGA-P5-A5F4-01A-11D-A289-08 ENST00000261196 p.F276F KRT73 chr12 52616224 52616224 Missense_Mutation C C G TCGA-P5-A5F4-01A-11D-A289-08 ENST00000305748 p.V202L ITGA5 chr12 54402209 54402209 Missense_Mutation C C G TCGA-P5-A5F4-01A-11D-A289-08 ENST00000293379 p.E702Q PTPRB chr12 70556120 70556120 Silent G G A TCGA-P5-A5F4-01A-11D-A289-08 ENST00000261266 p.C1363C ARID4A chr14 58365265 58365265 Missense_Mutation G G C TCGA-P5-A5F4-01A-11D-A289-08 ENST00000355431 p.S1059T DYNC1H1 chr14 101994816 101994817 Frame_Shift_Del AG AG - TCGA-P5-A5F4-01A-11D-A289-08 ENST00000360184 p.E1101Vfs*14 FLYWCH1 chr16 2933272 2933272 Silent G G A TCGA-P5-A5F4-01A-11D-A289-08 ENST00000253928 p.R313R RP11-231C14.4 chr16 29485566 29485566 Missense_Mutation G G T TCGA-P5-A5F4-01A-11D-A289-08 ENST00000550665 p.P304T TP53 chr17 7673802 7673802 Missense_Mutation C A A TCGA-P5-A5F4-01A-11D-A289-08 ENST00000269305 p.R273L KRT15 chr17 41516934 41516934 Silent G G A TCGA-P5-A5F4-01A-11D-A289-08 ENST00000254043 p.G204G HOXB2 chr17 48544974 48544975 5'UTR - - G TCGA-P5-A5F4-01A-11D-A289-08 ENST00000330070 TMC8 chr17 78138051 78138051 Missense_Mutation C C T TCGA-P5-A5F4-01A-11D-A289-08 ENST00000318430 p.R466W RNF126 chr19 651708 651708 Missense_Mutation G G C TCGA-P5-A5F4-01A-11D-A289-08 ENST00000292363 p.H116D MIR1270 chr19 20398882 20398882 3'Flank C C - TCGA-P5-A5F4-01A-11D-A289-08 ENST00000459320 ZNF430 chr19 21033494 21033494 Silent T T C TCGA-P5-A5F4-01A-11D-A289-08 ENST00000261560 p.S45S PLCB4 chr20 9408692 9408692 Missense_Mutation A A G TCGA-P5-A5F4-01A-11D-A289-08 ENST00000278655 p.K605E IFT52 chr20 43635936 43635936 Missense_Mutation C C G TCGA-P5-A5F4-01A-11D-A289-08 ENST00000373030 p.Q312E KRTAP10-7 chr21 44601339 44601339 Missense_Mutation G G T TCGA-P5-A5F4-01A-11D-A289-08 ENST00000609664 p.V240L LARGE chr22 33274472 33274472 Silent G G A TCGA-P5-A5F4-01A-11D-A289-08 ENST00000354992 p.Y742Y PRR5 chr22 44736850 44736850 Missense_Mutation C C T TCGA-P5-A5F4-01A-11D-A289-08 ENST00000336985 p.T257M DHRSX chrX 2243222 2243222 Missense_Mutation T T C TCGA-P5-A5F4-01A-11D-A289-08 ENST00000334651 p.Y202C HUWE1 chrX 53626002 53626002 Intron A A G TCGA-P5-A5F4-01A-11D-A289-08 ENST00000262854 CYLC1 chrX 83861188 83861188 Silent T T C TCGA-P5-A5F4-01A-11D-A289-08 ENST00000329312 p.S2S BTK chrX 101360690 101360690 Silent C C T TCGA-P5-A5F4-01A-11D-A289-08 ENST00000308731 p.K218K MUM1L1 chrX 106205988 106205988 Missense_Mutation T T C TCGA-P5-A5F4-01A-11D-A289-08 ENST00000337685 p.S186P MTOR chr1 11117039 11117039 Missense_Mutation C T T TCGA-DU-6393-01A-11D-1705-08 ENST00000361445 p.M2327I CDA chr1 20618602 20618602 3'UTR C A A TCGA-DU-6393-01A-11D-1705-08 ENST00000375071 CYP4B1 chr1 46813479 46813479 Splice_Region C A A TCGA-DU-6393-01A-11D-1705-08 ENST00000271153 INSL5 chr1 66801161 66801161 Missense_Mutation G G A TCGA-DU-6393-01A-11D-1705-08 ENST00000304526 p.R21W ASB17 chr1 75922207 75922207 Missense_Mutation A G G TCGA-DU-6393-01A-11D-1705-08 ENST00000284142 p.I185T TCHH chr1 152112888 152112888 Missense_Mutation A A G TCGA-DU-6393-01A-11D-1705-08 ENST00000368804 p.L110S FCRL1 chr1 157797119 157797119 Silent C C T TCGA-DU-6393-01A-11D-1705-08 ENST00000368176 p.G400G TTN chr2 178749388 178749388 Intron G G A TCGA-DU-6393-01A-11D-1705-08 ENST00000591111 IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-DU-6393-01A-11D-1705-08 ENST00000345146 p.R132H DIS3L2 chr2 232163532 232163532 Missense_Mutation G G A TCGA-DU-6393-01A-11D-1705-08 ENST00000325385 p.V342M ZBTB20 chr3 114350515 114350515 Silent G G A TCGA-DU-6393-01A-11D-1705-08 ENST00000474710 p.P521P BFSP2 chr3 133400492 133400492 Missense_Mutation C C T TCGA-DU-6393-01A-11D-1705-08 ENST00000302334 p.R137W FNIP1 chr5 131677742 131677742 Missense_Mutation C C T TCGA-DU-6393-01A-11D-1705-08 ENST00000510461 p.A494T RELN chr7 103540393 103540393 Missense_Mutation G G A TCGA-DU-6393-01A-11D-1705-08 ENST00000428762 p.P2245L PROSC chr8 37766328 37766328 Missense_Mutation C C G TCGA-DU-6393-01A-11D-1705-08 ENST00000328195 p.Q98E TNFRSF11B chr8 118933205 118933205 Silent G G A TCGA-DU-6393-01A-11D-1705-08 ENST00000297350 p.D42D GLIS3 chr9 3829411 3829411 Missense_Mutation C G G TCGA-DU-6393-01A-11D-1705-08 ENST00000324333 p.S697T TAF1L chr9 32630692 32630692 Silent A G G TCGA-DU-6393-01A-11D-1705-08 ENST00000242310 p.L1630L ZFYVE27 chr10 97738509 97738509 Missense_Mutation C C T TCGA-DU-6393-01A-11D-1705-08 ENST00000393677 p.P11L QSER1 chr11 32934056 32934057 In_Frame_Ins - - ATT TCGA-DU-6393-01A-11D-1705-08 ENST00000399302 p.L805dup OR10S1 chr11 123976808 123976808 Missense_Mutation G G A TCGA-DU-6393-01A-11D-1705-08 ENST00000531945 p.P295L GRIN2B chr12 13563253 13563253 Nonsense_Mutation G G A TCGA-DU-6393-01A-11D-1705-08 ENST00000609686 p.R1329* TRAV41 chr14 22320588 22320588 Missense_Mutation A A G TCGA-DU-6393-01A-11D-1705-08 ENST00000390468 p.H78R NPAP1 chr15 24676576 24676576 Missense_Mutation C T T TCGA-DU-6393-01A-11D-1705-08 ENST00000329468 p.P237S ADAM10 chr15 58633347 58633347 Missense_Mutation C C T TCGA-DU-6393-01A-11D-1705-08 ENST00000260408 p.G342E HEATR3 chr16 50102377 50102377 Missense_Mutation C C T TCGA-DU-6393-01A-11D-1705-08 ENST00000299192 p.S621L NOS2 chr17 27780777 27780777 Missense_Mutation C C T TCGA-DU-6393-01A-11D-1705-08 ENST00000313735 p.E332K CACNA1G chr17 50592062 50592062 Silent C C T TCGA-DU-6393-01A-11D-1705-08 ENST00000359106 p.V960V CIC chr19 42292169 42292170 Frame_Shift_Del CT CT - TCGA-DU-6393-01A-11D-1705-08 ENST00000575354 p.Q992Afs*158 KRTAP10-10 chr21 44637498 44637498 Silent C C T TCGA-DU-6393-01A-11D-1705-08 ENST00000380095 p.C27C PCDH11Y chrY 5737917 5737917 Missense_Mutation C T T TCGA-DU-6393-01A-11D-1705-08 ENST00000400457 p.P1333L PLEKHM3 chr2 208001300 208001300 Missense_Mutation C C T TCGA-HT-A5R5-01A-11D-A289-08 ENST00000427836 p.A114T IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-HT-A5R5-01A-11D-A289-08 ENST00000345146 p.R132H TFRC chr3 196077073 196077073 Missense_Mutation G G C TCGA-HT-A5R5-01A-11D-A289-08 ENST00000360110 p.F9L HARS chr5 140691273 140691273 Missense_Mutation A A T TCGA-HT-A5R5-01A-11D-A289-08 ENST00000504156 p.V11E FBXO30 chr6 145805212 145805212 Silent A A G TCGA-HT-A5R5-01A-11D-A289-08 ENST00000237281 p.S398S PLXNA4 chr7 132145124 132145130 Frame_Shift_Del GCTCTTC GCTCTTC - TCGA-HT-A5R5-01A-11D-A289-08 ENST00000321063 p.W1738* TRHR chr8 109087911 109087911 Silent C C G TCGA-HT-A5R5-01A-11D-A289-08 ENST00000311762 p.A133A RORB chr9 74662607 74662607 Splice_Site G G T TCGA-HT-A5R5-01A-11D-A289-08 ENST00000396204 p.X309_splice BTAF1 chr10 91989429 91989429 Missense_Mutation A A G TCGA-HT-A5R5-01A-11D-A289-08 ENST00000265990 p.I901M DCHS1 chr11 6632877 6632877 Missense_Mutation G G A TCGA-HT-A5R5-01A-11D-A289-08 ENST00000299441 p.R879W IGSF22 chr11 18717941 18717941 Silent G G A TCGA-HT-A5R5-01A-11D-A289-08 ENST00000319338 p.L321L STRAP chr12 15897966 15897966 Silent C C T TCGA-HT-A5R5-01A-11D-A289-08 ENST00000419869 p.G241G CTCF chr16 67629507 67629507 Missense_Mutation C C G TCGA-HT-A5R5-01A-11D-A289-08 ENST00000264010 p.S604C KRI1 chr19 10559677 10559677 Missense_Mutation G G A TCGA-HT-A5R5-01A-11D-A289-08 ENST00000312962 p.S326F NLRP8 chr19 55948174 55948174 Missense_Mutation G G A TCGA-HT-A5R5-01A-11D-A289-08 ENST00000291971 p.R91H DMD chrX 31729677 31729677 Silent T T C TCGA-HT-A5R5-01A-11D-A289-08 ENST00000357033 p.K2538K ATRX chrX 77681589 77681589 Nonsense_Mutation C C A TCGA-HT-A5R5-01A-11D-A289-08 ENST00000373344 p.E1223* THEMIS2 chr1 27885938 27885938 3'UTR C T T TCGA-E1-5318-01A-01D-1468-08 ENST00000373921 NBPF26 chr1 120833760 120833760 Missense_Mutation G G A TCGA-E1-5318-01A-01D-1468-08 ENST00000620612 p.A915T SELE chr1 169729496 169729496 Missense_Mutation G G A TCGA-E1-5318-01A-01D-1468-08 ENST00000333360 p.T298M LBX2 chr2 74502662 74502662 5'Flank G G A TCGA-E1-5318-01A-01D-1468-08 ENST00000377566 NEB chr2 151665386 151665386 Missense_Mutation T T A TCGA-E1-5318-01A-01D-1468-08 ENST00000172853 p.M1729L SI chr3 165059182 165059182 Missense_Mutation A A G TCGA-E1-5318-01A-01D-1468-08 ENST00000264382 p.Y422H FSTL5 chr4 161656376 161656376 Nonsense_Mutation C C T TCGA-E1-5318-01A-01D-1468-08 ENST00000306100 p.W282* NAIP chr5 71012560 71012560 Missense_Mutation C C T TCGA-E1-5318-01A-01D-1468-08 ENST00000194097 p.R119K C5orf46 chr5 147901624 147901624 Splice_Region C C T TCGA-E1-5318-01A-01D-1468-08 ENST00000318315 PSD3 chr8 18867714 18867714 Missense_Mutation T T C TCGA-E1-5318-01A-01D-1468-08 ENST00000440756 p.I532V KCNU1 chr8 36814277 36814277 Missense_Mutation A A G TCGA-E1-5318-01A-01D-1468-08 ENST00000399881 p.Y268C KLHL9 chr9 21333866 21333866 Missense_Mutation G G A TCGA-E1-5318-01A-01D-1468-08 ENST00000359039 p.P332S SIT1 chr9 35650245 35650245 Missense_Mutation C C T TCGA-E1-5318-01A-01D-1468-08 ENST00000259608 p.G99E PTEN chr10 87965506 87965506 3'UTR A A C TCGA-E1-5318-01A-01D-1468-08 ENST00000371953 RPEL1 chr10 103246034 103246034 Missense_Mutation A A G TCGA-E1-5318-01A-01D-1468-08 ENST00000441178 p.N13S KNDC1 chr10 133224691 133224691 Missense_Mutation C C T TCGA-E1-5318-01A-01D-1468-08 ENST00000304613 p.A1684V OR52B6 chr11 5581634 5581634 Missense_Mutation G G A TCGA-E1-5318-01A-01D-1468-08 ENST00000345043 p.R253H AHNAK chr11 62531738 62531738 Silent C C T TCGA-E1-5318-01A-01D-1468-08 ENST00000378024 p.E893E CWF19L2 chr11 107353597 107353597 Missense_Mutation T T C TCGA-E1-5318-01A-01D-1468-08 ENST00000282251 p.Q671R HEBP1 chr12 13002072 13002072 5'Flank G G C TCGA-E1-5318-01A-01D-1468-08 ENST00000014930 KSR2 chr12 117579173 117579173 Missense_Mutation G G A TCGA-E1-5318-01A-01D-1468-08 ENST00000339824 p.T424M IL31 chr12 122174201 122174201 5'Flank G G T TCGA-E1-5318-01A-01D-1468-08 ENST00000377035 LMO7 chr13 75808079 75808079 Missense_Mutation G G A TCGA-E1-5318-01A-01D-1468-08 ENST00000465261 p.G366E MED6 chr14 70592875 70592875 Splice_Region C C T TCGA-E1-5318-01A-01D-1468-08 ENST00000256379 CYP1A1 chr15 74720627 74720627 Silent G G C TCGA-E1-5318-01A-01D-1468-08 ENST00000379727 p.V467V IDH2 chr15 90088606 90088606 Missense_Mutation C C A TCGA-E1-5318-01A-01D-1468-08 ENST00000330062 p.R172M CDH5 chr16 66402741 66402741 Missense_Mutation G G A TCGA-E1-5318-01A-01D-1468-08 ENST00000341529 p.V643I KRT33B chr17 41365511 41365511 Missense_Mutation C C T TCGA-E1-5318-01A-01D-1468-08 ENST00000251646 p.V211M ELL chr19 18446807 18446807 Silent G G A TCGA-E1-5318-01A-01D-1468-08 ENST00000262809 p.N491N PRODH2 chr19 35811965 35811965 Silent C C T TCGA-E1-5318-01A-01D-1468-08 ENST00000301175 p.G274G CIC chr19 42291089 42291090 Frame_Shift_Ins - - GCCCCCT TCGA-E1-5318-01A-01D-1468-08 ENST00000575354 p.V778Pfs*155 KLK4 chr19 50908579 50908579 Missense_Mutation C C T TCGA-E1-5318-01A-01D-1468-08 ENST00000324041 p.G159S NKG7 chr19 51371742 51371742 3'UTR C C T TCGA-E1-5318-01A-01D-1468-08 ENST00000221978 VN1R4 chr19 53267245 53267245 Missense_Mutation C C G TCGA-E1-5318-01A-01D-1468-08 ENST00000311170 p.V141L MIR498 chr19 53674262 53674262 RNA A G G TCGA-E1-5318-01A-01D-1468-08 ENST00000385134 BRWD1 chr21 39218255 39218255 Missense_Mutation C C T TCGA-E1-5318-01A-01D-1468-08 ENST00000333229 p.A1186T PDHA1 chrX 19350000 19350000 Missense_Mutation G G C TCGA-E1-5318-01A-01D-1468-08 ENST00000422285 p.G61R MAGEB2 chrX 30219254 30219254 Missense_Mutation A A T TCGA-E1-5318-01A-01D-1468-08 ENST00000378988 p.E225V BCOR chrX 40074622 40074622 Frame_Shift_Del C C - TCGA-E1-5318-01A-01D-1468-08 ENST00000378444 p.E242Sfs*24 PGRMC1 chrX 119236598 119236598 Missense_Mutation C C T TCGA-E1-5318-01A-01D-1468-08 ENST00000217971 p.R79W ZYG11B chr1 52816632 52816632 Splice_Region A A T TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000294353 SPTA1 chr1 158626888 158626888 Silent A A G TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000368147 p.Y1928Y TTC7A chr2 46994348 46994348 Intron C C G TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000319190 RANBP2 chr2 108767057 108767057 Missense_Mutation T T C TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000283195 p.M2173T TBR1 chr2 161419005 161419005 Silent C C T TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000389554 p.F361F IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000345146 p.R132H FBLN2 chr3 13629199 13629199 Missense_Mutation G G A TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000295760 p.G870S ZNF860 chr3 31989538 31989538 Silent T T C TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000360311 p.D153D HTT chr4 3212695 3212695 Missense_Mutation G G A TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000355072 p.V2254M ARAP2 chr4 36119712 36119712 Missense_Mutation C C T TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000303965 p.E1301K INPP4B chr4 142173782 142173782 Silent T T A TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000262992 p.S403S TENM3 chr4 182324091 182324091 Missense_Mutation C C A TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000511685 p.T24K AGXT2 chr5 35037008 35037008 Silent G G A TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000231420 p.V140V RAD50 chr5 132557437 132557437 Missense_Mutation A A G TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000378823 p.N38S DSP chr6 7576382 7576382 Missense_Mutation C C T TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000379802 p.R907C PRSS16 chr6 27249132 27249132 Missense_Mutation G G A TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000230582 p.A124T LRRC73 chr6 43507510 43507511 Frame_Shift_Del CT CT - TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000372441 p.G276Afs*37 PTPRZ1 chr7 122036659 122036659 Missense_Mutation T T C TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000393386 p.Y1782H EYA1 chr8 71244610 71244610 Missense_Mutation T T C TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000340726 p.D378G CPEB3 chr10 92111114 92111115 Frame_Shift_Del AG AG - TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000265997 p.Y512Pfs*22 KRT6A chr12 52492791 52492791 Missense_Mutation C C T TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000330722 p.G133E LRP1 chr12 57195299 57195301 In_Frame_Del CTC CTC - TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000243077 p.S2780del CUX2 chr12 111310633 111310633 Silent G G A TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000261726 p.S617S IFT140 chr16 1520262 1520262 Missense_Mutation T T C TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000426508 p.I1248V PPL chr16 4885554 4885556 In_Frame_Del AGG AGG - TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000345988 p.L1034del RBBP6 chr16 24571387 24571388 Frame_Shift_Del AA AA - TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000319715 p.L1443Vfs*8 MC2R chr18 13884745 13884745 Silent G G A TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000327606 p.F258F CIC chr19 42289063 42289066 Frame_Shift_Del CAGT CAGT - TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000575354 p.S370Rfs*6 CIC chr19 42294911 42294913 In_Frame_Del AGA AGA - TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000575354 p.K1517del ZNF135 chr19 58067197 58067200 Frame_Shift_Del GAGA GAGA - TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000313434 p.E239Dfs*9 SLC7A4 chr22 21031382 21031383 Frame_Shift_Del AT AT - TCGA-R8-A6MK-01A-11D-A32B-08 ENST00000382932 p.M144Vfs*10 CYP4Z2P chr1 46868058 46868058 RNA G G A TCGA-DU-8164-01A-11D-2253-08 ENST00000423332 ERICH3 chr1 74573168 74573168 Missense_Mutation C C A TCGA-DU-8164-01A-11D-2253-08 ENST00000326665 p.V848F FUBP1 chr1 77965204 77965204 Frame_Shift_Del A - - TCGA-DU-8164-01A-11D-2253-08 ENST00000370768 p.I167Mfs*25 NUP210L chr1 154089582 154089582 Nonsense_Mutation G G A TCGA-DU-8164-01A-11D-2253-08 ENST00000368559 p.R734* TTN chr2 178570977 178570977 Missense_Mutation C C T TCGA-DU-8164-01A-11D-2253-08 ENST00000591111 p.R23411H HIBCH chr2 190319764 190319764 5'UTR G G T TCGA-DU-8164-01A-11D-2253-08 ENST00000359678 HIBCH chr2 190319765 190319765 5'UTR A A T TCGA-DU-8164-01A-11D-2253-08 ENST00000359678 IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-DU-8164-01A-11D-2253-08 ENST00000345146 p.R132H SETD2 chr3 47113904 47113904 Missense_Mutation C C G TCGA-DU-8164-01A-11D-2253-08 ENST00000409792 p.G1563R PIK3CA chr3 179210291 179210291 Missense_Mutation G G A TCGA-DU-8164-01A-11D-2253-08 ENST00000263967 p.E453K IGJ chr4 70662136 70662136 Silent G G A TCGA-DU-8164-01A-11D-2253-08 ENST00000254801 p.S48S SOWAHB chr4 76896868 76896868 Missense_Mutation A A C TCGA-DU-8164-01A-11D-2253-08 ENST00000334306 p.W328G FST chr5 53485845 53485845 Intron G G T TCGA-DU-8164-01A-11D-2253-08 ENST00000256759 ARSK chr5 95583188 95583188 Missense_Mutation G G T TCGA-DU-8164-01A-11D-2253-08 ENST00000380009 p.W230L TENM2 chr5 168247699 168247699 Missense_Mutation A A G TCGA-DU-8164-01A-11D-2253-08 ENST00000518659 p.I2254V LRFN2 chr6 40432941 40432941 Missense_Mutation C C T TCGA-DU-8164-01A-11D-2253-08 ENST00000338305 p.R58H PTCD1 chr7 99424899 99424899 Missense_Mutation C C A TCGA-DU-8164-01A-11D-2253-08 ENST00000292478 p.V545F FANCC chr9 95247432 95247432 Missense_Mutation C C T TCGA-DU-8164-01A-11D-2253-08 ENST00000289081 p.D84N NIPSNAP3B chr9 104768878 104768878 Missense_Mutation G G A TCGA-DU-8164-01A-11D-2253-08 ENST00000374762 p.R96Q PTPRO chr12 15501633 15501633 Silent T T C TCGA-DU-8164-01A-11D-2253-08 ENST00000281171 p.P225P RGS6 chr14 72495220 72495220 Missense_Mutation C C A TCGA-DU-8164-01A-11D-2253-08 ENST00000553530 p.P308H ATP8B4 chr15 49897393 49897393 Missense_Mutation A A C TCGA-DU-8164-01A-11D-2253-08 ENST00000284509 p.Y866D ZNF688 chr16 30570194 30570194 Missense_Mutation A A T TCGA-DU-8164-01A-11D-2253-08 ENST00000223459 p.C185S HOXB8 chr17 48614502 48614502 Missense_Mutation G G A TCGA-DU-8164-01A-11D-2253-08 ENST00000239144 p.P68L DCC chr18 53205294 53205294 Missense_Mutation C C T TCGA-DU-8164-01A-11D-2253-08 ENST00000442544 p.P551L ELANE chr19 852344 852344 Nonsense_Mutation C C T TCGA-DU-8164-01A-11D-2253-08 ENST00000263621 p.R6* FEM1A chr19 4792839 4792839 Missense_Mutation C C T TCGA-DU-8164-01A-11D-2253-08 ENST00000269856 p.R329C KXD1 chr19 18568621 18568621 Missense_Mutation C C T TCGA-DU-8164-01A-11D-2253-08 ENST00000222307 p.T174M IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-FG-7641-01B-11D-2253-08 ENST00000345146 p.R132H EPHA4 chr2 221456675 221456675 Missense_Mutation C C T TCGA-FG-7641-01B-11D-2253-08 ENST00000281821 p.R514Q HTRA3 chr4 8291481 8291481 Missense_Mutation G G A TCGA-FG-7641-01B-11D-2253-08 ENST00000307358 p.V274I DNAH5 chr5 13765992 13765992 Missense_Mutation A A G TCGA-FG-7641-01B-11D-2253-08 ENST00000265104 p.F3362S VCAN chr5 83553462 83553462 Missense_Mutation C C T TCGA-FG-7641-01B-11D-2253-08 ENST00000265077 p.R3198C DCANP1 chr5 135447100 135447100 Silent G G A TCGA-FG-7641-01B-11D-2253-08 ENST00000503143 p.Y3Y PCDHB5 chr5 141137107 141137107 Missense_Mutation C C T TCGA-FG-7641-01B-11D-2253-08 ENST00000231134 p.P558L MAS1L chr6 29486847 29486847 Silent G G A TCGA-FG-7641-01B-11D-2253-08 ENST00000377127 p.I352I RHAG chr6 49615689 49615689 Missense_Mutation G G T TCGA-FG-7641-01B-11D-2253-08 ENST00000371175 p.S192Y PARP12 chr7 140034311 140034311 Missense_Mutation C C T TCGA-FG-7641-01B-11D-2253-08 ENST00000263549 p.V449I KCNB2 chr8 72567912 72567912 Missense_Mutation C C T TCGA-FG-7641-01B-11D-2253-08 ENST00000523207 p.R60C UHRF1BP1L chr12 100108386 100108386 Splice_Region C C T TCGA-FG-7641-01B-11D-2253-08 ENST00000279907 p.R69R PTPN11 chr12 112450335 112450335 Missense_Mutation C C G TCGA-FG-7641-01B-11D-2253-08 ENST00000351677 p.T52S CCDC113 chr16 58262434 58262434 Missense_Mutation A A G TCGA-FG-7641-01B-11D-2253-08 ENST00000219299 p.K226R NUP88 chr17 5408798 5408798 Silent T T A TCGA-FG-7641-01B-11D-2253-08 ENST00000573584 p.A264A USP32P3 chr17 20426845 20426845 RNA A A G TCGA-FG-7641-01B-11D-2253-08 ENST00000413270 CACNG5 chr17 66884774 66884774 Intron A A G TCGA-FG-7641-01B-11D-2253-08 ENST00000307139 QTRT1 chr19 10713259 10713259 Missense_Mutation A A T TCGA-FG-7641-01B-11D-2253-08 ENST00000250237 p.T401S CIC chr19 42287576 42287576 Missense_Mutation A A G TCGA-FG-7641-01B-11D-2253-08 ENST00000575354 p.N205S CIC chr19 42287644 42287644 Missense_Mutation C C T TCGA-FG-7641-01B-11D-2253-08 ENST00000575354 p.R228W ZBTB45 chr19 58517557 58517557 Missense_Mutation A A C TCGA-FG-7641-01B-11D-2253-08 ENST00000354590 p.I39M ATAD3C chr1 1460902 1460902 Missense_Mutation C C A TCGA-HT-7611-01A-11D-2395-08 ENST00000378785 p.A322D RNF19B chr1 32937065 32937065 Missense_Mutation C C T TCGA-HT-7611-01A-11D-2395-08 ENST00000373456 p.C647Y LCE3C chr1 152600904 152600904 Missense_Mutation G A A TCGA-HT-7611-01A-11D-2395-08 ENST00000333881 p.R58K SNAPIN chr1 153661280 153661280 Silent C C T TCGA-HT-7611-01A-11D-2395-08 ENST00000368685 p.P130P TTN chr2 178553061 178553061 Nonsense_Mutation G G A TCGA-HT-7611-01A-11D-2395-08 ENST00000591111 p.R28306* IDH1 chr2 208248389 208248389 Missense_Mutation G G C TCGA-HT-7611-01A-11D-2395-08 ENST00000345146 p.R132G PLEKHG4B chr5 161803 161803 Silent A A G TCGA-HT-7611-01A-11D-2395-08 ENST00000283426 p.L480L KIAA0319 chr6 24566622 24566622 Missense_Mutation C C A TCGA-HT-7611-01A-11D-2395-08 ENST00000378214 p.R756L HIST1H4C chr6 26104099 26104099 Missense_Mutation T T C TCGA-HT-7611-01A-11D-2395-08 ENST00000377803 p.I51T AOC1 chr7 150858990 150858990 Missense_Mutation A A G TCGA-HT-7611-01A-11D-2395-08 ENST00000360937 p.M600V VCP chr9 35057055 35057055 3'UTR G G A TCGA-HT-7611-01A-11D-2395-08 ENST00000358901 TRPM6 chr9 74762175 74762175 Missense_Mutation A A G TCGA-HT-7611-01A-11D-2395-08 ENST00000360774 p.L1499P OR1Q1 chr9 122615416 122615416 Missense_Mutation C C T TCGA-HT-7611-01A-11D-2395-08 ENST00000297913 p.R227W ABO chr9 133256340 133256340 Missense_Mutation T T C TCGA-HT-7611-01A-11D-2395-08 ENST00000611156 p.K130E CDC42BPG chr11 64835537 64835537 Missense_Mutation C C T TCGA-HT-7611-01A-11D-2395-08 ENST00000342711 p.A615T FOXM1 chr12 2874116 2874117 Frame_Shift_Del GA GA - TCGA-HT-7611-01A-11D-2395-08 ENST00000359843 p.L121Pfs*9 STOML3 chr13 38990691 38990691 Nonsense_Mutation G G A TCGA-HT-7611-01A-11D-2395-08 ENST00000379631 p.Q11* IGHD5-12 chr14 105902655 105902655 Missense_Mutation G G A TCGA-HT-7611-01A-11D-2395-08 ENST00000390581 p.T6M CHRM5 chr15 34064056 34064056 Missense_Mutation A A G TCGA-HT-7611-01A-11D-2395-08 ENST00000383263 p.I447V RP11-24M17.5 chr15 75775652 75775652 RNA G G A TCGA-HT-7611-01A-11D-2395-08 ENST00000566174 C16orf89 chr16 5044570 5044570 3'UTR C C T TCGA-HT-7611-01A-11D-2395-08 ENST00000315997 GPRC5B chr16 19872504 19872504 Silent G G T TCGA-HT-7611-01A-11D-2395-08 ENST00000300571 p.I114I CHD9 chr16 53314906 53314906 Missense_Mutation T T A TCGA-HT-7611-01A-11D-2395-08 ENST00000398510 p.D2482E TP53 chr17 7673763 7673763 Missense_Mutation T T C TCGA-HT-7611-01A-11D-2395-08 ENST00000269305 p.E286G TMEM98 chr17 32941063 32941063 3'UTR A A G TCGA-HT-7611-01A-11D-2395-08 ENST00000394642 IFI35 chr17 43014219 43014219 Missense_Mutation G G A TCGA-HT-7611-01A-11D-2395-08 ENST00000415816 p.G261R CYP4F8 chr19 15623221 15623221 Missense_Mutation G G A TCGA-HT-7611-01A-11D-2395-08 ENST00000612078 p.R255H FCGBP chr19 39875586 39875586 Missense_Mutation C C T TCGA-HT-7611-01A-11D-2395-08 ENST00000616721 p.V3469M ATRX chrX 77683109 77683113 Frame_Shift_Del AATTT AATTT - TCGA-HT-7611-01A-11D-2395-08 ENST00000373344 p.K715Afs*4 ZSCAN20 chr1 33494715 33494715 Missense_Mutation G G C TCGA-DU-A7T8-01A-21D-A34J-08 ENST00000361328 p.E791Q LRRC7 chr1 70121927 70121927 3'UTR T T C TCGA-DU-A7T8-01A-21D-A34J-08 ENST00000035383 LHX8 chr1 75130641 75130641 5'UTR A A C TCGA-DU-A7T8-01A-21D-A34J-08 ENST00000294638 NBPF25P chr1 145578886 145578886 RNA T T C TCGA-DU-A7T8-01A-21D-A34J-08 ENST00000619932 CASP8 chr2 201285004 201285004 Missense_Mutation G G A TCGA-DU-A7T8-01A-21D-A34J-08 ENST00000432109 p.A331T IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-DU-A7T8-01A-21D-A34J-08 ENST00000345146 p.R132H VIL1 chr2 218440744 218440744 Missense_Mutation A A G TCGA-DU-A7T8-01A-21D-A34J-08 ENST00000248444 p.D751G APPL1 chr3 57260014 57260014 Frame_Shift_Del T T - TCGA-DU-A7T8-01A-21D-A34J-08 ENST00000288266 p.L552* MDN1 chr6 89688151 89688151 Missense_Mutation A A C TCGA-DU-A7T8-01A-21D-A34J-08 ENST00000369393 p.I3761S ZNF394 chr7 99500130 99500130 5'UTR T T C TCGA-DU-A7T8-01A-21D-A34J-08 ENST00000337673 CYP11B2 chr8 142917803 142917803 Missense_Mutation G G A TCGA-DU-A7T8-01A-21D-A34J-08 ENST00000323110 p.A13V GRIA4 chr11 105898425 105898425 Missense_Mutation A A G TCGA-DU-A7T8-01A-21D-A34J-08 ENST00000282499 p.K295E IPO8 chr12 30690540 30690540 Missense_Mutation C C T TCGA-DU-A7T8-01A-21D-A34J-08 ENST00000256079 p.R41Q CLMN chr14 95203232 95203232 Missense_Mutation T T C TCGA-DU-A7T8-01A-21D-A34J-08 ENST00000298912 p.E706G GPR132 chr14 105051677 105051677 Missense_Mutation G G A TCGA-DU-A7T8-01A-21D-A34J-08 ENST00000329797 p.R154C IGHG1 chr14 106518653 106518653 Intron G G A TCGA-DU-A7T8-01A-21D-A34J-08 ENST00000618756 FHOD1 chr16 67234088 67234088 Missense_Mutation G G A TCGA-DU-A7T8-01A-21D-A34J-08 ENST00000258201 p.L539F TP53 chr17 7676011 7676011 Missense_Mutation T T C TCGA-DU-A7T8-01A-21D-A34J-08 ENST00000269305 p.K120E ATRX chrX 77683883 77683883 Nonsense_Mutation G T T TCGA-DU-A7T8-01A-21D-A34J-08 ENST00000373344 p.S458* LCE5A chr1 152511726 152511727 Frame_Shift_Ins - - G TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000334269 p.G66Wfs*111 LCE5A chr1 152511734 152511749 Frame_Shift_Del GCTGCCTGAGCCACCA GCTGCCTGAGCCACCA - TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000334269 p.C67Sfs*65 HMCN1 chr1 186001339 186001339 Missense_Mutation T T C TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000271588 p.S1371P TMEM183A chr1 203022996 203022997 Frame_Shift_Del TT TT - TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000367242 p.F363* ARID4B chr1 235182003 235182004 Frame_Shift_Del CA CA - TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000264183 p.V972Gfs*2 HEATR5B chr2 37013887 37013890 Frame_Shift_Del CTCT CTCT - TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000233099 p.E1412Vfs*22 INSIG2 chr2 118108290 118108291 Frame_Shift_Del AA AA - TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000245787 p.K216Sfs*30 IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000345146 p.R132H MAP2 chr2 209709947 209709947 Missense_Mutation G G A TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000360351 p.G1589D ERBB4 chr2 211713571 211713571 Missense_Mutation T T C TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000342788 p.K321E ZNF142 chr2 218642843 218642843 Missense_Mutation T T C TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000411696 p.I1225V ALPI chr2 232458285 232458285 Missense_Mutation G G A TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000295463 p.D354N ZBTB20 chr3 114339381 114339383 In_Frame_Del AAG AAG - TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000474710 p.L617del FOXL2NB chr3 138950211 138950211 Intron G G A TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000383165 U2SURP chr3 143022538 143022538 Silent A A C TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000473835 p.G298G PTX3 chr3 157436917 157436918 5'UTR TT TT - TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000295927 MUC7 chr4 70480949 70480949 Missense_Mutation C C T TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000304887 p.R69C DDX60L chr4 168461943 168461943 Missense_Mutation G G A TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000260184 p.T121M DHX29 chr5 55289416 55289417 Frame_Shift_Del AA AA - TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000251636 p.L307Rfs*7 C5orf24 chr5 134855141 134855143 In_Frame_Del AAG AAG - TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000338051 p.K82del PCDHB6 chr5 141157877 141157877 3'Flank C C - TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000231136 HIST1H1D chr6 26234560 26234560 Missense_Mutation C C A TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000244534 p.G125V SNX8 chr7 2251147 2251147 3'Flank T T - TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000222990 TMEM168 chr7 112784024 112784024 Missense_Mutation C C T TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000312814 p.V268I OR2A12 chr7 144095867 144095867 Missense_Mutation G G A TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000408949 p.A254T SSPO chr7 149777722 149777722 Missense_Mutation C C T TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000378016 p.R204C OPRK1 chr8 53229799 53229799 Missense_Mutation A A G TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000265572 p.F214S MSC chr8 71844127 71844127 Nonsense_Mutation G G A TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000325509 p.Q18* PNPLA7 chr9 137462036 137462036 Silent C C T TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000277531 p.V1192V MRC1 chr10 17907579 17907579 Nonsense_Mutation G G A TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000569591 p.W1320* CFAP43 chr10 104182381 104182381 Silent G G A TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000357060 p.S758S INPP5A chr10 132710442 132710442 Silent C C T TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000368594 p.G211G RSF1 chr11 77702448 77702448 Missense_Mutation C C T TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000308488 p.D261N GRM5 chr11 88653307 88653307 Missense_Mutation C C G TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000305447 p.W336C KMT2D chr12 49031174 49031176 Splice_Site CCT CCT - TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000301067 p.X4510_splice KRT71 chr12 52552855 52552855 Missense_Mutation G G A TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000267119 p.R75W HECTD4 chr12 112167907 112167910 Frame_Shift_Del GAAA GAAA - TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000550722 p.F3939Afs*36 ANAPC5 chr12 121337314 121337314 Missense_Mutation A A T TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000261819 p.F246I KIF26A chr14 104166892 104166894 In_Frame_Del GAA GAA - TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000423312 p.K321del DMXL2 chr15 51480707 51480709 In_Frame_Del TCT TCT - TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000251076 p.R2133del DNAJA4 chr15 78274392 78274394 In_Frame_Del AGA AGA - TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000343789 p.K207del DNM1P47 chr15 101759775 101759775 RNA G G T TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000561463 ZKSCAN2 chr16 25256751 25256754 Frame_Shift_Del TCTT TCTT - TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000328086 p.K125Rfs*5 MMP15 chr16 58043242 58043242 Missense_Mutation C C G TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000219271 p.L446V CNTNAP4 chr16 76427599 76427602 Splice_Site AGTA AGTA - TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000611870 p.X180_splice OR1A2 chr17 3198127 3198127 Silent C C T TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000381951 p.V203V DNAJC7 chr17 41981958 41981960 In_Frame_Del CTT CTT - TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000457167 p.K427del PNPLA6 chr19 7561311 7561311 Silent C C T TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000414982 p.S1349S NCCRP1 chr19 39200434 39200434 Missense_Mutation C C A TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000339852 p.H213N CFAP61 chr20 20075505 20075505 Silent T T C TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000245957 p.T152T BCOR chrX 40073020 40073021 Frame_Shift_Ins - - T TCGA-S9-A6WL-01A-21D-A33T-08 ENST00000378444 p.H776Tfs*41 CEP104 chr1 3852305 3852305 Missense_Mutation G G A TCGA-DU-6394-01A-11D-1705-08 ENST00000378230 p.R35W FUBP1 chr1 77968164 77968167 Splice_Site CAGT CAGT - TCGA-DU-6394-01A-11D-1705-08 ENST00000370768 p.X83_splice IDH1 chr2 208248388 208248388 Missense_Mutation C C T TCGA-DU-6394-01A-11D-1705-08 ENST00000345146 p.R132H HGD chr3 120638491 120638491 Frame_Shift_Del C C - TCGA-DU-6394-01A-11D-1705-08 ENST00000283871 p.V324Lfs*16 SMC4 chr3 160419511 160419511 Missense_Mutation T T A TCGA-DU-6394-01A-11D-1705-08 ENST00000344722 p.S609T TXK chr4 48112387 48112387 Silent A A G TCGA-DU-6394-01A-11D-1705-08 ENST00000264316 p.N100N WDFY3 chr4 84810176 84810178 In_Frame_Del GAA GAA - TCGA-DU-6394-01A-11D-1705-08 ENST00000295888 p.L685del NPY1R chr4 163325967 163325967 Silent G G A TCGA-DU-6394-01A-11D-1705-08 ENST00000296533 p.Y196Y ZDHHC11 chr5 814761 814761 Missense_Mutation C C G TCGA-DU-6394-01A-11D-1705-08 ENST00000283441 p.G394A PIK3R1 chr5 68295277 68295279 In_Frame_Del TAA TAA - TCGA-DU-6394-01A-11D-1705-08 ENST00000521381 p.K567del MAN2A1 chr5 109713729 109713732 Frame_Shift_Del CTGT CTGT - TCGA-DU-6394-01A-11D-1705-08 ENST00000261483 p.F118Lfs*19 DNAH8 chr6 38722823 38722823 5'Flank C C T TCGA-DU-6394-01A-11D-1705-08 ENST00000359357 HDAC2 chr6 113956678 113956680 In_Frame_Del TCT TCT - TCGA-DU-6394-01A-11D-1705-08 ENST00000519065 p.E99del THEMIS chr6 127813929 127813929 Nonsense_Mutation G G A TCGA-DU-6394-01A-11D-1705-08 ENST00000368248 p.R238* NOTCH1 chr9 136497545 136497546 Frame_Shift_Del AG AG - TCGA-DU-6394-01A-11D-1705-08 ENST00000277541 p.L2065Vfs*202 NOTCH1 chr9 136500711 136500714 Frame_Shift_Del GTCT GTCT - TCGA-DU-6394-01A-11D-1705-08 ENST00000277541 p.D1925Afs*55 NOS1 chr12 117232085 117232085 Silent G G A TCGA-DU-6394-01A-11D-1705-08 ENST00000317775 p.T1094T NPAS3 chr14 33794046 33794046 Splice_Site T T G TCGA-DU-6394-01A-11D-1705-08 ENST00000356141 p.X434_splice JAG2 chr14 105149282 105149282 Silent G G A TCGA-DU-6394-01A-11D-1705-08 ENST00000331782 p.N547N ENKD1 chr16 67666136 67666136 Missense_Mutation C C T TCGA-DU-6394-01A-11D-1705-08 ENST00000243878 p.R72H PHLPP2 chr16 71658694 71658696 In_Frame_Del TGT TGT - TCGA-DU-6394-01A-11D-1705-08 ENST00000568954 p.N702del NF1 chr17 31219018 31219019 Frame_Shift_Del AG AG - TCGA-DU-6394-01A-11D-1705-08 ENST00000358273 p.Q514Rfs*43 NF1 chr17 31343137 31343137 Splice_Site T T A TCGA-DU-6394-01A-11D-1705-08 ENST00000358273 p.X2397_splice NT5C chr17 75130580 75130580 Missense_Mutation C C A TCGA-DU-6394-01A-11D-1705-08 ENST00000245552 p.V172F NPTX1 chr17 80470860 80470860 Missense_Mutation C C T TCGA-DU-6394-01A-11D-1705-08 ENST00000306773 p.G418R GADD45B chr19 2476507 2476507 Intron G G C TCGA-DU-6394-01A-11D-1705-08 ENST00000215631 PLIN4 chr19 4510902 4510904 In_Frame_Del TGG TGG - TCGA-DU-6394-01A-11D-1705-08 ENST00000301286 p.T1005del FKBP8 chr19 18539418 18539418 Silent C C T TCGA-DU-6394-01A-11D-1705-08 ENST00000222308 p.T168T IRF2BP1 chr19 45884120 45884120 Missense_Mutation C A A TCGA-DU-6394-01A-11D-1705-08 ENST00000302165 p.C552F PHACTR3 chr20 59806052 59806052 Missense_Mutation C C T TCGA-DU-6394-01A-11D-1705-08 ENST00000371015 p.R396W KRTAP13-1 chr21 30396516 30396516 Missense_Mutation G G A TCGA-DU-6394-01A-11D-1705-08 ENST00000355459 p.V144I PWP2 chr21 44120474 44120474 Missense_Mutation G A A TCGA-DU-6394-01A-11D-1705-08 ENST00000291576 p.V439M FRMPD4 chrX 12683549 12683549 Missense_Mutation C T T TCGA-DU-6394-01A-11D-1705-08 ENST00000380682 p.R179C BCORL1 chrX 130013281 130013283 In_Frame_Del AGA AGA - TCGA-DU-6394-01A-11D-1705-08 ENST00000218147 p.K171del WRAP73 chr1 3635269 3635269 Missense_Mutation T T C TCGA-WY-A85C-01A-11D-A36O-08 ENST00000270708 p.D210G COL24A1 chr1 86125926 86125926 Nonsense_Mutation A A T TCGA-WY-A85C-01A-11D-A36O-08 ENST00000370571 p.L137* LRRC52 chr1 165563579 165563579 Nonsense_Mutation C C T TCGA-WY-A85C-01A-11D-A36O-08 ENST00000294818 p.R233* FAM129A chr1 184808212 184808212 Silent A A G TCGA-WY-A85C-01A-11D-A36O-08 ENST00000367511 p.L399L IDH1 chr2 208248389 208248389 Missense_Mutation G G C TCGA-WY-A85C-01A-11D-A36O-08 ENST00000345146 p.R132G POGLUT1 chr3 119477386 119477386 Nonsense_Mutation C C T TCGA-WY-A85C-01A-11D-A36O-08 ENST00000295588 p.R132* SNX25 chr4 185342062 185342062 Nonsense_Mutation G G A TCGA-WY-A85C-01A-11D-A36O-08 ENST00000264694 p.W547* DDX4 chr5 55787939 55787939 Missense_Mutation G G T TCGA-WY-A85C-01A-11D-A36O-08 ENST00000505374 p.V371L MEF2C chr5 88722552 88722552 3'UTR G G A TCGA-WY-A85C-01A-11D-A36O-08 ENST00000437473 EFNA5 chr5 107381213 107381213 3'UTR G G A TCGA-WY-A85C-01A-11D-A36O-08 ENST00000333274 SLIT3 chr5 168883287 168883287 Missense_Mutation C C T TCGA-WY-A85C-01A-11D-A36O-08 ENST00000519560 p.G155S GPRC6A chr6 116809504 116809504 Missense_Mutation C C A TCGA-WY-A85C-01A-11D-A36O-08 ENST00000310357 p.C103F ROS1 chr6 117342533 117342533 Missense_Mutation G G C TCGA-WY-A85C-01A-11D-A36O-08 ENST00000368508 p.D1512E DNAH11 chr7 21742100 21742100 Frame_Shift_Del C C - TCGA-WY-A85C-01A-11D-A36O-08 ENST00000409508 p.L2698Yfs*13 CLK2P1 chr7 23585355 23585355 RNA G G T TCGA-WY-A85C-01A-11D-A36O-08 ENST00000416636 REXO1L1P chr8 85655114 85655114 3'Flank T T A TCGA-WY-A85C-01A-11D-A36O-08 ENST00000379010 GEM chr8 94260213 94260213 Silent A A G TCGA-WY-A85C-01A-11D-A36O-08 ENST00000297596 p.G97G SLK chr10 104005651 104005651 Frame_Shift_Del A A - TCGA-WY-A85C-01A-11D-A36O-08 ENST00000369755 p.T814Qfs*21 SLK chr10 104005652 104005652 Missense_Mutation C C T TCGA-WY-A85C-01A-11D-A36O-08 ENST00000369755 p.T814I RP11-564D11.3 chr10 122888466 122888466 RNA A A G TCGA-WY-A85C-01A-11D-A36O-08 ENST00000368895 PHLDB1 chr11 118642290 118642303 Frame_Shift_Del CAGTGGTACCAGGA CAGTGGTACCAGGA - TCGA-WY-A85C-01A-11D-A36O-08 ENST00000361417 p.Q925Afs*73 CHD4 chr12 6581131 6581131 Missense_Mutation C C T TCGA-WY-A85C-01A-11D-A36O-08 ENST00000357008 p.V1608I MDM2 chr12 68816889 68816889 Silent A A C TCGA-WY-A85C-01A-11D-A36O-08 ENST00000258149 p.S84S HECTD4 chr12 112167373 112167373 Nonsense_Mutation G G A TCGA-WY-A85C-01A-11D-A36O-08 ENST00000550722 p.Q4026* MTUS2 chr13 29026588 29026588 Missense_Mutation G G T TCGA-WY-A85C-01A-11D-A36O-08 ENST00000612955 p.K640N TTBK2 chr15 42746206 42746206 Missense_Mutation G G C TCGA-WY-A85C-01A-11D-A36O-08 ENST00000267890 p.F1108L C16orf78 chr16 49399254 49399254 Silent C C T TCGA-WY-A85C-01A-11D-A36O-08 ENST00000299191 p.T258T PHLPP2 chr16 71648784 71648784 3'UTR A A - TCGA-WY-A85C-01A-11D-A36O-08 ENST00000568954 TP53 chr17 7675088 7675088 Missense_Mutation C C T TCGA-WY-A85C-01A-11D-A36O-08 ENST00000269305 p.R175H TP53 chr17 7676398 7676398 Frame_Shift_Del G G - TCGA-WY-A85C-01A-11D-A36O-08 ENST00000269305 p.P27Lfs*17 MYH13 chr17 10309574 10309574 Missense_Mutation C C T TCGA-WY-A85C-01A-11D-A36O-08 ENST00000252172 p.R1638H KRT16P6 chr17 16820667 16820667 RNA C C T TCGA-WY-A85C-01A-11D-A36O-08 ENST00000417510 TBX22 chrX 80030647 80030647 Missense_Mutation G A A TCGA-WY-A85C-01A-11D-A36O-08 ENST00000373294 p.V367I IL20RB chr3 137010229 137010229 3'UTR C C T TCGA-QH-A6CS-01A-11D-A31L-08 ENST00000329582 APBB2 chr4 40816238 40816238 Missense_Mutation C C A TCGA-QH-A6CS-01A-11D-A31L-08 ENST00000295974 p.V711L FBXW7 chr4 152322940 152322940 Missense_Mutation G G A TCGA-QH-A6CS-01A-11D-A31L-08 ENST00000281708 p.R689W SPATA4 chr4 176192796 176192796 Missense_Mutation C C A TCGA-QH-A6CS-01A-11D-A31L-08 ENST00000280191 p.Q173H PCDHA7 chr5 140835736 140835736 Silent C C T TCGA-QH-A6CS-01A-11D-A31L-08 ENST00000525929 p.N451N PCDHB9 chr5 141187888 141187888 Missense_Mutation A A G TCGA-QH-A6CS-01A-11D-A31L-08 ENST00000316105 p.I190M KCNIP1 chr5 170732828 170732828 Missense_Mutation A A G TCGA-QH-A6CS-01A-11D-A31L-08 ENST00000411494 p.Y166C EIF2AK1 chr7 6054646 6054646 Missense_Mutation G G T TCGA-QH-A6CS-01A-11D-A31L-08 ENST00000199389 p.F59L AZGP1 chr7 99968162 99968162 Silent G G A TCGA-QH-A6CS-01A-11D-A31L-08 ENST00000292401 p.D202D UTP23 chr8 116771745 116771745 Missense_Mutation A A G TCGA-QH-A6CS-01A-11D-A31L-08 ENST00000309822 p.Q218R PTEN chr10 87961046 87961047 Frame_Shift_Ins - - A TCGA-QH-A6CS-01A-11D-A31L-08 ENST00000371953 p.T319Nfs*6 SYT8 chr11 1835050 1835050 Intron C C T TCGA-QH-A6CS-01A-11D-A31L-08 ENST00000381968 CCDC53 chr12 102039967 102039967 Silent T T C TCGA-QH-A6CS-01A-11D-A31L-08 ENST00000240079 p.T112T HERC2 chr15 28233531 28233531 Missense_Mutation C C T TCGA-QH-A6CS-01A-11D-A31L-08 ENST00000261609 p.G1461D NF1 chr17 31325956 31325956 Frame_Sh