Hugo_Symbol Chromosome Start_Position End_Position Variant_Classification Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 Tumor_Sample_Barcode transcript_name amino_acid_change OR6K2 chr1 158700106 158700106 Missense_Mutation C C T TCGA-G7-7502-01A-11D-2201-08 ENST00000359610 p.V183M IFI16 chr1 159049485 159049485 Silent G G T TCGA-G7-7502-01A-11D-2201-08 ENST00000295809 p.L517L PAPPA2 chr1 176771141 176771141 Missense_Mutation G G T TCGA-G7-7502-01A-11D-2201-08 ENST00000367662 p.G1559V KDM3A chr2 86489625 86489626 In_Frame_Ins - - GGG TCGA-G7-7502-01A-11D-2201-08 ENST00000312912 p.K1180_D1181insG STK36 chr2 218692247 218692247 Silent C C G TCGA-G7-7502-01A-11D-2201-08 ENST00000295709 p.L623L ECEL1 chr2 232486087 232486087 Silent G G A TCGA-G7-7502-01A-11D-2201-08 ENST00000304546 p.D189D JAGN1 chr3 9892992 9892992 Missense_Mutation G G A TCGA-G7-7502-01A-11D-2201-08 ENST00000307768 p.S56N DAG1 chr3 49531208 49531208 Frame_Shift_Del A A - TCGA-G7-7502-01A-11D-2201-08 ENST00000308775 p.N233Tfs*34 APEH chr3 49683256 49683256 Missense_Mutation A A G TCGA-G7-7502-01A-11D-2201-08 ENST00000296456 p.S705G ABHD14A-ACY1 chr3 51988522 51988522 Splice_Site A A C TCGA-G7-7502-01A-11D-2201-08 ENST00000463937 p.X409_splice STAB1 chr3 52520275 52520275 Nonsense_Mutation C C A TCGA-G7-7502-01A-11D-2201-08 ENST00000321725 p.C1828* MYH15 chr3 108391763 108391763 Silent G G A TCGA-G7-7502-01A-11D-2201-08 ENST00000273353 p.S1829S FAM162A chr3 122409774 122409774 Silent C C T TCGA-G7-7502-01A-11D-2201-08 ENST00000477892 p.N136N N4BP2 chr4 40121350 40121350 Frame_Shift_Del A A - TCGA-G7-7502-01A-11D-2201-08 ENST00000261435 p.S1081Vfs*24 EHMT2 chr6 31896965 31896965 Missense_Mutation C C A TCGA-G7-7502-01A-11D-2201-08 ENST00000375537 p.A23S BRD2 chr6 32977489 32977489 Silent T T C TCGA-G7-7502-01A-11D-2201-08 ENST00000374825 p.A416A DNAH8 chr6 38945568 38945568 Missense_Mutation T T C TCGA-G7-7502-01A-11D-2201-08 ENST00000359357 p.F3820L MRPL2 chr6 43056069 43056082 Splice_Site GCCATCTCTCACCT GCCATCTCTCACCT - TCGA-G7-7502-01A-11D-2201-08 ENST00000388752 p.X173_splice SLC35B2 chr6 44256388 44256388 Missense_Mutation G G C TCGA-G7-7502-01A-11D-2201-08 ENST00000393812 p.P105R TMEM30A chr6 75284714 75284714 5'UTR G G A TCGA-G7-7502-01A-11D-2201-08 ENST00000230461 MOXD1 chr6 132372995 132372995 Missense_Mutation A A C TCGA-G7-7502-01A-11D-2201-08 ENST00000367963 p.D138E TXLNB chr6 139242610 139242610 Silent T T C TCGA-G7-7502-01A-11D-2201-08 ENST00000358430 p.A657A HOXA10 chr7 27172076 27172076 Silent C C T TCGA-G7-7502-01A-11D-2201-08 ENST00000283921 p.E352E NRG1 chr8 32605683 32605683 Missense_Mutation G G A TCGA-G7-7502-01A-11D-2201-08 ENST00000405005 p.E134K ADGRA2 chr8 37835389 37835389 Missense_Mutation C C G TCGA-G7-7502-01A-11D-2201-08 ENST00000412232 p.F608L FBXL6 chr8 144357591 144357591 Intron C C A TCGA-G7-7502-01A-11D-2201-08 ENST00000331890 TEK chr9 27229378 27229378 3'UTR C C T TCGA-G7-7502-01A-11D-2201-08 ENST00000380036 GAPVD1 chr9 125359454 125359454 Missense_Mutation G G A TCGA-G7-7502-01A-11D-2201-08 ENST00000394104 p.V1354I OLAH chr10 15065662 15065662 Missense_Mutation G G A TCGA-G7-7502-01A-11D-2201-08 ENST00000378228 p.G161S SLC5A12 chr11 26703816 26703816 Missense_Mutation A A C TCGA-G7-7502-01A-11D-2201-08 ENST00000396005 p.N219K ELF5 chr11 34493434 34493434 Intron T T G TCGA-G7-7502-01A-11D-2201-08 ENST00000312319 AHNAK chr11 62526278 62526278 Frame_Shift_Del G G - TCGA-G7-7502-01A-11D-2201-08 ENST00000378024 p.L2714* LRFN4 chr11 66858154 66858154 Missense_Mutation C C T TCGA-G7-7502-01A-11D-2201-08 ENST00000309602 p.P137L LRP5 chr11 68438461 68438461 Missense_Mutation C C T TCGA-G7-7502-01A-11D-2201-08 ENST00000294304 p.P1376L KMT2D chr12 49039597 49039597 Silent C C G TCGA-G7-7502-01A-11D-2201-08 ENST00000301067 p.L2689L RPH3A chr12 112868496 112868496 Missense_Mutation C C A TCGA-G7-7502-01A-11D-2201-08 ENST00000389385 p.P171T CCDC62 chr12 122801731 122801731 Missense_Mutation A A T TCGA-G7-7502-01A-11D-2201-08 ENST00000253079 p.M529L SLC15A4 chr12 128799381 128799381 Missense_Mutation A A G TCGA-G7-7502-01A-11D-2201-08 ENST00000266771 p.M484T SLITRK1 chr13 83879760 83879760 Missense_Mutation G G A TCGA-G7-7502-01A-11D-2201-08 ENST00000377084 p.A583V UBAC2 chr13 99238520 99238520 Missense_Mutation T T C TCGA-G7-7502-01A-11D-2201-08 ENST00000403766 p.V42A CASC5 chr15 40621869 40621870 Frame_Shift_Del TT TT - TCGA-G7-7502-01A-11D-2201-08 ENST00000346991 p.N561Kfs*2 NEO1 chr15 73135904 73135904 Missense_Mutation G G T TCGA-G7-7502-01A-11D-2201-08 ENST00000261908 p.V298L SCAMP2 chr15 74850629 74850629 Missense_Mutation A A T TCGA-G7-7502-01A-11D-2201-08 ENST00000268099 p.W173R ZSCAN2 chr15 84616323 84616323 Intron G G A TCGA-G7-7502-01A-11D-2201-08 ENST00000448803 ACSM2A chr16 20471159 20471159 Missense_Mutation C C G TCGA-G7-7502-01A-11D-2201-08 ENST00000219054 p.P228R KIAA0556 chr16 27749685 27749685 Missense_Mutation T T A TCGA-G7-7502-01A-11D-2201-08 ENST00000261588 p.S909T SEZ6L2 chr16 29873546 29873546 Missense_Mutation T T A TCGA-G7-7502-01A-11D-2201-08 ENST00000308713 p.K763I HEATR3 chr16 50070177 50070177 Splice_Site G G A TCGA-G7-7502-01A-11D-2201-08 ENST00000299192 p.X134_splice AMFR chr16 56367526 56367526 Missense_Mutation C C A TCGA-G7-7502-01A-11D-2201-08 ENST00000290649 p.R506L HYDIN chr16 70833046 70833046 Missense_Mutation T T A TCGA-G7-7502-01A-11D-2201-08 ENST00000393567 p.K4567N ZNF286B chr17 18671500 18671500 Intron A A C TCGA-G7-7502-01A-11D-2201-08 ENST00000545289 GRB7 chr17 39742335 39742335 Missense_Mutation A A G TCGA-G7-7502-01A-11D-2201-08 ENST00000309156 p.S12G RNF152 chr18 61815721 61815721 3'UTR A A G TCGA-G7-7502-01A-11D-2201-08 ENST00000312828 RANBP3 chr19 5941695 5941695 Missense_Mutation T T C TCGA-G7-7502-01A-11D-2201-08 ENST00000340578 p.E111G DNMT1 chr19 10140056 10140056 Frame_Shift_Del A A - TCGA-G7-7502-01A-11D-2201-08 ENST00000340748 p.S1250Pfs*31 TMED1 chr19 10834999 10835010 In_Frame_Del CCTCCTCGTCAT CCTCCTCGTCAT - TCGA-G7-7502-01A-11D-2201-08 ENST00000214869 p.D130_E133del TMED1 chr19 10835011 10835011 Missense_Mutation C C G TCGA-G7-7502-01A-11D-2201-08 ENST00000214869 p.D130H SUGP1 chr19 19302391 19302391 Splice_Region T T G TCGA-G7-7502-01A-11D-2201-08 ENST00000247001 ZNF101 chr19 19678772 19678772 Silent G G C TCGA-G7-7502-01A-11D-2201-08 ENST00000318110 p.L59L ZFP14 chr19 36340613 36340613 Missense_Mutation A A C TCGA-G7-7502-01A-11D-2201-08 ENST00000270001 p.F405V ZNF776 chr19 57753877 57753877 Frame_Shift_Del T T - TCGA-G7-7502-01A-11D-2201-08 ENST00000317178 p.N249Kfs*143 CHGB chr20 5923284 5923284 Silent T T C TCGA-G7-7502-01A-11D-2201-08 ENST00000378961 p.S380S BPIFA1 chr20 33237857 33237857 Missense_Mutation G G A TCGA-G7-7502-01A-11D-2201-08 ENST00000354297 p.G49E HMGB3P1 chr20 34834408 34834408 RNA A A C TCGA-G7-7502-01A-11D-2201-08 ENST00000393368 MYH7B chr20 34990445 34990445 Intron A A T TCGA-G7-7502-01A-11D-2201-08 ENST00000262873 TUBB1 chr20 59023982 59023982 Silent G G A TCGA-G7-7502-01A-11D-2201-08 ENST00000217133 p.A185A MAP3K7CL chr21 29174812 29174812 Frame_Shift_Del T T - TCGA-G7-7502-01A-11D-2201-08 ENST00000286791 p.L217* COL6A1 chr21 46003972 46003972 Missense_Mutation G G A TCGA-G7-7502-01A-11D-2201-08 ENST00000361866 p.V1016I ARVCF chr22 19978909 19978909 Missense_Mutation G G A TCGA-G7-7502-01A-11D-2201-08 ENST00000263207 p.S523L GUCD1 chr22 24543026 24543026 Missense_Mutation A A T TCGA-G7-7502-01A-11D-2201-08 ENST00000407471 p.F235I CSF2RB chr22 36938403 36938403 Silent G G T TCGA-G7-7502-01A-11D-2201-08 ENST00000403662 p.V865V CSF2RB chr22 36938404 36938404 Missense_Mutation C C T TCGA-G7-7502-01A-11D-2201-08 ENST00000403662 p.P866S CHD5 chr1 6152415 6152415 Silent G G T TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000262450 p.S289S COL16A1 chr1 31652733 31652733 Missense_Mutation C C G TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000373672 p.C1578S GCLM chr1 93894650 93894650 Missense_Mutation A A G TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000370238 p.F207L ATXN7L2 chr1 109492589 109492589 Missense_Mutation A A G TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000369870 p.K720E TRIM33 chr1 114399562 114399562 Silent G G A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000358465 p.T1005T VTCN1 chr1 117156898 117156898 Missense_Mutation T T C TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000369458 p.T41A CCT3 chr1 156309228 156309228 Missense_Mutation C C G TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000295688 p.G537R SPTA1 chr1 158651383 158651383 Missense_Mutation C C G TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000368147 p.G1154A C1orf74 chr1 209783147 209783147 Missense_Mutation T T C TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000294811 p.H163R USH2A chr1 216421961 216421961 Missense_Mutation T T C TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000307340 p.S126G NAT8 chr2 73641654 73641655 5'UTR - - T TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000272425 SMYD1 chr2 88091025 88091025 Missense_Mutation G G C TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000419482 p.G181A DDX18 chr2 117821292 117821292 Missense_Mutation G G A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000263239 p.G216S LRP2 chr2 169205514 169205514 Silent A A G TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000263816 p.Y2560Y NFE2L2 chr2 177230746 177230747 3'UTR - - A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000397062 TTN chr2 178601560 178601560 Silent T T A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000591111 p.V16838V CALCRL chr2 187380680 187380680 Missense_Mutation A A T TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000392370 p.S98T COL5A2 chr2 189179612 189179612 5'UTR T T A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000374866 DNAH7 chr2 195809861 195809861 Missense_Mutation G G T TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000312428 p.L3258I CCNYL1 chr2 207711911 207711911 Silent G G A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000295414 p.L5L ITM2C chr2 230876905 230876905 Missense_Mutation G G C TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000326427 p.E167Q SEC13 chr3 10305077 10305077 Missense_Mutation G G A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000350697 p.P222S CTNNB1 chr3 41227238 41227238 Missense_Mutation G G C TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000349496 p.A323P DAG1 chr3 49531288 49531288 Silent C C G TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000308775 p.S259S CACNA1D chr3 53811138 53811138 Missense_Mutation G G A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000350061 p.R2073H FAM208A chr3 56660929 56660929 Missense_Mutation A A C TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000493960 p.L417V OR5H6 chr3 98265126 98265126 Missense_Mutation C C T TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000383696 p.P281L FAT4 chr4 125451615 125451615 Silent T T C TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000394329 p.T3533T GUSBP1 chr5 21501760 21501760 RNA C C G TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000607545 CDH9 chr5 26890514 26890514 Missense_Mutation G G A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000231021 p.S435L HMGCS1 chr5 43294760 43294761 Frame_Shift_Ins - - GT TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000325110 p.L336Hfs*23 SETD9 chr5 56911242 56911242 Missense_Mutation A A C TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000285947 p.K58Q POU5F2 chr5 93741246 93741246 Silent G G C TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000510627 p.A106A NREP chr5 111976723 111976723 Missense_Mutation T T A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000395634 p.N6I CEP120 chr5 123377501 123377501 Missense_Mutation C C T TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000306467 p.R744H FBN2 chr5 128464741 128464741 Missense_Mutation C C T TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000262464 p.R270H NPM1 chr5 171387982 171387982 Missense_Mutation C C A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000296930 p.L12M GNB2L1 chr5 181243822 181243822 5'UTR C C T TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000512805 ABCF1 chr6 30590668 30590668 Silent G G A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000326195 p.L835L RPL10A chr6 35470177 35470177 Splice_Site A A G TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000322203 p.X104_splice SAYSD1 chr6 39114923 39114923 Missense_Mutation G G C TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000229903 p.P56R SLC29A1 chr6 44233445 44233445 Missense_Mutation G G C TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000371708 p.A430P GPRC6A chr6 116800615 116800615 Missense_Mutation T T A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000310357 p.Q506L DNAJC30 chr7 73683153 73683153 Missense_Mutation A A G TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000395176 p.F91L COPS6 chr7 100089356 100089356 Missense_Mutation T T C TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000303904 p.I48T DUS4L chr7 107576584 107576584 Missense_Mutation G G T TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000265720 p.G233V AGAP3 chr7 151143350 151143350 Missense_Mutation G G T TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000622464 p.K725N C8orf86 chr8 38512388 38512388 Silent T T C TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000358138 p.*224* CYHR1 chr8 144464176 144464176 Intron C C T TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000438911 TTC16 chr9 127727071 127727075 Frame_Shift_Del GGAGG GGAGG - TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000373289 p.E510Qfs*15 TSC1 chr9 132905994 132905994 Silent G G A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000298552 p.G528G CUBN chr10 17129777 17129777 5'UTR G G T TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000377833 SVIL chr10 29532761 29532761 Frame_Shift_Del C C - TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000355867 p.E536Kfs*25 STOX1 chr10 68884804 68884804 Missense_Mutation G G T TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000298596 p.Q336H BMPR1A chr10 86919215 86919215 Missense_Mutation G G C TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000372037 p.Q304H MICAL2 chr11 12242420 12242420 Missense_Mutation A A T TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000256194 p.E848D SLC22A6 chr11 62976767 62976767 3'UTR G G T TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000377871 KAT5 chr11 65712707 65712707 Intron G G A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000377046 PHLDB1 chr11 118627854 118627854 Missense_Mutation G G C TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000361417 p.R344P AEBP2 chr12 19462663 19462663 Silent C C T TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000398864 p.S275S CCDC184 chr12 48185493 48185493 3'UTR G G C TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000316554 KRT73 chr12 52618146 52618146 Missense_Mutation T T G TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000305748 p.K127Q MON2 chr12 62499004 62499004 Missense_Mutation C C G TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000393630 p.T174S RNFT2 chr12 116741067 116741067 Missense_Mutation G G C TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000257575 p.S19T HIP1R chr12 122855583 122855584 Frame_Shift_Ins - - C TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000253083 p.N345Qfs*13 SACS chr13 23355266 23355266 Missense_Mutation G G C TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000382292 p.P449R RNF17 chr13 24799484 24799484 Missense_Mutation A A G TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000255324 p.R497G GPR12 chr13 26759813 26759813 Silent C C T TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000381436 p.L5L MYH7 chr14 23423946 23423946 Silent C C A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000355349 p.L961L SOCS4 chr14 55048488 55048488 3'UTR A A G TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000339298 ALDH6A1 chr14 74064838 74064838 Missense_Mutation T T A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000553458 p.N496I IGHD2-21 chr14 105888574 105888574 Frame_Shift_Del A A - TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000390572 p.I2Nfs*? RYR3 chr15 33649088 33649088 Missense_Mutation T T A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000389232 p.I1332N RYR3 chr15 33649089 33649089 Silent C C T TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000389232 p.I1332I EIF2AK4 chr15 39976723 39976723 Missense_Mutation G G A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000263791 p.E710K LRRC57 chr15 42547367 42547367 Missense_Mutation C C A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000323443 p.S129I EPB42 chr15 43203217 43203217 Missense_Mutation G G T TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000441366 p.N559K SPG21 chr15 64983581 64983581 5'UTR A A G TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000204566 ZSCAN10 chr16 3091820 3091820 Missense_Mutation C C T TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000252463 p.G170S VWA3A chr16 22118913 22118913 Frame_Shift_Del C C - TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000389398 p.R335Gfs*49 HSF4 chr16 67165605 67165605 Silent G G T TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000264009 p.A69A MINK1 chr17 4885556 4885556 Nonsense_Mutation G G A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000355280 p.W194* SLC2A4 chr17 7284494 7284494 Missense_Mutation G G A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000317370 p.R246H SHMT1 chr17 18329371 18329371 Missense_Mutation G G A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000316694 p.R397W FAM106A chr17 18525515 18525515 3'UTR C C T TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000392176 MLLT6 chr17 38724710 38724738 Frame_Shift_Del CCCATGGCCAGCCTGCTGGCAGGAAGCTC CCCATGGCCAGCCTGCTGGCAGGAAGCTC - TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000621332 p.P992Hfs*82 STAT3 chr17 42329767 42329767 Silent C C T TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000264657 p.G373G STAT3 chr17 42329768 42329768 Missense_Mutation C C A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000264657 p.G373V EFTUD2 chr17 44872513 44872513 Silent G G A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000426333 p.F309F NFE2L1 chr17 48051359 48051359 Silent C C A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000362042 p.R81R CLTC chr17 59677011 59677011 Silent T T C TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000269122 p.P873P ABCA10 chr17 69174756 69174756 Missense_Mutation A A G TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000269081 p.W967R AFMID chr17 78191029 78191029 Silent C C A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000409257 p.A41A DCC chr18 52906089 52906089 Missense_Mutation T T G TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000442544 p.M153R TNFRSF11A chr18 62349886 62349886 Missense_Mutation G G C TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000586569 p.D78H KEAP1 chr19 10492091 10492091 Missense_Mutation C C A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000171111 p.V271L ZNF788 chr19 12113598 12113598 Frame_Shift_Del T T - TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000397759 p.Q221Kfs*? SIGLEC1 chr20 3688464 3688464 3'UTR C C G TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000344754 IL17RA chr22 17109145 17109145 Missense_Mutation A A C TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000319363 p.E642D MICAL3 chr22 17817727 17817727 Missense_Mutation C C T TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000441493 p.R1645H MN1 chr22 27797968 27797968 Missense_Mutation T T A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000302326 p.K859I EMID1 chr22 29232305 29232305 Silent C C A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000334018 p.T242T KDM6A chrX 45069759 45069760 Frame_Shift_Ins - - A TCGA-5P-A9KE-01A-11D-A42J-10 ENST00000377967 p.H702Qfs*28 MTOR chr1 11213546 11213546 Silent G G C TCGA-B9-4113-01A-01D-1252-08 ENST00000361445 p.T1046T UBR4 chr1 19163806 19163806 Missense_Mutation C C G TCGA-B9-4113-01A-01D-1252-08 ENST00000375254 p.K1574N EPHA8 chr1 22600693 22600693 Silent A A T TCGA-B9-4113-01A-01D-1252-08 ENST00000166244 p.P807P ZMYM6 chr1 34992361 34992361 Frame_Shift_Del T T - TCGA-B9-4113-01A-01D-1252-08 ENST00000357182 p.K673Nfs*14 MCOLN3 chr1 85022305 85022305 Missense_Mutation C C A TCGA-B9-4113-01A-01D-1252-08 ENST00000370589 p.K397N GOLT1A chr1 204198359 204198359 3'UTR C C A TCGA-B9-4113-01A-01D-1252-08 ENST00000308302 PIGR chr1 206932561 206932561 Nonsense_Mutation C C A TCGA-B9-4113-01A-01D-1252-08 ENST00000356495 p.G635* CD46 chr1 207767163 207767163 Missense_Mutation C C A TCGA-B9-4113-01A-01D-1252-08 ENST00000358170 p.T275N RBM34 chr1 235154930 235154930 Missense_Mutation T T A TCGA-B9-4113-01A-01D-1252-08 ENST00000408888 p.N183I HADHA chr2 26236953 26236953 Missense_Mutation G G C TCGA-B9-4113-01A-01D-1252-08 ENST00000380649 p.F72L GTF3C2 chr2 27343052 27343053 Frame_Shift_Ins - - TGGCCTTT TCGA-B9-4113-01A-01D-1252-08 ENST00000264720 p.Q115Kfs*18 GTF3C2 chr2 27343053 27343053 Silent G G T TCGA-B9-4113-01A-01D-1252-08 ENST00000264720 p.P114P EML4 chr2 42261280 42261280 Silent T T C TCGA-B9-4113-01A-01D-1252-08 ENST00000318522 p.A166A HAAO chr2 42767448 42767448 Missense_Mutation G G C TCGA-B9-4113-01A-01D-1252-08 ENST00000294973 p.P284A ANTXR1 chr2 69245444 69245447 Frame_Shift_Del GCAC GCAC - TCGA-B9-4113-01A-01D-1252-08 ENST00000303714 p.A552Lfs*41 EDAR chr2 108910831 108910831 Silent C C T TCGA-B9-4113-01A-01D-1252-08 ENST00000258443 p.P225P BIN1 chr2 127060617 127060617 Intron C C G TCGA-B9-4113-01A-01D-1252-08 ENST00000316724 ORC2 chr2 200925872 200925872 Missense_Mutation C C A TCGA-B9-4113-01A-01D-1252-08 ENST00000234296 p.D371Y XRCC5 chr2 216116840 216116841 Frame_Shift_Ins - - C TCGA-B9-4113-01A-01D-1252-08 ENST00000392132 p.F107Lfs*15 TRNT1 chr3 3147967 3147967 Missense_Mutation G G C TCGA-B9-4113-01A-01D-1252-08 ENST00000251607 p.C373S OSBPL10 chr3 31733349 31733349 Missense_Mutation G G A TCGA-B9-4113-01A-01D-1252-08 ENST00000396556 p.L335F ATR chr3 142555950 142555950 Silent A A T TCGA-B9-4113-01A-01D-1252-08 ENST00000350721 p.S756S SLC26A1 chr4 991432 991432 Missense_Mutation G G A TCGA-B9-4113-01A-01D-1252-08 ENST00000361661 p.S91L ACOX3 chr4 8415947 8415947 Missense_Mutation C C T TCGA-B9-4113-01A-01D-1252-08 ENST00000356406 p.G66E ADGRA3 chr4 22388626 22388626 Missense_Mutation C C G TCGA-B9-4113-01A-01D-1252-08 ENST00000334304 p.L1015F AASDH chr4 56382502 56382502 Missense_Mutation A A T TCGA-B9-4113-01A-01D-1252-08 ENST00000205214 p.I109N ABCG2 chr4 88118175 88118175 Silent A A G TCGA-B9-4113-01A-01D-1252-08 ENST00000237612 p.L259L NDST4 chr4 114845862 114845862 Silent G G A TCGA-B9-4113-01A-01D-1252-08 ENST00000264363 p.I692I ASB5 chr4 176215645 176215645 Silent T T C TCGA-B9-4113-01A-01D-1252-08 ENST00000296525 p.Q315Q FAM149A chr4 186156032 186156032 Missense_Mutation A A G TCGA-B9-4113-01A-01D-1252-08 ENST00000356371 p.Q430R LIFR chr5 38504083 38504083 Missense_Mutation T T C TCGA-B9-4113-01A-01D-1252-08 ENST00000263409 p.I444V SLC36A3 chr5 151281156 151281156 Nonsense_Mutation G G T TCGA-B9-4113-01A-01D-1252-08 ENST00000335230 p.Y334* NPM1 chr5 171387884 171387884 5'UTR C C T TCGA-B9-4113-01A-01D-1252-08 ENST00000296930 RGS14 chr5 177370995 177370995 Missense_Mutation G G T TCGA-B9-4113-01A-01D-1252-08 ENST00000408923 p.K406N OR11A1 chr6 29427604 29427604 Missense_Mutation T T G TCGA-B9-4113-01A-01D-1252-08 ENST00000377147 p.E13A PNPLA1 chr6 36302040 36302040 Missense_Mutation G G A TCGA-B9-4113-01A-01D-1252-08 ENST00000394571 p.D319N HECA chr6 139174453 139174453 Frame_Shift_Del A A - TCGA-B9-4113-01A-01D-1252-08 ENST00000367658 p.K461Sfs*32 SEPT7 chr7 35872767 35872767 Splice_Site G G A TCGA-B9-4113-01A-01D-1252-08 ENST00000350320 p.X126_splice CLDN15 chr7 101232601 101232601 Splice_Region C C T TCGA-B9-4113-01A-01D-1252-08 ENST00000308344 PRKRIP1 chr7 102399648 102399648 Splice_Region G G A TCGA-B9-4113-01A-01D-1252-08 ENST00000397912 p.K102K PRKRIP1 chr7 102399649 102399649 Splice_Site G G A TCGA-B9-4113-01A-01D-1252-08 ENST00000397912 p.X102_splice ZNF777 chr7 149432352 149432352 Silent C C T TCGA-B9-4113-01A-01D-1252-08 ENST00000247930 p.E640E CA9 chr9 35674200 35674200 Nonsense_Mutation G G T TCGA-B9-4113-01A-01D-1252-08 ENST00000378357 p.E81* AGTPBP1 chr9 85586861 85586861 Missense_Mutation T T A TCGA-B9-4113-01A-01D-1252-08 ENST00000357081 p.Q1001H NIPSNAP3A chr9 104759364 104759364 3'UTR C C T TCGA-B9-4113-01A-01D-1252-08 ENST00000374767 COL5A1 chr9 134701199 134701199 Frame_Shift_Del A A - TCGA-B9-4113-01A-01D-1252-08 ENST00000371817 p.K174Rfs*6 ECD chr10 73136728 73136728 Missense_Mutation T T G TCGA-B9-4113-01A-01D-1252-08 ENST00000372979 p.K560N COX15 chr10 99732034 99732034 Missense_Mutation A A C TCGA-B9-4113-01A-01D-1252-08 ENST00000016171 p.F6V E2F8 chr11 19229728 19229728 Missense_Mutation A A T TCGA-B9-4113-01A-01D-1252-08 ENST00000250024 p.L540Q QSER1 chr11 32933384 32933384 Nonsense_Mutation C C A TCGA-B9-4113-01A-01D-1252-08 ENST00000399302 p.S580* LRP4 chr11 46858973 46858974 3'UTR - - T TCGA-B9-4113-01A-01D-1252-08 ENST00000378623 MADD chr11 47282578 47282578 Missense_Mutation T T G TCGA-B9-4113-01A-01D-1252-08 ENST00000311027 p.L556R A2ML1 chr12 8854142 8854142 Frame_Shift_Del A A - TCGA-B9-4113-01A-01D-1252-08 ENST00000299698 p.T869Lfs*126 PIK3C2G chr12 18505358 18505358 Missense_Mutation G G A TCGA-B9-4113-01A-01D-1252-08 ENST00000266497 p.D1033N PDZRN4 chr12 41191533 41191533 Nonsense_Mutation C C T TCGA-B9-4113-01A-01D-1252-08 ENST00000402685 p.R242* PPP1R12A chr12 79934921 79934921 Missense_Mutation G G A TCGA-B9-4113-01A-01D-1252-08 ENST00000261207 p.A4V ACAD10 chr12 111746279 111746279 Missense_Mutation C C A TCGA-B9-4113-01A-01D-1252-08 ENST00000313698 p.P751T TMEM132D chr12 129700274 129700274 Silent C C G TCGA-B9-4113-01A-01D-1252-08 ENST00000422113 p.L168L SLC46A3 chr13 28713373 28713373 Missense_Mutation A A G TCGA-B9-4113-01A-01D-1252-08 ENST00000266943 p.Y123H ATP7B chr13 51973972 51973972 Silent A A T TCGA-B9-4113-01A-01D-1252-08 ENST00000242839 p.A416A RNF219 chr13 78616371 78616371 Missense_Mutation T T A TCGA-B9-4113-01A-01D-1252-08 ENST00000282003 p.T464S SPINT1 chr15 40853823 40853823 Silent C C T TCGA-B9-4113-01A-01D-1252-08 ENST00000344051 p.G285G TP53BP1 chr15 43432203 43432203 Silent G G A TCGA-B9-4113-01A-01D-1252-08 ENST00000263801 p.L1217L CTDSPL2 chr15 44524300 44524300 3'UTR G G C TCGA-B9-4113-01A-01D-1252-08 ENST00000260327 CGNL1 chr15 57438640 57438640 Missense_Mutation C C G TCGA-B9-4113-01A-01D-1252-08 ENST00000281282 p.T214R MCTP2 chr15 94298505 94298505 Silent C C T TCGA-B9-4113-01A-01D-1252-08 ENST00000357742 p.S80S EEF2K chr16 22225707 22225707 5'UTR G G C TCGA-B9-4113-01A-01D-1252-08 ENST00000263026 PRMT7 chr16 68352241 68352241 Splice_Region T T G TCGA-B9-4113-01A-01D-1252-08 ENST00000339507 ATAD5 chr17 30893710 30893710 Missense_Mutation T T G TCGA-B9-4113-01A-01D-1252-08 ENST00000321990 p.N1619K RP11-798G7.6 chr17 45548658 45548658 Intron C C T TCGA-B9-4113-01A-01D-1252-08 ENST00000586348 TANC2 chr17 63389506 63389506 Missense_Mutation C C A TCGA-B9-4113-01A-01D-1252-08 ENST00000424789 p.L931M SLC16A6 chr17 68274071 68274071 Splice_Site C C A TCGA-B9-4113-01A-01D-1252-08 ENST00000327268 p.X78_splice PTPRM chr18 7567848 7567848 Frame_Shift_Del T T - TCGA-B9-4113-01A-01D-1252-08 ENST00000332175 p.L11Wfs*6 PTPRM chr18 7567849 7567849 Missense_Mutation T T A TCGA-B9-4113-01A-01D-1252-08 ENST00000332175 p.L11M SALL3 chr18 78994972 78994972 Missense_Mutation T T C TCGA-B9-4113-01A-01D-1252-08 ENST00000537592 p.I994T DOT1L chr19 2191112 2191112 Missense_Mutation C C G TCGA-B9-4113-01A-01D-1252-08 ENST00000398665 p.P122R DOT1L chr19 2216712 2216712 Silent G G A TCGA-B9-4113-01A-01D-1252-08 ENST00000398665 p.L785L ZNF136 chr19 12186816 12186816 Missense_Mutation G G T TCGA-B9-4113-01A-01D-1252-08 ENST00000343979 p.W146C CASP14 chr19 15053822 15053822 Silent C C T TCGA-B9-4113-01A-01D-1252-08 ENST00000427043 p.H89H NWD1 chr19 16807894 16807894 Missense_Mutation G G A TCGA-B9-4113-01A-01D-1252-08 ENST00000552788 p.E1349K ZNF665 chr19 53166117 53166117 Missense_Mutation C C G TCGA-B9-4113-01A-01D-1252-08 ENST00000600412 p.A60P HELZ2 chr20 63561734 63561734 Missense_Mutation T T C TCGA-B9-4113-01A-01D-1252-08 ENST00000467148 p.R2235G LSS chr21 46206770 46206770 Splice_Site T T G TCGA-B9-4113-01A-01D-1252-08 ENST00000356396 p.X490_splice TOP3B chr22 21965362 21965363 In_Frame_Ins - - TTG TCGA-B9-4113-01A-01D-1252-08 ENST00000357179 p.T288dup TGFBRAP1 chr2 105269594 105269594 Missense_Mutation G G A TCGA-BQ-7055-01A-11D-1961-08 ENST00000258449 p.A695V TTN chr2 178794932 178794932 Missense_Mutation C C T TCGA-BQ-7055-01A-11D-1961-08 ENST00000591111 p.G412D CCDC71 chr3 49163428 49163429 Frame_Shift_Del CT CT - TCGA-BQ-7055-01A-11D-1961-08 ENST00000321895 p.R260Sfs*48 DEFB114 chr6 49964057 49964057 Silent G G A TCGA-BQ-7055-01A-11D-1961-08 ENST00000322066 p.L17L CRY1 chr12 107005233 107005233 Missense_Mutation T T C TCGA-BQ-7055-01A-11D-1961-08 ENST00000008527 p.K95E DPEP2 chr16 67992006 67992006 Intron C C A TCGA-BQ-7055-01A-11D-1961-08 ENST00000393847 SYT3 chr19 50632418 50632418 Missense_Mutation G G A TCGA-BQ-7055-01A-11D-1961-08 ENST00000338916 p.P181L ZNF304 chr19 57357689 57357689 Missense_Mutation G G A TCGA-BQ-7055-01A-11D-1961-08 ENST00000282286 p.R607K SRRM2 chr16 2765060 2765060 Missense_Mutation C C T TCGA-4A-A93Y-01A-11D-A36X-10 ENST00000301740 p.T1511I SPAG9 chr17 51120380 51120380 Nonsense_Mutation T T A TCGA-4A-A93Y-01A-11D-A36X-10 ENST00000262013 p.K93* SYCP2 chr20 59869985 59869985 Splice_Site T T G TCGA-4A-A93Y-01A-11D-A36X-10 ENST00000357552 p.X1186_splice H6PD chr1 9245477 9245477 Silent C C T TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000377403 p.F181F LYPLA2 chr1 23794382 23794382 Intron A A G TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000374514 NCMAP chr1 24595443 24595443 Missense_Mutation A A T TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000374392 p.T5S KANK4 chr1 62274685 62274685 Frame_Shift_Del A A - TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000371153 p.L140Wfs*21 KANK4 chr1 62274686 62274686 Missense_Mutation A A T TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000371153 p.L140M RABGGTB chr1 75787518 75787518 Missense_Mutation A A G TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000319942 p.I9V OVGP1 chr1 111415318 111415318 Missense_Mutation A A C TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000369732 p.F395V AL591893.1 chr1 152021383 152021387 Splice_Site AGGTA AGGTA - TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000432386 CCT3 chr1 156325067 156325067 Silent A A G TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000295688 p.A109A HHIPL2 chr1 222532052 222532052 Missense_Mutation C C T TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000343410 p.C546Y C1orf95 chr1 226596924 226596924 Missense_Mutation G G A TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000366788 p.V109I CTNNA2 chr2 79909790 79909790 Missense_Mutation T T C TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000402739 p.M350T WDR75 chr2 189441453 189441453 5'UTR G G A TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000314761 WDR75 chr2 189441543 189441543 Missense_Mutation G G C TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000314761 p.L17F CUL3 chr2 224497823 224497823 Missense_Mutation C G G TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000264414 p.R546P TRIP12 chr2 229810923 229810923 Missense_Mutation C T T TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000283943 p.M678I ULK4 chr3 41754473 41754473 Frame_Shift_Del T T - TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000301831 p.I737Lfs*24 BSN chr3 49658133 49658133 Silent C C T TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000296452 p.T2859T CISH chr3 50608470 50608470 Missense_Mutation C C A TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000348721 p.E48D DNAH1 chr3 52346531 52346531 Missense_Mutation C C A TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000420323 p.S572R IL17RB chr3 53852112 53852120 In_Frame_Del CCCTCTGGT CCCTCTGGT - TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000288167 p.P114_G116del A4GNT chr3 138130847 138130847 Splice_Site A A C TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000236709 p.X136_splice PLS1 chr3 142684340 142684340 Missense_Mutation A A G TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000337777 p.Y278C PRKCI chr3 170303117 170303117 Frame_Shift_Del A A - TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000295797 p.E594Dfs*18 ACTL6A chr3 179580982 179580982 Nonsense_Mutation G G T TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000429709 p.G307* KLB chr4 39434300 39434300 Nonsense_Mutation G G T TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000257408 p.E306* WDFY3 chr4 84801686 84801686 Missense_Mutation C C A TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000295888 p.R929L TLL1 chr4 166101083 166101091 3'UTR ATGGTATTA ATGGTATTA - TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000061240 ADAMTS12 chr5 33534838 33534838 Missense_Mutation C C A TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000504830 p.S1534I ZFP2 chr5 178933140 178933140 3'UTR A A T TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000361362 GFPT2 chr5 180301377 180301377 3'UTR G G C TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000253778 CD83 chr6 14133715 14133715 Frame_Shift_Del C C - TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000379153 p.A150Vfs*7 E2F3 chr6 20490220 20490220 Missense_Mutation C C G TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000346618 p.N396K MDN1 chr6 89683254 89683254 Missense_Mutation T T G TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000369393 p.K3994Q ASCC3 chr6 100627948 100627948 Missense_Mutation C C A TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000369162 p.R1472L NRCAM chr7 108167008 108167008 Missense_Mutation T T C TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000379028 p.M1127V MDFIC chr7 114922584 114922586 5'UTR GAG GAG - TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000393486 OR6V1 chr7 143053150 143053150 Missense_Mutation G G C TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000418316 p.K270N SNAI2 chr8 48921258 48921258 Missense_Mutation C C G TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000020945 p.R3P MTSS1 chr8 124557860 124557860 Frame_Shift_Del A A - TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000518547 p.S351Lfs*73 RFX3 chr9 3301560 3301560 Missense_Mutation G G A TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000382004 p.L179F ALDH1B1 chr9 38397533 38397533 3'UTR C C T TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000377698 GLIDR chr9 39809860 39809860 RNA A A G TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000625350 RASEF chr9 83022368 83022368 Missense_Mutation T T G TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000376447 p.I213L EXOSC2 chr9 130703767 130703767 Frame_Shift_Del A A - TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000372358 p.E292Gfs*57 TMEM254 chr10 80078877 80078877 Intron G G A TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000372281 VPS26B chr11 134225160 134225160 Missense_Mutation A A T TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000281187 p.E13V WNT10B chr12 48968298 48968298 Missense_Mutation G T T TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000301061 p.S120Y BAZ2A chr12 56613117 56613117 Missense_Mutation T T A TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000551812 p.N347Y TMTC2 chr12 82857353 82857353 Missense_Mutation G G T TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000321196 p.G143W RFX4 chr12 106733136 106733136 Intron G G C TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000392842 FOXA1 chr14 37591583 37591583 Missense_Mutation A A T TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000250448 p.S401T C14orf169 chr14 73492305 73492305 Missense_Mutation G G A TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000304061 p.D430N MOK chr14 102251989 102251989 Missense_Mutation C C A TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000361847 p.R97I PAK6 chr15 40252719 40252719 Intron C C T TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000260404 CASC5 chr15 40622161 40622161 Frame_Shift_Del A A - TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000346991 p.S659Afs*2 CHTF18 chr16 792099 792099 Intron T T C TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000262315 EME2 chr16 1776069 1776069 Missense_Mutation C C T TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000568449 p.A324V ABCA3 chr16 2319833 2319833 Missense_Mutation G G C TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000301732 p.I207M ADCY9 chr16 3992306 3992306 Frame_Shift_Del C C - TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000294016 p.E683Rfs*23 DCTPP1 chr16 30424262 30424262 Missense_Mutation A A T TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000319285 p.C162S DHX38 chr16 72108902 72108902 Missense_Mutation C C T TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000268482 p.H1120Y MYH13 chr17 10312075 10312075 Frame_Shift_Del A A - TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000252172 p.V1456Afs*33 NCOR1 chr17 16068117 16068117 Silent T T G TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000268712 p.T1506T CCR7 chr17 40555054 40555054 Missense_Mutation G G T TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000246657 p.F275L SLC4A1 chr17 44258543 44258543 Silent T T A TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000262418 p.L319L PPP1R9B chr17 50139279 50139279 Missense_Mutation T T C TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000612501 p.Q686R KIF2B chr17 53824287 53824287 Silent C C T TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000268919 p.V418V KCNH6 chr17 63535754 63535754 Missense_Mutation A A G TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000583023 p.Y396C LAMA1 chr18 6992670 6992670 Silent G G A TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000389658 p.L1687L ANKRD12 chr18 9257705 9257705 Missense_Mutation C C G TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000262126 p.Q1480E TRAPPC8 chr18 31874442 31874442 Intron G G A TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000283351 MBP chr18 76988889 76988889 Silent C C T TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000355994 p.P235P ZNF43 chr19 21807894 21807894 Missense_Mutation A A T TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000354959 p.F715I FBXO46 chr19 45712589 45712589 Missense_Mutation T T C TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000317683 p.K303E EDN3 chr20 59301548 59301548 Missense_Mutation G G T TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000337938 p.G64V ATP11C chrX 139774932 139774932 Missense_Mutation C C G TCGA-A4-A5Y0-01A-11D-A31X-10 ENST00000327569 p.E661D ARID1A chr1 26774427 26774427 Silent T T C TCGA-B1-A656-01A-11D-A31X-10 ENST00000324856 p.P1400P FGR chr1 27616934 27616934 Missense_Mutation T T A TCGA-B1-A656-01A-11D-A31X-10 ENST00000374003 p.K202I MRPS15 chr1 36456281 36456281 Missense_Mutation A A G TCGA-B1-A656-01A-11D-A31X-10 ENST00000373116 p.I181T BCAR3 chr1 93567488 93567488 Missense_Mutation G G C TCGA-B1-A656-01A-11D-A31X-10 ENST00000260502 p.S697C TARS2 chr1 150487445 150487445 5'UTR A A G TCGA-B1-A656-01A-11D-A31X-10 ENST00000369064 GON4L chr1 155747629 155747634 3'Flank AGAGCT AGAGCT - TCGA-B1-A656-01A-11D-A31X-10 ENST00000368331 GON4L chr1 155747635 155747635 3'Flank G G T TCGA-B1-A656-01A-11D-A31X-10 ENST00000368331 GON4L chr1 155764953 155764953 Intron A A G TCGA-B1-A656-01A-11D-A31X-10 ENST00000368331 GORAB chr1 170539297 170539297 Missense_Mutation A A C TCGA-B1-A656-01A-11D-A31X-10 ENST00000367763 p.K75T TEDDM1 chr1 182399876 182399876 Missense_Mutation A A G TCGA-B1-A656-01A-11D-A31X-10 ENST00000367565 p.W204R EIF2D chr1 206593763 206593763 Missense_Mutation C C T TCGA-B1-A656-01A-11D-A31X-10 ENST00000271764 p.G514S TP53BP2 chr1 223795929 223795929 Missense_Mutation C C A TCGA-B1-A656-01A-11D-A31X-10 ENST00000343537 p.E870D PARP1 chr1 226368296 226368298 In_Frame_Del GAG GAG - TCGA-B1-A656-01A-11D-A31X-10 ENST00000366794 p.S727del MAP10 chr1 232809766 232809766 3'Flank A A T TCGA-B1-A656-01A-11D-A31X-10 ENST00000418460 RPS7 chr2 3576613 3576615 In_Frame_Del GTC GTC - TCGA-B1-A656-01A-11D-A31X-10 ENST00000304921 p.V93del MYCN chr2 15942136 15942136 Silent A A G TCGA-B1-A656-01A-11D-A31X-10 ENST00000281043 p.L24L ATAD2B chr2 23832331 23832331 Intron A A T TCGA-B1-A656-01A-11D-A31X-10 ENST00000238789 DPY30 chr2 32039422 32039422 Missense_Mutation T T A TCGA-B1-A656-01A-11D-A31X-10 ENST00000295066 p.Q12L EPAS1 chr2 46380648 46380648 Missense_Mutation C C G TCGA-B1-A656-01A-11D-A31X-10 ENST00000263734 p.T659R REV1 chr2 99402933 99402934 Frame_Shift_Ins - - A TCGA-B1-A656-01A-11D-A31X-10 ENST00000258428 p.D1114* CNTNAP5 chr2 124417515 124417515 Missense_Mutation G G A TCGA-B1-A656-01A-11D-A31X-10 ENST00000431078 p.V152I CCDC141 chr2 178978498 178978498 Nonsense_Mutation C C A TCGA-B1-A656-01A-11D-A31X-10 ENST00000420890 p.E135* HIBCH chr2 190205148 190205148 Missense_Mutation T T C TCGA-B1-A656-01A-11D-A31X-10 ENST00000359678 p.K377R ALS2 chr2 201707886 201707893 Frame_Shift_Del AGATCGGG AGATCGGG - TCGA-B1-A656-01A-11D-A31X-10 ENST00000264276 p.S1460* ALS2 chr2 201707897 201707900 Frame_Shift_Del CTGA CTGA - TCGA-B1-A656-01A-11D-A31X-10 ENST00000264276 p.S1458Ifs*12 NEU2 chr2 233034257 233034257 Silent C C T TCGA-B1-A656-01A-11D-A31X-10 ENST00000233840 p.L115L MTMR14 chr3 9683210 9683212 Nonsense_Mutation CCT CCT - TCGA-B1-A656-01A-11D-A31X-10 ENST00000296003 p.Y310_L311delins* MTMR14 chr3 9683213 9683214 Frame_Shift_Ins - - A TCGA-B1-A656-01A-11D-A31X-10 ENST00000296003 p.L313Afs*7 HDAC11 chr3 13483552 13483552 Silent T T G TCGA-B1-A656-01A-11D-A31X-10 ENST00000295757 p.L80L TRAK1 chr3 42176887 42176887 Silent G G A TCGA-B1-A656-01A-11D-A31X-10 ENST00000327628 p.E120E SNRK chr3 43347356 43347356 Missense_Mutation A A T TCGA-B1-A656-01A-11D-A31X-10 ENST00000296088 p.K366I SETD2 chr3 47123900 47123901 Frame_Shift_Ins - - A TCGA-B1-A656-01A-11D-A31X-10 ENST00000409792 p.V246Cfs*10 PBRM1 chr3 52615414 52615414 Nonsense_Mutation T T A TCGA-B1-A656-01A-11D-A31X-10 ENST00000296302 p.K621* DENND6A chr3 57630810 57630810 Missense_Mutation T T G TCGA-B1-A656-01A-11D-A31X-10 ENST00000311128 p.L474F KPNA1 chr3 122426779 122426779 3'UTR C G G TCGA-B1-A656-01A-11D-A31X-10 ENST00000344337 SH3TC1 chr4 8228419 8228419 Missense_Mutation T T C TCGA-B1-A656-01A-11D-A31X-10 ENST00000245105 p.F909L NPFFR2 chr4 72147137 72147137 Silent C C G TCGA-B1-A656-01A-11D-A31X-10 ENST00000308744 p.S298S FAM13A chr4 88737506 88737506 Missense_Mutation T T A TCGA-B1-A656-01A-11D-A31X-10 ENST00000264344 p.E871V KIAA0922 chr4 153620877 153620877 Nonsense_Mutation C C A TCGA-B1-A656-01A-11D-A31X-10 ENST00000409663 p.S1229* TRIM61 chr4 164970141 164970141 5'UTR G G C TCGA-B1-A656-01A-11D-A31X-10 ENST00000329314 IRX2 chr5 2747389 2747389 3'UTR A A - TCGA-B1-A656-01A-11D-A31X-10 ENST00000302057 DNAH5 chr5 13788713 13788713 Splice_Region T T A TCGA-B1-A656-01A-11D-A31X-10 ENST00000265104 F2R chr5 76733465 76733465 Missense_Mutation A A G TCGA-B1-A656-01A-11D-A31X-10 ENST00000319211 p.N414D TMEM173 chr5 139476277 139476277 Missense_Mutation C C T TCGA-B1-A656-01A-11D-A31X-10 ENST00000330794 p.R375H UNC5A chr5 176878474 176878474 Splice_Site G G A TCGA-B1-A656-01A-11D-A31X-10 ENST00000329542 p.X674_splice UIMC1 chr5 176968661 176968661 Missense_Mutation C C T TCGA-B1-A656-01A-11D-A31X-10 ENST00000377227 p.R365K SQSTM1 chr5 179823983 179823983 Missense_Mutation A A T TCGA-B1-A656-01A-11D-A31X-10 ENST00000389805 p.S143C DHX16 chr6 30654751 30654751 Silent C C A TCGA-B1-A656-01A-11D-A31X-10 ENST00000376442 p.L984L MUC21 chr6 30984162 30984162 Intron G G A TCGA-B1-A656-01A-11D-A31X-10 ENST00000376296 COL19A1 chr6 69936904 69936904 Silent A A G TCGA-B1-A656-01A-11D-A31X-10 ENST00000620364 p.P289P MLLT4 chr6 167976782 167976782 3'Flank G G A TCGA-B1-A656-01A-11D-A31X-10 ENST00000392112 KDELR2 chr7 6462814 6462814 3'UTR A A - TCGA-B1-A656-01A-11D-A31X-10 ENST00000258739 TRIL chr7 28956868 28956868 Silent G G A TCGA-B1-A656-01A-11D-A31X-10 ENST00000539664 p.P393P ABCA13 chr7 48279451 48279451 Missense_Mutation G G A TCGA-B1-A656-01A-11D-A31X-10 ENST00000435803 p.D2753N NSUN5 chr7 73303408 73303411 3'UTR GCCT GCCT - TCGA-B1-A656-01A-11D-A31X-10 ENST00000252594 FZD1 chr7 91266835 91266835 3'UTR T T C TCGA-B1-A656-01A-11D-A31X-10 ENST00000287934 LMTK2 chr7 98204027 98204027 Missense_Mutation T T G TCGA-B1-A656-01A-11D-A31X-10 ENST00000297293 p.S1442A SRRT chr7 100888083 100888083 Missense_Mutation C C A TCGA-B1-A656-01A-11D-A31X-10 ENST00000611405 p.Q790K CDHR3 chr7 106032601 106032601 Frame_Shift_Del G G - TCGA-B1-A656-01A-11D-A31X-10 ENST00000317716 p.G855Vfs*20 DLD chr7 107915682 107915682 Frame_Shift_Del A A - TCGA-B1-A656-01A-11D-A31X-10 ENST00000205402 p.I289Lfs*36 DLD chr7 107915683 107915683 Nonsense_Mutation A A T TCGA-B1-A656-01A-11D-A31X-10 ENST00000205402 p.K288* CADPS2 chr7 122441545 122441545 Silent A A G TCGA-B1-A656-01A-11D-A31X-10 ENST00000449022 p.G773G UBE2H chr7 129952500 129952500 Splice_Region T T C TCGA-B1-A656-01A-11D-A31X-10 ENST00000355621 ANK1 chr8 41693918 41693918 Missense_Mutation C C T TCGA-B1-A656-01A-11D-A31X-10 ENST00000347528 p.R1171H SLC20A2 chr8 42444652 42444652 Frame_Shift_Del T T - TCGA-B1-A656-01A-11D-A31X-10 ENST00000342228 p.I242* RFX3 chr9 3271084 3271084 Missense_Mutation C C G TCGA-B1-A656-01A-11D-A31X-10 ENST00000382004 p.S374T SLC24A2 chr9 19516369 19516369 Frame_Shift_Del A A - TCGA-B1-A656-01A-11D-A31X-10 ENST00000341998 p.H591Tfs*38 RASEF chr9 83009667 83009667 Nonsense_Mutation A A T TCGA-B1-A656-01A-11D-A31X-10 ENST00000376447 p.Y311* STXBP1 chr9 127675858 127675858 Missense_Mutation G G A TCGA-B1-A656-01A-11D-A31X-10 ENST00000373299 p.A389T ENG chr9 127820018 127820018 Missense_Mutation G G A TCGA-B1-A656-01A-11D-A31X-10 ENST00000373203 p.T385M ASB6 chr9 129637867 129637867 Nonsense_Mutation T T A TCGA-B1-A656-01A-11D-A31X-10 ENST00000277458 p.K397* ALOX5 chr10 45441378 45441378 Missense_Mutation T T A TCGA-B1-A656-01A-11D-A31X-10 ENST00000374391 p.I407N NCOA4 chr10 46010649 46010649 Silent C C T TCGA-B1-A656-01A-11D-A31X-10 ENST00000581486 p.K424K ADO chr10 62806312 62806312 3'UTR G G A TCGA-B1-A656-01A-11D-A31X-10 ENST00000373783 NUDT13 chr10 73120148 73120148 Missense_Mutation A A C TCGA-B1-A656-01A-11D-A31X-10 ENST00000357321 p.S72R ZMIZ1 chr10 79208345 79208345 Missense_Mutation A A T TCGA-B1-A656-01A-11D-A31X-10 ENST00000334512 p.N24Y SORCS1 chr10 106611986 106611986 Missense_Mutation G G T TCGA-B1-A656-01A-11D-A31X-10 ENST00000263054 p.N986K OR5P2 chr11 7796871 7796871 Silent T T A TCGA-B1-A656-01A-11D-A31X-10 ENST00000329434 p.P24P OR5P2 chr11 7796872 7796872 Missense_Mutation G G A TCGA-B1-A656-01A-11D-A31X-10 ENST00000329434 p.P24L OR5P2 chr11 7796873 7796873 Missense_Mutation G G T TCGA-B1-A656-01A-11D-A31X-10 ENST00000329434 p.P24T LGR4 chr11 27380712 27380712 Splice_Site C C G TCGA-B1-A656-01A-11D-A31X-10 ENST00000379214 p.X277_splice PLCB3 chr11 64267236 64267236 Nonsense_Mutation C C T TCGA-B1-A656-01A-11D-A31X-10 ENST00000279230 p.Q1156* NAALADL1 chr11 65046503 65046503 Silent G G A TCGA-B1-A656-01A-11D-A31X-10 ENST00000358658 p.Y541Y CLPB chr11 72434170 72434170 Missense_Mutation T T A TCGA-B1-A656-01A-11D-A31X-10 ENST00000294053 p.D102V KCNE3 chr11 74457304 74457304 Missense_Mutation T T A TCGA-B1-A656-01A-11D-A31X-10 ENST00000310128 p.K87M KCNE3 chr11 74457305 74457305 Nonsense_Mutation T T A TCGA-B1-A656-01A-11D-A31X-10 ENST00000310128 p.K87* FZD4 chr11 86952320 86952320 Missense_Mutation T T C TCGA-B1-A656-01A-11D-A31X-10 ENST00000531380 p.S146G FAT3 chr11 92798211 92798211 Missense_Mutation G G A TCGA-B1-A656-01A-11D-A31X-10 ENST00000525166 p.R1583H DYNC2H1 chr11 103220701 103220701 Missense_Mutation C C G TCGA-B1-A656-01A-11D-A31X-10 ENST00000375735 p.P3009A BACE1 chr11 117315584 117315584 Missense_Mutation G G A TCGA-B1-A656-01A-11D-A31X-10 ENST00000313005 p.S71L ADAMTS15 chr11 130449640 130449640 Missense_Mutation C C G TCGA-B1-A656-01A-11D-A31X-10 ENST00000299164 p.L223V GUCY2C chr12 14686209 14686209 Missense_Mutation C C G TCGA-B1-A656-01A-11D-A31X-10 ENST00000261170 p.G116A PLCZ1 chr12 18723429 18723430 Frame_Shift_Ins - - T TCGA-B1-A656-01A-11D-A31X-10 ENST00000266505 p.N83Kfs*9 C12orf40 chr12 39682719 39682719 Frame_Shift_Del A A - TCGA-B1-A656-01A-11D-A31X-10 ENST00000324616 p.I266Yfs*19 NACA chr12 56718483 56718483 Intron G G T TCGA-B1-A656-01A-11D-A31X-10 ENST00000356769 LRIG3 chr12 58874484 58874484 Missense_Mutation T T G TCGA-B1-A656-01A-11D-A31X-10 ENST00000320743 p.M929L RAB21 chr12 71785904 71785905 3'UTR - - G TCGA-B1-A656-01A-11D-A31X-10 ENST00000261263 GPN3 chr12 110465134 110465134 Silent T T C TCGA-B1-A656-01A-11D-A31X-10 ENST00000228827 p.A43A BRCA2 chr13 32338760 32338760 Missense_Mutation G G T TCGA-B1-A656-01A-11D-A31X-10 ENST00000380152 p.D1469Y KLF5 chr13 73062138 73062138 Missense_Mutation C C T TCGA-B1-A656-01A-11D-A31X-10 ENST00000377687 p.P180L MCF2L chr13 113065003 113065004 Frame_Shift_Ins - - G TCGA-B1-A656-01A-11D-A31X-10 ENST00000375608 p.A256Gfs*2 OR4K17 chr14 20117595 20117595 Silent G G A TCGA-B1-A656-01A-11D-A31X-10 ENST00000315543 p.S63S THBS1 chr15 39585537 39585537 Missense_Mutation A A G TCGA-B1-A656-01A-11D-A31X-10 ENST00000260356 p.D365G KNSTRN chr15 40393337 40393337 Intron A A G TCGA-B1-A656-01A-11D-A31X-10 ENST00000249776 SPINT1 chr15 40844658 40844658 Missense_Mutation C C A TCGA-B1-A656-01A-11D-A31X-10 ENST00000344051 p.A35D LRRC57 chr15 42545183 42545183 Missense_Mutation C C T TCGA-B1-A656-01A-11D-A31X-10 ENST00000323443 p.S191N SHC4 chr15 48855981 48855981 Missense_Mutation G G T TCGA-B1-A656-01A-11D-A31X-10 ENST00000332408 p.P405H FBXL22 chr15 63597598 63597598 Missense_Mutation C C T TCGA-B1-A656-01A-11D-A31X-10 ENST00000360587 p.P69L LARP6 chr15 70836487 70836487 Silent T T C TCGA-B1-A656-01A-11D-A31X-10 ENST00000299213 p.G73G NTRK3 chr15 88137490 88137490 Missense_Mutation T T C TCGA-B1-A656-01A-11D-A31X-10 ENST00000360948 p.E179G RPUSD1 chr16 787749 787749 Splice_Region C C T TCGA-B1-A656-01A-11D-A31X-10 ENST00000007264 PARN chr16 14584424 14584424 Splice_Site T T C TCGA-B1-A656-01A-11D-A31X-10 ENST00000437198 p.X336_splice ACSM2A chr16 20478628 20478628 Missense_Mutation G G A TCGA-B1-A656-01A-11D-A31X-10 ENST00000219054 p.G411D TNRC6A chr16 24790000 24790000 Missense_Mutation C C G TCGA-B1-A656-01A-11D-A31X-10 ENST00000395799 p.P453R PYDC1 chr16 31216883 31216883 Missense_Mutation A A G TCGA-B1-A656-01A-11D-A31X-10 ENST00000302964 p.I49T N4BP1 chr16 48543063 48543063 Silent G G A TCGA-B1-A656-01A-11D-A31X-10 ENST00000262384 p.P844P ADCY7 chr16 50304536 50304536 Silent C C T TCGA-B1-A656-01A-11D-A31X-10 ENST00000254235 p.N515N BCAR1 chr16 75242636 75242636 Missense_Mutation G G C TCGA-B1-A656-01A-11D-A31X-10 ENST00000162330 p.P156R HS3ST3A1 chr17 13601119 13601119 Missense_Mutation G G T TCGA-B1-A656-01A-11D-A31X-10 ENST00000284110 p.P4Q ZNF830 chr17 34961758 34961758 Silent C C A TCGA-B1-A656-01A-11D-A31X-10 ENST00000361952 p.L64L GGNBP2 chr17 36578127 36578127 Silent C C T TCGA-B1-A656-01A-11D-A31X-10 ENST00000613102 p.C262C AOC4P chr17 42868538 42868538 RNA C C T TCGA-B1-A656-01A-11D-A31X-10 ENST00000566825 NBR1 chr17 43191422 43191422 Missense_Mutation T T C TCGA-B1-A656-01A-11D-A31X-10 ENST00000341165 p.L305S RPRML chr17 46978717 46978717 Missense_Mutation G G T TCGA-B1-A656-01A-11D-A31X-10 ENST00000322329 p.S97R HOXB4 chr17 48578271 48578272 In_Frame_Ins - - CTT TCGA-B1-A656-01A-11D-A31X-10 ENST00000332503 p.K16dup FDXR chr17 74866242 74866242 Splice_Region G G A TCGA-B1-A656-01A-11D-A31X-10 ENST00000293195 p.S132S CEP192 chr18 13055804 13055804 Missense_Mutation A A T TCGA-B1-A656-01A-11D-A31X-10 ENST00000506447 p.T1072S CABLES1 chr18 23234701 23234701 Silent G G A TCGA-B1-A656-01A-11D-A31X-10 ENST00000256925 p.G394G PHLPP1 chr18 62717242 62717242 Missense_Mutation T T A TCGA-B1-A656-01A-11D-A31X-10 ENST00000262719 p.L520H FSD1 chr19 4306035 4306035 Silent C C T TCGA-B1-A656-01A-11D-A31X-10 ENST00000221856 p.N35N FEM1A chr19 4792808 4792808 Silent C C A TCGA-B1-A656-01A-11D-A31X-10 ENST00000269856 p.A318A ZNF558 chr19 8812018 8812018 Missense_Mutation A A G TCGA-B1-A656-01A-11D-A31X-10 ENST00000301475 p.F158L ZNF426 chr19 9528621 9528621 Missense_Mutation G G A TCGA-B1-A656-01A-11D-A31X-10 ENST00000253115 p.P475L ICAM3 chr19 10333893 10333893 Silent T T A TCGA-B1-A656-01A-11D-A31X-10 ENST00000160262 p.T536T CYP4F3 chr19 15641446 15641446 Missense_Mutation C C G TCGA-B1-A656-01A-11D-A31X-10 ENST00000221307 p.L11V ZNF506 chr19 19794951 19794951 Silent G G C TCGA-B1-A656-01A-11D-A31X-10 ENST00000443905 p.P312P LTBP4 chr19 40623627 40623627 Nonsense_Mutation C C T TCGA-B1-A656-01A-11D-A31X-10 ENST00000308370 p.R1261* CYP2F1 chr19 41121553 41121553 Missense_Mutation C C T TCGA-B1-A656-01A-11D-A31X-10 ENST00000331105 p.R194C PSG9 chr19 43267927 43267927 Missense_Mutation C C T TCGA-B1-A656-01A-11D-A31X-10 ENST00000270077 p.S96N CLASRP chr19 45057776 45057776 Missense_Mutation G G A TCGA-B1-A656-01A-11D-A31X-10 ENST00000221455 p.G164D ZNF836 chr19 52157060 52157060 Missense_Mutation A A T TCGA-B1-A656-01A-11D-A31X-10 ENST00000597252 p.L208H ZIM2 chr19 56775364 56775364 Missense_Mutation C C T TCGA-B1-A656-01A-11D-A31X-10 ENST00000593711 p.G303E ATRN chr20 3471507 3471507 Missense_Mutation G G C TCGA-B1-A656-01A-11D-A31X-10 ENST00000262919 p.G134R SPTLC3 chr20 13049141 13049141 Intron G G A TCGA-B1-A656-01A-11D-A31X-10 ENST00000399002 TIAM1 chr21 31266951 31266951 Missense_Mutation G G A TCGA-B1-A656-01A-11D-A31X-10 ENST00000286827 p.H8Y GUSBP11 chr22 23640417 23640425 Intron CAGGAACCT CAGGAACCT - TCGA-B1-A656-01A-11D-A31X-10 ENST00000455485 C22orf46 chr22 41697584 41697584 3'UTR A A G TCGA-B1-A656-01A-11D-A31X-10 ENST00000402966 ASMTL chrX 1421718 1421718 Missense_Mutation G G C TCGA-B1-A656-01A-11D-A31X-10 ENST00000381317 p.I395M PIR chrX 15385101 15385102 In_Frame_Ins - - TCA TCGA-B1-A656-01A-11D-A31X-10 ENST00000380420 p.M258dup ACOT9 chrX 23705044 23705044 Silent G G A TCGA-B1-A656-01A-11D-A31X-10 ENST00000336430 p.I343I ZMAT1 chrX 101897968 101897968 Silent A A T TCGA-B1-A656-01A-11D-A31X-10 ENST00000372782 p.I135I DCX chrX 111301546 111301546 3'UTR C C G TCGA-B1-A656-01A-11D-A31X-10 ENST00000338081 HTR2C chrX 114763257 114763257 Intron C C T TCGA-B1-A656-01A-11D-A31X-10 ENST00000276198 PNCK chrX 153671593 153671593 Missense_Mutation G G C TCGA-B1-A656-01A-11D-A31X-10 ENST00000340888 p.A165G MTFR1L chr1 25823076 25823076 5'UTR T T A TCGA-A4-7585-01A-11D-2136-08 ENST00000374300 ADGRB2 chr1 31741815 31741815 Nonsense_Mutation C C A TCGA-A4-7585-01A-11D-2136-08 ENST00000373658 p.E524* TOE1 chr1 45342423 45342423 Missense_Mutation C C G TCGA-A4-7585-01A-11D-2136-08 ENST00000372090 p.L178V ADGRL2 chr1 81990771 81990771 Missense_Mutation C C G TCGA-A4-7585-01A-11D-2136-08 ENST00000370717 p.L1336V CIART chr1 150286588 150286588 Silent T T A TCGA-A4-7585-01A-11D-2136-08 ENST00000290363 p.T264T CRTC2 chr1 153952044 153952044 Missense_Mutation C C A TCGA-A4-7585-01A-11D-2136-08 ENST00000368633 p.G324V C1orf111 chr1 162374324 162374324 Silent T T C TCGA-A4-7585-01A-11D-2136-08 ENST00000367935 p.L170L BRINP3 chr1 190098139 190098139 Nonsense_Mutation A A T TCGA-A4-7585-01A-11D-2136-08 ENST00000367462 p.L727* TAF1B chr2 9875918 9875918 Missense_Mutation G G C TCGA-A4-7585-01A-11D-2136-08 ENST00000263663 p.E203Q CAD chr2 27237408 27237408 Missense_Mutation G G A TCGA-A4-7585-01A-11D-2136-08 ENST00000264705 p.E1476K TSGA10 chr2 99104010 99104010 Nonsense_Mutation C C A TCGA-A4-7585-01A-11D-2136-08 ENST00000355053 p.E190* LCT chr2 135808924 135808924 Frame_Shift_Del T T - TCGA-A4-7585-01A-11D-2136-08 ENST00000264162 p.A1142Pfs*27 DARS chr2 135979367 135979367 Splice_Site C C A TCGA-A4-7585-01A-11D-2136-08 ENST00000264161 p.X42_splice THSD7B chr2 137411616 137411616 Missense_Mutation C C A TCGA-A4-7585-01A-11D-2136-08 ENST00000272643 p.S901R KIF5C chr2 148978982 148978982 Nonsense_Mutation C C T TCGA-A4-7585-01A-11D-2136-08 ENST00000435030 p.Q452* PTPRN chr2 219297045 219297045 Missense_Mutation A A C TCGA-A4-7585-01A-11D-2136-08 ENST00000295718 p.C726G COL6A3 chr2 237367241 237367241 Missense_Mutation T T C TCGA-A4-7585-01A-11D-2136-08 ENST00000295550 p.N1649S CAPN7 chr3 15220957 15220957 Missense_Mutation C C T TCGA-A4-7585-01A-11D-2136-08 ENST00000253693 p.T205I EXOSC7 chr3 45007429 45007429 Missense_Mutation C C T TCGA-A4-7585-01A-11D-2136-08 ENST00000265564 p.R209W TREX1 chr3 48467361 48467361 Missense_Mutation A A T TCGA-A4-7585-01A-11D-2136-08 ENST00000625293 p.T291S NPRL2 chr3 50350026 50350026 Splice_Region G G T TCGA-A4-7585-01A-11D-2136-08 ENST00000232501 GRM2 chr3 51718128 51718128 3'UTR G G A TCGA-A4-7585-01A-11D-2136-08 ENST00000395052 VPS8 chr3 184982632 184982632 Missense_Mutation C C T TCGA-A4-7585-01A-11D-2136-08 ENST00000625842 p.H1163Y ABCG2 chr4 88121737 88121737 Missense_Mutation A A C TCGA-A4-7585-01A-11D-2136-08 ENST00000237612 p.I196R KIAA1109 chr4 122234942 122234942 Nonsense_Mutation G G T TCGA-A4-7585-01A-11D-2136-08 ENST00000264501 p.E1165* PCDH18 chr4 137530889 137530889 Frame_Shift_Del A A - TCGA-A4-7585-01A-11D-2136-08 ENST00000344876 p.H400Qfs*17 FASTKD3 chr5 7867508 7867508 Silent A A G TCGA-A4-7585-01A-11D-2136-08 ENST00000264669 p.P192P SPATA9 chr5 95658747 95658747 Missense_Mutation C C G TCGA-A4-7585-01A-11D-2136-08 ENST00000274432 p.R214T SEC24A chr5 134661459 134661470 In_Frame_Del CTCACAAACAAA CTCACAAACAAA - TCGA-A4-7585-01A-11D-2136-08 ENST00000398844 p.S147_N150del SLC36A2 chr5 151322084 151322084 Missense_Mutation A A T TCGA-A4-7585-01A-11D-2136-08 ENST00000335244 p.L381Q DOCK2 chr5 170036525 170036525 Missense_Mutation A A G TCGA-A4-7585-01A-11D-2136-08 ENST00000256935 p.K1212R NSD1 chr5 177269647 177269647 Silent C C T TCGA-A4-7585-01A-11D-2136-08 ENST00000439151 p.N1783N FAM50B chr6 3850209 3850209 Missense_Mutation C C T TCGA-A4-7585-01A-11D-2136-08 ENST00000380272 p.A133V ATXN1 chr6 16327176 16327176 Missense_Mutation G G A TCGA-A4-7585-01A-11D-2136-08 ENST00000244769 p.R379W GLTSCR1L chr6 42828967 42828967 Missense_Mutation C C G TCGA-A4-7585-01A-11D-2136-08 ENST00000314073 p.Q212E MRPL2 chr6 43055908 43055908 Missense_Mutation A A C TCGA-A4-7585-01A-11D-2136-08 ENST00000388752 p.I207S SENP6 chr6 75702727 75702727 Missense_Mutation G G A TCGA-A4-7585-01A-11D-2136-08 ENST00000447266 p.A791T SHPRH chr6 145913494 145913494 Missense_Mutation C C G TCGA-A4-7585-01A-11D-2136-08 ENST00000275233 p.R1437P KIAA0895 chr7 36357004 36357004 Silent G G A TCGA-A4-7585-01A-11D-2136-08 ENST00000297063 p.F255F URGCP chr7 43878483 43878483 Missense_Mutation A A C TCGA-A4-7585-01A-11D-2136-08 ENST00000453200 p.I327S ABCA13 chr7 48278219 48278220 Frame_Shift_Ins - - T TCGA-A4-7585-01A-11D-2136-08 ENST00000435803 p.S2343Ffs*12 ZNF107 chr7 64666252 64666252 5'UTR T T G TCGA-A4-7585-01A-11D-2136-08 ENST00000344930 RELN chr7 103989209 103989209 Missense_Mutation C C T TCGA-A4-7585-01A-11D-2136-08 ENST00000428762 p.G50R HAS2 chr8 121629233 121629233 Missense_Mutation A A T TCGA-A4-7585-01A-11D-2136-08 ENST00000303924 p.F36L PRUNE2 chr9 76905987 76905987 5'UTR C C G TCGA-A4-7585-01A-11D-2136-08 ENST00000376718 ZBTB43 chr9 126833106 126833106 Silent G G T TCGA-A4-7585-01A-11D-2136-08 ENST00000373457 p.S199S COL5A1 chr9 134842156 134842156 Splice_Site G G C TCGA-A4-7585-01A-11D-2136-08 ENST00000371817 p.X1791_splice PPRC1 chr10 102138685 102138685 Frame_Shift_Del A A - TCGA-A4-7585-01A-11D-2136-08 ENST00000278070 p.N137Mfs*79 HTRA1 chr10 122514327 122514327 Missense_Mutation A A T TCGA-A4-7585-01A-11D-2136-08 ENST00000368984 p.I471F ARAP1 chr11 72688510 72688510 Frame_Shift_Del T T - TCGA-A4-7585-01A-11D-2136-08 ENST00000393609 p.I1339Lfs*10 TECTA chr11 121109330 121109330 Frame_Shift_Del A A - TCGA-A4-7585-01A-11D-2136-08 ENST00000264037 p.I107Ffs*16 PHB2 chr12 6967589 6967589 Intron C C T TCGA-A4-7585-01A-11D-2136-08 ENST00000535923 CNTN1 chr12 40933788 40933788 Missense_Mutation A A C TCGA-A4-7585-01A-11D-2136-08 ENST00000347616 p.N299H PLEKHA8P1 chr12 45174098 45174098 RNA G G T TCGA-A4-7585-01A-11D-2136-08 ENST00000256692 KRT77 chr12 52703386 52703386 Silent G G T TCGA-A4-7585-01A-11D-2136-08 ENST00000341809 p.R17R STAT6 chr12 57105300 57105300 Missense_Mutation C C A TCGA-A4-7585-01A-11D-2136-08 ENST00000300134 p.K284N TRAV39 chr14 22304546 22304546 Silent C C T TCGA-A4-7585-01A-11D-2136-08 ENST00000390466 p.A108A NFKBIA chr14 35402423 35402423 Missense_Mutation A A T TCGA-A4-7585-01A-11D-2136-08 ENST00000216797 p.S293T SLC39A9 chr14 69399381 69399381 Silent C C T TCGA-A4-7585-01A-11D-2136-08 ENST00000336643 p.F4F SLC28A2 chr15 45269530 45269530 Missense_Mutation A A C TCGA-A4-7585-01A-11D-2136-08 ENST00000347644 p.I521L MTFMT chr15 65003086 65003086 Silent A A C TCGA-A4-7585-01A-11D-2136-08 ENST00000220058 p.V382V VWA9 chr15 65595730 65595730 Splice_Region C C G TCGA-A4-7585-01A-11D-2136-08 ENST00000313182 C15orf27 chr15 76191971 76191971 Missense_Mutation G G A TCGA-A4-7585-01A-11D-2136-08 ENST00000388942 p.E258K CIITA chr16 10898961 10898961 Missense_Mutation T T C TCGA-A4-7585-01A-11D-2136-08 ENST00000324288 p.M132T IRX6 chr16 55325088 55325088 5'UTR C C A TCGA-A4-7585-01A-11D-2136-08 ENST00000290552 IST1 chr16 71922617 71922617 Missense_Mutation G G T TCGA-A4-7585-01A-11D-2136-08 ENST00000535424 p.M245I GAN chr16 81377498 81377498 Missense_Mutation C C T TCGA-A4-7585-01A-11D-2136-08 ENST00000568107 p.R566C KRT9 chr17 41569874 41569874 Missense_Mutation C C A TCGA-A4-7585-01A-11D-2136-08 ENST00000246662 p.K289N CACNA1G chr17 50615370 50615371 Frame_Shift_Del GC GC - TCGA-A4-7585-01A-11D-2136-08 ENST00000359106 p.C1590* PPM1D chr17 60663085 60663085 Nonsense_Mutation G G T TCGA-A4-7585-01A-11D-2136-08 ENST00000305921 p.E451* ABCA5 chr17 69308345 69308345 Missense_Mutation C C G TCGA-A4-7585-01A-11D-2136-08 ENST00000392676 p.A165P GAA chr17 80112094 80112095 Frame_Shift_Del CC CC - TCGA-A4-7585-01A-11D-2136-08 ENST00000302262 p.H584Qfs*51 PTPRS chr19 5231531 5231531 Missense_Mutation T T A TCGA-A4-7585-01A-11D-2136-08 ENST00000357368 p.E645V SLC23A2 chr20 4874592 4874592 Missense_Mutation A A T TCGA-A4-7585-01A-11D-2136-08 ENST00000338244 p.L310Q ITSN1 chr21 33867273 33867273 Missense_Mutation C C A TCGA-A4-7585-01A-11D-2136-08 ENST00000381318 p.S1372Y MYO18B chr22 26027036 26027036 Silent C C G TCGA-A4-7585-01A-11D-2136-08 ENST00000536101 p.L2354L PKDREJ chr22 46257763 46257763 Missense_Mutation T T G TCGA-A4-7585-01A-11D-2136-08 ENST00000253255 p.N1854H PPP6R2 chr22 50440008 50440008 Missense_Mutation G G T TCGA-A4-7585-01A-11D-2136-08 ENST00000216061 p.S778I PTCHD1 chrX 23393841 23393842 Frame_Shift_Ins - - G TCGA-A4-7585-01A-11D-2136-08 ENST00000379361 p.F775Cfs*11 SMC1A chrX 53415085 53415087 In_Frame_Del ATC ATC - TCGA-A4-7585-01A-11D-2136-08 ENST00000322213 p.I65del EPHA2 chr1 16148993 16148993 Missense_Mutation A A G TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000358432 p.C70R LRP8 chr1 53247041 53247041 Missense_Mutation G G A TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000306052 p.L957F MYSM1 chr1 58675476 58675476 Splice_Site C C - TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000472487 p.X498_splice MYSM1 chr1 58675478 58675478 Missense_Mutation A A T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000472487 p.M498K ZNHIT6 chr1 85702233 85702233 Missense_Mutation T T A TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000370574 p.R315W FCRL6 chr1 159808341 159808341 Silent A A T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000368106 p.A72A ARHGAP30 chr1 161048846 161048848 In_Frame_Del CTT CTT - TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000368013 p.K725del DNM3 chr1 171987699 171987699 Frame_Shift_Del T T - TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000355305 p.F94Lfs*15 EML4 chr2 42330249 42330249 3'UTR G G A TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000318522 EIF5B chr2 99399451 99399451 3'UTR T T C TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000289371 CNTNAP5 chr2 124790135 124790135 Frame_Shift_Del A A - TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000431078 p.E997Rfs*22 LRP2 chr2 169201721 169201722 Frame_Shift_Ins - - A TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000263816 p.M2787Yfs*4 TTN chr2 178532634 178532635 Frame_Shift_Ins - - A TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000591111 p.E33020* TTN chr2 178591384 178591384 Missense_Mutation G G T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000591111 p.T18473N GTF3C3 chr2 196784929 196784929 Frame_Shift_Del T T - TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000263956 p.I348* UGT1A3 chr2 233729944 233729944 Missense_Mutation T T C TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000482026 p.M273T AGAP1 chr2 235883374 235883374 Silent G G A TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000304032 p.S360S ESPNL chr2 238131579 238131579 Silent C C T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000343063 p.A955A BRPF1 chr3 9746426 9746426 Missense_Mutation G G C TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000457855 p.V1145L SYN2 chr3 12190672 12190672 3'UTR A A T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000621198 NEK10 chr3 27304783 27304784 Frame_Shift_Ins - - A TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000429845 p.W331Lfs*20 SHQ1 chr3 72832394 72832394 Missense_Mutation C C T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000325599 p.A192T KCNMB3 chr3 179242858 179242858 3'UTR G G C TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000314235 MCF2L2 chr3 183300092 183300092 Silent C C T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000328913 p.R406R SLIT2 chr4 20256705 20256705 Silent G G C TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000504154 p.T71T NPR3 chr5 32790205 32790205 3'UTR G G A TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000265074 SNCAIP chr5 122444694 122444694 Silent G G T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000261368 p.L518L FAM53C chr5 138341290 138341290 5'UTR T T A TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000239906 FAM53C chr5 138341291 138341291 5'UTR C C T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000239906 PCDHGB3 chr5 141372741 141372741 Missense_Mutation G G T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000576222 p.D783Y HIST1H3PS1 chr6 26322175 26322175 RNA C C - TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000404612 XPO5 chr6 43530699 43530699 Missense_Mutation C C G TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000265351 p.R889T HCRTR2 chr6 55277447 55277447 Missense_Mutation G G A TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000370862 p.G277E KHDRBS2 chr6 61894717 61894717 Missense_Mutation G G A TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000281156 p.P243L UTRN chr6 144490148 144490148 Silent C C A TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000367545 p.T1404T AKAP12 chr6 151352900 151352900 Missense_Mutation G G T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000253332 p.E1503D MLLT4 chr6 167946833 167946833 Missense_Mutation A A G TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000447894 p.K1155R FGL2 chr7 77196847 77196847 Missense_Mutation C C G TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000248598 p.W251S SRPK2 chr7 105143212 105143212 Missense_Mutation T T G TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000357311 p.K300T IQUB chr7 123512312 123512312 Missense_Mutation G G T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000324698 p.A10D CCDC136 chr7 128812829 128812829 Missense_Mutation A A T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000297788 p.Q888L KLHDC10 chr7 130116631 130116631 Missense_Mutation A A G TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000335420 p.D147G KCNH2 chr7 150952777 150952777 Missense_Mutation T T C TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000262186 p.H402R KMT2C chr7 152181337 152181337 Missense_Mutation T T C TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000262189 p.S2175G KIAA1456 chr8 13025106 13025106 3'UTR T T C TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000524591 NEFL chr8 24955546 24955546 Missense_Mutation C C A TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000610854 p.G324C SULF1 chr8 69603612 69603612 Silent C C T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000260128 p.N401N UBR5 chr8 102254499 102254499 Missense_Mutation A A T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000520539 p.S2735T PTPRD chr9 8341221 8341221 Missense_Mutation A A C TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000356435 p.N1665K PSIP1 chr9 15474061 15474062 Frame_Shift_Ins - - C TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000380733 p.V269Gfs*8 ZNF782 chr9 96818913 96818913 Silent T T C TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000481138 p.E370E FAM208B chr10 5746771 5746771 Missense_Mutation G G T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000328090 p.G1117V BAMBI chr10 28681523 28681523 Silent T T C TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000375533 p.S114S TSPAN15 chr10 69507662 69507662 3'UTR T T G TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000373290 IFIT1B chr10 89384517 89384517 Missense_Mutation T T C TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000371809 p.Y402H CWF19L1 chr10 100236943 100236943 Silent A A C TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000354105 p.S427S BUB3 chr10 123163846 123163846 3'UTR T T - TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000368865 BUB3 chr10 123163850 123163850 3'UTR C C T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000368865 OR52R1 chr11 4804071 4804071 Missense_Mutation C C A TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000356069 p.V104L PPP1R14B chr11 64246589 64246589 Missense_Mutation A A T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000309318 p.Y29N ARHGAP32 chr11 128974986 128974988 In_Frame_Del GAA GAA - TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000310343 p.F723del CRACR2A chr12 3638161 3638161 Missense_Mutation G G A TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000440314 p.P522L KANSL2 chr12 48669148 48669148 Missense_Mutation C C A TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000420613 p.L278F NOS1 chr12 117220110 117220110 Missense_Mutation C C T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000317775 p.A1379T OR10G2 chr14 21634648 21634648 Silent G G A TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000542433 p.Y65Y PRMT5 chr14 22924482 22924482 Missense_Mutation A A T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000324366 p.V358D DHRS1 chr14 24291185 24291185 Silent C C T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000288111 p.L253L RALGAPA1 chr14 35635523 35635523 Missense_Mutation G G C TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000389698 p.H1412D ADAM21P1 chr14 70247383 70247383 RNA G G T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000530196 DYNC1H1 chr14 102018575 102018575 Missense_Mutation C C T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000360184 p.P2768S ZBTB42 chr14 104801543 104801543 Missense_Mutation G G C TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000342537 p.G116R NEO1 chr15 73116737 73116738 Frame_Shift_Ins - - A TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000261908 p.F110Yfs*12 CRTC3 chr15 90629301 90629301 Silent C C T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000268184 p.S345S CCDC154 chr16 1436697 1436697 Missense_Mutation G G T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000389176 p.Q478K PDXDC1 chr16 15036060 15036060 Missense_Mutation A A G TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000396410 p.S718G DPEP3 chr16 67978347 67978347 Missense_Mutation G G C TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000268793 p.D227E PRMT7 chr16 68339501 68339501 Missense_Mutation T T G TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000339507 p.I228M CDH3 chr16 68682314 68682314 Missense_Mutation G G T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000264012 p.V337L ZNRF1 chr16 75093650 75093650 Missense_Mutation C C G TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000335325 p.P168R FANCA chr16 89765030 89765031 In_Frame_Ins - - GGCCTCTGA TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000389301 p.S877_A879dup ADPRM chr17 10705003 10705003 Missense_Mutation T T A TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000379774 p.V26D SPAG5 chr17 28579783 28579783 Missense_Mutation C C G TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000321765 p.R951P ZNF830 chr17 34962155 34962155 Missense_Mutation T T A TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000361952 p.S197T ZNF830 chr17 34962156 34962156 Missense_Mutation C C T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000361952 p.S197L LRRC37A2 chr17 46513143 46513143 Missense_Mutation C C T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000333412 p.P144L ANKRD12 chr18 9221919 9221919 Missense_Mutation T T C TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000262126 p.V288A NPC1 chr18 23536737 23536737 Missense_Mutation T T G TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000269228 p.I1061L MUC16 chr19 8975816 8975816 Missense_Mutation T T C TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000397910 p.T1775A KIAA1683 chr19 18266514 18266514 Silent T T A TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000600328 p.T342T RASGRP4 chr19 38419879 38419879 Missense_Mutation C C G TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000587738 p.R215P MEGF8 chr19 42375720 42375720 Missense_Mutation G G A TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000251268 p.V2495M C20orf85 chr20 58155511 58155511 Missense_Mutation T T A TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000371168 p.I65N URB1 chr21 32317718 32317722 Frame_Shift_Del GGTCT GGTCT - TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000382751 p.E1996Dfs*6 BCR chr22 23311721 23311721 Silent C C T TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000305877 p.Y1069Y DDX17 chr22 38488289 38488289 Intron A A G TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000403230 MID1IP1 chrX 38806237 38806237 3'UTR T T C TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000336949 P2RY4 chrX 70259079 70259081 In_Frame_Del GGT GGT - TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000374519 p.T182del MORC4 chrX 106993298 106993298 Missense_Mutation A A C TCGA-V9-A7HT-01A-11D-A33Q-10 ENST00000355610 p.N80K ATG4C chr1 62829067 62829067 Missense_Mutation A A G TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000317868 p.Q275R NBPF15 chr1 144436988 144436988 Missense_Mutation C C A TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000488031 p.D134Y FMO2 chr1 171193361 171193361 Silent T T C TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000209929 p.S53S FMN2 chr1 240208049 240208049 Silent A A T TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000319653 p.P1079P MAPRE3 chr2 27024200 27024204 Frame_Shift_Del CAACC CAACC - TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000233121 p.N125Sfs*14 ATP6V1E2 chr2 46512027 46512038 Missense_Mutation AGGCTTATATAA AGGCTTATATAA - TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000306448 ZAP70 chr2 97737855 97737855 Silent C C T TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000264972 p.V527V MYO7B chr2 127633325 127633325 Frame_Shift_Del A A - TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000409816 p.I1799Sfs*65 HNRNPCP2 chr2 189923834 189923834 RNA C C - TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000399515 ALS2CR11 chr2 201619006 201619006 Frame_Shift_Del T T - TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000286195 p.H42Pfs*14 PROM1 chr4 16000560 16000560 Missense_Mutation A A T TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000447510 p.F505Y C5orf42 chr5 37170149 37170149 Missense_Mutation A A C TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000425232 p.F2118L LRRC1 chr6 53919551 53919551 Missense_Mutation T T A TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000370888 p.L387Q RSPH10B2 chr7 6764013 6764013 Missense_Mutation G G T TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000297186 p.G162V MPP6 chr7 24650509 24650509 Missense_Mutation A A G TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000222644 p.N150D TBRG4 chr7 45109112 45109112 Silent T T C TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000258770 p.S42S MTUS1 chr8 17754193 17754193 Missense_Mutation C C T TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000262102 p.A539T WHSC1L1 chr8 38329870 38329870 Missense_Mutation T T A TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000317025 p.R363S ANK1 chr8 41725856 41725856 Missense_Mutation G G A TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000347528 p.R173C PITRM1 chr10 3146978 3146978 Intron T T - TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000224949 CACNB2 chr10 18261294 18261294 Intron C C T TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000324631 CCDC186 chr10 114162637 114162637 Missense_Mutation T T C TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000369287 p.K211R FAM175B chr10 124834879 124834879 Missense_Mutation C C G TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000298492 p.P386A FAM160A2 chr11 6214862 6214862 Silent G G A TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000449352 p.N755N SYTL2 chr11 85718900 85718900 Intron C C A TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000528231 NPAT chr11 108173036 108173036 Missense_Mutation C C T TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000278612 p.E650K PCED1B chr12 47235618 47235618 Missense_Mutation G G T TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000432328 p.K185N EEA1 chr12 92777657 92777657 Silent A A G TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000322349 p.L1300L RALGAPA1 chr14 35627921 35627921 Missense_Mutation G G A TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000389698 p.S1503F CTAGE5 chr14 39267398 39267398 5'UTR C C A TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000280083 PPP2R5E chr14 63376086 63376086 Missense_Mutation G G A TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000337537 p.R443C WDR25 chr14 100530047 100530047 3'UTR T T G TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000335290 RCCD1 chr15 90957339 90957339 Silent T T A TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000394258 p.A131A CACNA1H chr16 1221747 1221747 3'UTR A A - TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000348261 PDILT chr16 20360609 20360609 Silent G G A TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000302451 p.L489L TK2 chr16 66513730 66513730 Splice_Site C C G TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000299697 p.X233_splice SUPT6H chr17 28678177 28678177 Silent A A C TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000314616 p.R367R AKAP1 chr17 57106200 57106200 Missense_Mutation G G C TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000337714 p.G246R SOX9 chr17 72121771 72121771 Missense_Mutation A A G TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000245479 p.Y127C FXYD1 chr19 35140100 35140100 Missense_Mutation C C G TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000351325 p.I7M PRR12 chr19 49596409 49596409 Intron A A C TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000615927 SIGLEC16 chr19 49969874 49969874 RNA G G C TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000602139 SLC2A11 chr22 23877460 23877460 Intron C C T TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000345044 GUCD1 chr22 24546915 24546915 Missense_Mutation A A T TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000407471 p.C129S ACE2 chrX 15578165 15578165 Silent G G A TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000252519 p.I407I LANCL3 chrX 37572242 37572242 Silent C C T TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000378619 p.G124G ARMCX3 chrX 101626381 101626381 3'UTR G G T TCGA-2Z-A9JO-01A-11D-A42J-10 ENST00000341189 PRKCZ chr1 2135338 2135338 Silent C C T TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000378567 p.R137R LRRC8C chr1 89714518 89714518 Missense_Mutation A A G TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000370454 p.T650A ZNF644 chr1 90938012 90938012 Nonsense_Mutation G G T TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000337393 p.S1054* ZC3H11A chr1 203818655 203818658 Frame_Shift_Del GACA GACA - TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000332127 p.Q48Cfs*30 SUSD4 chr1 223363344 223363344 Missense_Mutation T T C TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000343846 p.R28G SNAP47 chr1 227747894 227747894 Missense_Mutation T T A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000315781 p.I98K SH3BP5L chr1 248812295 248812295 Missense_Mutation T T A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000366472 p.N263Y ATRAID chr2 27213276 27213276 Missense_Mutation A A G TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000606999 p.N67D CLEC4F chr2 70809786 70809786 Silent G G A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000272367 p.S537S RMND5A chr2 86720802 86720802 Silent G G A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000283632 p.Q45Q SCN3A chr2 165092472 165092472 Missense_Mutation A A G TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000360093 p.I1530T SCN1A chr2 166036289 166036289 Missense_Mutation G G A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000303395 p.S1063F XIRP2 chr2 167250176 167250177 Frame_Shift_Del CT CT - TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000628543 p.S2754Cfs*8 KIAA2012 chr2 202074972 202074972 Missense_Mutation T T A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000541917 p.W56R SPEG chr2 219477757 219477757 Missense_Mutation T T C TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000312358 p.F1600L UGT1A9 chr2 233671896 233671896 5'UTR T T C TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000354728 PASK chr2 241142864 241142864 Missense_Mutation G G T TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000234040 p.L57I HDLBP chr2 241256618 241256618 Silent T T C TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000391975 p.L213L CELSR3 chr3 48655330 48655330 Silent T T A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000164024 p.T1602T CELSR3 chr3 48655332 48655332 Frame_Shift_Del T T - TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000164024 p.T1602Qfs*4 BSN chr3 49651626 49651626 Silent C C A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000296452 p.I690I ACOX2 chr3 58534114 58534115 Frame_Shift_Ins - - TATATTT TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000302819 p.H119Kfs*52 SPICE1 chr3 113457286 113457286 Missense_Mutation C C T TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000295872 p.E503K ALDH1L1 chr3 126107238 126107238 Missense_Mutation A A C TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000393434 p.F786V PRKCI chr3 170284546 170284546 Silent T T C TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000295797 p.L385L HTT chr4 3229007 3229007 Missense_Mutation T T C TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000355072 p.S2703P LIFR chr5 38506073 38506073 Missense_Mutation A A C TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000263409 p.F375V IK chr5 140654551 140654551 Missense_Mutation A A C TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000417647 p.E185D PCDHGA11 chr5 141421266 141421266 Silent G G A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000398587 p.L13L CDKAL1 chr6 20739547 20739547 Missense_Mutation G G C TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000274695 p.V134L SOX4 chr6 21596317 21596317 3'UTR C C - TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000244745 CDKN1A chr6 36685837 36685837 3'UTR G G A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000244741 NFYA chr6 41091683 41091683 Missense_Mutation G G A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000341376 p.G235R YIPF3 chr6 43515641 43515641 Frame_Shift_Del T T - TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000372422 p.I117Sfs*21 FTSJ2 chr7 2235520 2235520 Missense_Mutation G G T TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000242257 p.H115N NOD1 chr7 30452790 30452790 Silent G G A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000222823 p.S209S OGDH chr7 44707632 44707633 Frame_Shift_Ins - - A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000222673 p.N950Kfs*3 ZNF273 chr7 64928575 64928575 Missense_Mutation C C G TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000476120 p.T416S AC005522.7 chr7 76980835 76980835 5'Flank G G A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000434531 ABCB4 chr7 87420015 87420015 Missense_Mutation T T C TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000265723 p.K793E PON3 chr7 95363609 95363609 Intron G C C TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000265627 SRRT chr7 100887708 100887708 Silent T T C TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000611405 p.P725P PPP2CB chr8 30793931 30793931 Missense_Mutation G G C TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000221138 p.Q242E PRKDC chr8 47897254 47897254 Missense_Mutation C C G TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000314191 p.V1169L RB1CC1 chr8 52656762 52656762 Nonsense_Mutation G G A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000025008 p.Q1023* ARHGAP22 chr10 48451009 48451009 Missense_Mutation C C G TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000249601 p.E374Q DNA2 chr10 68450099 68450099 Missense_Mutation T T C TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000358410 p.T290A ITPRIP chr10 104314363 104314363 3'UTR G G A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000278071 TALDO1 chr11 764914 764914 3'UTR G G A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000319006 FJX1 chr11 35620539 35620539 3'UTR G G A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000317811 ZNF408 chr11 46704683 46704683 Missense_Mutation A A C TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000311764 p.Q328P PPP1CA chr11 67400880 67400880 Missense_Mutation A A C TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000376745 p.F76C CLPB chr11 72434506 72434506 5'UTR C C G TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000294053 GRIA4 chr11 105753156 105753156 Silent A A T TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000282499 p.A141A DLAT chr11 112064005 112064005 3'UTR C C G TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000280346 DDN chr12 48997032 48997032 Missense_Mutation A A T TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000421952 p.V615E LYZ chr12 69350164 69350164 Missense_Mutation G G T TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000261267 p.A65S ATP2B1 chr12 89599210 89599211 Frame_Shift_Ins - - AA TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000428670 p.L1086Ffs*2 UBE2N chr12 93442035 93442035 5'UTR T T A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000318066 THSD1 chr13 52397416 52397416 Frame_Shift_Del G G - TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000258613 p.R280Dfs*56 ZIC2 chr13 99983068 99983068 Missense_Mutation G G A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000376335 p.C335Y SCFD1 chr14 30705869 30705869 Missense_Mutation A A T TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000458591 p.T513S TMEM260 chr14 56605634 56605634 Missense_Mutation A A C TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000261556 p.Y196S ZFYVE26 chr14 67785900 67785900 Missense_Mutation C C T TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000347230 p.D1088N EXD2 chr14 69230517 69230517 Missense_Mutation G G C TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000312994 p.E212D ADAM20 chr14 70522900 70522900 Missense_Mutation A A C TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000256389 p.C670G ELMSAN1 chr14 73739957 73739957 Missense_Mutation A A T TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000286523 p.F18I VRTN chr14 74359520 74359521 3'UTR - - A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000256362 BCL2L10 chr15 52112528 52112528 Missense_Mutation A A T TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000260442 p.Y67N PIF1 chr15 64815831 64815831 3'UTR A A T TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000268043 ULK3 chr15 74840282 74840282 Silent C C T TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000440863 p.R216R CLDN9 chr16 3013764 3013764 Silent C C A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000445369 p.I134I TIGD7 chr16 3300743 3300743 5'UTR T T A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000396862 FOXN1 chr17 28524931 28524931 Frame_Shift_Del C C - TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000226247 p.Y186Tfs*116 RPL19 chr17 39202404 39202404 Missense_Mutation C C T TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000225430 p.T67I THRA chr17 40074302 40074302 5'UTR A A G TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000264637 TOB1 chr17 50863711 50863711 Missense_Mutation T T A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000268957 p.I103F DDX5 chr17 64500734 64500734 Missense_Mutation G G C TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000225792 p.P419R POLRMT chr19 623528 623528 Missense_Mutation T T C TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000588649 p.M406V PLIN3 chr19 4844773 4844773 Silent G G A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000221957 p.G285G KEAP1 chr19 10499890 10499890 Silent G G T TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000171111 p.G48G KMT2B chr19 35738280 35738280 Splice_Site A A G TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000420124 p.X2625_splice CEACAM16 chr19 44707932 44707932 Missense_Mutation G G A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000405314 p.V338M TBC1D17 chr19 49884542 49884542 Missense_Mutation G G A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000221543 p.G443S CST9L chr20 23566031 23566033 In_Frame_Del CCC CCC - TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000376979 p.G99del L3MBTL1 chr20 43528805 43528805 Intron C C A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000418998 COL9A3 chr20 62836197 62836197 Missense_Mutation G G T TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000343916 p.R471L GABPA chr21 25758013 25758013 Missense_Mutation C C A TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000354828 p.P186H TANGO2 chr22 20043395 20043395 Missense_Mutation C C T TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000327374 p.P33S MEI1 chr22 41778846 41778846 Intron C C G TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000401548 BCOR chrX 40072895 40072895 Silent A A G TCGA-A4-A5XZ-01A-11D-A31X-10 ENST00000378444 p.T817T CEP104 chr1 3831152 3831152 Missense_Mutation G G A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000378230 p.A577V PRAMEF12 chr1 12775646 12775646 Nonsense_Mutation C C T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000357726 p.R131* HTR1D chr1 23194094 23194094 Silent G G A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000374619 p.A42A MACF1 chr1 39415934 39415934 Intron C C A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000372915 CYP4A11 chr1 46935041 46935041 Missense_Mutation C C A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000310638 p.R250L FOXD2 chr1 47439552 47439552 Missense_Mutation G G A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000334793 p.G473R CIART chr1 150284455 150284472 In_Frame_Del ATGGACAGGATCCAGCGT ATGGACAGGATCCAGCGT - TCGA-A4-A57E-01A-11D-A26P-10 ENST00000290363 p.M158_R163del PRUNE chr1 151028932 151028932 Frame_Shift_Del A A - TCGA-A4-A57E-01A-11D-A26P-10 ENST00000271620 p.L308Sfs*17 PRDX6 chr1 173485424 173485424 Missense_Mutation A A G TCGA-A4-A57E-01A-11D-A26P-10 ENST00000340385 p.R106G SIPA1L2 chr1 232464861 232464861 Missense_Mutation C C G TCGA-A4-A57E-01A-11D-A26P-10 ENST00000262861 p.R933S SNTG2 chr2 1237990 1237990 Silent C C A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000308624 p.A274A SNTG2 chr2 1237991 1237991 Missense_Mutation A A T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000308624 p.N275Y IL1A chr2 112782740 112782740 Silent G G T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000263339 p.S24S SLC35F5 chr2 113729439 113729439 Missense_Mutation A A C TCGA-A4-A57E-01A-11D-A26P-10 ENST00000245680 p.V351G FAM168B chr2 131055364 131055364 Missense_Mutation G G A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000389915 p.P128L RAPH1 chr2 203440075 203440075 Missense_Mutation C C G TCGA-A4-A57E-01A-11D-A26P-10 ENST00000319170 p.G1039R ZFAND2B chr2 219207992 219207992 Silent C C T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000289528 p.L130L CUL3 chr2 224557746 224557746 Missense_Mutation T T G TCGA-A4-A57E-01A-11D-A26P-10 ENST00000264414 p.R59S KIF1A chr2 240719111 240719111 Frame_Shift_Del G G - TCGA-A4-A57E-01A-11D-A26P-10 ENST00000320389 p.Y1603Mfs*185 KIT chr4 54703870 54703870 Silent C C G TCGA-A4-A57E-01A-11D-A26P-10 ENST00000288135 p.V301V ADAMTS3 chr4 72283278 72283278 Missense_Mutation C C T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000286657 p.S1159N DMXL1 chr5 119116254 119116254 Missense_Mutation A A T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000311085 p.I221F ARAP3 chr5 141655746 141655746 Missense_Mutation G G C TCGA-A4-A57E-01A-11D-A26P-10 ENST00000239440 p.Q1329E PCDH12 chr5 141955302 141955303 Frame_Shift_Ins - - A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000231484 p.N851Qfs*47 ADAMTS2 chr5 179140001 179140001 Missense_Mutation G G A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000251582 p.P555L ABT1 chr6 26597100 26597100 Nonsense_Mutation A A T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000274849 p.K40* DHX16 chr6 30671033 30671033 Splice_Region T T A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000376442 COL21A1 chr6 56060758 56060759 Frame_Shift_Ins - - A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000244728 p.C797Lfs*19 ZNF451 chr6 57101792 57101792 Intron C C T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000370706 LAMA2 chr6 129445815 129445815 Silent C C T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000421865 p.A2141A REPS1 chr6 138914736 138914736 Silent G G T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000450536 p.A582A MEOX2 chr7 15686242 15686242 Missense_Mutation G G C TCGA-A4-A57E-01A-11D-A26P-10 ENST00000262041 p.P54R HDAC9 chr7 18935894 18935894 Silent C C T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000432645 p.A960A FAM221A chr7 23689373 23689373 Missense_Mutation C C G TCGA-A4-A57E-01A-11D-A26P-10 ENST00000344962 p.P115R NEUROD6 chr7 31338321 31338321 Silent G G A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000297142 p.Y316Y SAMD9L chr7 93134735 93134735 Missense_Mutation A A T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000318238 p.Y413N CCDC132 chr7 93323707 93323707 Missense_Mutation A A T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000305866 p.Y651F GATS chr7 100201005 100201005 3'UTR C C T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000328453 MUC17 chr7 101033527 101033527 Missense_Mutation A A G TCGA-A4-A57E-01A-11D-A26P-10 ENST00000306151 p.E704G COL22A1 chr8 138694833 138694833 Missense_Mutation C C T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000303045 p.G880E TOP1MT chr8 143315756 143315756 Missense_Mutation G G C TCGA-A4-A57E-01A-11D-A26P-10 ENST00000329245 p.H508Q ANKRD18A chr9 38593857 38593858 Frame_Shift_Ins - - AAAA TCGA-A4-A57E-01A-11D-A26P-10 ENST00000399703 p.S636Ffs*17 CNTRL chr9 121150506 121150506 Intron C C T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000238341 KCNT1 chr9 135757331 135757331 Missense_Mutation C C G TCGA-A4-A57E-01A-11D-A26P-10 ENST00000488444 p.P218A PNLIPRP1 chr10 116597835 116597835 Silent T T C TCGA-A4-A57E-01A-11D-A26P-10 ENST00000358834 p.D194D MUC2 chr11 1100778 1100778 RNA C C T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000361558 MRGPRX3 chr11 18138044 18138044 Frame_Shift_Del G G - TCGA-A4-A57E-01A-11D-A26P-10 ENST00000396275 p.R281Lfs*7 JRKL chr11 96393345 96393345 3'Flank T T G TCGA-A4-A57E-01A-11D-A26P-10 ENST00000332349 EXPH5 chr11 108514099 108514099 Missense_Mutation C C T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000265843 p.G470R ABCG4 chr11 119156443 119156443 Missense_Mutation G G T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000615496 p.M267I PIK3C2G chr12 18282448 18282448 Missense_Mutation G G A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000266497 p.E123K RP11-478B9.1 chr12 45064511 45064511 Intron C C G TCGA-A4-A57E-01A-11D-A26P-10 ENST00000548424 KRT86 chr12 52306220 52306220 Missense_Mutation A A G TCGA-A4-A57E-01A-11D-A26P-10 ENST00000293525 p.K396R CYP27B1 chr12 57764444 57764444 Missense_Mutation G G A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000228606 p.A357V SRGAP1 chr12 64097345 64097345 Missense_Mutation G G C TCGA-A4-A57E-01A-11D-A26P-10 ENST00000355086 p.E595Q LRRC43 chr12 122184699 122184699 Silent T T C TCGA-A4-A57E-01A-11D-A26P-10 ENST00000339777 p.L111L DNAH10 chr12 123850948 123850948 Missense_Mutation G G A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000409039 p.G1937S BRI3BP chr12 125025150 125025150 Missense_Mutation G G T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000341446 p.W159L TBC1D4 chr13 75349279 75349279 Silent C C A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000377636 p.L433L TEP1 chr14 20378108 20378108 Silent G G C TCGA-A4-A57E-01A-11D-A26P-10 ENST00000262715 p.A1879A KCNH5 chr14 62981011 62981011 Missense_Mutation G G A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000322893 p.T268M PPP1R36 chr14 64586870 64586870 Silent G G A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000298705 p.K234K MPP5 chr14 67301969 67301969 Splice_Region C C T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000261681 RIN3 chr14 92651606 92651607 Frame_Shift_Ins - - T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000216487 p.P187Sfs*30 RTL1 chr14 100881145 100881145 Missense_Mutation C C T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000534062 p.R1215H RTL1 chr14 100883794 100883800 Frame_Shift_Del TCGTTGA TCGTTGA - TCGA-A4-A57E-01A-11D-A26P-10 ENST00000534062 p.L330Rfs*16 RTL1 chr14 100883801 100883801 Missense_Mutation G G A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000534062 p.L330F ARHGAP11A chr15 32637266 32637266 Silent T T C TCGA-A4-A57E-01A-11D-A26P-10 ENST00000361627 p.L831L ZNF770 chr15 34983419 34983419 Missense_Mutation T T A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000356321 p.N6Y PRTG chr15 55639789 55639790 Frame_Shift_Ins - - CGGGTGG TCGA-A4-A57E-01A-11D-A26P-10 ENST00000389286 p.H726Pfs*10 PRTG chr15 55639790 55639790 Missense_Mutation G G T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000389286 p.H726N ADAMTS7 chr15 78771037 78771037 Intron C C G TCGA-A4-A57E-01A-11D-A26P-10 ENST00000388820 DNAH3 chr16 21145312 21145312 Missense_Mutation G G A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000261383 p.P106L GTF3C1 chr16 27462311 27462311 Missense_Mutation C C T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000356183 p.V2034M TANGO6 chr16 68907511 68907511 Missense_Mutation G G T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000261778 p.G579V AP1G1 chr16 71745263 71745263 Missense_Mutation T T G TCGA-A4-A57E-01A-11D-A26P-10 ENST00000299980 p.D627A MLKL chr16 74682761 74682761 Silent G G T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000308807 p.V282V ZNF276 chr16 89723121 89723121 Intron C C T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000443381 WDR81 chr17 1727004 1727004 Missense_Mutation C C T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000409644 p.S682F TP53 chr17 7674241 7674241 Missense_Mutation G C C TCGA-A4-A57E-01A-11D-A26P-10 ENST00000269305 p.S241C ALDOC chr17 28574093 28574093 Missense_Mutation C C T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000226253 p.R258H SSH2 chr17 29631128 29631128 Missense_Mutation T T C TCGA-A4-A57E-01A-11D-A26P-10 ENST00000269033 p.T1329A NSRP1 chr17 30185515 30185515 Silent G G T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000247026 p.G506G DBF4B chr17 44751277 44751277 3'UTR C C A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000315005 SAMD14 chr17 50114200 50114201 Frame_Shift_Del TG TG - TCGA-A4-A57E-01A-11D-A26P-10 ENST00000330175 p.Q310Vfs*4 CSHL1 chr17 63911196 63911196 Translation_Start_Site T T A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000309894 p.M1? TPM4 chr19 16089052 16089052 Frame_Shift_Del G G - TCGA-A4-A57E-01A-11D-A26P-10 ENST00000300933 p.G155Vfs*14 YJEFN3 chr19 19529469 19529469 Missense_Mutation G G T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000514277 p.Q55H TSHZ3 chr19 31278157 31278157 Missense_Mutation C C T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000240587 p.G546S RYR1 chr19 38528615 38528615 Missense_Mutation A A T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000359596 p.M3652L POLD1 chr19 50414822 50414822 Missense_Mutation T T A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000440232 p.F799Y ZNF805 chr19 57254758 57254758 3'Flank T T A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000414468 ZNF548 chr19 57397105 57397105 Missense_Mutation C C T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000366197 p.L25F PAK7 chr20 9544428 9544428 Missense_Mutation C C A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000353224 p.V604F PAK7 chr20 9544429 9544429 Silent C C T TCGA-A4-A57E-01A-11D-A26P-10 ENST00000353224 p.L603L KIAA1755 chr20 38240907 38240907 Missense_Mutation C C A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000279024 p.E408D SGK2 chr20 43570668 43570668 Missense_Mutation T T C TCGA-A4-A57E-01A-11D-A26P-10 ENST00000341458 p.F198L C20orf62 chr20 44462170 44462170 Silent G G A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000372910 p.N76N SREBF2 chr22 41893159 41893159 Missense_Mutation C C A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000361204 p.H751N PRR32 chrX 126821431 126821431 Missense_Mutation T A A TCGA-A4-A57E-01A-11D-A26P-10 ENST00000371125 p.F265I ZSCAN20 chr1 33495185 33495185 Silent C T T TCGA-G7-6797-01A-11D-1961-08 ENST00000361328 p.I947I CAMSAP2 chr1 200853420 200853421 Frame_Shift_Ins - - A TCGA-G7-6797-01A-11D-1961-08 ENST00000236925 p.Q1264Tfs*12 FAM71A chr1 212626106 212626106 Missense_Mutation G T T TCGA-G7-6797-01A-11D-1961-08 ENST00000294829 p.R410M URB2 chr1 229635112 229635112 Missense_Mutation G C C TCGA-G7-6797-01A-11D-1961-08 ENST00000258243 p.A167P URB2 chr1 229635116 229635116 Missense_Mutation A G G TCGA-G7-6797-01A-11D-1961-08 ENST00000258243 p.Q168R GEN1 chr2 17774391 17774391 Nonsense_Mutation C C T TCGA-G7-6797-01A-11D-1961-08 ENST00000317402 p.Q398* ADGRF3 chr2 26310040 26310040 Silent C C A TCGA-G7-6797-01A-11D-1961-08 ENST00000311519 p.V1048V PSME4 chr2 53920215 53920215 Frame_Shift_Del C C - TCGA-G7-6797-01A-11D-1961-08 ENST00000404125 p.D800Mfs*15 XPO1 chr2 61478794 61478795 3'UTR - - A TCGA-G7-6797-01A-11D-1961-08 ENST00000401558 GFPT1 chr2 69326202 69326202 Missense_Mutation A A T TCGA-G7-6797-01A-11D-1961-08 ENST00000357308 p.V696E NCKAP5 chr2 132784159 132784159 Missense_Mutation C C G TCGA-G7-6797-01A-11D-1961-08 ENST00000409261 p.W884C TANC1 chr2 159227871 159227871 Missense_Mutation T T G TCGA-G7-6797-01A-11D-1961-08 ENST00000263635 p.F1319C ITM2C chr2 230876868 230876868 Silent G G C TCGA-G7-6797-01A-11D-1961-08 ENST00000326427 p.A154A CCR2 chr3 46357594 46357594 Missense_Mutation T T A TCGA-G7-6797-01A-11D-1961-08 ENST00000292301 p.F23I SLC26A6 chr3 48631308 48631308 Splice_Site T T C TCGA-G7-6797-01A-11D-1961-08 ENST00000395550 p.X302_splice ZMYND10 chr3 50341586 50341586 Nonsense_Mutation C C T TCGA-G7-6797-01A-11D-1961-08 ENST00000231749 p.W412* FAM208A chr3 56624855 56624855 Missense_Mutation G G C TCGA-G7-6797-01A-11D-1961-08 ENST00000493960 p.Q1431E ACOX2 chr3 58531805 58531805 Silent C C A TCGA-G7-6797-01A-11D-1961-08 ENST00000302819 p.R197R ZBTB11 chr3 101651261 101651261 Missense_Mutation C C T TCGA-G7-6797-01A-11D-1961-08 ENST00000312938 p.V1023I KIAA2018 chr3 113657562 113657562 Missense_Mutation T T C TCGA-G7-6797-01A-11D-1961-08 ENST00000316407 p.M1374V FSTL1 chr3 120403312 120403312 Silent A A G TCGA-G7-6797-01A-11D-1961-08 ENST00000295633 p.N208N COL6A6 chr3 130593074 130593074 Frame_Shift_Del A A - TCGA-G7-6797-01A-11D-1961-08 ENST00000358511 p.N1463Mfs*6 COPB2 chr3 139374430 139374430 Intron G G C TCGA-G7-6797-01A-11D-1961-08 ENST00000333188 ETV5 chr3 186048814 186048814 Missense_Mutation G G A TCGA-G7-6797-01A-11D-1961-08 ENST00000306376 p.A453V FAT1 chr4 186618716 186618716 Missense_Mutation C C A TCGA-G7-6797-01A-11D-1961-08 ENST00000441802 p.D2624Y CLPTM1L chr5 1335143 1335143 Missense_Mutation A A G TCGA-G7-6797-01A-11D-1961-08 ENST00000320895 p.L237P RGS7BP chr5 64609220 64609220 Frame_Shift_Del T T - TCGA-G7-6797-01A-11D-1961-08 ENST00000334025 p.F248Sfs*19 BHMT chr5 79131004 79131005 Frame_Shift_Ins - - A TCGA-G7-6797-01A-11D-1961-08 ENST00000274353 p.D371Rfs*21 FBXL21 chr5 135940549 135940549 Frame_Shift_Del A A - TCGA-G7-6797-01A-11D-1961-08 ENST00000620812 p.I184Lfs*11 PLEKHG1 chr6 150831520 150831520 Frame_Shift_Del T T - TCGA-G7-6797-01A-11D-1961-08 ENST00000358517 p.D805Ifs*5 AKAP12 chr6 151305846 151305846 Missense_Mutation C C G TCGA-G7-6797-01A-11D-1961-08 ENST00000253332 p.L88V PGAM2 chr7 44065526 44065526 Missense_Mutation C C A TCGA-G7-6797-01A-11D-1961-08 ENST00000297283 p.A2S TMED4 chr7 44581526 44581526 Missense_Mutation A A G TCGA-G7-6797-01A-11D-1961-08 ENST00000457408 p.S104P ADAM28 chr8 24352007 24352007 Silent T T C TCGA-G7-6797-01A-11D-1961-08 ENST00000265769 p.H733H XKR4 chr8 55523315 55523315 Silent C C G TCGA-G7-6797-01A-11D-1961-08 ENST00000327381 p.A347A PTK2 chr8 140735283 140735283 Silent C C T TCGA-G7-6797-01A-11D-1961-08 ENST00000521059 p.R666R TBC1D13 chr9 128803357 128803357 Missense_Mutation C C G TCGA-G7-6797-01A-11D-1961-08 ENST00000372648 p.I217M MCM10 chr10 13180572 13180572 Missense_Mutation A A C TCGA-G7-6797-01A-11D-1961-08 ENST00000484800 p.I300L PCBD1 chr10 70884026 70884026 Missense_Mutation T T C TCGA-G7-6797-01A-11D-1961-08 ENST00000299299 p.H80R OR4C13 chr11 49952524 49952524 Silent C C A TCGA-G7-6797-01A-11D-1961-08 ENST00000555099 p.I34I NUMA1 chr11 72012945 72012945 Missense_Mutation G G T TCGA-G7-6797-01A-11D-1961-08 ENST00000393695 p.L1520M HEBP1 chr12 12987186 12987186 Missense_Mutation T T C TCGA-G7-6797-01A-11D-1961-08 ENST00000014930 p.I122V PPFIBP1 chr12 27656662 27656662 Missense_Mutation A A C TCGA-G7-6797-01A-11D-1961-08 ENST00000318304 p.E279A GPD1 chr12 50109459 50109459 Nonsense_Mutation C C G TCGA-G7-6797-01A-11D-1961-08 ENST00000301149 p.Y330* KRT76 chr12 52776952 52776952 Frame_Shift_Del T T - TCGA-G7-6797-01A-11D-1961-08 ENST00000332411 p.S114Vfs*45 LRIG3 chr12 58877508 58877508 Missense_Mutation C C A TCGA-G7-6797-01A-11D-1961-08 ENST00000320743 p.V810F ANKRD13A chr12 110019262 110019262 Missense_Mutation T T C TCGA-G7-6797-01A-11D-1961-08 ENST00000261739 p.V223A SIX4 chr14 60723572 60723572 Missense_Mutation A A C TCGA-G7-6797-01A-11D-1961-08 ENST00000216513 p.I168S PPP1R36 chr14 64589361 64589361 3'UTR G G A TCGA-G7-6797-01A-11D-1961-08 ENST00000298705 IGHV3-79 chr14 106867830 106867830 RNA G G A TCGA-G7-6797-01A-11D-1961-08 ENST00000618968 GABRG3 chr15 27532726 27532729 Frame_Shift_Del TTCT TTCT - TCGA-G7-6797-01A-11D-1961-08 ENST00000615808 p.F417Sfs*19 GABRG3 chr15 27532730 27532730 Missense_Mutation T T C TCGA-G7-6797-01A-11D-1961-08 ENST00000615808 p.F418S IREB2 chr15 78473346 78473346 Missense_Mutation G G A TCGA-G7-6797-01A-11D-1961-08 ENST00000258886 p.V330I IREB2 chr15 78473347 78473347 Missense_Mutation T T C TCGA-G7-6797-01A-11D-1961-08 ENST00000258886 p.V330A C16orf59 chr16 2461751 2461751 Silent C C T TCGA-G7-6797-01A-11D-1961-08 ENST00000361837 p.L204L CES3 chr16 66966838 66966838 Missense_Mutation C C A TCGA-G7-6797-01A-11D-1961-08 ENST00000303334 p.N345K FAM65A chr16 67542123 67542123 Missense_Mutation G G A TCGA-G7-6797-01A-11D-1961-08 ENST00000379312 p.R450Q CHMP1A chr16 89651591 89651591 Missense_Mutation G G C TCGA-G7-6797-01A-11D-1961-08 ENST00000397901 p.A28G SLC47A2 chr17 19706732 19706732 Missense_Mutation C C G TCGA-G7-6797-01A-11D-1961-08 ENST00000325411 p.G289R ZNF207 chr17 32369331 32369331 Missense_Mutation A A T TCGA-G7-6797-01A-11D-1961-08 ENST00000321233 p.N385Y MPO chr17 58277972 58277972 Silent C C T TCGA-G7-6797-01A-11D-1961-08 ENST00000225275 p.L353L PPM1D chr17 60663476 60663476 Missense_Mutation G G A TCGA-G7-6797-01A-11D-1961-08 ENST00000305921 p.R581Q SMAD7 chr18 48921517 48921517 Missense_Mutation C C T TCGA-G7-6797-01A-11D-1961-08 ENST00000262158 p.R379Q GATAD2A chr19 19502386 19502386 Missense_Mutation C C T TCGA-G7-6797-01A-11D-1961-08 ENST00000358713 p.T544M ZNF573 chr19 37739238 37739238 Nonsense_Mutation C C A TCGA-G7-6797-01A-11D-1961-08 ENST00000536220 p.E418* ZNF573 chr19 37739239 37739239 Missense_Mutation C C A TCGA-G7-6797-01A-11D-1961-08 ENST00000536220 p.K417N PRR12 chr19 49594734 49594734 5'Flank G G C TCGA-G7-6797-01A-11D-1961-08 ENST00000615927 DSN1 chr20 36771177 36771177 Missense_Mutation C C A TCGA-G7-6797-01A-11D-1961-08 ENST00000373750 p.M17I NF2 chr22 29655677 29655677 Splice_Site G A A TCGA-G7-6797-01A-11D-1961-08 ENST00000338641 p.X200_splice NXF3 chrX 103082783 103082783 Missense_Mutation C T T TCGA-G7-6797-01A-11D-1961-08 ENST00000395065 p.V253I DOCK11 chrX 118597540 118597540 Silent A T T TCGA-G7-6797-01A-11D-1961-08 ENST00000276202 p.A791A KIAA1210 chrX 119089131 119089131 Missense_Mutation A G G TCGA-G7-6797-01A-11D-1961-08 ENST00000402510 p.I700T LRRC8B chr1 89582986 89582986 Silent A A G TCGA-IA-A40X-01A-11D-A25F-10 ENST00000330947 p.K112K OTX1 chr2 63055595 63055595 Missense_Mutation T T A TCGA-IA-A40X-01A-11D-A25F-10 ENST00000282549 p.V115E TTN chr2 178751231 178751231 Intron C C T TCGA-IA-A40X-01A-11D-A25F-10 ENST00000591111 SLC11A1 chr2 218384314 218384314 Missense_Mutation C C A TCGA-IA-A40X-01A-11D-A25F-10 ENST00000233202 p.D74E CRBN chr3 3167788 3167788 Missense_Mutation T T G TCGA-IA-A40X-01A-11D-A25F-10 ENST00000231948 p.Q178P KLHDC8B chr3 49174870 49174870 Missense_Mutation G G A TCGA-IA-A40X-01A-11D-A25F-10 ENST00000332780 p.V224I SLC6A19 chr5 1219103 1219103 Silent C C T TCGA-IA-A40X-01A-11D-A25F-10 ENST00000304460 p.L458L PCDHB3 chr5 141100632 141100632 5'UTR A A T TCGA-IA-A40X-01A-11D-A25F-10 ENST00000231130 TNRC18 chr7 5357243 5357243 Nonsense_Mutation G G A TCGA-IA-A40X-01A-11D-A25F-10 ENST00000430969 p.Q1623* C9orf153 chr9 86229557 86229557 Missense_Mutation G G A TCGA-IA-A40X-01A-11D-A25F-10 ENST00000376001 p.A16V CTNNA3 chr10 65966667 65966667 Missense_Mutation C C T TCGA-IA-A40X-01A-11D-A25F-10 ENST00000433211 p.C782Y NUP98 chr11 3723244 3723244 Missense_Mutation T T A TCGA-IA-A40X-01A-11D-A25F-10 ENST00000359171 p.S704C MTMR2 chr11 95835298 95835298 Missense_Mutation C C T TCGA-IA-A40X-01A-11D-A25F-10 ENST00000346299 p.V642I CRACR2A chr12 3656379 3656379 Missense_Mutation G G T TCGA-IA-A40X-01A-11D-A25F-10 ENST00000252322 p.Q264K ADGRD1 chr12 130992371 130992372 Frame_Shift_Ins - - AC TCGA-IA-A40X-01A-11D-A25F-10 ENST00000261654 p.A317Qfs*3 IL21R chr16 27434442 27434442 Missense_Mutation C C G TCGA-IA-A40X-01A-11D-A25F-10 ENST00000337929 p.L49V IL21R chr16 27448553 27448553 Missense_Mutation T T C TCGA-IA-A40X-01A-11D-A25F-10 ENST00000337929 p.F296S TRIM37 chr17 59057046 59057046 Missense_Mutation T T C TCGA-IA-A40X-01A-11D-A25F-10 ENST00000262294 p.Y343C ZNF536 chr19 30445104 30445104 Missense_Mutation G G C TCGA-IA-A40X-01A-11D-A25F-10 ENST00000355537 p.E514D GMFG chr19 39335979 39335979 5'UTR T T C TCGA-IA-A40X-01A-11D-A25F-10 ENST00000597595 PLD3 chr19 40366697 40366697 Intron C C G TCGA-IA-A40X-01A-11D-A25F-10 ENST00000356508 KCNN4 chr19 43774202 43774202 Missense_Mutation C C T TCGA-IA-A40X-01A-11D-A25F-10 ENST00000262888 p.V225M BPIFB3 chr20 33072771 33072771 Missense_Mutation A A G TCGA-IA-A40X-01A-11D-A25F-10 ENST00000375494 p.N460S FAM83C chr20 35286779 35286779 Missense_Mutation G G C TCGA-IA-A40X-01A-11D-A25F-10 ENST00000374408 p.S667C TMPRSS3 chr21 42382223 42382223 Missense_Mutation G G C TCGA-IA-A40X-01A-11D-A25F-10 ENST00000291532 p.P265R MMP11 chr22 23783431 23783431 Missense_Mutation G G T TCGA-IA-A40X-01A-11D-A25F-10 ENST00000215743 p.G452C VCX chrX 7843749 7843749 Silent C C T TCGA-IA-A40X-01A-11D-A25F-10 ENST00000381059 p.S118S GAB3 chrX 154680152 154680152 Missense_Mutation A A G TCGA-IA-A40X-01A-11D-A25F-10 ENST00000369575 p.S542P ZC3H12A chr1 37482920 37482920 Missense_Mutation A A T TCGA-G7-A8LC-01A-11D-A35Z-10 ENST00000373087 p.E370V SWT1 chr1 185190604 185190604 Missense_Mutation C C G TCGA-G7-A8LC-01A-11D-A35Z-10 ENST00000367500 p.H495Q SLC6A3 chr5 1420578 1420578 Silent G G A TCGA-G7-A8LC-01A-11D-A35Z-10 ENST00000270349 p.C306C TRAPPC9 chr8 139885957 139885957 Missense_Mutation G G A TCGA-G7-A8LC-01A-11D-A35Z-10 ENST00000438773 p.R993C NUP98 chr11 3712527 3712527 Intron C C T TCGA-G7-A8LC-01A-11D-A35Z-10 ENST00000359171 OR51E1 chr11 4654221 4654221 3'UTR A A - TCGA-G7-A8LC-01A-11D-A35Z-10 ENST00000396952 PAX6 chr11 31789745 31789745 3'Flank T T A TCGA-G7-A8LC-01A-11D-A35Z-10 ENST00000241001 PDGFD chr11 104036843 104036843 Intron C C T TCGA-G7-A8LC-01A-11D-A35Z-10 ENST00000393158 NACA chr12 56716931 56716931 Intron A A G TCGA-G7-A8LC-01A-11D-A35Z-10 ENST00000356769 POTEM chr14 18977532 18977532 Missense_Mutation C C G TCGA-G7-A8LC-01A-11D-A35Z-10 ENST00000547889 p.N328K SAV1 chr14 50665249 50665249 Frame_Shift_Del G G - TCGA-G7-A8LC-01A-11D-A35Z-10 ENST00000324679 p.Y156Tfs*33 SAV1 chr14 50665251 50665251 Missense_Mutation C C A TCGA-G7-A8LC-01A-11D-A35Z-10 ENST00000324679 p.D155Y YLPM1 chr14 74809780 74809780 Missense_Mutation A A T TCGA-G7-A8LC-01A-11D-A35Z-10 ENST00000325680 p.D1641V TOMM40 chr19 44900805 44900805 Missense_Mutation G G A TCGA-G7-A8LC-01A-11D-A35Z-10 ENST00000252487 p.R240Q TXNIP chr1 145995152 145995152 Missense_Mutation C C T TCGA-BQ-5889-01A-11D-1589-08 ENST00000582401 p.D155N OBSCN chr1 228303698 228303698 Intron G G A TCGA-BQ-5889-01A-11D-1589-08 ENST00000422127 SRBD1 chr2 45419870 45419870 Missense_Mutation T T C TCGA-BQ-5889-01A-11D-1589-08 ENST00000263736 p.K692E SLC20A1 chr2 112646956 112646956 Missense_Mutation A A T TCGA-BQ-5889-01A-11D-1589-08 ENST00000272542 p.D43V ERCC3 chr2 127292656 127292656 Missense_Mutation T T A TCGA-BQ-5889-01A-11D-1589-08 ENST00000285398 p.K142M UGT1A1 chr2 233760376 233760376 Missense_Mutation T T C TCGA-BQ-5889-01A-11D-1589-08 ENST00000305208 p.I30T AC093642.5 chr2 242114679 242114679 RNA G G A TCGA-BQ-5889-01A-11D-1589-08 ENST00000456398 PLCXD2 chr3 111713910 111713910 Silent C C T TCGA-BQ-5889-01A-11D-1589-08 ENST00000477665 p.P216P DRD5 chr4 9782455 9782455 Missense_Mutation C C G TCGA-BQ-5889-01A-11D-1589-08 ENST00000304374 p.I142M CCT5 chr5 10261639 10261639 Missense_Mutation T T G TCGA-BQ-5889-01A-11D-1589-08 ENST00000280326 p.L358R ARAP3 chr5 141654367 141654367 Silent T T C TCGA-BQ-5889-01A-11D-1589-08 ENST00000239440 p.P1406P FBXO38 chr5 148402087 148402087 Missense_Mutation A A G TCGA-BQ-5889-01A-11D-1589-08 ENST00000340253 p.H123R EPHB6 chr7 142864556 142864556 Silent G G T TCGA-BQ-5889-01A-11D-1589-08 ENST00000619012 p.G252G FBXO16 chr8 28463779 28463779 Missense_Mutation T T G TCGA-BQ-5889-01A-11D-1589-08 ENST00000380254 p.T59P FAM214B chr9 35105256 35105256 Frame_Shift_Del C C - TCGA-BQ-5889-01A-11D-1589-08 ENST00000322813 p.A528Pfs*99 ANKRD22 chr10 88851701 88851701 5'UTR A A T TCGA-BQ-5889-01A-11D-1589-08 ENST00000371930 NDUFV1 chr11 67611935 67611935 Missense_Mutation C C A TCGA-BQ-5889-01A-11D-1589-08 ENST00000322776 p.F373L SLC26A10 chr12 57622852 57622852 Missense_Mutation T T C TCGA-BQ-5889-01A-11D-1589-08 ENST00000320442 p.I286T YEATS4 chr12 69365835 69365835 Missense_Mutation A A C TCGA-BQ-5889-01A-11D-1589-08 ENST00000247843 p.E95A UBE3B chr12 109501435 109501435 Missense_Mutation C C T TCGA-BQ-5889-01A-11D-1589-08 ENST00000342494 p.R395W CLEC14A chr14 38254624 38254624 Missense_Mutation C C T TCGA-BQ-5889-01A-11D-1589-08 ENST00000342213 p.G467R HERC2 chr15 28265726 28265726 Missense_Mutation T T A TCGA-BQ-5889-01A-11D-1589-08 ENST00000261609 p.S588C TSC2 chr16 2076138 2076138 Missense_Mutation T T C TCGA-BQ-5889-01A-11D-1589-08 ENST00000219476 p.F904L PRPF8 chr17 1661161 1661161 Missense_Mutation A A T TCGA-BQ-5889-01A-11D-1589-08 ENST00000304992 p.V1447D SCRN2 chr17 47837851 47837851 Missense_Mutation T T C TCGA-BQ-5889-01A-11D-1589-08 ENST00000290216 p.Y424C TEX2 chr17 64213149 64213149 Missense_Mutation C C T TCGA-BQ-5889-01A-11D-1589-08 ENST00000583097 p.G357S PRPSAP1 chr17 76311622 76311622 Frame_Shift_Del T T - TCGA-BQ-5889-01A-11D-1589-08 ENST00000446526 p.I360Ffs*47 RAE1 chr20 57374811 57374811 Intron C C T TCGA-BQ-5889-01A-11D-1589-08 ENST00000371242 GPRASP1 chrX 102655755 102655755 Silent G G C TCGA-BQ-5889-01A-11D-1589-08 ENST00000361600 p.G614G F8 chrX 154929608 154929608 Silent C C T TCGA-BQ-5889-01A-11D-1589-08 ENST00000360256 p.T1394T SFN chr1 26863424 26863424 Missense_Mutation A A G TCGA-J7-6720-01A-11D-2136-08 ENST00000339276 p.E71G GPR3 chr1 27393826 27393846 In_Frame_Del GCCTGGCTCTCAGCTGGCTCA GCCTGGCTCTCAGCTGGCTCA - TCGA-J7-6720-01A-11D-2136-08 ENST00000374024 p.A10_S16del PIAS3 chr1 145856101 145856101 Missense_Mutation G G A TCGA-J7-6720-01A-11D-2136-08 ENST00000393045 p.A182V TSACC chr1 156339792 156339792 Splice_Site G G C TCGA-J7-6720-01A-11D-2136-08 ENST00000368251 p.X12_splice LBR chr1 225410355 225410355 Missense_Mutation G G C TCGA-J7-6720-01A-11D-2136-08 ENST00000272163 p.S417C CALCRL chr2 187380698 187380698 Missense_Mutation A A G TCGA-J7-6720-01A-11D-2136-08 ENST00000392370 p.F92L WDR12 chr2 202897383 202897383 Missense_Mutation C C T TCGA-J7-6720-01A-11D-2136-08 ENST00000261015 p.R124Q COL4A3 chr2 227280555 227280555 Missense_Mutation G G T TCGA-J7-6720-01A-11D-2136-08 ENST00000396578 p.G780V FBXO36 chr2 230010713 230010713 Silent A A G TCGA-J7-6720-01A-11D-2136-08 ENST00000283946 p.K132K ABHD14A-ACY1 chr3 51986503 51986503 Frame_Shift_Del G G - TCGA-J7-6720-01A-11D-2136-08 ENST00000463937 TWF2 chr3 52235082 52235082 Missense_Mutation A A G TCGA-J7-6720-01A-11D-2136-08 ENST00000305533 p.F17S FNDC3B chr3 172307402 172307402 Silent C C G TCGA-J7-6720-01A-11D-2136-08 ENST00000336824 p.S367S ZNF876P chr4 253712 253712 RNA A A C TCGA-J7-6720-01A-11D-2136-08 ENST00000356347 TBC1D14 chr4 7025138 7025138 Missense_Mutation C C A TCGA-J7-6720-01A-11D-2136-08 ENST00000409757 p.T631N PDLIM5 chr4 94575776 94575776 Missense_Mutation C C G TCGA-J7-6720-01A-11D-2136-08 ENST00000317968 p.T151S SH3RF1 chr4 169107187 169107187 Silent A A G TCGA-J7-6720-01A-11D-2136-08 ENST00000284637 p.L720L GIN1 chr5 103108622 103108631 Frame_Shift_Del AGTGTAGTTG AGTGTAGTTG - TCGA-J7-6720-01A-11D-2136-08 ENST00000399004 p.S26Cfs*8 HINT1 chr5 131165152 131165152 Silent G G T TCGA-J7-6720-01A-11D-2136-08 ENST00000304043 p.I18I TBC1D9B chr5 179899225 179899225 Silent C C T TCGA-J7-6720-01A-11D-2136-08 ENST00000356834 p.E104E CDKAL1 chr6 20846091 20846091 Missense_Mutation A A G TCGA-J7-6720-01A-11D-2136-08 ENST00000274695 p.T219A TJAP1 chr6 43504915 43504915 Missense_Mutation A A G TCGA-J7-6720-01A-11D-2136-08 ENST00000372445 p.N245S ZDHHC14 chr6 157672743 157672753 Frame_Shift_Del TTCAGAGCACC TTCAGAGCACC - TCGA-J7-6720-01A-11D-2136-08 ENST00000359775 p.I363Kfs*66 THBS2 chr6 169241919 169241919 Missense_Mutation C C G TCGA-J7-6720-01A-11D-2136-08 ENST00000366787 p.R245P ZNF735 chr7 64266601 64266601 Missense_Mutation C C G TCGA-J7-6720-01A-11D-2136-08 ENST00000623629 p.P368R ZKSCAN1 chr7 100023430 100023430 5'UTR A A - TCGA-J7-6720-01A-11D-2136-08 ENST00000324306 RELN chr7 103651769 103651769 Missense_Mutation G G C TCGA-J7-6720-01A-11D-2136-08 ENST00000428762 p.T595S JPH1 chr8 74315430 74315430 Silent G G A TCGA-J7-6720-01A-11D-2136-08 ENST00000342232 p.R190R CYP11B1 chr8 142875313 142875313 Splice_Site C C G TCGA-J7-6720-01A-11D-2136-08 ENST00000292427 p.X374_splice IFIT5 chr10 89418702 89418705 3'UTR TGTT TGTT - TCGA-J7-6720-01A-11D-2136-08 ENST00000371795 ING4 chr12 6652383 6652383 Frame_Shift_Del C C - TCGA-J7-6720-01A-11D-2136-08 ENST00000396807 p.G179Afs*31 FGD4 chr12 32625033 32625034 In_Frame_Ins - - TTTTTT TCGA-J7-6720-01A-11D-2136-08 ENST00000427716 p.I534_A535insFF DGKH chr13 42168495 42168495 Missense_Mutation G G A TCGA-J7-6720-01A-11D-2136-08 ENST00000337343 p.G392R DGKH chr13 42168496 42168496 Missense_Mutation G G T TCGA-J7-6720-01A-11D-2136-08 ENST00000337343 p.G392V JKAMP chr14 59498856 59498856 Silent T T C TCGA-J7-6720-01A-11D-2136-08 ENST00000554271 p.L210L CEMIP chr15 80929169 80929170 Frame_Shift_Del AG AG - TCGA-J7-6720-01A-11D-2136-08 ENST00000220244 p.I869Mfs*7 SBK1 chr16 28319034 28319034 Missense_Mutation C C T TCGA-J7-6720-01A-11D-2136-08 ENST00000341901 p.T89I PSG2 chr19 43081065 43081065 Nonsense_Mutation A A T TCGA-J7-6720-01A-11D-2136-08 ENST00000406487 p.Y82* ZNF347 chr19 53140320 53140322 In_Frame_Del TGA TGA - TCGA-J7-6720-01A-11D-2136-08 ENST00000334197 p.S836del NOP56 chr20 2652837 2652837 Splice_Region T T A TCGA-J7-6720-01A-11D-2136-08 ENST00000329276 COL6A2 chr21 46122874 46122874 Splice_Site G G A TCGA-J7-6720-01A-11D-2136-08 ENST00000300527 p.X537_splice PCNT chr21 46389332 46389332 Missense_Mutation A A T TCGA-J7-6720-01A-11D-2136-08 ENST00000359568 p.E1247D PRDM16 chr1 3417899 3417899 Silent C C G TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000270722 p.S921S MIIP chr1 12021821 12021821 Missense_Mutation T T C TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000235332 p.V32A WDTC1 chr1 27260982 27260982 5'UTR T T C TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000319394 FAM46C chr1 117627762 117627762 3'UTR G G C TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000369448 FLAD1 chr1 154984044 154984044 Missense_Mutation T T G TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000292180 p.I117S INSRR chr1 156854189 156854189 Missense_Mutation T T C TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000368195 p.D67G KIRREL chr1 158088437 158088437 Frame_Shift_Del A A - TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000359209 p.K344Rfs*7 MLK4 chr1 233382607 233382607 Missense_Mutation G G T TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000366624 p.D1003Y HEATR1 chr1 236603047 236603047 Intron A A C TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000366582 DOCK10 chr2 224823640 224823640 Missense_Mutation C C T TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000258390 p.R1015Q PSMD1 chr2 231165892 231165893 Frame_Shift_Ins - - A TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000308696 p.E866Rfs*7 RAB17 chr2 237586108 237586108 Missense_Mutation T T A TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000264601 p.Q16L PRRT3 chr3 9946707 9946707 Frame_Shift_Del G G - TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000295984 p.E823Sfs*3 SHISA5 chr3 48469055 48469055 3'UTR T T C TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000296444 CACNA1D chr3 53811309 53811309 Missense_Mutation T T C TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000350061 p.L2130P SHQ1 chr3 72792952 72792952 Missense_Mutation T T C TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000325599 p.Y382C PIK3CB chr3 138759334 138759334 Missense_Mutation T T C TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000289153 p.S4G EIF4G1 chr3 184334736 184334736 Missense_Mutation G G A TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000346169 p.R1543Q DLG1 chr3 197080947 197080947 Intron A A G TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000419354 ARAP2 chr4 36177865 36177865 Missense_Mutation A A C TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000303965 p.L607V SCLT1 chr4 129093306 129093306 5'UTR G G C TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000281142 COX7C chr5 86618012 86618012 5'UTR C C T TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000247655 PAIP2 chr5 139369039 139369039 3'UTR A G G TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000265192 SLC4A9 chr5 140367436 140367436 Missense_Mutation G A A TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000507527 p.R701H TINAG chr6 54349742 54349742 Missense_Mutation T T C TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000259782 p.L309P DST chr6 56629432 56629432 Silent A A G TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000312431 p.S1260S LAMA4 chr6 112109440 112109440 Silent G G A TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000230538 p.A1823A LAMA4 chr6 112109441 112109441 Missense_Mutation G G T TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000230538 p.A1823D NHSL1 chr6 138424687 138424687 Frame_Shift_Del A A - TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000427025 p.Q1410Rfs*19 AP5Z1 chr7 4788800 4788800 Intron C C T TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000348624 RAPGEF5 chr7 22160572 22160572 Missense_Mutation A A G TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000401957 p.I188T VPS41 chr7 38862601 38862601 Missense_Mutation A A T TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000310301 p.Y64N FZD1 chr7 91268526 91268526 3'UTR A A G TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000287934 PEG10 chr7 94667738 94667739 3'UTR - - AAA TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000482108 PHF20L1 chr8 132811056 132811056 Silent A A G TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000395386 p.A286A JRK chr8 142666276 142666276 5'UTR T T C TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000612905 RECQL4 chr8 144516151 144516151 Missense_Mutation C C T TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000617875 p.S323N TSTD2 chr9 97627506 97627506 Missense_Mutation T T G TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000341170 p.R19S GATA3 chr10 8069504 8069504 Missense_Mutation C C A TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000346208 p.A318E ZNF438 chr10 30849261 30849261 Missense_Mutation T T C TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000361310 p.R382G PCDH15 chr10 54664204 54664204 Missense_Mutation A A T TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000320301 p.L20H MKI67 chr10 128112396 128112396 Missense_Mutation A A G TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000368654 p.V569A SLC25A22 chr11 793537 793540 Frame_Shift_Del AGAG AGAG - TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000320230 p.S95Rfs*6 NLRP14 chr11 7062342 7062342 Silent C C A TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000299481 p.G938G LPXN chr11 58578078 58578078 5'Flank T T C TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000395074 CCDC88B chr11 64343324 64343325 Frame_Shift_Ins - - GGCAT TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000356786 NUMA1 chr11 72005315 72005315 Missense_Mutation T T C TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000393695 p.D1916G CREBZF chr11 85662088 85662088 3'UTR T T C TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000490820 MMP10 chr11 102779235 102779235 Missense_Mutation T T C TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000279441 p.I158M GRIK4 chr11 120875142 120875142 Missense_Mutation G G A TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000438375 p.E355K ITFG2 chr12 2820771 2820771 Silent G G A TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000228799 p.L198L KLRG1 chr12 9009033 9009033 Missense_Mutation C C G TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000266551 p.S139C PAN2 chr12 56324293 56324293 Splice_Site C C T TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000425394 p.X643_splice LRP1 chr12 57154561 57154561 Missense_Mutation G G A TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000243077 p.D363N GLI1 chr12 57464835 57464835 Missense_Mutation G G A TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000228682 p.G119D USP44 chr12 95528939 95528939 Missense_Mutation C C T TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000258499 p.E498K USP44 chr12 95528940 95528940 Missense_Mutation C C A TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000258499 p.L497F CKAP4 chr12 106239715 106239715 Missense_Mutation A A C TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000378026 p.L373R EP400 chr12 131961416 131961416 Missense_Mutation C C T TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000389562 p.P266L PARP4 chr13 24459107 24459107 Missense_Mutation C C G TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000381989 p.M787I ALOX5AP chr13 30764126 30764126 3'UTR T T C TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000380490 EXD2 chr14 69230509 69230509 Missense_Mutation C C A TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000312994 p.L210I SMEK1 chr14 91470931 91470931 Silent G G A TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000554943 p.H522H KIF26A chr14 104152449 104152449 Silent G G A TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000423312 p.P241P PKM chr15 72210454 72210454 Missense_Mutation C C T TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000335181 p.V91M ARIH1 chr15 72563483 72563483 Missense_Mutation A A C TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000379887 p.K298N SNN chr16 11679032 11679032 3'UTR T T A TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000329565 ITGAX chr16 31360364 31360375 In_Frame_Del CATTGTCATCAC CATTGTCATCAC - TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000268296 p.I255_T258del MPDU1 chr17 7587431 7587431 Silent C C T TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000250124 p.T208T FNDC8 chr17 35130419 35130419 Silent C C T TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000158009 p.Y320Y HNF1B chr17 37744678 37744689 In_Frame_Del GTGGCCGTTGGT GTGGCCGTTGGT - TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000617811 p.T66_H69del SEC14L1 chr17 77206400 77206400 Frame_Shift_Del G G - TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000430767 CHST9 chr18 27142708 27142708 Missense_Mutation C C A TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000581714 p.W34C ZNF567 chr19 36719700 36719700 Missense_Mutation G G T TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000536254 p.D326Y PSMD8 chr19 38382251 38382251 Intron G G T TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000215071 DMPK chr19 45770587 45770589 In_Frame_Del AAC AAC - TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000291270 p.V597del ZNF606 chr19 57978703 57978703 Silent T T C TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000341164 p.K659K SOX12 chr20 329604 329604 3'UTR T T C TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000342665 REM1 chr20 31476537 31476537 Missense_Mutation G G A TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000201979 p.G31D UFD1L chr22 19454727 19454727 Intron A A T TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000263202 RFPL2 chr22 32202452 32202452 5'Flank C C T TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000248983 KIAA1644 chr22 44249586 44249586 3'UTR G G T TCGA-2Z-A9JP-01A-11D-A42J-10 ENST00000381176 UBR4 chr1 19094067 19094067 Missense_Mutation G G T TCGA-B9-4114-01A-01D-1252-08 ENST00000375254 p.R4607S ZYG11B chr1 52771263 52771263 Missense_Mutation C C A TCGA-B9-4114-01A-01D-1252-08 ENST00000294353 p.T147N SGIP1 chr1 66673313 66673313 Missense_Mutation C C A TCGA-B9-4114-01A-01D-1252-08 ENST00000371037 p.A198D BCAR3 chr1 93589174 93589174 Silent C C T TCGA-B9-4114-01A-01D-1252-08 ENST00000260502 p.Q244Q ATP1A1 chr1 116388954 116388954 Missense_Mutation A A C TCGA-B9-4114-01A-01D-1252-08 ENST00000295598 p.D230A PGLYRP3 chr1 153307185 153307185 Nonsense_Mutation G G C TCGA-B9-4114-01A-01D-1252-08 ENST00000290722 p.Y46* MRPS14 chr1 175023349 175023349 Intron A A C TCGA-B9-4114-01A-01D-1252-08 ENST00000476371 IRF2BP2 chr1 234607310 234607312 In_Frame_Del AGC AGC - TCGA-B9-4114-01A-01D-1252-08 ENST00000366609 p.C530del CAPN13 chr2 30732483 30732483 Missense_Mutation A A T TCGA-B9-4114-01A-01D-1252-08 ENST00000295055 p.F628I REV1 chr2 99462666 99462666 Intron T T A TCGA-B9-4114-01A-01D-1252-08 ENST00000258428 TRAK2 chr2 201398244 201398244 Silent G G A TCGA-B9-4114-01A-01D-1252-08 ENST00000332624 p.F197F SP140 chr2 230312656 230312656 Missense_Mutation C C T TCGA-B9-4114-01A-01D-1252-08 ENST00000392045 p.A859V IFT57 chr3 108218587 108218587 Missense_Mutation G G C TCGA-B9-4114-01A-01D-1252-08 ENST00000264538 p.L148V RARRES1 chr3 158704811 158704811 Missense_Mutation G G C TCGA-B9-4114-01A-01D-1252-08 ENST00000237696 p.L218V EVC chr4 5719352 5719352 Silent G G A TCGA-B9-4114-01A-01D-1252-08 ENST00000264956 p.S93S KCTD8 chr4 44447767 44447767 Missense_Mutation T T G TCGA-B9-4114-01A-01D-1252-08 ENST00000360029 p.N253H KCTD8 chr4 44447768 44447768 Silent G G A TCGA-B9-4114-01A-01D-1252-08 ENST00000360029 p.L252L LNX1 chr4 53476925 53476925 Missense_Mutation C C T TCGA-B9-4114-01A-01D-1252-08 ENST00000263925 p.A574T AGPAT9 chr4 83536662 83536662 Missense_Mutation T T C TCGA-B9-4114-01A-01D-1252-08 ENST00000264409 p.W14R SEMA5A chr5 9119108 9119108 Silent A A T TCGA-B9-4114-01A-01D-1252-08 ENST00000382496 p.S605S RAI14 chr5 34757563 34757563 Silent C C T TCGA-B9-4114-01A-01D-1252-08 ENST00000265109 p.A44A PARP8 chr5 50828014 50828014 Missense_Mutation T T A TCGA-B9-4114-01A-01D-1252-08 ENST00000281631 p.F683Y NR2F1 chr5 93593718 93593718 Missense_Mutation C C A TCGA-B9-4114-01A-01D-1252-08 ENST00000327111 p.S383Y POU5F2 chr5 93740976 93740976 Silent A A T TCGA-B9-4114-01A-01D-1252-08 ENST00000510627 p.L196L FNIP1 chr5 131670485 131670485 Missense_Mutation G G A TCGA-B9-4114-01A-01D-1252-08 ENST00000510461 p.S1029L FNIP1 chr5 131706462 131706462 Missense_Mutation C C A TCGA-B9-4114-01A-01D-1252-08 ENST00000510461 p.R288L PCDHGA12 chr5 141431604 141431610 Frame_Shift_Del GGTATGT GGTATGT - TCGA-B9-4114-01A-01D-1252-08 ENST00000252085 p.Y283Tfs*10 HLA-DQA2 chr6 32746004 32746004 Missense_Mutation C C T TCGA-B9-4114-01A-01D-1252-08 ENST00000374940 p.S182F LEMD2 chr6 33781149 33781149 Missense_Mutation A A C TCGA-B9-4114-01A-01D-1252-08 ENST00000293760 p.N286K TTBK1 chr6 43283957 43283957 Missense_Mutation C C A TCGA-B9-4114-01A-01D-1252-08 ENST00000259750 p.L1073M ROS1 chr6 117425601 117425601 Missense_Mutation C C G TCGA-B9-4114-01A-01D-1252-08 ENST00000368508 p.C19S TMEM184A chr7 1550877 1550877 Missense_Mutation G G A TCGA-B9-4114-01A-01D-1252-08 ENST00000297477 p.L109F TFR2 chr7 100630984 100630984 Missense_Mutation C C T TCGA-B9-4114-01A-01D-1252-08 ENST00000223051 p.G392D KMT2C chr7 152185589 152185589 Missense_Mutation T T G TCGA-B9-4114-01A-01D-1252-08 ENST00000262189 p.K1684T AGPAT5 chr8 6757193 6757193 Missense_Mutation T T A TCGA-B9-4114-01A-01D-1252-08 ENST00000285518 p.D300E TNKS chr8 9556174 9556174 Missense_Mutation C C G TCGA-B9-4114-01A-01D-1252-08 ENST00000310430 p.R79G CCAR2 chr8 22606641 22606641 Missense_Mutation T T A TCGA-B9-4114-01A-01D-1252-08 ENST00000308511 p.V62D KCNS2 chr8 98429039 98429039 Nonsense_Mutation G G T TCGA-B9-4114-01A-01D-1252-08 ENST00000287042 p.E354* UNC13B chr9 35375166 35375166 Missense_Mutation A A G TCGA-B9-4114-01A-01D-1252-08 ENST00000378495 p.M445V TNC chr9 115030389 115030389 Frame_Shift_Del G G - TCGA-B9-4114-01A-01D-1252-08 ENST00000350763 p.F1980Sfs*10 ABL1 chr9 130872984 130872984 Silent C C T TCGA-B9-4114-01A-01D-1252-08 ENST00000318560 p.A344A NODAL chr10 70435668 70435668 Missense_Mutation T T A TCGA-B9-4114-01A-01D-1252-08 ENST00000287139 p.E170V NOLC1 chr10 102157482 102157482 Missense_Mutation C C T TCGA-B9-4114-01A-01D-1252-08 ENST00000605788 p.A123V BRSK2 chr11 1445393 1445393 Silent C C T TCGA-B9-4114-01A-01D-1252-08 ENST00000528841 p.D304D KCNC1 chr11 17772736 17772736 3'UTR C C T TCGA-B9-4114-01A-01D-1252-08 ENST00000379472 EIF3M chr11 32602352 32602352 Missense_Mutation A A T TCGA-B9-4114-01A-01D-1252-08 ENST00000531120 p.N360Y TMX2 chr11 57712634 57712634 Missense_Mutation C C A TCGA-B9-4114-01A-01D-1252-08 ENST00000278422 p.P6T FAU chr11 65121796 65121796 Silent G G T TCGA-B9-4114-01A-01D-1252-08 ENST00000527548 p.R6R FAU chr11 65121797 65121797 Missense_Mutation C C G TCGA-B9-4114-01A-01D-1252-08 ENST00000527548 p.R6P NXPE1 chr11 114530441 114530441 Silent C C T TCGA-B9-4114-01A-01D-1252-08 ENST00000424269 p.A189A OAF chr11 120226871 120226871 Missense_Mutation A A C TCGA-B9-4114-01A-01D-1252-08 ENST00000328965 p.H141P OAF chr11 120226872 120226872 Missense_Mutation C C A TCGA-B9-4114-01A-01D-1252-08 ENST00000328965 p.H141Q SMARCC2 chr12 56164528 56164528 Missense_Mutation T T G TCGA-B9-4114-01A-01D-1252-08 ENST00000267064 p.N1115H GLI1 chr12 57467360 57467360 Missense_Mutation C C A TCGA-B9-4114-01A-01D-1252-08 ENST00000228682 p.R314S C12orf66 chr12 64222046 64222046 Silent G G C TCGA-B9-4114-01A-01D-1252-08 ENST00000398055 p.A64A MYO1H chr12 109396514 109396514 Frame_Shift_Del A A - TCGA-B9-4114-01A-01D-1252-08 ENST00000310903 p.T125Pfs*4 PEBP1 chr12 118139528 118139528 Missense_Mutation G G A TCGA-B9-4114-01A-01D-1252-08 ENST00000261313 p.G108D ZCCHC8 chr12 122480285 122480286 Frame_Shift_Ins - - A TCGA-B9-4114-01A-01D-1252-08 ENST00000543897 p.G111Wfs*7 PARP4 chr13 24493638 24493638 Silent T T C TCGA-B9-4114-01A-01D-1252-08 ENST00000381989 p.E279E ITM2B chr13 48256296 48256297 In_Frame_Ins - - CAA TCGA-B9-4114-01A-01D-1252-08 ENST00000378565 p.F122_E123insQ RNF31 chr14 24148004 24148004 Missense_Mutation C C G TCGA-B9-4114-01A-01D-1252-08 ENST00000324103 p.T74R FAM179B chr14 44964326 44964326 Frame_Shift_Del C C - TCGA-B9-4114-01A-01D-1252-08 ENST00000361577 p.H635Qfs*16 SERPINA1 chr14 94382876 94382876 Missense_Mutation T T G TCGA-B9-4114-01A-01D-1252-08 ENST00000355814 p.Q121P WDR20 chr14 102209601 102209601 Silent T T C TCGA-B9-4114-01A-01D-1252-08 ENST00000342702 p.D477D PLCB2 chr15 40298356 40298356 Missense_Mutation G G A TCGA-B9-4114-01A-01D-1252-08 ENST00000260402 p.S341L ANKDD1A chr15 64947489 64947489 Missense_Mutation G G T TCGA-B9-4114-01A-01D-1252-08 ENST00000319580 p.W416L ISLR2 chr15 74132911 74132911 Frame_Shift_Del G G - TCGA-B9-4114-01A-01D-1252-08 ENST00000361742 p.V53* SAXO2 chr15 82282338 82282338 Missense_Mutation A A C TCGA-B9-4114-01A-01D-1252-08 ENST00000339465 p.H158P LINS chr15 100573829 100573829 Frame_Shift_Del C C - TCGA-B9-4114-01A-01D-1252-08 ENST00000314742 p.L349Cfs*2 PALB2 chr16 23635086 23635086 Missense_Mutation A A T TCGA-B9-4114-01A-01D-1252-08 ENST00000261584 p.V487D RNF40 chr16 30765205 30765205 Missense_Mutation A A T TCGA-B9-4114-01A-01D-1252-08 ENST00000324685 p.T266S CDH16 chr16 66911963 66911963 Missense_Mutation T T C TCGA-B9-4114-01A-01D-1252-08 ENST00000299752 p.S576G DPH1 chr17 2043186 2043186 3'UTR C C A TCGA-B9-4114-01A-01D-1252-08 ENST00000263083 ERBB2 chr17 39719827 39719827 Silent A A C TCGA-B9-4114-01A-01D-1252-08 ENST00000269571 p.R647R ATXN7L3 chr17 44197718 44197718 Nonsense_Mutation C C A TCGA-B9-4114-01A-01D-1252-08 ENST00000389384 p.E22* SLC25A39 chr17 44321242 44321242 Intron A A - TCGA-B9-4114-01A-01D-1252-08 ENST00000377095 SPATA20 chr17 50550835 50550835 Missense_Mutation G G C TCGA-B9-4114-01A-01D-1252-08 ENST00000356488 p.G418A ABCA6 chr17 69112232 69112232 Missense_Mutation C C T TCGA-B9-4114-01A-01D-1252-08 ENST00000284425 p.G695S SPHK1 chr17 76385948 76385948 Intron G G A TCGA-B9-4114-01A-01D-1252-08 ENST00000392496 C19orf24 chr19 1279089 1279089 3'UTR C C A TCGA-B9-4114-01A-01D-1252-08 ENST00000409293 ZNF14 chr19 19712271 19712271 Missense_Mutation C C A TCGA-B9-4114-01A-01D-1252-08 ENST00000344099 p.C337F ATP4A chr19 35560016 35560016 Missense_Mutation G G T TCGA-B9-4114-01A-01D-1252-08 ENST00000262623 p.A282E NOP56 chr20 2657709 2657709 Intron T T - TCGA-B9-4114-01A-01D-1252-08 ENST00000329276 UBOX5 chr20 3110297 3110297 Silent G G A TCGA-B9-4114-01A-01D-1252-08 ENST00000217173 p.L479L ZSWIM1 chr20 45883506 45883506 Missense_Mutation A A T TCGA-B9-4114-01A-01D-1252-08 ENST00000372520 p.N305I GRAMD4 chr22 46672891 46672891 Missense_Mutation G G A TCGA-B9-4114-01A-01D-1252-08 ENST00000361034 p.R378H PADI6 chr1 17394972 17394972 Silent T T C TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000619609 p.S453S NT5C1A chr1 39661200 39661200 Missense_Mutation C C T TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000235628 p.R207H ODF2L chr1 86351929 86351930 3'UTR - - T TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000317336 TGFBR3 chr1 91716643 91716643 Silent C C T TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000212355 p.E544E GLMN chr1 92247133 92247133 Missense_Mutation A A T TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000370360 p.S533T NBPF12 chr1 146963177 146963177 Missense_Mutation C C T TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000617931 p.R121C ITLN2 chr1 160954743 160954743 5'UTR C C G TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000368029 DCAF6 chr1 168075465 168075465 3'UTR T T C TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000312263 ABL2 chr1 179109233 179109233 Missense_Mutation C C A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000502732 p.Q678H TRMT1L chr1 185137642 185137642 Nonsense_Mutation C C A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000367506 p.E493* CACNA1S chr1 201040684 201040687 Frame_Shift_Del GCAT GCAT - TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000362061 p.M1721* FAM89A chr1 231020068 231020068 Missense_Mutation G G A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000366654 p.S117L ASAP2 chr2 9207212 9207213 Frame_Shift_Del TG TG - TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000281419 p.V37Gfs*35 NBAS chr2 15394270 15394270 Missense_Mutation C C G TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000281513 p.A1072P USP34 chr2 61206028 61206028 Missense_Mutation T T C TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000398571 p.N3048S USP34 chr2 61206029 61206029 Missense_Mutation T T A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000398571 p.N3048Y ANKRD36BP2 chr2 88804875 88804875 RNA A A G TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000622311 TTC21B chr2 165943271 165943271 Missense_Mutation T T C TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000243344 p.Y167C C2orf88 chr2 190202757 190202757 3'UTR A A C TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000340623 PIKFYVE chr2 208285826 208285826 Silent T T C TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000264380 p.D238D AAMP chr2 218264382 218264382 3'UTR G G T TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000248450 KIF1A chr2 240719090 240719090 Silent G G A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000320389 p.S1609S SETD2 chr3 47121402 47121402 Frame_Shift_Del C - - TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000409792 p.L1078Ffs*43 PBRM1 chr3 52563421 52563421 Frame_Shift_Del A - - TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000296302 p.F1316Lfs*4 TBC1D23 chr3 100306544 100306544 Splice_Site G A A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000394144 p.X471_splice PCCB chr3 136255863 136255864 Frame_Shift_Ins - - A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000251654 p.T65Nfs*17 WWTR1 chr3 149657057 149657057 Missense_Mutation G C C TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000360632 p.H84D ZNF141 chr4 373640 373641 In_Frame_Ins - - ACA TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000240499 p.G401_K402insT FGFRL1 chr4 1024506 1024506 Missense_Mutation T T A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000264748 p.V305E SLC12A7 chr5 1094226 1094227 In_Frame_Ins - - TTT TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000264930 p.E48_N49insK FAM172A chr5 93881510 93881510 Frame_Shift_Del T T - TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000395965 p.N249Tfs*8 RNF216 chr7 5752877 5752879 In_Frame_Del TCT TCT - TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000425013 p.E57del TRIP6 chr7 100870621 100870621 Missense_Mutation G G C TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000200457 p.V293L SSPO chr7 149778925 149778925 Missense_Mutation A A G TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000378016 p.N327S ANK1 chr8 41665168 41665168 Intron G G T TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000347528 INTS8 chr8 94823462 94823462 Missense_Mutation G G A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000523731 p.A11T DSCC1 chr8 119841901 119841901 Missense_Mutation C C A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000313655 p.A273S FAM91A1 chr8 123799519 123799519 Splice_Site G G A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000334705 p.X521_splice MROH6 chr8 143571738 143571738 Silent C C T TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000398882 p.L177L RABL6 chr9 136823639 136823639 Missense_Mutation G G T TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000311502 p.S82I PTGDS chr9 136980203 136980203 Missense_Mutation G G T TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000371625 p.A157S ZNF248 chr10 37831822 37831822 Missense_Mutation T T G TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000357328 p.Q511H CCAR1 chr10 68791242 68791242 Silent C C G TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000265872 p.S1143S GPR26 chr10 123688121 123688121 Silent C C T TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000284674 p.G325G PTDSS2 chr11 460237 460243 Frame_Shift_Del ATGTGAC ATGTGAC - TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000308020 p.Y78Cfs*52 IRF7 chr11 613956 613956 Missense_Mutation G G A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000397574 p.T254M MUC5AC chr11 1163938 1163938 Missense_Mutation G G T TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000621226 p.D246Y OR51B4 chr11 5301843 5301843 Missense_Mutation G G A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000380224 p.S35F TTC17 chr11 43448023 43448023 Missense_Mutation G G A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000039989 p.R896H CDC42BPG chr11 64833936 64833936 Missense_Mutation G G A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000342711 p.R819W TIMM8B chr11 112085398 112085398 Missense_Mutation G G A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000504148 p.S50F WNK1 chr12 896085 896085 Silent A A G TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000315939 p.A1866A SCNN1A chr12 6363657 6363657 Missense_Mutation G G A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000228916 p.T157M ITGA5 chr12 54398650 54398650 Missense_Mutation G G C TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000293379 p.L964V UBE3B chr12 109524075 109524075 Frame_Shift_Del C C - TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000342494 p.S821Ffs*25 ATP7B chr13 51942542 51942543 Frame_Shift_Ins - - T TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000242839 p.E1086Rfs*32 EFS chr14 23359475 23359475 Missense_Mutation G G A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000216733 p.R335W RIPK3 chr14 24337897 24337897 Missense_Mutation G G T TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000216274 p.P270T SYT16 chr14 61996123 61996123 Nonsense_Mutation T T A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000568344 p.L35* SYT16 chr14 61996124 61996124 Missense_Mutation A A T TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000568344 p.L35F AHNAK2 chr14 104941900 104941900 Silent G G A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000333244 p.S4517S TRPM1 chr15 31037813 31037814 Frame_Shift_Del CT CT - TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000397795 p.K801Rfs*3 VPS39 chr15 42164467 42164467 Silent A A G TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000348544 p.A650A DUOXA1 chr15 45119232 45119232 Silent G G A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000560572 p.L302L PLEKHO2 chr15 64865541 64865541 Frame_Shift_Del C C - TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000323544 p.W378Gfs*39 MYO9A chr15 71899919 71899919 Missense_Mutation G G C TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000356056 p.L1080V SLC28A1 chr15 84908770 84908770 Missense_Mutation T T C TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000286749 p.L257P TMC5 chr16 19463361 19463361 Silent T T A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000396229 p.I410I RBBP6 chr16 24567198 24567198 Missense_Mutation T T C TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000319715 p.S549P BCKDK chr16 31110204 31110204 Splice_Site G G T TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000219794 p.X142_splice SRR chr17 2323333 2323333 Missense_Mutation G G T TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000344595 p.E264D GP1BA chr17 4934940 4934940 3'UTR T T G TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000329125 ZNF594 chr17 5181968 5181968 Nonsense_Mutation A A T TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000399604 p.C763* CASC3 chr17 40140776 40140777 Frame_Shift_Del GT GT - TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000264645 GRN chr17 44350505 44350505 Missense_Mutation A A C TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000053867 p.T176P FLJ45079 chr17 77883283 77883283 RNA C C A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000374983 FLJ45079 chr17 77883284 77883284 RNA C C T TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000374983 GREB1L chr18 21451082 21451082 Nonsense_Mutation G G T TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000424526 p.E594* ESCO1 chr18 21574173 21574173 Missense_Mutation G G A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000269214 p.S224F ZNF77 chr19 2936621 2936622 Frame_Shift_Ins - - A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000314531 p.V72Cfs*7 HNRNPUL1 chr19 41302680 41302680 Missense_Mutation C C A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000392006 p.P568Q BCAM chr19 44819185 44819185 Missense_Mutation G G A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000270233 p.G489E CD3EAP chr19 45408268 45408268 Frame_Shift_Del G G - TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000309424 p.A101Qfs*15 AP2A1 chr19 49802008 49802028 In_Frame_Del CTGGGGCTGCGGGCAGCCCCT CTGGGGCTGCGGGCAGCCCCT - TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000359032 p.L661_P667del USP29 chr19 57129615 57129615 Missense_Mutation C C A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000254181 p.L314I USP29 chr19 57129616 57129616 Missense_Mutation T T A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000254181 p.L314H VN1R1 chr19 57455831 57455831 Missense_Mutation A A G TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000321039 p.L219S ZNF341 chr20 33788943 33788943 Missense_Mutation G G A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000375200 p.E645K ADNP chr20 50893628 50893628 Silent T T C TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000349014 p.Q362Q BCAS1 chr20 54028308 54028308 Intron G G T TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000395961 MIR99AHG chr21 16231065 16231065 RNA A A C TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000619222 ABCG1 chr21 42273318 42273318 Frame_Shift_Del G G - TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000361802 p.A142Pfs*37 SMARCB1 chr22 23834143 23834143 Missense_Mutation G G A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000263121 p.R374Q VSIG4 chrX 66033553 66033553 Silent G A A TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000374737 p.Y111Y AMOT chrX 112822338 112822338 Nonsense_Mutation A T T TCGA-5P-A9JU-01A-11D-A42J-10 ENST00000371959 p.Y263* GBP1 chr1 89053183 89053183 3'UTR T T - TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000370473 CTTNBP2NL chr1 112456453 112456453 Missense_Mutation A A G TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000271277 p.R321G ANKRD35 chr1 145873240 145873240 Missense_Mutation C C T TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000355594 p.R510Q ILDR2 chr1 166920766 166920766 Missense_Mutation C C T TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000271417 p.D609N ASPM chr1 197103160 197103160 Missense_Mutation A A G TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000367409 p.Y2031H PPP1R15B chr1 204405951 204405952 3'UTR - - A TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000367188 IFT172 chr2 27479525 27479525 Missense_Mutation T T A TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000260570 p.Y330F TCF7L1 chr2 85134027 85134027 Silent C C G TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000282111 p.R87R MALL chr2 110115709 110115709 Silent G G A TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000272462 p.F28F SLC20A1 chr2 112660476 112660476 Missense_Mutation T T C TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000272542 p.L566P PTPN18 chr2 130374708 130374708 3'UTR G G - TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000175756 ANKRD44 chr2 197013520 197013520 Frame_Shift_Del G G - TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000282272 p.H639Mfs*4 EEF1B2 chr2 206162554 206162554 Missense_Mutation A A T TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000236957 p.M155L COL4A3 chr2 227267035 227267035 Missense_Mutation G G T TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000396578 p.G484V RAB17 chr2 237586098 237586098 Silent C C A TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000264601 p.V19V SLC6A6 chr3 14466599 14466599 Silent A A G TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000622186 p.A272A TMEM115 chr3 50358787 50358787 Missense_Mutation A A G TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000266025 p.W93R FGFR3 chr4 1805926 1805926 Missense_Mutation T T A TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000260795 p.L608M ISL1 chr5 51384576 51384576 Missense_Mutation A A G TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000230658 p.N22D PDLIM4 chr5 132271701 132271701 Intron A A G TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000253754 SEC24A chr5 134724986 134724986 Missense_Mutation G G C TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000398844 p.E1058D CREBRF chr5 173091243 173091243 Missense_Mutation A A T TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000296953 p.E355V SESN1 chr6 108988620 108988620 Frame_Shift_Del T T - TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000356644 p.T439Lfs*34 HIVEP2 chr6 142769601 142769601 Missense_Mutation G G T TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000012134 p.P1713H EIF2AK1 chr7 6044574 6044574 Missense_Mutation T T G TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000199389 p.I240L SVOPL chr7 138659900 138659900 Missense_Mutation G G A TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000419765 p.T145M CLCN1 chr7 143351956 143351956 Silent G G A TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000343257 p.L986L TRPM3 chr9 70536219 70536220 Frame_Shift_Ins - - T TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000377110 p.E1620Rfs*39 CTSL chr9 87729681 87729681 Missense_Mutation C C T TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000340342 p.P244S IFIT5 chr10 89417255 89417255 Missense_Mutation A A G TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000371795 p.H19R SORCS3 chr10 105043067 105043067 Missense_Mutation A A G TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000369699 p.M323V USH1C chr11 17520924 17520924 Missense_Mutation A A C TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000318024 p.L386V SSRP1 chr11 57332808 57332808 Silent C C A TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000278412 p.T195T SYVN1 chr11 65132780 65132780 Frame_Shift_Del T T - TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000377190 p.M127Wfs*38 FRMD8 chr11 65400742 65400742 Missense_Mutation C C T TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000317568 p.R316C MUS81 chr11 65863721 65863721 Missense_Mutation G G A TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000308110 p.A321T TCIRG1 chr11 68044285 68044285 Missense_Mutation G G A TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000265686 p.E321K INPPL1 chr11 72237559 72237559 Silent A A G TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000298229 p.P1105P C2CD3 chr11 74085764 74085764 Missense_Mutation C C G TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000334126 p.C1255S YAP1 chr11 102229824 102229824 Nonsense_Mutation G G T TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000282441 p.G467* ARHGAP32 chr11 129063920 129063920 Silent A A G TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000310343 p.P275P CLSTN3 chr12 7149602 7149602 Silent T T C TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000266546 p.D718D MON2 chr12 62560797 62560797 Missense_Mutation T T A TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000393630 p.L1239Q COL4A2 chr13 110465565 110465565 Missense_Mutation T T A TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000360467 p.F646Y DNAL1 chr14 73696143 73696143 3'UTR T T C TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000553645 GTF2A1 chr14 81192761 81192761 Missense_Mutation T T A TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000553612 p.N231Y SETD3 chr14 99463544 99463544 Silent C C T TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000331768 p.E46E FAN1 chr15 30905635 30905635 Missense_Mutation T T G TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000362065 p.H324Q SIN3A chr15 75412789 75412789 Nonsense_Mutation G G A TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000360439 p.Q244* RASGRF1 chr15 79058386 79058386 Missense_Mutation A A T TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000419573 p.L160H GRIN2A chr16 9764632 9764632 Missense_Mutation T T C TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000330684 p.Q971R AC106782.1 chr16 30267586 30267586 5'Flank A A G TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000620872 ITGAX chr16 31362074 31362074 Splice_Site G G A TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000268296 p.X363_splice SRSF1 chr17 58006476 58006476 Nonsense_Mutation G G T TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000258962 p.Y82* KCNJ16 chr17 70134887 70134888 3'UTR - - T TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000283936 TK1 chr17 78187198 78187198 5'UTR C C A TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000301634 DOT1L chr19 2226195 2226195 Missense_Mutation C C T TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000398665 p.A1225V RYR1 chr19 38458207 38458207 Nonsense_Mutation C C G TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000359596 p.Y694* PSG5 chr19 43175214 43175214 Splice_Site C C T TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000342951 p.X322_splice NLRP8 chr19 55976277 55976277 Silent C C T TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000291971 p.N950N ACTR5 chr20 38754982 38754982 Silent T T C TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000243903 p.D267D PREX1 chr20 48745121 48745121 Silent G G A TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000371941 p.I106I RP2 chrX 46837188 46837188 Missense_Mutation G G T TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000218340 p.D30Y PRICKLE3 chrX 49175664 49175664 3'UTR G G T TCGA-KV-A6GD-01A-11D-A31X-10 ENST00000599218 MYOM3 chr1 24094913 24094913 Missense_Mutation G G T TCGA-DW-7834-01A-11D-2136-08 ENST00000374434 p.L290M PEF1 chr1 31635354 31635354 Nonsense_Mutation C C A TCGA-DW-7834-01A-11D-2136-08 ENST00000373703 p.G65* CFAP57 chr1 43183807 43183807 Missense_Mutation G G C TCGA-DW-7834-01A-11D-2136-08 ENST00000372492 p.E231Q DEDD chr1 161122025 161122025 3'UTR A A T TCGA-DW-7834-01A-11D-2136-08 ENST00000368006 DEDD chr1 161122229 161122229 Missense_Mutation A A C TCGA-DW-7834-01A-11D-2136-08 ENST00000368006 p.L292R RGS1 chr1 192578224 192578224 Missense_Mutation G G C TCGA-DW-7834-01A-11D-2136-08 ENST00000367459 p.G95R PLXNA2 chr1 208042236 208042236 Missense_Mutation C C T TCGA-DW-7834-01A-11D-2136-08 ENST00000367033 p.R1383Q NUP133 chr1 229495985 229495985 Silent G G T TCGA-DW-7834-01A-11D-2136-08 ENST00000261396 p.I294I LPIN1 chr2 11773625 11773625 Missense_Mutation T T C TCGA-DW-7834-01A-11D-2136-08 ENST00000256720 p.L201P THSD7B chr2 137170749 137170749 Missense_Mutation A A G TCGA-DW-7834-01A-11D-2136-08 ENST00000272643 p.T512A IFIH1 chr2 162310887 162310887 Missense_Mutation A A G TCGA-DW-7834-01A-11D-2136-08 ENST00000263642 p.L167P NABP1 chr2 191678679 191678679 Missense_Mutation A A C TCGA-DW-7834-01A-11D-2136-08 ENST00000425611 p.N22T SF3B1 chr2 197409874 197409874 Missense_Mutation G G T TCGA-DW-7834-01A-11D-2136-08 ENST00000335508 p.T267N DDX60 chr4 168250970 168250970 Missense_Mutation C C T TCGA-DW-7834-01A-11D-2136-08 ENST00000393743 p.R1281K WWC2 chr4 183245535 183245535 Missense_Mutation A A C TCGA-DW-7834-01A-11D-2136-08 ENST00000403733 p.D241A PDZD2 chr5 32074519 32074519 Missense_Mutation G G T TCGA-DW-7834-01A-11D-2136-08 ENST00000438447 p.S1138I RXFP3 chr5 33938172 33938172 3'UTR G G C TCGA-DW-7834-01A-11D-2136-08 ENST00000330120 SEPP1 chr5 42807044 42807044 Missense_Mutation T T A TCGA-DW-7834-01A-11D-2136-08 ENST00000506577 p.N90Y FCHO2 chr5 73087718 73087718 Missense_Mutation A A G TCGA-DW-7834-01A-11D-2136-08 ENST00000430046 p.Y792C VCAN chr5 83490124 83490124 Missense_Mutation A A T TCGA-DW-7834-01A-11D-2136-08 ENST00000265077 p.R33W VARS2 chr6 30920424 30920424 Missense_Mutation T T C TCGA-DW-7834-01A-11D-2136-08 ENST00000321897 p.L462P ZNF76 chr6 35292881 35292881 Missense_Mutation C C T TCGA-DW-7834-01A-11D-2136-08 ENST00000373953 p.A389V DNAH8 chr6 38741789 38741789 Missense_Mutation A A G TCGA-DW-7834-01A-11D-2136-08 ENST00000359357 p.M182V UBR2 chr6 42642481 42642482 Frame_Shift_Ins - - GTAAT TCGA-DW-7834-01A-11D-2136-08 ENST00000372899 ADGRB3 chr6 69233351 69233351 Missense_Mutation C C T TCGA-DW-7834-01A-11D-2136-08 ENST00000370598 p.H848Y RFX6 chr6 116924739 116924739 Missense_Mutation T T A TCGA-DW-7834-01A-11D-2136-08 ENST00000332958 p.N542K AEBP1 chr7 44112609 44112609 Missense_Mutation G G C TCGA-DW-7834-01A-11D-2136-08 ENST00000223357 p.V757L OGDH chr7 44674523 44674523 Missense_Mutation G G A TCGA-DW-7834-01A-11D-2136-08 ENST00000222673 p.G301S VSTM2A chr7 54549999 54549999 Missense_Mutation C C T TCGA-DW-7834-01A-11D-2136-08 ENST00000407838 p.R155C C7orf55-LUC7L2 chr7 139422286 139422286 Missense_Mutation T T A TCGA-DW-7834-01A-11D-2136-08 ENST00000354926 p.N375K PRSS55 chr8 10532963 10532963 Nonsense_Mutation G G A TCGA-DW-7834-01A-11D-2136-08 ENST00000328655 p.W219* NUGGC chr8 28031298 28031298 Missense_Mutation C C G TCGA-DW-7834-01A-11D-2136-08 ENST00000413272 p.G618A PCDH15 chr10 53810632 53810632 Missense_Mutation C C T TCGA-DW-7834-01A-11D-2136-08 ENST00000614895 p.R1473Q KIF20B chr10 89738581 89738581 Missense_Mutation A A C TCGA-DW-7834-01A-11D-2136-08 ENST00000371728 p.E1247A TRIM8 chr10 102645124 102645124 Silent C C T TCGA-DW-7834-01A-11D-2136-08 ENST00000302424 p.Y169Y PTPRJ chr11 48127951 48127951 Missense_Mutation C C T TCGA-DW-7834-01A-11D-2136-08 ENST00000418331 p.P422L NAALADL1 chr11 65054609 65054609 Missense_Mutation C C T TCGA-DW-7834-01A-11D-2136-08 ENST00000358658 p.E245K IL10RA chr11 117989481 117989481 Missense_Mutation C C A TCGA-DW-7834-01A-11D-2136-08 ENST00000227752 p.S76R PZP chr12 9203831 9203831 Missense_Mutation T T A TCGA-DW-7834-01A-11D-2136-08 ENST00000261336 p.E68D DNAJC22 chr12 49349583 49349583 Silent T T C TCGA-DW-7834-01A-11D-2136-08 ENST00000395069 p.L237L GPR18 chr13 99255797 99255797 Missense_Mutation G G C TCGA-DW-7834-01A-11D-2136-08 ENST00000340807 p.L26V SLC7A8 chr14 23137994 23137994 Missense_Mutation C C T TCGA-DW-7834-01A-11D-2136-08 ENST00000316902 p.A315T PPP1R36 chr14 64565366 64565366 Missense_Mutation T T A TCGA-DW-7834-01A-11D-2136-08 ENST00000298705 p.D93E EIF2S1 chr14 67381618 67381618 Silent T T C TCGA-DW-7834-01A-11D-2136-08 ENST00000256383 p.Y202Y ARID3B chr15 74595796 74595796 3'UTR C C A TCGA-DW-7834-01A-11D-2136-08 ENST00000622429 NUBP2 chr16 1786593 1786593 Missense_Mutation G G C TCGA-DW-7834-01A-11D-2136-08 ENST00000262302 p.G25R KIAA0556 chr16 27708745 27708745 Missense_Mutation T T C TCGA-DW-7834-01A-11D-2136-08 ENST00000261588 p.I477T TNFSF13 chr17 7561114 7561115 3'UTR - - A TCGA-DW-7834-01A-11D-2136-08 ENST00000338784 TOP3A chr17 18308894 18308894 Silent A A G TCGA-DW-7834-01A-11D-2136-08 ENST00000321105 p.H76H EFTUD2 chr17 44867862 44867862 Missense_Mutation G G A TCGA-DW-7834-01A-11D-2136-08 ENST00000426333 p.S365F WNT3 chr17 46768620 46768620 Silent C C T TCGA-DW-7834-01A-11D-2136-08 ENST00000225512 p.V256V GRIN2C chr17 74844217 74844217 Intron A A - TCGA-DW-7834-01A-11D-2136-08 ENST00000293190 SGSH chr17 80211025 80211025 Intron G G - TCGA-DW-7834-01A-11D-2136-08 ENST00000326317 DSEL chr18 67514255 67514255 Silent A A G TCGA-DW-7834-01A-11D-2136-08 ENST00000310045 p.N128N AP3D1 chr19 2151254 2151254 Missense_Mutation G G C TCGA-DW-7834-01A-11D-2136-08 ENST00000345016 p.N27K PSMC4 chr19 39972554 39972554 Splice_Region A A G TCGA-DW-7834-01A-11D-2136-08 ENST00000157812 p.T107T MEGF8 chr19 42357446 42357446 Missense_Mutation C C G TCGA-DW-7834-01A-11D-2136-08 ENST00000251268 p.L1625V LILRA5 chr19 54307367 54307367 3'UTR G G T TCGA-DW-7834-01A-11D-2136-08 ENST00000432233 ZNF8 chr19 58294222 58294222 Silent G G A TCGA-DW-7834-01A-11D-2136-08 ENST00000621650 p.G138G GDF5 chr20 35433862 35433862 3'UTR A A G TCGA-DW-7834-01A-11D-2136-08 ENST00000374369 COL9A3 chr20 62837228 62837228 Silent C C T TCGA-DW-7834-01A-11D-2136-08 ENST00000343916 p.R583R NRIP1 chr21 14965349 14965349 Silent A A G TCGA-DW-7834-01A-11D-2136-08 ENST00000318948 p.D948D NCAM2 chr21 21286342 21286342 Silent A A T TCGA-DW-7834-01A-11D-2136-08 ENST00000400546 p.R137R SON chr21 33560076 33560076 Intron A A G TCGA-DW-7834-01A-11D-2136-08 ENST00000356577 CECR2 chr22 17542222 17542222 Silent C C T TCGA-DW-7834-01A-11D-2136-08 ENST00000342247 p.C713C RHBDD3 chr22 29260776 29260776 Silent C C A TCGA-DW-7834-01A-11D-2136-08 ENST00000216085 p.G207G MAP7D3 chrX 136232010 136232010 Missense_Mutation T T C TCGA-DW-7834-01A-11D-2136-08 ENST00000316077 p.N316S PRDM2 chr1 13782341 13782341 Missense_Mutation C C T TCGA-MH-A561-01A-11D-A26P-10 ENST00000235372 p.R1516W PLEKHM2 chr1 15727774 15727774 Missense_Mutation T T G TCGA-MH-A561-01A-11D-A26P-10 ENST00000375799 p.S568A RP1-163M9.7 chr1 16707383 16707383 3'Flank C C T TCGA-MH-A561-01A-11D-A26P-10 ENST00000624517 E2F2 chr1 23521845 23521845 Missense_Mutation G G C TCGA-MH-A561-01A-11D-A26P-10 ENST00000361729 p.I190M COL8A2 chr1 36098505 36098505 Silent A A G TCGA-MH-A561-01A-11D-A26P-10 ENST00000303143 p.I392I CDC20 chr1 43361143 43361143 Missense_Mutation G G C TCGA-MH-A561-01A-11D-A26P-10 ENST00000310955 p.Q367H SLC6A9 chr1 43997531 43997531 3'UTR C C G TCGA-MH-A561-01A-11D-A26P-10 ENST00000360584 GPBP1L1 chr1 45659076 45659076 Silent A A G TCGA-MH-A561-01A-11D-A26P-10 ENST00000290795 p.H4H AGBL4 chr1 48534175 48534175 Nonstop_Mutation A A G TCGA-MH-A561-01A-11D-A26P-10 ENST00000371839 p.*504Qext*27 NFIA chr1 61359230 61359230 Missense_Mutation C C A TCGA-MH-A561-01A-11D-A26P-10 ENST00000403491 p.P301Q FNBP1L chr1 93499579 93499579 Missense_Mutation T T A TCGA-MH-A561-01A-11D-A26P-10 ENST00000271234 p.L46M ABCA4 chr1 94056764 94056764 Frame_Shift_Del A A - TCGA-MH-A561-01A-11D-A26P-10 ENST00000370225 p.F740Sfs*47 MAB21L3 chr1 116112563 116112563 5'UTR A A - TCGA-MH-A561-01A-11D-A26P-10 ENST00000369500 FAM72C chr1 143964915 143964917 In_Frame_Del TGT TGT - TCGA-MH-A561-01A-11D-A26P-10 ENST00000584486 p.N98del APH1A chr1 150266452 150266452 Intron G G A TCGA-MH-A561-01A-11D-A26P-10 ENST00000369109 AQP10 chr1 154324325 154324325 Missense_Mutation G G T TCGA-MH-A561-01A-11D-A26P-10 ENST00000324978 p.V251L CENPL chr1 173803159 173803160 Frame_Shift_Ins - - T TCGA-MH-A561-01A-11D-A26P-10 ENST00000345664 p.I256Nfs*26 CENPL chr1 173803162 173803162 Missense_Mutation G G T TCGA-MH-A561-01A-11D-A26P-10 ENST00000345664 p.A255E RFWD2 chr1 176027690 176027690 Splice_Site T T C TCGA-MH-A561-01A-11D-A26P-10 ENST00000367669 p.X538_splice CEP350 chr1 179990509 179990510 Frame_Shift_Del GA GA - TCGA-MH-A561-01A-11D-A26P-10 ENST00000367607 p.R42Tfs*3 MR1 chr1 181034012 181034012 Missense_Mutation G G T TCGA-MH-A561-01A-11D-A26P-10 ENST00000367580 p.G2V CACNA1S chr1 201074616 201074616 Missense_Mutation G G C TCGA-MH-A561-01A-11D-A26P-10 ENST00000362061 p.I651M DIEXF chr1 209833217 209833217 Nonsense_Mutation G G T TCGA-MH-A561-01A-11D-A26P-10 ENST00000491415 p.E141* CENPF chr1 214647353 214647353 Missense_Mutation A A T TCGA-MH-A561-01A-11D-A26P-10 ENST00000366955 p.N2595Y AAK1 chr2 69530057 69530057 Silent G G A TCGA-MH-A561-01A-11D-A26P-10 ENST00000409085 p.F274F RTKN chr2 74441735 74441735 Silent G G T TCGA-MH-A561-01A-11D-A26P-10 ENST00000272430 p.R28R AUP1 chr2 74528274 74528274 Missense_Mutation G G T TCGA-MH-A561-01A-11D-A26P-10 ENST00000377526 p.F215L SOWAHC chr2 109615497 109615497 Silent C C T TCGA-MH-A561-01A-11D-A26P-10 ENST00000356454 p.A336A LCT chr2 135798060 135798060 Silent T T G TCGA-MH-A561-01A-11D-A26P-10 ENST00000264162 p.R1649R LRP2 chr2 169279499 169279499 Nonsense_Mutation T T A TCGA-MH-A561-01A-11D-A26P-10 ENST00000263816 p.K480* GAD1 chr2 170844081 170844081 Missense_Mutation G G T TCGA-MH-A561-01A-11D-A26P-10 ENST00000358196 p.M225I METAP1D chr2 172065724 172065724 Missense_Mutation A A G TCGA-MH-A561-01A-11D-A26P-10 ENST00000315796 p.N157D MSTN chr2 190062455 190062455 Missense_Mutation T T C TCGA-MH-A561-01A-11D-A26P-10 ENST00000260950 p.T48A C2orf69 chr2 199925131 199925131 Missense_Mutation G G T TCGA-MH-A561-01A-11D-A26P-10 ENST00000319974 p.A135S DGKD chr2 233460280 233460280 Missense_Mutation G G T TCGA-MH-A561-01A-11D-A26P-10 ENST00000264057 p.M972I SATB1 chr3 18349444 18349444 Missense_Mutation T T C TCGA-MH-A561-01A-11D-A26P-10 ENST00000338745 p.E673G EPM2AIP1 chr3 36991992 36991992 Missense_Mutation C C A TCGA-MH-A561-01A-11D-A26P-10 ENST00000322716 p.L362F SCN10A chr3 38698525 38698525 Silent A A G TCGA-MH-A561-01A-11D-A26P-10 ENST00000449082 p.S1565S SCN10A chr3 38698527 38698527 Missense_Mutation T T G TCGA-MH-A561-01A-11D-A26P-10 ENST00000449082 p.S1565R SCN10A chr3 38698529 38698532 Frame_Shift_Del TGAA TGAA - TCGA-MH-A561-01A-11D-A26P-10 ENST00000449082 p.L1563Qfs*23 DNAH1 chr3 52382403 52382403 Missense_Mutation T T C TCGA-MH-A561-01A-11D-A26P-10 ENST00000420323 p.L2630P IGSF10 chr3 151449008 151449008 Missense_Mutation C C T TCGA-MH-A561-01A-11D-A26P-10 ENST00000282466 p.G325R BOD1L1 chr4 13600121 13600121 Missense_Mutation G G A TCGA-MH-A561-01A-11D-A26P-10 ENST00000040738 p.S2260L RUFY3 chr4 70722689 70722689 Missense_Mutation G G T TCGA-MH-A561-01A-11D-A26P-10 ENST00000226328 p.W39L GRID2 chr4 93216880 93216880 Missense_Mutation A A G TCGA-MH-A561-01A-11D-A26P-10 ENST00000282020 p.D311G FBXW7 chr4 152329731 152329731 Frame_Shift_Del G G - TCGA-MH-A561-01A-11D-A26P-10 ENST00000281708 p.R393Efs*2 CTC-512J14.7 chr5 80299872 80299872 RNA T T C TCGA-MH-A561-01A-11D-A26P-10 ENST00000507366 PCDHB7 chr5 141176326 141176326 3'UTR T T A TCGA-MH-A561-01A-11D-A26P-10 ENST00000231137 TAF7 chr5 141319807 141319807 Missense_Mutation T T C TCGA-MH-A561-01A-11D-A26P-10 ENST00000313368 p.I80V TFAP2A chr6 10398456 10398456 Missense_Mutation G G C TCGA-MH-A561-01A-11D-A26P-10 ENST00000482890 p.N425K KIF13A chr6 17817216 17817216 Missense_Mutation C C T TCGA-MH-A561-01A-11D-A26P-10 ENST00000259711 p.V602I Unknown chr6 60499373 60499373 IGR G G T TCGA-MH-A561-01A-11D-A26P-10 COL12A1 chr6 75152165 75152165 Silent T T C TCGA-MH-A561-01A-11D-A26P-10 ENST00000322507 p.A1267A MAP3K7 chr6 90516680 90516681 Frame_Shift_Del GC GC - TCGA-MH-A561-01A-11D-A26P-10 ENST00000369329 p.Q548Rfs*10 MAP3K7 chr6 90516682 90516682 Splice_Site C C T TCGA-MH-A561-01A-11D-A26P-10 ENST00000369329 p.X547_splice GRIK2 chr6 102065896 102065896 Intron T T - TCGA-MH-A561-01A-11D-A26P-10 ENST00000421544 HDAC2 chr6 113943481 113943481 Silent A A C TCGA-MH-A561-01A-11D-A26P-10 ENST00000519065 p.A416A SDK1 chr7 4268788 4268788 3'UTR C C A TCGA-MH-A561-01A-11D-A26P-10 ENST00000404826 ELMO1 chr7 37013432 37013432 Missense_Mutation C C T TCGA-MH-A561-01A-11D-A26P-10 ENST00000310758 p.S435N KMT2E chr7 105077091 105077091 Missense_Mutation G G C TCGA-MH-A561-01A-11D-A26P-10 ENST00000257745 p.E299D LAMB4 chr7 108091664 108091675 In_Frame_Del CCTCGTAGAGAT CCTCGTAGAGAT - TCGA-MH-A561-01A-11D-A26P-10 ENST00000205386 p.Y551_A555delinsS MET chr7 116783420 116783420 Missense_Mutation T T C TCGA-MH-A561-01A-11D-A26P-10 ENST00000397752 p.M1250T CLCN1 chr7 143323595 143323596 Intron CC CC - TCGA-MH-A561-01A-11D-A26P-10 ENST00000343257 KIAA1456 chr8 13027365 13027365 3'UTR T T G TCGA-MH-A561-01A-11D-A26P-10 ENST00000524591 NRG1 chr8 32759355 32759355 Missense_Mutation A A T TCGA-MH-A561-01A-11D-A26P-10 ENST00000405005 p.E327V NKX6-3 chr8 41646546 41646546 Missense_Mutation G G T TCGA-MH-A561-01A-11D-A26P-10 ENST00000518699 p.P234Q NCOA2 chr8 70141345 70141345 Missense_Mutation G G A TCGA-MH-A561-01A-11D-A26P-10 ENST00000452400 p.P956L CSMD3 chr8 112304765 112304765 Missense_Mutation G G A TCGA-MH-A561-01A-11D-A26P-10 ENST00000297405 p.P2741L PHF20L1 chr8 132794493 132794493 Missense_Mutation A A G TCGA-MH-A561-01A-11D-A26P-10 ENST00000395386 p.E56G SLC28A3 chr9 84285523 84285523 Missense_Mutation A A T TCGA-MH-A561-01A-11D-A26P-10 ENST00000376238 p.F490Y PTPN3 chr9 109457186 109457186 Frame_Shift_Del C C - TCGA-MH-A561-01A-11D-A26P-10 ENST00000374541 p.K93Sfs*3 PALM2 chr9 109943324 109943324 Missense_Mutation A A G TCGA-MH-A561-01A-11D-A26P-10 ENST00000374531 p.T347A FAM102A chr9 127944817 127944817 Silent G G A TCGA-MH-A561-01A-11D-A26P-10 ENST00000373095 p.I333I NUP188 chr9 128987687 128987687 Missense_Mutation T T C TCGA-MH-A561-01A-11D-A26P-10 ENST00000372577 p.I788T KIN chr10 7780152 7780152 Missense_Mutation C C G TCGA-MH-A561-01A-11D-A26P-10 ENST00000379562 p.V94L SORBS1 chr10 95410623 95410631 Splice_Site CCTCTCTTA CCTCTCTTA - TCGA-MH-A561-01A-11D-A26P-10 ENST00000361941 p.X319_splice ALDH18A1 chr10 95606701 95606701 3'UTR G G A TCGA-MH-A561-01A-11D-A26P-10 ENST00000371224 RP11-108K14.8 chr10 133396245 133396246 Frame_Shift_Ins - - GC TCGA-MH-A561-01A-11D-A26P-10 ENST00000468317 p.A93Rfs*14 INS chr11 2159905 2159905 Missense_Mutation G G T TCGA-MH-A561-01A-11D-A26P-10 ENST00000250971 p.Q94K PDE3B chr11 14786643 14786643 Missense_Mutation A A T TCGA-MH-A561-01A-11D-A26P-10 ENST00000282096 p.E412D CHRM1 chr11 62909735 62909735 Missense_Mutation G G A TCGA-MH-A561-01A-11D-A26P-10 ENST00000306960 p.P456S CHRM1 chr11 62910038 62910038 Missense_Mutation A A T TCGA-MH-A561-01A-11D-A26P-10 ENST00000306960 p.F355I VPS51 chr11 65108390 65108390 Frame_Shift_Del G G - TCGA-MH-A561-01A-11D-A26P-10 ENST00000279281 p.G307Efs*116 CARNS1 chr11 67424707 67424707 3'UTR C C T TCGA-MH-A561-01A-11D-A26P-10 ENST00000307823 SYTL2 chr11 85698002 85698002 Missense_Mutation A A C TCGA-MH-A561-01A-11D-A26P-10 ENST00000528231 p.S810R NCAPD3 chr11 134194053 134194053 Missense_Mutation C C T TCGA-MH-A561-01A-11D-A26P-10 ENST00000534548 p.R596Q FAM186A chr12 50351349 50351349 Missense_Mutation G G T TCGA-MH-A561-01A-11D-A26P-10 ENST00000327337 p.S1828Y GALNT6 chr12 51364237 51364237 Silent G G C TCGA-MH-A561-01A-11D-A26P-10 ENST00000356317 p.P311P HOXC6 chr12 54028448 54028448 5'UTR C C A TCGA-MH-A561-01A-11D-A26P-10 ENST00000243108 GCN1L1 chr12 120131997 120131997 Missense_Mutation C C T TCGA-MH-A561-01A-11D-A26P-10 ENST00000300648 p.G2448E HMGB1 chr13 30462423 30462423 Intron C C T TCGA-MH-A561-01A-11D-A26P-10 ENST00000339872 ATP11A chr13 112871796 112871796 Missense_Mutation T T C TCGA-MH-A561-01A-11D-A26P-10 ENST00000375645 p.L1018P PSMB11 chr14 23043378 23043378 3'UTR C C A TCGA-MH-A561-01A-11D-A26P-10 ENST00000408907 CDH24 chr14 23048420 23048420 Frame_Shift_Del C C - TCGA-MH-A561-01A-11D-A26P-10 ENST00000267383 p.E674Rfs*167 FLRT2 chr14 85624057 85624057 3'UTR A A T TCGA-MH-A561-01A-11D-A26P-10 ENST00000330753 VPS13C chr15 61919435 61919435 Missense_Mutation T T C TCGA-MH-A561-01A-11D-A26P-10 ENST00000261517 p.T2498A ADAMTSL3 chr15 83923985 83923985 Missense_Mutation G G A TCGA-MH-A561-01A-11D-A26P-10 ENST00000286744 p.R690H RPL3L chr16 1945507 1945507 Missense_Mutation C C A TCGA-MH-A561-01A-11D-A26P-10 ENST00000268661 p.A387S SCNN1B chr16 23348818 23348818 Silent C C G TCGA-MH-A561-01A-11D-A26P-10 ENST00000343070 p.T73T RBBP6 chr16 24570172 24570172 Missense_Mutation A A T TCGA-MH-A561-01A-11D-A26P-10 ENST00000319715 p.E1161V MYLK3 chr16 46747843 46747843 Missense_Mutation C C A TCGA-MH-A561-01A-11D-A26P-10 ENST00000394809 p.M117I EDC4 chr16 67876955 67876955 Missense_Mutation T T G TCGA-MH-A561-01A-11D-A26P-10 ENST00000358933 p.L145W MYO15A chr17 18153868 18153868 Missense_Mutation C C G TCGA-MH-A561-01A-11D-A26P-10 ENST00000205890 p.A2687G KRT36 chr17 41486303 41486308 3'UTR TAAGCC TAAGCC - TCGA-MH-A561-01A-11D-A26P-10 ENST00000328119 ITGA2B chr17 44372424 44372424 Splice_Site C C T TCGA-MH-A561-01A-11D-A26P-10 ENST00000262407 p.X1021_splice C17orf104 chr17 44666828 44666828 Missense_Mutation A A T TCGA-MH-A561-01A-11D-A26P-10 ENST00000409122 p.Q306L SPAG9 chr17 50989751 50989751 Silent G G T TCGA-MH-A561-01A-11D-A26P-10 ENST00000262013 p.V913V METTL23 chr17 76733016 76733016 Silent C C A TCGA-MH-A561-01A-11D-A26P-10 ENST00000341249 p.A41A AATK chr17 81121514 81121514 Missense_Mutation G G T TCGA-MH-A561-01A-11D-A26P-10 ENST00000326724 p.P808T HDGFRP2 chr19 4501188 4501188 Splice_Region C C T TCGA-MH-A561-01A-11D-A26P-10 ENST00000616600 SYDE1 chr19 15109190 15109190 Missense_Mutation A A T TCGA-MH-A561-01A-11D-A26P-10 ENST00000342784 p.S75C PDCD5 chr19 32586888 32586888 Frame_Shift_Del A A - TCGA-MH-A561-01A-11D-A26P-10 ENST00000590247 p.V99* ZNF792 chr19 34959307 34959307 Frame_Shift_Del T T - TCGA-MH-A561-01A-11D-A26P-10 ENST00000404801 p.N183Tfs*16 ERCC1 chr19 45413960 45413960 Splice_Region T T C TCGA-MH-A561-01A-11D-A26P-10 ENST00000300853 ZNF256 chr19 57941197 57941197 Frame_Shift_Del A A - TCGA-MH-A561-01A-11D-A26P-10 ENST00000282308 p.H537Qfs*83 SOX12 chr20 328659 328659 3'UTR T T A TCGA-MH-A561-01A-11D-A26P-10 ENST00000342665 PLTP chr20 45911247 45911247 Silent C C T TCGA-MH-A561-01A-11D-A26P-10 ENST00000372431 p.K35K ZNF831 chr20 59207014 59207014 Frame_Shift_Del A A - TCGA-MH-A561-01A-11D-A26P-10 ENST00000371030 p.K1329Sfs*13 TRPM2 chr21 44405911 44405911 Silent C C T TCGA-MH-A561-01A-11D-A26P-10 ENST00000300482 p.I888I KRTAP10-10 chr21 44637984 44637984 Silent C C T TCGA-MH-A561-01A-11D-A26P-10 ENST00000380095 p.S189S ADORA2A chr22 24440590 24440590 Missense_Mutation G G T TCGA-MH-A561-01A-11D-A26P-10 ENST00000337539 p.G114C CBX6 chr22 38866325 38866325 Missense_Mutation T T G TCGA-MH-A561-01A-11D-A26P-10 ENST00000407418 p.S375R SMC1A chrX 53413352 53413352 Silent C G G TCGA-MH-A561-01A-11D-A26P-10 ENST00000322213 p.A165A GLRA4 chrX 103719006 103719006 Intron T T A TCGA-MH-A561-01A-11D-A26P-10 ENST00000372617 UPF3B chrX 119851504 119851504 Missense_Mutation C G G TCGA-MH-A561-01A-11D-A26P-10 ENST00000276201 p.D121H SMIM10 chrX 134991718 134991718 3'UTR A A - TCGA-MH-A561-01A-11D-A26P-10 ENST00000330288 AGL chr1 99881119 99881119 Missense_Mutation C C G TCGA-GL-6846-01A-11D-1961-08 ENST00000294724 p.S648C PRRC2C chr1 171566778 171566778 Missense_Mutation G G A TCGA-GL-6846-01A-11D-1961-08 ENST00000338920 p.E2163K AGT chr1 230706051 230706051 Missense_Mutation A A T TCGA-GL-6846-01A-11D-1961-08 ENST00000366667 p.F336I PUM2 chr2 20318588 20318588 Missense_Mutation C C T TCGA-GL-6846-01A-11D-1961-08 ENST00000338086 p.G37S UNC50 chr2 98616432 98616432 Missense_Mutation A A T TCGA-GL-6846-01A-11D-1961-08 ENST00000357765 p.H181L TTN chr2 178746439 178746439 Intron C C T TCGA-GL-6846-01A-11D-1961-08 ENST00000591111 ANKRD44 chr2 197121507 197121507 Missense_Mutation T T C TCGA-GL-6846-01A-11D-1961-08 ENST00000282272 p.H244R FZD5 chr2 207768076 207768076 Missense_Mutation A A G TCGA-GL-6846-01A-11D-1961-08 ENST00000295417 p.C222R ZNF142 chr2 218638657 218638657 Silent G G T TCGA-GL-6846-01A-11D-1961-08 ENST00000411696 p.T1582T FBXW12 chr3 48394622 48394622 Missense_Mutation A A G TCGA-GL-6846-01A-11D-1961-08 ENST00000296438 p.D453G KIAA1407 chr3 114002528 114002528 Missense_Mutation C C A TCGA-GL-6846-01A-11D-1961-08 ENST00000295878 p.E663D POLQ chr3 121498480 121498480 Missense_Mutation T T G TCGA-GL-6846-01A-11D-1961-08 ENST00000264233 p.K717T SEC62 chr3 169988337 169988337 Silent C C T TCGA-GL-6846-01A-11D-1961-08 ENST00000337002 p.A236A ACAP2 chr3 195285797 195285797 Splice_Region T T C TCGA-GL-6846-01A-11D-1961-08 ENST00000326793 p.P745P LMLN chr3 197960274 197960274 Missense_Mutation G G A TCGA-GL-6846-01A-11D-1961-08 ENST00000330198 p.G18D FRYL chr4 48595985 48595986 Frame_Shift_Del TT TT - TCGA-GL-6846-01A-11D-1961-08 ENST00000358350 p.K350Nfs*11 TET2 chr4 105236304 105236304 Nonsense_Mutation G G T TCGA-GL-6846-01A-11D-1961-08 ENST00000380013 p.E788* TRPC3 chr4 121932370 121932370 Silent G G A TCGA-GL-6846-01A-11D-1961-08 ENST00000379645 p.S296S FAT1 chr4 186609264 186609264 Silent T T A TCGA-GL-6846-01A-11D-1961-08 ENST00000441802 p.I3375I AGGF1 chr5 77048956 77048956 Missense_Mutation C C A TCGA-GL-6846-01A-11D-1961-08 ENST00000312916 p.T445N NME5 chr5 138138694 138138694 Frame_Shift_Del C C - TCGA-GL-6846-01A-11D-1961-08 ENST00000265191 p.I30Yfs*41 NME5 chr5 138138695 138138695 Missense_Mutation T T G TCGA-GL-6846-01A-11D-1961-08 ENST00000265191 p.E29A NME5 chr5 138138696 138138696 Nonsense_Mutation C C A TCGA-GL-6846-01A-11D-1961-08 ENST00000265191 p.E29* NME5 chr5 138138697 138138697 Missense_Mutation C C G TCGA-GL-6846-01A-11D-1961-08 ENST00000265191 p.E28D PCDH12 chr5 141957050 141957050 Missense_Mutation C C T TCGA-GL-6846-01A-11D-1961-08 ENST00000231484 p.A268T PHYKPL chr5 178215284 178215284 Silent C C T TCGA-GL-6846-01A-11D-1961-08 ENST00000308158 p.G358G OR2Y1 chr5 180739694 180739694 Missense_Mutation C C T TCGA-GL-6846-01A-11D-1961-08 ENST00000307832 p.R122H MRS2 chr6 24418094 24418094 Missense_Mutation A A T TCGA-GL-6846-01A-11D-1961-08 ENST00000378386 p.S283C KCTD20 chr6 36486957 36486957 Missense_Mutation C C T TCGA-GL-6846-01A-11D-1961-08 ENST00000373731 p.R348C POLH chr6 43620296 43620296 3'Flank A A T TCGA-GL-6846-01A-11D-1961-08 ENST00000372236 ULBP1 chr6 149968699 149968699 Missense_Mutation C C A TCGA-GL-6846-01A-11D-1961-08 ENST00000229708 p.P60T MLLT4 chr6 167943412 167943412 Missense_Mutation T T A TCGA-GL-6846-01A-11D-1961-08 ENST00000447894 p.L1052Q PDGFA chr7 500933 500947 Intron GCAGGTGTGGGATCC GCAGGTGTGGGATCC - TCGA-GL-6846-01A-11D-1961-08 ENST00000354513 ACTB chr7 5528605 5528605 Missense_Mutation T T C TCGA-GL-6846-01A-11D-1961-08 ENST00000331789 p.T160A C7orf26 chr7 6600203 6600203 Missense_Mutation T T G TCGA-GL-6846-01A-11D-1961-08 ENST00000344417 p.F319V ASB4 chr7 95495952 95495952 Missense_Mutation G G A TCGA-GL-6846-01A-11D-1961-08 ENST00000325885 p.D128N NRCAM chr7 108168377 108168377 Silent G G A TCGA-GL-6846-01A-11D-1961-08 ENST00000379028 p.S1071S CHD7 chr8 60742203 60742203 Silent T T C TCGA-GL-6846-01A-11D-1961-08 ENST00000423902 p.H257H PTPRD chr9 8460558 8460558 Missense_Mutation G G T TCGA-GL-6846-01A-11D-1961-08 ENST00000356435 p.T1243N BNC2 chr9 16552616 16552617 In_Frame_Ins - - GAA TCGA-GL-6846-01A-11D-1961-08 ENST00000380672 p.F194dup GTF3C5 chr9 133042292 133042292 Missense_Mutation T T A TCGA-GL-6846-01A-11D-1961-08 ENST00000372097 p.I120N GTF3C5 chr9 133042293 133042293 Silent T T A TCGA-GL-6846-01A-11D-1961-08 ENST00000372097 p.I120I LCN12 chr9 136952365 136952367 In_Frame_Del TGC TGC - TCGA-GL-6846-01A-11D-1961-08 ENST00000371633 p.L14del CACNA1B chr9 138049218 138049218 Silent T T C TCGA-GL-6846-01A-11D-1961-08 ENST00000371372 p.L1205L DIP2C chr10 329509 329509 Missense_Mutation A A T TCGA-GL-6846-01A-11D-1961-08 ENST00000280886 p.V1226D ZEB1 chr10 31524021 31524021 Missense_Mutation G G T TCGA-GL-6846-01A-11D-1961-08 ENST00000320985 p.R897L SLK chr10 104003357 104003357 Missense_Mutation G G A TCGA-GL-6846-01A-11D-1961-08 ENST00000369755 p.G727S SEC23IP chr10 119933146 119933146 Missense_Mutation T T C TCGA-GL-6846-01A-11D-1961-08 ENST00000369075 p.L967P DOCK1 chr10 126990527 126990527 Missense_Mutation C C G TCGA-GL-6846-01A-11D-1961-08 ENST00000280333 p.L133V OR56A1 chr11 6027219 6027219 Silent A A G TCGA-GL-6846-01A-11D-1961-08 ENST00000316650 p.L162L CTTN chr11 70436415 70436415 3'UTR T T C TCGA-GL-6846-01A-11D-1961-08 ENST00000301843 C2CD5 chr12 22470870 22470870 Silent C C T TCGA-GL-6846-01A-11D-1961-08 ENST00000333957 p.Q800Q ITGB7 chr12 53192763 53192763 Missense_Mutation T T C TCGA-GL-6846-01A-11D-1961-08 ENST00000267082 p.Q625R FSCB chr14 44506058 44506058 Silent C C T TCGA-GL-6846-01A-11D-1961-08 ENST00000340446 p.A310A ACTN1 chr14 68885422 68885422 Splice_Region T T C TCGA-GL-6846-01A-11D-1961-08 ENST00000193403 TDP1 chr14 89963588 89963588 Silent G G A TCGA-GL-6846-01A-11D-1961-08 ENST00000335725 p.L158L SRRM2 chr16 2764252 2764252 Missense_Mutation G G A TCGA-GL-6846-01A-11D-1961-08 ENST00000301740 p.V1242I C16orf86 chr16 67668234 67668234 Nonsense_Mutation C C G TCGA-GL-6846-01A-11D-1961-08 ENST00000403458 p.Y196* VPS9D1 chr16 89708910 89708910 Frame_Shift_Del G G - TCGA-GL-6846-01A-11D-1961-08 ENST00000389386 p.T549Pfs*32 SCARF1 chr17 1634937 1634937 Missense_Mutation T T C TCGA-GL-6846-01A-11D-1961-08 ENST00000263071 p.R772G CAMKK1 chr17 3885328 3885328 Missense_Mutation C C G TCGA-GL-6846-01A-11D-1961-08 ENST00000348335 p.E120D ZNF232 chr17 5106217 5106217 Silent A A G TCGA-GL-6846-01A-11D-1961-08 ENST00000250076 p.Y314Y POLDIP2 chr17 28357324 28357324 Missense_Mutation G G A TCGA-GL-6846-01A-11D-1961-08 ENST00000540200 p.A42V POLDIP2 chr17 28357325 28357325 Missense_Mutation C C T TCGA-GL-6846-01A-11D-1961-08 ENST00000540200 p.A42T SLC13A2 chr17 28491527 28491527 Missense_Mutation G G A TCGA-GL-6846-01A-11D-1961-08 ENST00000314669 p.S222N SPAG5 chr17 28592828 28592828 Missense_Mutation T T C TCGA-GL-6846-01A-11D-1961-08 ENST00000321765 p.Q139R SLC6A4 chr17 30198340 30198340 3'UTR C C G TCGA-GL-6846-01A-11D-1961-08 ENST00000261707 FAM20A chr17 68542704 68542705 Frame_Shift_Del AA AA - TCGA-GL-6846-01A-11D-1961-08 ENST00000592554 p.F306Cfs*73 UNC13D chr17 75835685 75835685 Silent G G T TCGA-GL-6846-01A-11D-1961-08 ENST00000207549 p.L563L CTAGE1 chr18 22417295 22417295 Missense_Mutation G G A TCGA-GL-6846-01A-11D-1961-08 ENST00000391403 p.R173W ACER1 chr19 6306642 6306642 3'UTR C C G TCGA-GL-6846-01A-11D-1961-08 ENST00000301452 ZNF20 chr19 12135892 12135892 Missense_Mutation A A C TCGA-GL-6846-01A-11D-1961-08 ENST00000334213 p.S6A LGI4 chr19 35126343 35126343 Missense_Mutation A A G TCGA-GL-6846-01A-11D-1961-08 ENST00000310123 p.V409A ZNF546 chr19 40014939 40014939 Missense_Mutation G G A TCGA-GL-6846-01A-11D-1961-08 ENST00000347077 p.E557K EGLN2 chr19 40800698 40800698 Nonsense_Mutation T T A TCGA-GL-6846-01A-11D-1961-08 ENST00000303961 p.C42* SLC24A3 chr20 19685338 19685338 Missense_Mutation C C T TCGA-GL-6846-01A-11D-1961-08 ENST00000328041 p.P434L PCIF1 chr20 45945830 45945830 Missense_Mutation A A C TCGA-GL-6846-01A-11D-1961-08 ENST00000372409 p.I430L ARFGEF2 chr20 49025453 49025453 Silent C C T TCGA-GL-6846-01A-11D-1961-08 ENST00000371917 p.Y1632Y KRTAP10-3 chr21 44558125 44558125 Silent G G A TCGA-GL-6846-01A-11D-1961-08 ENST00000391620 p.L197L SMARCB1 chr22 23833651 23833652 Frame_Shift_Ins - T T TCGA-GL-6846-01A-11D-1961-08 ENST00000263121 p.T357Dfs*4 MTHFR chr1 11788823 11788823 3'UTR C C T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000376590 SPEN chr1 15931842 15931842 Missense_Mutation T T G TCGA-B9-A44B-01A-11D-A25F-10 ENST00000375759 p.L1868V RCAN3 chr1 24514464 24514464 Frame_Shift_Del A A - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000374395 p.N32Mfs*8 DNALI1 chr1 37562190 37562192 In_Frame_Del AGA AGA - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000296218 p.K253del EFCAB14 chr1 46678521 46678522 Frame_Shift_Del AA AA - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000371933 p.F476* SLC44A3 chr1 94894912 94894912 Missense_Mutation T T C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000271227 p.I651T ATXN7L2 chr1 109487013 109487013 Missense_Mutation G G C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000369870 p.R102T CTTNBP2NL chr1 112456797 112456797 Frame_Shift_Del G G - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000271277 p.K435Nfs*19 SELENBP1 chr1 151369320 151369320 Intron T T A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000368868 CELF3 chr1 151715986 151715986 Missense_Mutation C C T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000290583 p.G12E MRPL24 chr1 156738101 156738101 Missense_Mutation G G A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000361531 p.R105W AXDND1 chr1 179491707 179491707 Missense_Mutation A A C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000367618 p.K754T ZNF648 chr1 182057777 182057783 Frame_Shift_Del TTCCTCT TTCCTCT - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000339948 p.E77Rfs*29 ZNF281 chr1 200407687 200407687 Silent T T C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000294740 p.Q673Q HS1BP3 chr2 20619097 20619097 Missense_Mutation C C G TCGA-B9-A44B-01A-11D-A25F-10 ENST00000304031 p.A357P CCDC121 chr2 27627681 27627681 Missense_Mutation A A G TCGA-B9-A44B-01A-11D-A25F-10 ENST00000324364 p.L40P ALK chr2 29197607 29197607 Missense_Mutation C C A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000389048 p.Q1336H ACTG2 chr2 73919581 73919581 3'UTR G G A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000345517 STARD7-AS1 chr2 96240678 96240678 RNA C C A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000432267 RGPD3 chr2 106456976 106456976 Silent G G A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000409886 p.L134L ORC4 chr2 147975968 147975968 5'UTR T T - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000264169 SCN2A chr2 165297035 165297035 Nonsense_Mutation A A T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000283256 p.K96* LRP2 chr2 169198796 169198796 Silent A A G TCGA-B9-A44B-01A-11D-A25F-10 ENST00000263816 p.P2856P PGAP1 chr2 196920129 196920129 Missense_Mutation G G T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000354764 p.L57M RPUSD3 chr3 9837956 9837956 3'UTR C A A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000383820 MKRN2 chr3 12570174 12570174 Missense_Mutation G A A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000170447 p.V87I RPSA chr3 39412062 39412065 Splice_Site GTAT - - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000301821 p.X265_splice SETD2 chr3 47122476 47122477 Frame_Shift_Ins - - C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000409792 p.F721Ifs*5 POC1A chr3 52147024 52147024 Missense_Mutation C C A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000296484 p.S176I STAB1 chr3 52521654 52521655 Frame_Shift_Ins - - T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000321725 p.C2041Lfs*2 PBRM1 chr3 52603631 52603631 Missense_Mutation G T T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000296302 p.A890E SLMAP chr3 57757804 57757804 Silent A G G TCGA-B9-A44B-01A-11D-A25F-10 ENST00000428312 p.L51L THPO chr3 184372847 184372847 Missense_Mutation A A C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000204615 p.I243S EIF4A2 chr3 186785981 186785981 Missense_Mutation G G T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000323963 p.Q149H MUC4 chr3 195779637 195779637 Silent G G A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000463781 p.H3981H PPP2R2C chr4 6472258 6472258 5'UTR G G A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000382599 DCAF4L1 chr4 41986011 41986011 3'UTR G G C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000333141 TMPRSS11A chr4 67911393 67911393 Frame_Shift_Del G G - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000334830 p.Y405* TMPRSS11A chr4 67911394 67911394 Missense_Mutation T T A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000334830 p.Y405F ZNF622 chr5 16465370 16465370 Missense_Mutation A A G TCGA-B9-A44B-01A-11D-A25F-10 ENST00000308683 p.V99A MYO10 chr5 16685805 16685805 Missense_Mutation A A C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000513610 p.V1308G CDH9 chr5 26915743 26915743 Missense_Mutation C C T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000231021 p.R137Q GDNF chr5 37834823 37834823 Splice_Site C C A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000326524 PRRC1 chr5 127524822 127524822 Missense_Mutation G G C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000296666 p.G132A MATR3 chr5 139307550 139307550 Missense_Mutation G G A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000394805 p.M45I GRPEL2 chr5 149350931 149350931 Silent C C T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000329271 p.F109F DSP chr6 7562763 7562763 Frame_Shift_Del A A - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000379802 p.I238Sfs*22 SLC17A3 chr6 25850050 25850050 Frame_Shift_Del A A - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000360657 p.L296* TCP11 chr6 35118287 35118287 Silent T T G TCGA-B9-A44B-01A-11D-A25F-10 ENST00000512012 p.T498T KLC4 chr6 43073904 43073905 Frame_Shift_Ins - - CAACACGA TCGA-B9-A44B-01A-11D-A25F-10 ENST00000347162 p.M585Tfs*4 KLC4 chr6 43073910 43073910 Missense_Mutation T T C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000347162 p.M585T YIPF3 chr6 43512777 43512777 Missense_Mutation A A G TCGA-B9-A44B-01A-11D-A25F-10 ENST00000372422 p.L255P SNAP91 chr6 83661575 83661575 Missense_Mutation A A T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000369694 p.Y127N SPACA1 chr6 88066223 88066223 Missense_Mutation C C A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000237201 p.P258H MDN1 chr6 89692594 89692594 Nonsense_Mutation G G C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000369393 p.S3479* HACE1 chr6 104850964 104850964 Missense_Mutation A A T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000262903 p.F55Y SOBP chr6 107506323 107506323 Missense_Mutation C C A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000317357 p.A106D NUS1 chr6 117694156 117694156 Missense_Mutation G G A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000368494 p.V223I ADGRG6 chr6 142370441 142370441 Silent C C T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000230173 p.V239V IGF2R chr6 160024644 160024644 Missense_Mutation T T C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000356956 p.Y196H NEUROD6 chr7 31338825 31338825 Missense_Mutation T T A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000297142 p.E148D NEUROD6 chr7 31338826 31338826 Missense_Mutation T T A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000297142 p.E148V CCDC129 chr7 31643104 31643104 Missense_Mutation C C A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000407970 p.D578E HERPUD2 chr7 35694327 35694327 Missense_Mutation C C T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000311350 p.D2N PKD1L1 chr7 47814002 47814002 Missense_Mutation C C T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000289672 p.G2368R POMZP3 chr7 76611484 76611484 Missense_Mutation G G T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000310842 p.S182Y PCLO chr7 82949725 82949725 Frame_Shift_Del T T - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000333891 p.V3622Sfs*15 PCLO chr7 82955950 82955950 Missense_Mutation T T C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000333891 p.K1668R ANKIB1 chr7 92327836 92327836 Silent T T C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000265742 p.I241I LRRN3 chr7 111125405 111125405 3'Flank A A T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000308478 ADCK2 chr7 140681087 140681087 Missense_Mutation G G T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000072869 p.D419Y KMT2C chr7 152137001 152137001 Intron T C C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000262189 RBM33 chr7 155741887 155741888 Frame_Shift_Ins - - A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000401878 p.N707Kfs*4 CHRNA2 chr8 27471189 27471189 5'UTR C C G TCGA-B9-A44B-01A-11D-A25F-10 ENST00000407991 FUT10 chr8 33389164 33389165 Frame_Shift_Ins - - A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000327671 p.R338Qfs*6 RNF19A chr8 100264743 100264743 Missense_Mutation G G A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000341084 p.R412W ENPP2 chr8 119638816 119638816 5'UTR C C T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000075322 MROH5 chr8 141476096 141476096 Silent G G A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000621837 p.T499T EEF1D chr8 143579825 143579825 Missense_Mutation C C G TCGA-B9-A44B-01A-11D-A25F-10 ENST00000317198 p.Q271H MELK chr9 36583637 36583637 Silent A A G TCGA-B9-A44B-01A-11D-A25F-10 ENST00000298048 p.A23A ZBTB43 chr9 126834280 126834280 3'UTR T C C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000373457 CREM chr10 35211487 35211487 Intron C C T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000345491 MSS51 chr10 73427664 73427664 Missense_Mutation C C A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000299432 p.R109I FUT11 chr10 73773698 73773698 Missense_Mutation C C T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000372841 p.A406V KAT6B chr10 75021909 75021909 Missense_Mutation G G C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000287239 p.C1017S GRID1 chr10 85724530 85724530 Silent T T G TCGA-B9-A44B-01A-11D-A25F-10 ENST00000327946 p.P560P SUFU chr10 102504219 102504225 Frame_Shift_Del CCCCCGG - - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000369902 p.P24Sfs*70 PDCD11 chr10 103445430 103445432 In_Frame_Del TTC TTC - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000369797 p.F1835del NANOS1 chr10 119032554 119032554 3'UTR C C A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000425699 DCHS1 chr11 6632801 6632801 Missense_Mutation G G T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000299441 p.P904Q FBXO3 chr11 33748785 33748785 Missense_Mutation C C T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000265651 p.G347E UBE2L6 chr11 57567621 57567621 5'UTR G G C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000287156 YPEL4 chr11 57647136 57647138 5'UTR GCT GCT - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000300022 CD6 chr11 61011125 61011133 In_Frame_Del AGTCACTAT AGTCACTAT - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000313421 p.V381_I383del HNRNPUL2 chr11 62723944 62723944 Frame_Shift_Del C C - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000301785 p.E241Rfs*6 GPR152 chr11 67452572 67452572 Silent C C T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000312457 p.A51A HEPHL1 chr11 94064346 94064363 In_Frame_Del ATTCAGGGACACGGAATG ATTCAGGGACACGGAATG - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000315765 p.S216_D221del PHLDB1 chr11 118639217 118639217 Missense_Mutation G A A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000361417 p.R901K CACNA2D4 chr12 1793690 1793690 Missense_Mutation A A G TCGA-B9-A44B-01A-11D-A25F-10 ENST00000382722 p.C1127R CHD4 chr12 6582842 6582845 Splice_Region ACTT ACTT - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000357008 LPAR5 chr12 6620008 6620008 3'UTR A A T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000329858 C2CD5 chr12 22517994 22517994 Missense_Mutation G G T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000333957 p.P315H KIF21A chr12 39332927 39332927 Missense_Mutation G G C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000361418 p.Q890E ARID2 chr12 45811437 45811438 Frame_Shift_Del AA AA - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000334344 p.K102Sfs*8 KCNH3 chr12 49557234 49557235 Frame_Shift_Del AC AC - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000257981 p.L878Gfs*133 KRT85 chr12 52360858 52360858 Missense_Mutation C C T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000257901 p.A507T PTPRB chr12 70538227 70538227 Missense_Mutation A A T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000261266 p.D1740E TMCC3 chr12 94571473 94571473 Missense_Mutation T T C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000261226 p.I466V CCDC42B chr12 113155300 113155301 Frame_Shift_Del AG AG - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000335621 p.K244Nfs*58 PXN chr12 120215210 120215210 Frame_Shift_Del G G - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000228307 p.Q333Sfs*13 BRCA2 chr13 32338146 32338146 Missense_Mutation A A G TCGA-B9-A44B-01A-11D-A25F-10 ENST00000380152 p.K1264R THSD1 chr13 52377309 52377309 3'UTR C C G TCGA-B9-A44B-01A-11D-A25F-10 ENST00000258613 ABCC4 chr13 95188461 95188461 Missense_Mutation C C A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000376887 p.A449S DOCK9 chr13 98797485 98797485 Missense_Mutation T T C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000376460 p.N1988S ACIN1 chr14 23080275 23080275 Missense_Mutation C C G TCGA-B9-A44B-01A-11D-A25F-10 ENST00000262710 p.E412Q SAMD4A chr14 54737158 54737158 Missense_Mutation C C T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000392067 p.L284F SYNE2 chr14 64056173 64056173 Missense_Mutation C C A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000344113 p.A3325D SYNE2 chr14 64143869 64143869 Missense_Mutation A A G TCGA-B9-A44B-01A-11D-A25F-10 ENST00000344113 p.Y5135C MTHFD1 chr14 64458224 64458224 Missense_Mutation T T C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000216605 p.M910T RDH11 chr14 67693050 67693050 Missense_Mutation T T G TCGA-B9-A44B-01A-11D-A25F-10 ENST00000381346 p.K26T WDR20 chr14 102209332 102209332 Missense_Mutation C C A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000342702 p.L388I C15orf41 chr15 36709871 36709871 Missense_Mutation T T A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000437989 p.I209K NUSAP1 chr15 41365528 41365528 Missense_Mutation A A G TCGA-B9-A44B-01A-11D-A25F-10 ENST00000559596 p.T263A TP53BP1 chr15 43479513 43479513 Silent T T C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000263801 p.E219E CATSPER2 chr15 43647930 43647930 Silent G G A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000321596 p.I44I DAPK2 chr15 63912117 63912117 Missense_Mutation C C G TCGA-B9-A44B-01A-11D-A25F-10 ENST00000261891 p.R313S SENP8 chr15 72140120 72140120 Missense_Mutation A A T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000340912 p.Y166F PARP6 chr15 72251218 72251218 Missense_Mutation G G A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000287196 p.P433S LINC00933 chr15 84578178 84578178 RNA T T - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000557887 FANCI chr15 89258739 89258739 Frame_Shift_Del A A - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000310775 p.V42Lfs*6 OR4F6 chr15 101806439 101806439 Silent G G T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000328882 p.L240L PLK1 chr16 23679101 23679101 Missense_Mutation C C A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000300093 p.R57S LONP2 chr16 48277475 48277475 Missense_Mutation T T G TCGA-B9-A44B-01A-11D-A25F-10 ENST00000285737 p.L460R VAC14 chr16 70687916 70687916 3'UTR G G A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000261776 MINK1 chr17 4886561 4886561 Missense_Mutation A A G TCGA-B9-A44B-01A-11D-A25F-10 ENST00000355280 p.E295G SGK494 chr17 28611569 28611569 Missense_Mutation A A G TCGA-B9-A44B-01A-11D-A25F-10 ENST00000301037 p.M270T EFCAB5 chr17 29969131 29969131 Missense_Mutation A A T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000394835 p.K177N LRRC37BP1 chr17 30634104 30634104 RNA G G A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000417404 LRRC37B chr17 32022501 32022501 Frame_Shift_Del C C - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000341671 p.I453* HEXIM1 chr17 45150586 45150586 3'UTR G G C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000332499 MBTD1 chr17 51225010 51225010 Missense_Mutation A A C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000415868 p.M51R AKAP1 chr17 57120255 57120255 Silent G G A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000337714 p.V881V MED13 chr17 61965150 61965150 Missense_Mutation T T C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000397786 p.N1567S KCNH6 chr17 63545707 63545707 Silent A A G TCGA-B9-A44B-01A-11D-A25F-10 ENST00000583023 p.A930A NAT9 chr17 74772003 74772003 Missense_Mutation T T G TCGA-B9-A44B-01A-11D-A25F-10 ENST00000357814 p.N149T GALK1 chr17 75762889 75762889 Splice_Region G G C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000225614 CARD14 chr17 80192593 80192593 Missense_Mutation G G A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000344227 p.D444N NPTX1 chr17 80475567 80475567 Frame_Shift_Del A A - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000306773 p.V199Afs*7 DSG3 chr18 31458490 31458490 Missense_Mutation T T G TCGA-B9-A44B-01A-11D-A25F-10 ENST00000257189 p.S88A ABCA7 chr19 1059070 1059070 Silent G G T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000263094 p.G1816G ICAM1 chr19 10285322 10285322 3'UTR C C - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000264832 ADGRE5 chr19 14406344 14406344 Missense_Mutation G G T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000242786 p.C612F EPS15L1 chr19 16437857 16437858 Frame_Shift_Del AT AT - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000248070 p.Y74Cfs*14 IFI30 chr19 18177205 18177205 Silent C C T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000407280 p.R183R ZNF85 chr19 20923358 20923358 5'UTR G G C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000328178 ZNF507 chr19 32382515 32382515 Silent T T A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000311921 p.S803S IRF3 chr19 49661869 49661869 Intron G G T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000309877 FAM182A chr20 26081180 26081180 RNA C C A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000376398 NECAB3 chr20 33657816 33657816 3'UTR G G C TCGA-B9-A44B-01A-11D-A25F-10 ENST00000246190 CHD6 chr20 41514856 41514856 Silent C C A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000373233 p.T217T MYBL2 chr20 43699996 43699996 Silent C C T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000217026 p.I301I WFDC8 chr20 45553226 45553226 Missense_Mutation G G T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000289953 p.P166T BCAS4 chr20 50841787 50841787 Missense_Mutation C C T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000358791 p.H126Y URB1 chr21 32385551 32385551 Missense_Mutation T T G TCGA-B9-A44B-01A-11D-A25F-10 ENST00000382751 p.E92D POTEH chr22 15711013 15711013 Missense_Mutation C C A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000343518 p.T500N CECR2 chr22 17549392 17549392 Missense_Mutation G G A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000342247 p.A1389T ZDHHC8 chr22 20140671 20140671 Missense_Mutation A A T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000334554 p.N239Y C22orf42 chr22 32159030 32159032 In_Frame_Del CTG CTG - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000382097 p.Q62del ACOT9 chrX 23705559 23705559 Silent G G A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000336430 p.F314F POLA1 chrX 24726009 24726009 Missense_Mutation T T A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000379059 p.I443K OPHN1 chrX 68063879 68063879 Silent G A A TCGA-B9-A44B-01A-11D-A25F-10 ENST00000355520 p.P711P SLC25A53 chrX 104104654 104104654 Missense_Mutation C C T TCGA-B9-A44B-01A-11D-A25F-10 ENST00000594199 p.G202S IRAK1 chrX 154011109 154011109 3'UTR G - - TCGA-B9-A44B-01A-11D-A25F-10 ENST00000369980 PLCH2 chr1 2504734 2504734 Missense_Mutation G G A TCGA-BQ-7051-01A-12D-1961-08 ENST00000378486 p.G1258S MFN2 chr1 12001491 12001492 Frame_Shift_Del TT TT - TCGA-BQ-7051-01A-12D-1961-08 ENST00000235329 p.F303Cfs*4 HSPG2 chr1 21887521 21887521 Missense_Mutation C C A TCGA-BQ-7051-01A-12D-1961-08 ENST00000374695 p.G286V MACF1 chr1 39332473 39332473 Missense_Mutation A A G TCGA-BQ-7051-01A-12D-1961-08 ENST00000372915 p.N1967S MYCL chr1 39897320 39897320 3'UTR A A - TCGA-BQ-7051-01A-12D-1961-08 ENST00000372816 HIVEP3 chr1 41582914 41582914 Silent A A T TCGA-BQ-7051-01A-12D-1961-08 ENST00000247584 p.L628L CYP4A11 chr1 46936680 46936680 Missense_Mutation G G C TCGA-BQ-7051-01A-12D-1961-08 ENST00000310638 p.S165C ZCCHC11 chr1 52436869 52436869 Silent G G T TCGA-BQ-7051-01A-12D-1961-08 ENST00000371544 p.R1349R TACSTD2 chr1 58576458 58576459 Frame_Shift_Del CT CT - TCGA-BQ-7051-01A-12D-1961-08 ENST00000371225 p.E233Vfs*143 MSTO1 chr1 155611230 155611230 Missense_Mutation C C G TCGA-BQ-7051-01A-12D-1961-08 ENST00000245564 p.T102S COPA chr1 160317626 160317626 Intron A A G TCGA-BQ-7051-01A-12D-1961-08 ENST00000241704 CEP350 chr1 180031400 180031400 Missense_Mutation A A C TCGA-BQ-7051-01A-12D-1961-08 ENST00000367607 p.K1211Q PTPN14 chr1 214383650 214383650 Silent G G A TCGA-BQ-7051-01A-12D-1961-08 ENST00000366956 p.A735A KMO chr1 241594302 241594302 3'UTR A A G TCGA-BQ-7051-01A-12D-1961-08 ENST00000366559 ZNF514 chr2 95150135 95150135 Missense_Mutation C C T TCGA-BQ-7051-01A-12D-1961-08 ENST00000295208 p.C117Y SULT1C4 chr2 108386325 108386325 Missense_Mutation T T C TCGA-BQ-7051-01A-12D-1961-08 ENST00000272452 p.I250T RANBP2 chr2 108753933 108753933 Missense_Mutation A A T TCGA-BQ-7051-01A-12D-1961-08 ENST00000283195 p.I722L RPRM chr2 153478485 153478485 Silent C C T TCGA-BQ-7051-01A-12D-1961-08 ENST00000325926 p.V27V MYO3B chr2 170519459 170519459 Missense_Mutation G G A TCGA-BQ-7051-01A-12D-1961-08 ENST00000408978 p.R1165H NFE2L2 chr2 177234075 177234075 Missense_Mutation C C A TCGA-BQ-7051-01A-12D-1961-08 ENST00000397062 p.G81V SLC22A13 chr3 38275938 38275938 Missense_Mutation T T C TCGA-BQ-7051-01A-12D-1961-08 ENST00000311856 p.L360P SACM1L chr3 45732140 45732140 Missense_Mutation A A T TCGA-BQ-7051-01A-12D-1961-08 ENST00000389061 p.Q363H SLC38A3 chr3 50215565 50215565 Missense_Mutation T T C TCGA-BQ-7051-01A-12D-1961-08 ENST00000614032 p.L132P PPM1M chr3 52248667 52248667 Silent C C T TCGA-BQ-7051-01A-12D-1961-08 ENST00000296487 p.L154L SLMAP chr3 57841362 57841362 Missense_Mutation T T C TCGA-BQ-7051-01A-12D-1961-08 ENST00000428312 p.L137P ADAMTS9 chr3 64551018 64551027 Frame_Shift_Del CACCACCTTG CACCACCTTG - TCGA-BQ-7051-01A-12D-1961-08 ENST00000498707 p.K1579Vfs*16 KIAA1524 chr3 108563171 108563171 Missense_Mutation C C A TCGA-BQ-7051-01A-12D-1961-08 ENST00000295746 p.R530I ZNF721 chr4 442230 442230 Missense_Mutation A A C TCGA-BQ-7051-01A-12D-1961-08 ENST00000338977 p.I734S POLN chr4 2159198 2159198 Missense_Mutation C C T TCGA-BQ-7051-01A-12D-1961-08 ENST00000382865 p.R523Q NSUN7 chr4 40776077 40776077 Missense_Mutation C C A TCGA-BQ-7051-01A-12D-1961-08 ENST00000381782 p.S285Y POLR2B chr4 56995392 56995392 Missense_Mutation C C A TCGA-BQ-7051-01A-12D-1961-08 ENST00000314595 p.L240M POLR2B chr4 57024888 57024888 Splice_Region A A G TCGA-BQ-7051-01A-12D-1961-08 ENST00000314595 p.V989V DHX29 chr5 55295523 55295523 Splice_Region A A G TCGA-BQ-7051-01A-12D-1961-08 ENST00000251636 p.D169D MAST4 chr5 67152766 67152766 Missense_Mutation T T C TCGA-BQ-7051-01A-12D-1961-08 ENST00000403625 p.I1142T CTNNA1 chr5 138932602 138932602 Missense_Mutation G G A TCGA-BQ-7051-01A-12D-1961-08 ENST00000302763 p.D775N ANKHD1-EIF4EBP3 chr5 140485239 140485239 Silent T T C TCGA-BQ-7051-01A-12D-1961-08 ENST00000532219 p.H663H TMCO6 chr5 140641927 140641927 Silent G G A TCGA-BQ-7051-01A-12D-1961-08 ENST00000394671 p.L124L HCP5 chr6 31463600 31463600 RNA G G T TCGA-BQ-7051-01A-12D-1961-08 ENST00000414046 C6orf47 chr6 31659648 31659648 Silent A A G TCGA-BQ-7051-01A-12D-1961-08 ENST00000375911 p.T100T PHF1 chr6 33412548 33412548 Missense_Mutation A A T TCGA-BQ-7051-01A-12D-1961-08 ENST00000374516 p.D67V GUCA1B chr6 42184871 42184871 Missense_Mutation C C A TCGA-BQ-7051-01A-12D-1961-08 ENST00000230361 p.D183Y SYNJ2 chr6 158028973 158028973 Silent C C T TCGA-BQ-7051-01A-12D-1961-08 ENST00000355585 p.V144V SOSTDC1 chr7 16465698 16465698 5'UTR G G A TCGA-BQ-7051-01A-12D-1961-08 ENST00000307068 DNAH11 chr7 21638972 21638972 Nonsense_Mutation C C A TCGA-BQ-7051-01A-12D-1961-08 ENST00000409508 p.Y1617* ARMC10 chr7 103083783 103083783 Missense_Mutation A A G TCGA-BQ-7051-01A-12D-1961-08 ENST00000323716 p.R116G KMT2C chr7 152183031 152183031 Frame_Shift_Del A A - TCGA-BQ-7051-01A-12D-1961-08 ENST00000262189 p.F1736Lfs*5 RP1 chr8 54622269 54622269 Silent A A G TCGA-BQ-7051-01A-12D-1961-08 ENST00000220676 p.A256A MATN2 chr8 97931378 97931381 Frame_Shift_Del CTAA CTAA - TCGA-BQ-7051-01A-12D-1961-08 ENST00000254898 p.L190Sfs*9 POP1 chr8 98140096 98140096 Nonsense_Mutation G G T TCGA-BQ-7051-01A-12D-1961-08 ENST00000349693 p.E461* SLC45A4 chr8 141228185 141228185 Intron G G A TCGA-BQ-7051-01A-12D-1961-08 ENST00000517878 PITRM1 chr10 3163837 3163837 Missense_Mutation G G A TCGA-BQ-7051-01A-12D-1961-08 ENST00000224949 p.P227S NCOA4 chr10 46009546 46009546 Silent T T A TCGA-BQ-7051-01A-12D-1961-08 ENST00000581486 p.V568V PTEN chr10 87957912 87957912 Missense_Mutation A A G TCGA-BQ-7051-01A-12D-1961-08 ENST00000371953 p.T232A SF3B2 chr11 66052358 66052358 5'UTR T T A TCGA-BQ-7051-01A-12D-1961-08 ENST00000322535 PAK1 chr11 77336239 77336239 Frame_Shift_Del T T - TCGA-BQ-7051-01A-12D-1961-08 ENST00000356341 p.K420Nfs*6 DDX10 chr11 108665094 108665094 5'UTR A A G TCGA-BQ-7051-01A-12D-1961-08 ENST00000322536 DIXDC1 chr11 111988974 111988974 Intron A G G TCGA-BQ-7051-01A-12D-1961-08 ENST00000440460 UBE4A chr11 118379513 118379513 Nonsense_Mutation C C T TCGA-BQ-7051-01A-12D-1961-08 ENST00000252108 p.Q547* NLRX1 chr11 119173628 119173628 Missense_Mutation C C T TCGA-BQ-7051-01A-12D-1961-08 ENST00000292199 p.P127S TRIM29 chr11 120118233 120118233 Silent G G A TCGA-BQ-7051-01A-12D-1961-08 ENST00000341846 p.F539F FKBP4 chr12 2799886 2799886 Silent A A G TCGA-BQ-7051-01A-12D-1961-08 ENST00000001008 p.Q236Q DPPA3 chr12 7715190 7715190 Silent T T A TCGA-BQ-7051-01A-12D-1961-08 ENST00000345088 p.S30S CNTN1 chr12 40929958 40929958 Missense_Mutation A A G TCGA-BQ-7051-01A-12D-1961-08 ENST00000347616 p.K220R ADAMTS20 chr12 43429675 43429675 Frame_Shift_Del A A - TCGA-BQ-7051-01A-12D-1961-08 ENST00000389420 p.L1144Yfs*7 CCNT1 chr12 48694126 48694126 Missense_Mutation G G T TCGA-BQ-7051-01A-12D-1961-08 ENST00000261900 p.S363Y KMT2D chr12 49041415 49041416 Frame_Shift_Ins - - G TCGA-BQ-7051-01A-12D-1961-08 ENST00000301067 p.A2119Rfs*36 KRT80 chr12 52185464 52185464 Missense_Mutation C C G TCGA-BQ-7051-01A-12D-1961-08 ENST00000394815 p.E142Q KRT7 chr12 52253617 52253617 3'Flank G G A TCGA-BQ-7051-01A-12D-1961-08 ENST00000331817 CAND1 chr12 67305564 67305564 Silent G G A TCGA-BQ-7051-01A-12D-1961-08 ENST00000545606 p.L632L DCLK1 chr13 36126085 36126085 Missense_Mutation G G A TCGA-BQ-7051-01A-12D-1961-08 ENST00000360631 p.A18V FREM2 chr13 38876269 38876269 Missense_Mutation T T G TCGA-BQ-7051-01A-12D-1961-08 ENST00000280481 p.Y2811D KBTBD6 chr13 41131474 41131476 In_Frame_Del CAC CAC - TCGA-BQ-7051-01A-12D-1961-08 ENST00000379485 p.V346del TEP1 chr14 20377322 20377322 Silent G G A TCGA-BQ-7051-01A-12D-1961-08 ENST00000262715 p.L2016L PNP chr14 20476449 20476449 Missense_Mutation C C T TCGA-BQ-7051-01A-12D-1961-08 ENST00000361505 p.L240F RNF31 chr14 24157341 24157341 Missense_Mutation C C T TCGA-BQ-7051-01A-12D-1961-08 ENST00000324103 p.R849C KIAA0391 chr14 35123458 35123458 Missense_Mutation T T G TCGA-BQ-7051-01A-12D-1961-08 ENST00000534898 p.D71E VTI1B chr14 67651424 67651424 Silent C C T TCGA-BQ-7051-01A-12D-1961-08 ENST00000554659 p.L220L COX5A chr15 74929120 74929120 Frame_Shift_Del A A - TCGA-BQ-7051-01A-12D-1961-08 ENST00000322347 p.I74* C15orf39 chr15 75208835 75208835 Intron G G A TCGA-BQ-7051-01A-12D-1961-08 ENST00000360639 SIN3A chr15 75372192 75372192 Silent G G A TCGA-BQ-7051-01A-12D-1961-08 ENST00000360439 p.S1203S TICRR chr15 89595514 89595514 Silent T T C TCGA-BQ-7051-01A-12D-1961-08 ENST00000268138 p.D601D PDXDC1 chr16 14989512 14989512 Intron C C T TCGA-BQ-7051-01A-12D-1961-08 ENST00000396410 SMG1P7 chr16 70233670 70233670 Splice_Region C C T TCGA-BQ-7051-01A-12D-1961-08 ENST00000565246 SLC46A1 chr17 28404841 28404841 Frame_Shift_Del C C - TCGA-BQ-7051-01A-12D-1961-08 ENST00000612814 p.D286Tfs*3 SPAG5 chr17 28584372 28584372 Missense_Mutation A A G TCGA-BQ-7051-01A-12D-1961-08 ENST00000321765 p.L757P TBC1D3L chr17 37978615 37978615 Missense_Mutation A A G TCGA-BQ-7051-01A-12D-1961-08 ENST00000612727 p.V502A COL1A1 chr17 50198469 50198469 Missense_Mutation C C G TCGA-BQ-7051-01A-12D-1961-08 ENST00000225964 p.E169D DYNLL2 chr17 58087096 58087096 Silent T T A TCGA-BQ-7051-01A-12D-1961-08 ENST00000579991 p.S2S HEXDC chr17 82424471 82424471 Silent T T C TCGA-BQ-7051-01A-12D-1961-08 ENST00000327949 p.P54P TIMM21 chr18 74149087 74149087 Silent C C G TCGA-BQ-7051-01A-12D-1961-08 ENST00000169551 p.T93T STXBP2 chr19 7647379 7647379 Missense_Mutation A A T TCGA-BQ-7051-01A-12D-1961-08 ENST00000221283 p.N522Y DOCK6 chr19 11201964 11201964 Missense_Mutation C C A TCGA-BQ-7051-01A-12D-1961-08 ENST00000294618 p.K1871N DOCK6 chr19 11202004 11202004 Missense_Mutation G G C TCGA-BQ-7051-01A-12D-1961-08 ENST00000294618 p.P1858R OR7A17 chr19 14881083 14881083 Silent G G A TCGA-BQ-7051-01A-12D-1961-08 ENST00000327462 p.V91V USHBP1 chr19 17251669 17251669 Missense_Mutation C C G TCGA-BQ-7051-01A-12D-1961-08 ENST00000252597 p.R612P CRTC1 chr19 18765435 18765435 Missense_Mutation C C G TCGA-BQ-7051-01A-12D-1961-08 ENST00000321949 p.H306Q ZNF253 chr19 19892482 19892482 Missense_Mutation C C T TCGA-BQ-7051-01A-12D-1961-08 ENST00000589717 p.S412F ZNF471 chr19 56525823 56525823 Missense_Mutation T T C TCGA-BQ-7051-01A-12D-1961-08 ENST00000308031 p.C586R PTPRT chr20 42472330 42472330 Silent G G A TCGA-BQ-7051-01A-12D-1961-08 ENST00000373187 p.L462L ZGPAT chr20 63735471 63735471 Missense_Mutation T T C TCGA-BQ-7051-01A-12D-1961-08 ENST00000328969 p.L455P SFI1 chr22 31606371 31606371 Missense_Mutation G G C TCGA-BQ-7051-01A-12D-1961-08 ENST00000400288 p.D700H C1QTNF6 chr22 37182211 37182211 Missense_Mutation G G C TCGA-BQ-7051-01A-12D-1961-08 ENST00000337843 p.L272V ARFGAP3 chr22 42817788 42817788 Silent A A G TCGA-BQ-7051-01A-12D-1961-08 ENST00000263245 p.I294I SYN1 chrX 47572909 47572909 Silent G C C TCGA-BQ-7051-01A-12D-1961-08 ENST00000295987 p.T691T RRAGB chrX 55718340 55718340 Missense_Mutation G A A TCGA-BQ-7051-01A-12D-1961-08 ENST00000262850 p.D5N HEPH chrX 66170663 66170663 Silent C T T TCGA-BQ-7051-01A-12D-1961-08 ENST00000343002 p.G31G ARHGAP36 chrX 131081844 131081844 Missense_Mutation G A A TCGA-BQ-7051-01A-12D-1961-08 ENST00000276211 p.R60H PLA2G2D chr1 20114226 20114226 Missense_Mutation C C T TCGA-A4-7287-01A-11D-2136-08 ENST00000375105 p.C109Y AGL chr1 99862421 99862421 Nonsense_Mutation C C G TCGA-A4-7287-01A-11D-2136-08 ENST00000294724 p.S153* NTRK1 chr1 156873769 156873769 Silent C C T TCGA-A4-7287-01A-11D-2136-08 ENST00000524377 p.F329F GORAB chr1 170532183 170532183 Missense_Mutation C C T TCGA-A4-7287-01A-11D-2136-08 ENST00000367763 p.A12V RGS21 chr1 192352116 192352116 Missense_Mutation C C A TCGA-A4-7287-01A-11D-2136-08 ENST00000417209 p.A53D CDC73 chr1 193130208 193130208 Missense_Mutation G G A TCGA-A4-7287-01A-11D-2136-08 ENST00000367435 p.R91Q SNRPE chr1 203863706 203863706 Missense_Mutation G G A TCGA-A4-7287-01A-11D-2136-08 ENST00000414487 p.R42Q SNRPE chr1 203863707 203863707 Silent G G A TCGA-A4-7287-01A-11D-2136-08 ENST00000414487 p.R42R LBR chr1 225411382 225411382 Missense_Mutation A A T TCGA-A4-7287-01A-11D-2136-08 ENST00000272163 p.F381L HYAL1 chr3 50302933 50302933 Missense_Mutation G G C TCGA-A4-7287-01A-11D-2136-08 ENST00000266031 p.I8M SERPINI2 chr3 167452976 167452976 Silent G G A TCGA-A4-7287-01A-11D-2136-08 ENST00000264677 p.T308T DCK chr4 71026684 71026684 Missense_Mutation C C A TCGA-A4-7287-01A-11D-2136-08 ENST00000286648 p.Q229K FAT4 chr4 125450419 125450419 Missense_Mutation G G A TCGA-A4-7287-01A-11D-2136-08 ENST00000394329 p.G3135S HIST1H4C chr6 26103977 26103977 Silent C C G TCGA-A4-7287-01A-11D-2136-08 ENST00000377803 p.G10G ZKSCAN8 chr6 28148414 28148414 Missense_Mutation G G A TCGA-A4-7287-01A-11D-2136-08 ENST00000330236 p.E3K CRISP3 chr6 49728762 49728762 Missense_Mutation C C T TCGA-A4-7287-01A-11D-2136-08 ENST00000433368 p.A259T COL9A1 chr6 70280858 70280858 Missense_Mutation G G A TCGA-A4-7287-01A-11D-2136-08 ENST00000357250 p.P310L IMPG1 chr6 75950748 75950748 Missense_Mutation G G C TCGA-A4-7287-01A-11D-2136-08 ENST00000369950 p.F546L IMPG1 chr6 75950919 75950919 Silent G G A TCGA-A4-7287-01A-11D-2136-08 ENST00000369950 p.I489I LAMA4 chr6 112133481 112133481 Silent G G C TCGA-A4-7287-01A-11D-2136-08 ENST00000230538 p.L1188L MSRA chr8 10054552 10054552 Silent C C T TCGA-A4-7287-01A-11D-2136-08 ENST00000317173 p.L12L MSRA chr8 10054593 10054593 Missense_Mutation C C T TCGA-A4-7287-01A-11D-2136-08 ENST00000317173 p.S26L RAB11FIP1 chr8 37873070 37873071 Frame_Shift_Ins - - G TCGA-A4-7287-01A-11D-2136-08 ENST00000330843 p.S578Lfs*2 RP11-395E19.2 chr9 66976724 66976724 5'Flank C C G TCGA-A4-7287-01A-11D-2136-08 ENST00000616253 ZNF189 chr9 101407952 101407952 Missense_Mutation G G C TCGA-A4-7287-01A-11D-2136-08 ENST00000339664 p.E62Q TSC1 chr9 132921435 132921439 Splice_Site GGCTA GGCTA - TCGA-A4-7287-01A-11D-2136-08 ENST00000298552 p.X222_splice PHPT1 chr9 136850892 136850893 3'UTR - - C TCGA-A4-7287-01A-11D-2136-08 ENST00000247665 OR10Q1 chr11 58228753 58228753 Missense_Mutation C C T TCGA-A4-7287-01A-11D-2136-08 ENST00000316770 p.M41I ZNF385A chr12 54370936 54370936 Silent T T C TCGA-A4-7287-01A-11D-2136-08 ENST00000338010 p.Q275Q C12orf74 chr12 92706915 92706915 Missense_Mutation C C G TCGA-A4-7287-01A-11D-2136-08 ENST00000397833 p.S95C SMAD9 chr13 36879714 36879714 5'UTR C C T TCGA-A4-7287-01A-11D-2136-08 ENST00000379826 COASY chr17 42565226 42565226 Splice_Site G G T TCGA-A4-7287-01A-11D-2136-08 ENST00000393818 p.X435_splice AOC2 chr17 42845470 42845470 Missense_Mutation G G C TCGA-A4-7287-01A-11D-2136-08 ENST00000253799 p.V282L TYMS chr18 662242 662242 Missense_Mutation A A G TCGA-A4-7287-01A-11D-2136-08 ENST00000323274 p.R126G FBXW9 chr19 12689802 12689802 Missense_Mutation G G A TCGA-A4-7287-01A-11D-2136-08 ENST00000393261 p.H369Y ZNF90 chr19 20078092 20078092 5'UTR A A T TCGA-A4-7287-01A-11D-2136-08 ENST00000418063 LYPD3 chr19 43463142 43463148 Frame_Shift_Del GTTGCCG GTTGCCG - TCGA-A4-7287-01A-11D-2136-08 ENST00000244333 p.D174Efs*4 SIRPG chr20 1635334 1635334 Silent C C A TCGA-A4-7287-01A-11D-2136-08 ENST00000303415 p.A338A HELZ2 chr20 63572129 63572129 Missense_Mutation G G A TCGA-A4-7287-01A-11D-2136-08 ENST00000467148 p.S86F CXADR chr21 17565745 17565745 3'UTR T T C TCGA-A4-7287-01A-11D-2136-08 ENST00000284878 FTCD chr21 46151597 46151597 Silent G G T TCGA-A4-7287-01A-11D-2136-08 ENST00000291670 p.I199I DGCR2 chr22 19041100 19041100 Missense_Mutation C C T TCGA-A4-7287-01A-11D-2136-08 ENST00000263196 p.E452K MSN chrX 65716896 65716896 Missense_Mutation G G C TCGA-A4-7287-01A-11D-2136-08 ENST00000360270 p.D31H OGT chrX 71562881 71562881 Missense_Mutation C C T TCGA-A4-7287-01A-11D-2136-08 ENST00000373719 p.A671V ATP7A chrX 77962685 77962685 Intron A A T TCGA-A4-7287-01A-11D-2136-08 ENST00000341514 STAG2 chrX 124063984 124063984 Nonsense_Mutation C C A TCGA-A4-7287-01A-11D-2136-08 ENST00000371144 p.S653* CDC14A chr1 100390733 100390733 Missense_Mutation C T T TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000336454 p.S73L CENPF chr1 214646222 214646222 Frame_Shift_Del C - - TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000366955 p.Q2218Kfs*12 AHCTF1 chr1 246916299 246916299 Missense_Mutation A A C TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000326225 p.V82G MAP3K19 chr2 134991574 134991574 Nonsense_Mutation G G T TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000375845 p.S194* TTN chr2 178641267 178641272 In_Frame_Del TTTTTA TTTTTA - TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000591111 p.K11894_K11895del SLC7A14 chr3 170526909 170526909 Missense_Mutation G G T TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000231706 p.P10T NPR3 chr5 32711566 32711567 5'UTR - - TTTTTCT TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000265074 EPB41L4A chr5 112266327 112266327 Nonsense_Mutation A A T TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000261486 p.Y113* TRIM36 chr5 115126780 115126780 Missense_Mutation G G C TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000282369 p.T637S FOXC1 chr6 1611680 1611681 Frame_Shift_Ins - G G TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000380874 p.Q413Afs*115 RFX6 chr6 116916086 116916086 Splice_Site G A A TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000332958 p.X286_splice PON2 chr7 95405138 95405138 3'UTR T T C TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000222572 ACO1 chr9 32425908 32425909 In_Frame_Ins - - TGAGTTCACCCTTGCTCA TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000309951 p.E421_H426dup SEC16A chr9 136448385 136448386 Intron - - A TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000313050 GPR158 chr10 25175466 25175466 Nonsense_Mutation C C T TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000376351 p.Q16* MUC5B chr11 1245399 1245399 Missense_Mutation C C T TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000529681 p.T2840M ARHGEF25 chr12 57613126 57613126 Silent T T A TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000286494 p.G98G CHFR chr12 132851657 132851657 Missense_Mutation C C G TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000432561 p.A497P SUSD6 chr14 69704715 69704715 Missense_Mutation C G G TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000342745 p.P144R SNRPA1 chr15 101286975 101286975 Missense_Mutation T T C TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000254193 p.Y131C CCDC64B chr16 3029565 3029565 Missense_Mutation C C T TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000389347 p.D313N FBXL19 chr16 30942230 30942230 Missense_Mutation G G T TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000380310 p.W492C PER1 chr17 8141900 8141900 Nonsense_Mutation G G A TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000317276 p.Q1169* HS3ST3A1 chr17 13496377 13496377 Silent C C T TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000284110 p.K347K MYO18A chr17 29120656 29120656 Missense_Mutation T T A TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000527372 p.D563V MAFG chr17 81922461 81922461 3'UTR G G A TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000357736 GNAL chr18 11884431 11884431 3'Flank A A G TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000269162 ZNF418 chr19 57927848 57927848 Missense_Mutation C C A TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000396147 p.R111S FTCD chr21 46145852 46145852 Missense_Mutation C C G TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000291670 p.G355A PORCN chrX 48512239 48512239 Intron T G G TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000326194 DOCK11 chrX 118683204 118683204 Missense_Mutation T G G TCGA-UN-AAZ9-01A-11D-A382-10 ENST00000276202 p.I2030S EXTL1 chr1 26031516 26031516 Frame_Shift_Del C C - TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000374280 p.P432Lfs*2 AKR1A1 chr1 45569201 45569201 Missense_Mutation A A G TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000351829 p.N295S GDAP2 chr1 117877982 117877992 Intron TGAGGGAGAAC TGAGGGAGAAC - TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000369443 SETDB1 chr1 150942689 150942692 Splice_Site GTAT GTAT - TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000271640 p.X225_splice SUCO chr1 172573894 172573894 Missense_Mutation T T A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000263688 p.F351L USH2A chr1 216321897 216321897 Missense_Mutation T T A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000307340 p.T544S RAB3GAP2 chr1 220267201 220267201 Intron T T A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000358951 NUP133 chr1 229495913 229495913 Missense_Mutation T T A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000261396 p.E318D NUP133 chr1 229495915 229495915 Frame_Shift_Del C C - TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000261396 p.E318Kfs*28 PREPL chr2 44322738 44322738 Silent T T C TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000260648 p.T671T PAPOLG chr2 60756358 60756358 5'UTR G G C TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000238714 RPIA chr2 88691673 88691673 5'UTR A A C TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000283646 RPIA chr2 88691674 88691674 5'UTR G G C TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000283646 GPD2 chr2 156550658 156550658 Missense_Mutation G G A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000310454 p.D295N ABCB6 chr2 219216395 219216395 Missense_Mutation C C G TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000265316 p.K313N ALPPL2 chr2 232409936 232409936 3'UTR G G A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000295453 RAB17 chr2 237574650 237574650 3'UTR A A C TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000264601 KIF1A chr2 240750547 240750547 Splice_Region C C T TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000320389 p.R852R CXCR6 chr3 45948095 45948095 3'UTR A A G TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000304552 RBM6 chr3 50066244 50066244 Splice_Region T T G TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000266022 p.P895P MYNN chr3 169778972 169778973 Frame_Shift_Ins - - G TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000349841 p.V158Gfs*11 HERC6 chr4 88440172 88440172 Missense_Mutation C C A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000264346 p.Q922K CMYA5 chr5 79729453 79729453 Missense_Mutation A A C TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000446378 p.K230Q ADGRV1 chr5 90777946 90777946 Missense_Mutation T T G TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000405460 p.F4190C RFESD chr5 95652228 95652228 5'UTR A A G TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000311364 BMP6 chr6 7880440 7880440 3'UTR G G A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000283147 PSMB8 chr6 32844013 32844013 5'UTR G G C TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000374882 RPL10A chr6 35470193 35470193 Missense_Mutation G G A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000322203 p.A109T ZNF318 chr6 43337570 43337570 Missense_Mutation G G A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000361428 p.S2143F CDC5L chr6 44424474 44424474 Missense_Mutation A A G TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000371477 p.K487R CD109 chr6 73810118 73810118 Missense_Mutation A A G TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000287097 p.I1164V TMEM200A chr6 130441908 130441908 3'UTR A A - TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000296978 SYNJ2 chr6 158083503 158083503 Silent G G A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000355585 p.R980R FAM20C chr7 208977 208977 Splice_Site G G A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000313766 p.X288_splice NXPH1 chr7 8751281 8751281 Missense_Mutation G G T TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000405863 p.V110F CHCHD2 chr7 56101676 56101676 3'UTR T T A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000395422 SLC4A2 chr7 151074765 151074765 Missense_Mutation G G A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000413384 p.V991M PTK2 chr8 140659657 140659657 Silent A A G TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000521059 p.L990L COL15A1 chr9 99036380 99036380 Missense_Mutation T T C TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000375001 p.I798T GAPVD1 chr9 125354659 125354660 Frame_Shift_Ins - - A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000394104 p.A1211Sfs*49 GAPVD1 chr9 125354661 125354661 Missense_Mutation G G A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000394104 p.A1211T LAMC3 chr9 131009402 131009402 Missense_Mutation C C A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000361069 p.P63H TRDMT1 chr10 17160342 17160342 Missense_Mutation C C A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000377799 p.G141V PTEN chr10 87864517 87864517 Frame_Shift_Del T T - TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000371953 p.Q17Kfs*7 OR51D1 chr11 4639920 4639920 Missense_Mutation C C A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000357605 p.L44M OR52E2 chr11 5059378 5059378 Missense_Mutation G G A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000321522 p.L84F OR52E2 chr11 5059379 5059379 Missense_Mutation C C T TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000321522 p.M83I NUP160 chr11 47840282 47840282 Intron A A T TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000378460 GRM5 chr11 88567330 88567330 Missense_Mutation A A T TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000305447 p.W785R MAML2 chr11 96093150 96093150 Missense_Mutation C C G TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000524717 p.G294A MAML2 chr11 96093151 96093151 Nonsense_Mutation C C A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000524717 p.G294* FKBP4 chr12 2795087 2795087 5'UTR A A G TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000001008 CD163 chr12 7486507 7486507 Missense_Mutation A A G TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000359156 p.I817T ITGA5 chr12 54408197 54408197 Missense_Mutation A A T TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000293379 p.S244T BAZ2A chr12 56598760 56598760 Missense_Mutation G G A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000551812 p.A1859V PAH chr12 102917206 102917206 5'UTR C C T TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000553106 HECTD4 chr12 112185079 112185081 In_Frame_Del GAG GAG - TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000550722 p.S3164del ATP6V0A2 chr12 123752340 123752340 Nonsense_Mutation C C T TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000330342 p.Q705* SAP18 chr13 21140912 21140912 Silent C C T TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000607003 p.F33F SERTM1 chr13 36697094 36697094 3'UTR C C T TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000315190 HECTD1 chr14 31168457 31168457 Missense_Mutation G G A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000399332 p.P488L NAA30 chr14 57391275 57391275 Silent G G C TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000556492 p.L106L ZFYVE1 chr14 72975591 72975591 Missense_Mutation T T C TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000556143 p.Q589R DIO2 chr14 80202896 80202896 Silent C C T TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000438257 p.P205P KIF26A chr14 104175083 104175083 Frame_Shift_Del C C - TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000423312 p.D767Tfs*55 C15orf62 chr15 40770936 40770936 Silent C C T TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000344320 p.L147L SSTR5 chr16 1079708 1079708 Silent C C T TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000293897 p.P280P TSC2 chr16 2084693 2084693 Missense_Mutation A A G TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000219476 p.K1491E GRIN2A chr16 9938030 9938030 Silent G G A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000330684 p.Y312Y RRN3P3 chr16 22429813 22429813 RNA A A C TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000551766 CLEC18C chr16 70177412 70177412 Nonsense_Mutation G G T TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000314151 p.E130* KARS chr16 75628653 75628653 Silent C C T TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000302445 p.L537L RAP1GAP2 chr17 2984987 2984987 Missense_Mutation C C A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000254695 p.S245Y FBF1 chr17 75920388 75920388 Missense_Mutation G G C TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000586717 p.S558R TNRC6C chr17 78091440 78091440 Missense_Mutation C C G TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000301624 p.A1268G USP36 chr17 78806190 78806190 Missense_Mutation C C T TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000542802 p.V728I PTPRM chr18 7774147 7774147 Splice_Site A A C TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000332175 p.X25_splice DSEL chr18 67512326 67512326 Silent A A G TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000310045 p.H771H CNDP2 chr18 74518993 74518993 Missense_Mutation C C T TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000324262 p.P419S FKBP8 chr19 18538422 18538422 Missense_Mutation A A G TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000222308 p.I188T ZNF285 chr19 44387902 44387902 Frame_Shift_Del A A - TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000614994 p.S115Lfs*11 LMTK3 chr19 48497688 48497688 Silent G G A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000600059 p.P1127P LENG8 chr19 54458761 54458761 Intron C C T TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000326764 ZNF579 chr19 55577992 55577992 Missense_Mutation T T G TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000325421 p.S550R OXT chr20 3072243 3072243 Missense_Mutation G G A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000217386 p.G96D HELZ2 chr20 63568632 63568632 Missense_Mutation C C T TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000467148 p.D486N PCNT chr21 46411414 46411414 Frame_Shift_Del G G - TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000359568 p.G1782Afs*21 PRR34 chr22 46053820 46053820 Missense_Mutation G G A TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000396008 p.R92W PHKA2 chrX 18984058 18984058 5'UTR G G C TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000379942 SLC9A7 chrX 46682338 46682338 Missense_Mutation T T C TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000328306 p.K175E IQSEC2 chrX 53320991 53320991 Missense_Mutation C C T TCGA-Y8-A897-01A-11D-A35Z-10 ENST00000396435 p.E45K FOXE3 chr1 47416743 47416743 Missense_Mutation A A C TCGA-DW-7842-01A-11D-2136-08 ENST00000335071 p.N143T PEA15 chr1 160211613 160211613 Silent C C A TCGA-DW-7842-01A-11D-2136-08 ENST00000360472 p.L23L PROM2 chr2 95275490 95275490 Missense_Mutation G G A TCGA-DW-7842-01A-11D-2136-08 ENST00000317620 p.A92T ATG16L1 chr2 233264913 233264913 Silent T T C TCGA-DW-7842-01A-11D-2136-08 ENST00000392017 p.T137T EI24P4 chr7 145006010 145006010 RNA C C G TCGA-DW-7842-01A-11D-2136-08 ENST00000423683 GALNT11 chr7 152108194 152108194 Missense_Mutation T T C TCGA-DW-7842-01A-11D-2136-08 ENST00000430044 p.V290A MYOM2 chr8 2115988 2115988 Missense_Mutation C C T TCGA-DW-7842-01A-11D-2136-08 ENST00000262113 p.T1070I BAG1 chr9 33255092 33255092 3'UTR A A G TCGA-DW-7842-01A-11D-2136-08 ENST00000472232 CCDC180 chr9 97354957 97354957 Missense_Mutation A A G TCGA-DW-7842-01A-11D-2136-08 ENST00000529487 p.I1115M GNG10 chr9 111666814 111666814 Splice_Site G G A TCGA-DW-7842-01A-11D-2136-08 ENST00000374293 p.X28_splice VIM chr10 17234733 17234733 Missense_Mutation C C G TCGA-DW-7842-01A-11D-2136-08 ENST00000224237 p.A308G ARHGAP21 chr10 24596774 24596775 Frame_Shift_Ins - - G TCGA-DW-7842-01A-11D-2136-08 ENST00000396432 p.R1148Pfs*4 C11orf49 chr11 47052518 47052518 Missense_Mutation G G T TCGA-DW-7842-01A-11D-2136-08 ENST00000278460 p.D94Y ARHGEF17 chr11 73309425 73309425 Missense_Mutation G G A TCGA-DW-7842-01A-11D-2136-08 ENST00000263674 p.G263R MED17 chr11 93809777 93809777 Missense_Mutation C C A TCGA-DW-7842-01A-11D-2136-08 ENST00000251871 p.L549M VPS26B chr11 134245554 134245554 Silent C C T TCGA-DW-7842-01A-11D-2136-08 ENST00000281187 p.T325T RPAP3 chr12 47686865 47686865 Missense_Mutation C C T TCGA-DW-7842-01A-11D-2136-08 ENST00000005386 p.E303K PTGDR chr14 52268175 52268175 Missense_Mutation C C A TCGA-DW-7842-01A-11D-2136-08 ENST00000306051 p.L121M PTGDR chr14 52268176 52268176 Missense_Mutation T T G TCGA-DW-7842-01A-11D-2136-08 ENST00000306051 p.L121R PLA2G4F chr15 42150386 42150386 Missense_Mutation A A G TCGA-DW-7842-01A-11D-2136-08 ENST00000397272 p.V291A SNORD3B-2 chr17 19063923 19063923 RNA A A G TCGA-DW-7842-01A-11D-2136-08 ENST00000571722 APCDD1 chr18 10487953 10487953 Missense_Mutation G G A TCGA-DW-7842-01A-11D-2136-08 ENST00000355285 p.R487Q DSG4 chr18 31400964 31400964 Missense_Mutation A A T TCGA-DW-7842-01A-11D-2136-08 ENST00000308128 p.K454M WDR18 chr19 992048 992048 Missense_Mutation A A G TCGA-DW-7842-01A-11D-2136-08 ENST00000585809 p.H342R FXYD3 chr19 35123524 35123524 3'UTR A A T TCGA-DW-7842-01A-11D-2136-08 ENST00000603181 NLRP5 chr19 55999754 55999754 Missense_Mutation G G A TCGA-DW-7842-01A-11D-2136-08 ENST00000390649 p.G10E DDI2 chr1 15630344 15630344 Silent C C T TCGA-IZ-8196-01A-11D-2396-08 ENST00000480945 p.F96F MSH4 chr1 75803817 75803817 Missense_Mutation G G A TCGA-IZ-8196-01A-11D-2396-08 ENST00000263187 p.D111N LRRC8C chr1 89714669 89714669 Missense_Mutation C C A TCGA-IZ-8196-01A-11D-2396-08 ENST00000370454 p.P700H RBM15 chr1 110340356 110340356 Silent T T C TCGA-IZ-8196-01A-11D-2396-08 ENST00000369784 p.P317P ANKRD35 chr1 145873393 145873393 Missense_Mutation T T C TCGA-IZ-8196-01A-11D-2396-08 ENST00000355594 p.Q459R MAEL chr1 167005324 167005324 Missense_Mutation C C A TCGA-IZ-8196-01A-11D-2396-08 ENST00000367872 p.L258I CNTN2 chr1 205059614 205059614 Silent C C A TCGA-IZ-8196-01A-11D-2396-08 ENST00000331830 p.A243A AHCTF1 chr1 246907693 246907693 Missense_Mutation C C T TCGA-IZ-8196-01A-11D-2396-08 ENST00000326225 p.G217R OR2L8 chr1 247949171 247949171 Missense_Mutation C C T TCGA-IZ-8196-01A-11D-2396-08 ENST00000357191 p.A105V MBOAT2 chr2 8862661 8862661 Frame_Shift_Del A A - TCGA-IZ-8196-01A-11D-2396-08 ENST00000305997 p.W372Gfs*10 KIF3C chr2 25955548 25955548 Missense_Mutation A A C TCGA-IZ-8196-01A-11D-2396-08 ENST00000264712 p.L588R RBKS chr2 27781638 27781639 Frame_Shift_Ins - - T TCGA-IZ-8196-01A-11D-2396-08 ENST00000302188 p.D316Rfs*31 PLEKHH2 chr2 43726332 43726332 Missense_Mutation G G T TCGA-IZ-8196-01A-11D-2396-08 ENST00000282406 p.D868Y DNAH6 chr2 84549985 84549985 Silent A A T TCGA-IZ-8196-01A-11D-2396-08 ENST00000237449 p.L471L MCM6 chr2 135862631 135862631 Missense_Mutation C C A TCGA-IZ-8196-01A-11D-2396-08 ENST00000264156 p.S399I MCM6 chr2 135862632 135862632 Missense_Mutation T T G TCGA-IZ-8196-01A-11D-2396-08 ENST00000264156 p.S399R HOXD8 chr2 176130597 176130613 Frame_Shift_Del GCCCTCCGGGACTGGGT GCCCTCCGGGACTGGGT - TCGA-IZ-8196-01A-11D-2396-08 ENST00000313173 p.P78Rfs*3 ATG9A chr2 219225567 219225567 Missense_Mutation A A C TCGA-IZ-8196-01A-11D-2396-08 ENST00000361242 p.F73C SPHKAP chr2 227995514 227995514 Silent G G C TCGA-IZ-8196-01A-11D-2396-08 ENST00000392056 p.S1543S CAMK1 chr3 9760761 9760761 Missense_Mutation C C T TCGA-IZ-8196-01A-11D-2396-08 ENST00000256460 p.G214S ARIH2OS chr3 48918658 48918658 Silent T T A TCGA-IZ-8196-01A-11D-2396-08 ENST00000408959 p.P164P ARHGEF3 chr3 56755037 56755037 Missense_Mutation T T A TCGA-IZ-8196-01A-11D-2396-08 ENST00000296315 p.T107S RNF13 chr3 149960788 149960788 Missense_Mutation C C G TCGA-IZ-8196-01A-11D-2396-08 ENST00000344229 p.T277S GABRA2 chr4 46310201 46310201 Silent A A T TCGA-IZ-8196-01A-11D-2396-08 ENST00000356504 p.A177A GALNTL6 chr4 172348608 172348608 Missense_Mutation C C T TCGA-IZ-8196-01A-11D-2396-08 ENST00000506823 p.R158W SLC9A3 chr5 476025 476025 Missense_Mutation T T A TCGA-IZ-8196-01A-11D-2396-08 ENST00000264938 p.E712V ADAMTS16 chr5 5235042 5235042 Missense_Mutation G G C TCGA-IZ-8196-01A-11D-2396-08 ENST00000274181 p.G627R DROSHA chr5 31526676 31526676 Missense_Mutation G G T TCGA-IZ-8196-01A-11D-2396-08 ENST00000344624 p.P86H IL7R chr5 35876043 35876043 Missense_Mutation G G T TCGA-IZ-8196-01A-11D-2396-08 ENST00000303115 p.D313Y PPIC chr5 123024001 123024001 Splice_Region T T A TCGA-IZ-8196-01A-11D-2396-08 ENST00000306442 p.T171T PCDHA8 chr5 140843616 140843616 Silent G A A TCGA-IZ-8196-01A-11D-2396-08 ENST00000531613 p.P765P PCDHGA12 chr5 141432238 141432238 Silent G G A TCGA-IZ-8196-01A-11D-2396-08 ENST00000252085 p.E493E LARP1 chr5 154803618 154803618 Missense_Mutation T T A TCGA-IZ-8196-01A-11D-2396-08 ENST00000336314 p.V694D PANK3 chr5 168568651 168568651 Missense_Mutation G G A TCGA-IZ-8196-01A-11D-2396-08 ENST00000239231 p.R126C TNF chr6 31577270 31577272 In_Frame_Del CCC CCC - TCGA-IZ-8196-01A-11D-2396-08 ENST00000449264 p.P146del HLA-DMA chr6 32948747 32948747 3'UTR C C T TCGA-IZ-8196-01A-11D-2396-08 ENST00000374843 DAXX chr6 33320044 33320045 Frame_Shift_Ins - - A TCGA-IZ-8196-01A-11D-2396-08 ENST00000266000 p.E478* DAAM2 chr6 39902086 39902087 3'UTR - - T TCGA-IZ-8196-01A-11D-2396-08 ENST00000274867 MDN1 chr6 89716734 89716734 Missense_Mutation C C T TCGA-IZ-8196-01A-11D-2396-08 ENST00000369393 p.G2220D SIM1 chr6 100447311 100447311 Missense_Mutation A A T TCGA-IZ-8196-01A-11D-2396-08 ENST00000262901 p.S319T REV3L chr6 111374285 111374285 Frame_Shift_Del T T - TCGA-IZ-8196-01A-11D-2396-08 ENST00000358835 p.N1357Ifs*12 NCOA7 chr6 125919323 125919323 Intron A A G TCGA-IZ-8196-01A-11D-2396-08 ENST00000368357 AHR chr7 17322553 17322553 Missense_Mutation A A T TCGA-IZ-8196-01A-11D-2396-08 ENST00000242057 p.R102S PDE1C chr7 31837893 31837893 Silent C C T TCGA-IZ-8196-01A-11D-2396-08 ENST00000321453 p.K353K PSMA2 chr7 42917532 42917532 3'UTR G G T TCGA-IZ-8196-01A-11D-2396-08 ENST00000223321 PCLO chr7 82949751 82949751 Missense_Mutation C C A TCGA-IZ-8196-01A-11D-2396-08 ENST00000333891 p.A3613S MET chr7 116782063 116782063 Missense_Mutation T T A TCGA-IZ-8196-01A-11D-2396-08 ENST00000397752 p.F1200I CTTNBP2 chr7 117791336 117791337 Frame_Shift_Ins - - C TCGA-IZ-8196-01A-11D-2396-08 ENST00000160373 p.V621Cfs*52 CTTNBP2 chr7 117791337 117791337 Missense_Mutation G G T TCGA-IZ-8196-01A-11D-2396-08 ENST00000160373 p.T620N CHRNB3 chr8 42710410 42710410 Missense_Mutation G G A TCGA-IZ-8196-01A-11D-2396-08 ENST00000289957 p.M75I RBM12B chr8 93735256 93735256 Silent A A G TCGA-IZ-8196-01A-11D-2396-08 ENST00000399300 p.H385H VPS13B chr8 99501835 99501835 Missense_Mutation C C T TCGA-IZ-8196-01A-11D-2396-08 ENST00000358544 p.P1340L FAM208B chr10 5746401 5746401 Missense_Mutation T T C TCGA-IZ-8196-01A-11D-2396-08 ENST00000328090 p.S994P C1QL3 chr10 16514596 16514596 Missense_Mutation C C T TCGA-IZ-8196-01A-11D-2396-08 ENST00000298943 p.G234R ITGB1 chr10 32912085 32912085 Frame_Shift_Del G G - TCGA-IZ-8196-01A-11D-2396-08 ENST00000302278 p.S503Rfs*64 RP11-445N18.7 chr10 45148773 45148773 RNA A A G TCGA-IZ-8196-01A-11D-2396-08 ENST00000427229 PIDD1 chr11 803185 803185 Missense_Mutation G G T TCGA-IZ-8196-01A-11D-2396-08 ENST00000347755 p.P233Q MUC2 chr11 1103275 1103275 Splice_Region T T G TCGA-IZ-8196-01A-11D-2396-08 ENST00000361558 TPP1 chr11 6616858 6616858 Frame_Shift_Del A A - TCGA-IZ-8196-01A-11D-2396-08 ENST00000299427 p.F230Sfs*28 API5 chr11 43320891 43320891 Missense_Mutation T T C TCGA-IZ-8196-01A-11D-2396-08 ENST00000531273 p.I101T HNRNPUL2 chr11 62721390 62721390 Missense_Mutation T T C TCGA-IZ-8196-01A-11D-2396-08 ENST00000301785 p.K506E PCF11 chr11 83166685 83166685 Silent A A G TCGA-IZ-8196-01A-11D-2396-08 ENST00000298281 p.R596R NCAM1 chr11 113207962 113207962 Missense_Mutation G G C TCGA-IZ-8196-01A-11D-2396-08 ENST00000316851 p.K292N C3AR1 chr12 8058982 8058982 Missense_Mutation G G A TCGA-IZ-8196-01A-11D-2396-08 ENST00000307637 p.L402F ESPL1 chr12 53293448 53293448 Missense_Mutation T T C TCGA-IZ-8196-01A-11D-2396-08 ENST00000257934 p.Y2113H DUSP6 chr12 89349325 89349330 In_Frame_Del CTGGAA CTGGAA - TCGA-IZ-8196-01A-11D-2396-08 ENST00000279488 p.V357_P358del ALDH2 chr12 111789890 111789890 Missense_Mutation T T C TCGA-IZ-8196-01A-11D-2396-08 ENST00000261733 p.Y170H HNF1A chr12 120999355 120999355 Missense_Mutation T T C TCGA-IZ-8196-01A-11D-2396-08 ENST00000257555 p.L530P BRCA2 chr13 32333216 32333216 Missense_Mutation A A C TCGA-IZ-8196-01A-11D-2396-08 ENST00000380152 p.I580L ESD chr13 46780016 46780016 Silent A A G TCGA-IZ-8196-01A-11D-2396-08 ENST00000378720 p.A173A OR11G2 chr14 20197875 20197875 Silent C C T TCGA-IZ-8196-01A-11D-2396-08 ENST00000357366 p.T180T C14orf37 chr14 58096965 58096965 Missense_Mutation C C G TCGA-IZ-8196-01A-11D-2396-08 ENST00000267485 p.E616D SYNE2 chr14 64129896 64129896 Missense_Mutation T T A TCGA-IZ-8196-01A-11D-2396-08 ENST00000344113 p.L4712I TTC8 chr14 88841094 88841094 Missense_Mutation T T A TCGA-IZ-8196-01A-11D-2396-08 ENST00000614125 p.S119R CDC42BPB chr14 102972031 102972031 Missense_Mutation T T A TCGA-IZ-8196-01A-11D-2396-08 ENST00000361246 p.K591M CEP170B chr14 104887275 104887275 Missense_Mutation T T G TCGA-IZ-8196-01A-11D-2396-08 ENST00000414716 p.H1012Q CATSPER2 chr15 43636214 43636214 Missense_Mutation A A G TCGA-IZ-8196-01A-11D-2396-08 ENST00000321596 p.L283P NEO1 chr15 73298372 73298372 Missense_Mutation C C T TCGA-IZ-8196-01A-11D-2396-08 ENST00000261908 p.T1309I IREB2 chr15 78463014 78463014 Missense_Mutation T T A TCGA-IZ-8196-01A-11D-2396-08 ENST00000258886 p.L67I ST8SIA2 chr15 92464377 92464377 Missense_Mutation G G A TCGA-IZ-8196-01A-11D-2396-08 ENST00000268164 p.A374T SEPHS2 chr16 30445394 30445394 Missense_Mutation A A G TCGA-IZ-8196-01A-11D-2396-08 ENST00000478753 p.F112L SRCAP chr16 30722182 30722182 Frame_Shift_Del C C - TCGA-IZ-8196-01A-11D-2396-08 ENST00000262518 p.A1201Efs*16 SRCAP chr16 30722184 30722184 Missense_Mutation G G A TCGA-IZ-8196-01A-11D-2396-08 ENST00000262518 p.G1202R CDH8 chr16 61817646 61817646 Silent C C T TCGA-IZ-8196-01A-11D-2396-08 ENST00000577390 p.G370G CDT1 chr16 88806029 88806029 Missense_Mutation G G A TCGA-IZ-8196-01A-11D-2396-08 ENST00000301019 p.G281R MAP2K4 chr17 12113318 12113318 Silent T T C TCGA-IZ-8196-01A-11D-2396-08 ENST00000353533 p.S257S NAGLU chr17 42543913 42543914 In_Frame_Ins - - TTTTTT TCGA-IZ-8196-01A-11D-2396-08 ENST00000225927 p.F637_Y638insFF NAGLU chr17 42543917 42543917 Silent C C T TCGA-IZ-8196-01A-11D-2396-08 ENST00000225927 p.F637F LSM12 chr17 44040221 44040221 Silent C C T TCGA-IZ-8196-01A-11D-2396-08 ENST00000293406 p.K98K AMH chr19 2249552 2249552 Missense_Mutation G G T TCGA-IZ-8196-01A-11D-2396-08 ENST00000221496 p.G74W JSRP1 chr19 2255344 2255344 Splice_Region G G A TCGA-IZ-8196-01A-11D-2396-08 ENST00000300961 ADGRE5 chr19 14408105 14408106 Frame_Shift_Ins - - A TCGA-IZ-8196-01A-11D-2396-08 ENST00000242786 p.E832Rfs*55 SNPH chr20 1305911 1305911 Missense_Mutation C C T TCGA-IZ-8196-01A-11D-2396-08 ENST00000381873 p.R448W DOPEY2 chr21 36253788 36253788 Missense_Mutation G G A TCGA-IZ-8196-01A-11D-2396-08 ENST00000399151 p.S1713N BRWD1 chr21 39269982 39269982 Missense_Mutation T T A TCGA-IZ-8196-01A-11D-2396-08 ENST00000333229 p.I483F PDE9A chr21 42731893 42731893 Missense_Mutation A A G TCGA-IZ-8196-01A-11D-2396-08 ENST00000291539 p.E129G SPECC1L chr22 24338446 24338446 Missense_Mutation C C T TCGA-IZ-8196-01A-11D-2396-08 ENST00000314328 p.T874I GGT1 chr22 24627971 24627971 Missense_Mutation T T C TCGA-IZ-8196-01A-11D-2396-08 ENST00000248923 p.I443T CHKB chr22 50580046 50580046 Silent A A C TCGA-IZ-8196-01A-11D-2396-08 ENST00000406938 p.V285V MTHFR chr1 11803194 11803194 Intron C C A TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000376590 ARID1A chr1 26779524 26779524 Frame_Shift_Del C C - TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000324856 p.P1876Qfs*7 TMEM125 chr1 43273365 43273365 Missense_Mutation A A G TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000432792 p.I215V C1orf185 chr1 51112521 51112521 Missense_Mutation G G C TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000371759 p.G25A RPL5 chr1 92832077 92832077 5'UTR C C G TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000370321 RPTN chr1 152154829 152154829 Missense_Mutation C C T TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000316073 p.R757Q NUP210L chr1 154135925 154135925 Missense_Mutation T T C TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000368559 p.R300G TMEM9 chr1 201153896 201153896 Missense_Mutation C C T TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000367330 p.V10I GPN1 chr2 27635140 27635140 Missense_Mutation G G A TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000610189 p.A144T ALMS1 chr2 73609580 73609580 Nonsense_Mutation C C T TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000613296 p.Q4159* IGKC chr2 88857353 88857353 3'UTR T T A TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000614656 ACVR2A chr2 147918584 147918584 Missense_Mutation A A G TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000241416 p.I318M SH3BP4 chr2 235041082 235041082 Missense_Mutation C C G TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000344528 p.P105A ITPR1 chr3 4818087 4818087 Missense_Mutation G G A TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000354582 p.E2625K THUMPD3 chr3 9365165 9365165 Missense_Mutation G G A TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000345094 p.E33K COL7A1 chr3 48572698 48572698 Frame_Shift_Del T T - TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000328333 p.E2291Dfs*97 IL17RD chr3 57110265 57110265 Frame_Shift_Del C C - TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000296318 p.K119Nfs*10 IGSF10 chr3 151437408 151437408 Missense_Mutation T T G TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000282466 p.S2385R UGT2B28 chr4 69280604 69280604 Missense_Mutation A A T TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000335568 p.H35L ENPEP chr4 110476773 110476773 Missense_Mutation G G A TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000265162 p.S120N CCT5 chr5 10263307 10263307 Silent G G A TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000280326 p.G497G ZNF366 chr5 72443882 72443882 Silent C C T TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000318442 p.R703R SLC12A2 chr5 128141840 128141840 Silent T T A TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000262461 p.V544V SLC26A2 chr5 149981726 149981726 Silent T T C TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000286298 p.S711S DNPH1 chr6 43226030 43226030 Splice_Region C C A TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000230431 HCRTR2 chr6 55248789 55248789 Missense_Mutation C C G TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000370862 p.S125C IGF2R chr6 160046562 160046562 Missense_Mutation G G C TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000356956 p.K656N ISPD chr7 16216146 16216146 Missense_Mutation G G C TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000407010 p.L391V HIP1 chr7 75554510 75554510 Silent C C T TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000336926 p.T660T CD36 chr7 80672797 80672797 Nonsense_Mutation A A T TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000309881 p.K385* SLC26A5 chr7 103421557 103421557 5'UTR C C G TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000306312 HIPK2 chr7 139620420 139620420 Missense_Mutation A A T TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000406875 p.L588Q PAXIP1 chr7 154975764 154975764 Missense_Mutation G G A TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000397192 p.R336W SGK223 chr8 8377790 8377790 Missense_Mutation A A G TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000622241 p.F207L PXDNL chr8 51447138 51447138 Missense_Mutation T T A TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000356297 p.Q464L RB1CC1 chr8 52642537 52642537 Missense_Mutation T T G TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000025008 p.K1384T UTP23 chr8 116770346 116770346 Missense_Mutation C C T TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000309822 p.H115Y TONSL chr8 144443205 144443205 Missense_Mutation C C G TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000409379 p.R127S NUTM2F chr9 94320297 94320297 Nonsense_Mutation G G A TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000253262 p.Q427* CCDC180 chr9 97366627 97366627 Silent C C T TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000529487 p.C1416C FAM21C chr10 45787188 45787196 In_Frame_Del GAGGCCGGT GAGGCCGGT - TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000374362 p.E989_G991del MYPN chr10 68199380 68199380 Missense_Mutation C C T TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000358913 p.P1100S TRIM8 chr10 102656336 102656336 Missense_Mutation C C A TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000302424 p.F333L GPR83 chr11 94380256 94380256 Missense_Mutation T T A TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000243673 p.N389Y PIWIL4 chr11 94607571 94607571 Missense_Mutation A A G TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000299001 p.I591V XPOT chr12 64433446 64433446 Missense_Mutation C C A TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000332707 p.F765L TBC1D15 chr12 71839708 71839708 5'Flank T T A TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000550746 UHRF1BP1L chr12 100059421 100059421 Missense_Mutation C C G TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000279907 p.R619P SCYL2 chr12 100313494 100313494 Missense_Mutation A A T TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000360820 p.N309Y KIAA1033 chr12 105126035 105126035 Missense_Mutation A A G TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000332180 p.N273S IFT81 chr12 110128091 110128091 Nonsense_Mutation C C T TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000242591 p.R64* OLFM4 chr13 53050692 53050692 Missense_Mutation C C A TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000219022 p.P485H C14orf105 chr14 57493578 57493578 Silent T T A TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000216445 p.S46S SERPINA6 chr14 94314247 94314247 Missense_Mutation A A T TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000341584 p.D134E NUSAP1 chr15 41377297 41377297 Nonsense_Mutation C C T TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000559596 p.Q409* SHF chr15 45198945 45198945 Missense_Mutation G G T TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000290894 p.H44N C15orf39 chr15 75207326 75207326 Silent C C T TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000360639 p.C426C CREBBP chr16 3851000 3851000 Missense_Mutation G G A TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000262367 p.S32L UBN1 chr16 4858003 4858003 Missense_Mutation C C T TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000262376 p.S88L DNAH3 chr16 21039938 21039938 Missense_Mutation C C A TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000261383 p.L1548F MBTPS1 chr16 84060701 84060701 Silent G G C TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000343411 p.V895V ZCCHC14 chr16 87411603 87411603 Missense_Mutation T T A TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000268616 p.S903C FXR2 chr17 7594001 7594001 Missense_Mutation T T G TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000250113 p.M342L MYH4 chr17 10463633 10463633 Missense_Mutation T G G TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000255381 p.E220A STAC2 chr17 39217169 39217169 Silent G G A TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000333461 p.N134N ZNF57 chr19 2915557 2915557 Silent C C T TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000306908 p.F13F C19orf80 chr19 11239712 11239712 Silent C C T TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000252453 p.G25G IL27RA chr19 14039609 14039609 Missense_Mutation G G A TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000263379 p.G107D MYO9B chr19 17212037 17212037 Silent G G A TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000594824 p.T2067T CYP2A6 chr19 40843858 40843858 Missense_Mutation G G T TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000301141 p.P475T ZNF221 chr19 43967043 43967043 Missense_Mutation G G C TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000587682 p.R514T SEPT5 chr22 19721907 19721907 Silent C C T TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000455784 p.C300C MTMR3 chr22 30020260 30020260 Silent C C T TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000401950 p.C867C POLA1 chrX 24732409 24732409 Missense_Mutation T A A TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000379059 p.L570M FAM155B chrX 69529053 69529053 Missense_Mutation C T T TCGA-HE-A5NJ-01A-11D-A26P-10 ENST00000252338 p.R308C CEP85 chr1 26276587 26276587 Missense_Mutation A A T TCGA-BQ-5885-01A-11D-1589-08 ENST00000252992 p.H652L OSCP1 chr1 36450322 36450322 Silent C C T TCGA-BQ-5885-01A-11D-1589-08 ENST00000356637 p.E16E LRRC41 chr1 46286218 46286218 Silent T T G TCGA-BQ-5885-01A-11D-1589-08 ENST00000343304 p.S213S CYB5RL chr1 54174722 54174722 Missense_Mutation C C T TCGA-BQ-5885-01A-11D-1589-08 ENST00000534324 p.R282K KIAA1324 chr1 109192774 109192774 Missense_Mutation G G T TCGA-BQ-5885-01A-11D-1589-08 ENST00000369939 p.G616V NCSTN chr1 160356705 160356705 Missense_Mutation C C T TCGA-BQ-5885-01A-11D-1589-08 ENST00000294785 p.T582I FMO4 chr1 171334682 171334682 Missense_Mutation A A G TCGA-BQ-5885-01A-11D-1589-08 ENST00000367749 p.I367V FMO4 chr1 171334683 171334683 Missense_Mutation T T C TCGA-BQ-5885-01A-11D-1589-08 ENST00000367749 p.I367T FAM129A chr1 184974327 184974327 Missense_Mutation G G T TCGA-BQ-5885-01A-11D-1589-08 ENST00000367511 p.D10E LRRN2 chr1 204617839 204617839 3'UTR A A G TCGA-BQ-5885-01A-11D-1589-08 ENST00000367175 HEATR1 chr1 236574795 236574795 Missense_Mutation C C T TCGA-BQ-5885-01A-11D-1589-08 ENST00000366582 p.G1065R HEATR1 chr1 236586436 236586436 Missense_Mutation T T C TCGA-BQ-5885-01A-11D-1589-08 ENST00000366582 p.I578V ITSN2 chr2 24203605 24203605 3'UTR T T C TCGA-BQ-5885-01A-11D-1589-08 ENST00000355123 CAD chr2 27217929 27217929 Nonsense_Mutation C C A TCGA-BQ-5885-01A-11D-1589-08 ENST00000264705 p.Y45* RTN4 chr2 55026377 55026377 Missense_Mutation T T A TCGA-BQ-5885-01A-11D-1589-08 ENST00000337526 p.E574D RTN4 chr2 55026378 55026378 Missense_Mutation T T G TCGA-BQ-5885-01A-11D-1589-08 ENST00000337526 p.E574A USP34 chr2 61278171 61278171 Frame_Shift_Del T T - TCGA-BQ-5885-01A-11D-1589-08 ENST00000398571 p.G1810Dfs*5 ALMS1 chr2 73453550 73453550 Silent T T C TCGA-BQ-5885-01A-11D-1589-08 ENST00000613296 p.N2341N SEMA4F chr2 74675622 74675622 Missense_Mutation G G A TCGA-BQ-5885-01A-11D-1589-08 ENST00000357877 p.M490I TBC1D8 chr2 101054235 101054235 Silent G A A TCGA-BQ-5885-01A-11D-1589-08 ENST00000376840 p.F153F TMEM177 chr2 119681778 119681778 Missense_Mutation G G A TCGA-BQ-5885-01A-11D-1589-08 ENST00000272521 p.G309S LRP1B chr2 141062064 141062064 Missense_Mutation A A T TCGA-BQ-5885-01A-11D-1589-08 ENST00000389484 p.I408N LRP2 chr2 169226570 169226570 Missense_Mutation A A G TCGA-BQ-5885-01A-11D-1589-08 ENST00000263816 p.I1749T EPHA4 chr2 221501153 221501153 Frame_Shift_Del G G - TCGA-BQ-5885-01A-11D-1589-08 ENST00000281821 p.Y281* CUL3 chr2 224557799 224557799 Nonsense_Mutation G G A TCGA-BQ-5885-01A-11D-1589-08 ENST00000264414 p.Q42* USP40 chr2 233540750 233540750 Missense_Mutation G G T TCGA-BQ-5885-01A-11D-1589-08 ENST00000251722 p.P360H TRPM8 chr2 233939140 233939140 Missense_Mutation T T A TCGA-BQ-5885-01A-11D-1589-08 ENST00000324695 p.I164N ATP2B2 chr3 10346058 10346058 Silent G G A TCGA-BQ-5885-01A-11D-1589-08 ENST00000352432 p.L828L ZNF502 chr3 44720892 44720892 Frame_Shift_Del G G - TCGA-BQ-5885-01A-11D-1589-08 ENST00000296091 p.K25Nfs*16 FYCO1 chr3 45968476 45968476 Silent C C T TCGA-BQ-5885-01A-11D-1589-08 ENST00000296137 p.E286E CCR5 chr3 46373659 46373659 Missense_Mutation A A T TCGA-BQ-5885-01A-11D-1589-08 ENST00000292303 p.I253F MST1 chr3 49688608 49688609 Frame_Shift_Ins - - AAGC TCGA-BQ-5885-01A-11D-1589-08 ENST00000449682 p.G29Lfs*12 MST1 chr3 49688615 49688615 Missense_Mutation T T A TCGA-BQ-5885-01A-11D-1589-08 ENST00000449682 p.Q26L QTRTD1 chr3 114079926 114079926 Missense_Mutation G G A TCGA-BQ-5885-01A-11D-1589-08 ENST00000281273 p.R256Q ZBBX chr3 167365926 167365926 Missense_Mutation T T G TCGA-BQ-5885-01A-11D-1589-08 ENST00000392766 p.Q78P TNFSF10 chr3 172506614 172506614 Missense_Mutation T T A TCGA-BQ-5885-01A-11D-1589-08 ENST00000241261 p.I242F OTOP1 chr4 4197279 4197279 Missense_Mutation T T C TCGA-BQ-5885-01A-11D-1589-08 ENST00000296358 p.S519G OTOP1 chr4 4197280 4197280 Silent C C T TCGA-BQ-5885-01A-11D-1589-08 ENST00000296358 p.E518E SDAD1 chr4 75956026 75956026 Silent C C T TCGA-BQ-5885-01A-11D-1589-08 ENST00000356260 p.R655R ANKRD50 chr4 124671632 124671632 Silent A A G TCGA-BQ-5885-01A-11D-1589-08 ENST00000504087 p.L549L PLK4 chr4 127883287 127883287 Missense_Mutation C C T TCGA-BQ-5885-01A-11D-1589-08 ENST00000270861 p.A51V LRBA chr4 150908368 150908368 Nonsense_Mutation G G A TCGA-BQ-5885-01A-11D-1589-08 ENST00000357115 p.Q487* FAT1 chr4 186619134 186619137 Frame_Shift_Del TCCA TCCA - TCGA-BQ-5885-01A-11D-1589-08 ENST00000441802 p.I2483Mfs*18 MARCH6 chr5 10401998 10401998 Intron A A - TCGA-BQ-5885-01A-11D-1589-08 ENST00000274140 GOLPH3 chr5 32126311 32126311 Missense_Mutation C C A TCGA-BQ-5885-01A-11D-1589-08 ENST00000265070 p.K266N GPBP1 chr5 57249505 57249505 Missense_Mutation T T G TCGA-BQ-5885-01A-11D-1589-08 ENST00000506184 p.F301V TRIM23 chr5 65609403 65609403 Missense_Mutation A A T TCGA-BQ-5885-01A-11D-1589-08 ENST00000231524 p.L295Q CD180 chr5 67182880 67182880 Silent T T G TCGA-BQ-5885-01A-11D-1589-08 ENST00000256447 p.R655R LNPEP chr5 96993112 96993112 Missense_Mutation T T A TCGA-BQ-5885-01A-11D-1589-08 ENST00000231368 p.I410N PCDHA9 chr5 140848953 140848953 Missense_Mutation C C A TCGA-BQ-5885-01A-11D-1589-08 ENST00000532602 p.P153Q PCDHGA9 chr5 141405153 141405153 Missense_Mutation G G C TCGA-BQ-5885-01A-11D-1589-08 ENST00000573521 p.G734A PCDHGC3 chr5 141477069 141477069 Missense_Mutation A A G TCGA-BQ-5885-01A-11D-1589-08 ENST00000308177 p.H318R DDX39B chr6 31539265 31539265 Missense_Mutation T T C TCGA-BQ-5885-01A-11D-1589-08 ENST00000396172 p.E74G DST chr6 56482861 56482861 Missense_Mutation A A G TCGA-BQ-5885-01A-11D-1589-08 ENST00000312431 p.L4818S AIM1 chr6 106544803 106544803 Missense_Mutation C C A TCGA-BQ-5885-01A-11D-1589-08 ENST00000369066 p.H1320N SLC35D3 chr6 136922558 136922558 Missense_Mutation G G C TCGA-BQ-5885-01A-11D-1589-08 ENST00000331858 p.V44L TAX1BP1 chr7 27816468 27816468 Silent T T C TCGA-BQ-5885-01A-11D-1589-08 ENST00000396319 p.N628N ZNF679 chr7 64260884 64260884 Missense_Mutation G G A TCGA-BQ-5885-01A-11D-1589-08 ENST00000255746 p.E73K DMTF1 chr7 87173647 87173650 Splice_Site AAGG AAGG - TCGA-BQ-5885-01A-11D-1589-08 ENST00000331242 p.X147_splice AKAP9 chr7 92002554 92002554 Silent A A G TCGA-BQ-5885-01A-11D-1589-08 ENST00000356239 p.E879E PEX1 chr7 92489913 92489913 Splice_Site T T C TCGA-BQ-5885-01A-11D-1589-08 ENST00000248633 p.X1147_splice LMTK2 chr7 98194408 98194408 Missense_Mutation G G C TCGA-BQ-5885-01A-11D-1589-08 ENST00000297293 p.E1315Q SND1 chr7 127997791 127997791 Intron C C A TCGA-BQ-5885-01A-11D-1589-08 ENST00000354725 SLC7A2 chr8 17544450 17544450 Splice_Site G G T TCGA-BQ-5885-01A-11D-1589-08 ENST00000494857 p.X126_splice ADAMDEC1 chr8 24398539 24398539 Frame_Shift_Del C C - TCGA-BQ-5885-01A-11D-1589-08 ENST00000256412 p.L251Yfs*4 EBF2 chr8 25858352 25858352 Silent G G A TCGA-BQ-5885-01A-11D-1589-08 ENST00000520164 p.L499L PRKDC chr8 47913945 47913945 Nonsense_Mutation G G A TCGA-BQ-5885-01A-11D-1589-08 ENST00000314191 p.R913* SYBU chr8 109575534 109575534 Frame_Shift_Del T T - TCGA-BQ-5885-01A-11D-1589-08 ENST00000276646 p.D455Afs*19 PHF20L1 chr8 132842707 132842707 Missense_Mutation G G C TCGA-BQ-5885-01A-11D-1589-08 ENST00000395386 p.E860D EPPK1 chr8 143870082 143870082 Missense_Mutation G G T TCGA-BQ-5885-01A-11D-1589-08 ENST00000615648 p.L1058I ARHGAP39 chr8 144581023 144581023 Missense_Mutation T T C TCGA-BQ-5885-01A-11D-1589-08 ENST00000276826 p.N112S ANKRD18A chr9 38571971 38571971 3'UTR T T A TCGA-BQ-5885-01A-11D-1589-08 ENST00000399703 SMC5 chr9 70286213 70286213 Missense_Mutation A A T TCGA-BQ-5885-01A-11D-1589-08 ENST00000361138 p.K332M PAPPA chr9 116235274 116235274 Missense_Mutation C C G TCGA-BQ-5885-01A-11D-1589-08 ENST00000328252 p.P790R MAP3K8 chr10 30460984 30460984 3'UTR G G T TCGA-BQ-5885-01A-11D-1589-08 ENST00000263056 JMJD1C chr10 63200605 63200605 Frame_Shift_Del A A - TCGA-BQ-5885-01A-11D-1589-08 ENST00000399262 p.L1716Yfs*9 TBATA chr10 70777307 70777307 Missense_Mutation T T C TCGA-BQ-5885-01A-11D-1589-08 ENST00000299290 p.E179G USP54 chr10 73534671 73534671 Missense_Mutation G G A TCGA-BQ-5885-01A-11D-1589-08 ENST00000339859 p.S415F PI4K2A chr10 97641049 97641049 Missense_Mutation G G A TCGA-BQ-5885-01A-11D-1589-08 ENST00000370631 p.E103K GBF1 chr10 102370756 102370756 Missense_Mutation C C A TCGA-BQ-5885-01A-11D-1589-08 ENST00000369983 p.L1185I CNNM2 chr10 102919551 102919551 Missense_Mutation G G T TCGA-BQ-5885-01A-11D-1589-08 ENST00000369878 p.E357D SORCS1 chr10 106652536 106652536 Missense_Mutation G G A TCGA-BQ-5885-01A-11D-1589-08 ENST00000263054 p.S774F MMP21 chr10 125766925 125766925 Missense_Mutation T T G TCGA-BQ-5885-01A-11D-1589-08 ENST00000368808 p.N483H PHRF1 chr11 601639 601639 Missense_Mutation T T C TCGA-BQ-5885-01A-11D-1589-08 ENST00000264555 p.S364P NELL1 chr11 21575129 21575129 3'UTR C C A TCGA-BQ-5885-01A-11D-1589-08 ENST00000357134 FAU chr11 65120786 65120786 Missense_Mutation C C A TCGA-BQ-5885-01A-11D-1589-08 ENST00000527548 p.K99N DPP3 chr11 66492771 66492771 Silent G G A TCGA-BQ-5885-01A-11D-1589-08 ENST00000541961 p.A348A DGAT2 chr11 75798416 75798416 Silent C C T TCGA-BQ-5885-01A-11D-1589-08 ENST00000228027 p.P333P BCL9L chr11 118900977 118900977 Missense_Mutation A A C TCGA-BQ-5885-01A-11D-1589-08 ENST00000334801 p.N922K OR8B8 chr11 124441023 124441023 Silent C C T TCGA-BQ-5885-01A-11D-1589-08 ENST00000328064 p.P21P C3AR1 chr12 8059843 8059843 Missense_Mutation C C T TCGA-BQ-5885-01A-11D-1589-08 ENST00000307637 p.A115T DENND5B chr12 31433195 31433196 In_Frame_Ins - - GGCGAA TCGA-BQ-5885-01A-11D-1589-08 ENST00000389082 p.L687_R688dup DENND5B chr12 31433211 31433211 Missense_Mutation T T C TCGA-BQ-5885-01A-11D-1589-08 ENST00000389082 p.K684E ATF7 chr12 53537550 53537550 Splice_Region A A T TCGA-BQ-5885-01A-11D-1589-08 ENST00000548446 p.A100A SRGAP1 chr12 64128133 64128133 Missense_Mutation C C A TCGA-BQ-5885-01A-11D-1589-08 ENST00000355086 p.S938Y EID3 chr12 104304441 104304441 Missense_Mutation T T A TCGA-BQ-5885-01A-11D-1589-08 ENST00000527879 p.H169Q ARHGEF7 chr13 111233206 111233206 Splice_Region G G A TCGA-BQ-5885-01A-11D-1589-08 ENST00000375741 p.E245E SAV1 chr14 50665185 50665185 Missense_Mutation C C T TCGA-BQ-5885-01A-11D-1589-08 ENST00000324679 p.A177T MGA chr15 41691669 41691669 Intron T T A TCGA-BQ-5885-01A-11D-1589-08 ENST00000219905 SMG1 chr16 18830274 18830274 Missense_Mutation G G T TCGA-BQ-5885-01A-11D-1589-08 ENST00000446231 p.A2963E SMG1 chr16 18830275 18830275 Missense_Mutation C C T TCGA-BQ-5885-01A-11D-1589-08 ENST00000446231 p.A2963T IL4R chr16 27363555 27363555 Nonsense_Mutation C C T TCGA-BQ-5885-01A-11D-1589-08 ENST00000395762 p.Q735* NKD1 chr16 50633552 50633552 Missense_Mutation C C G TCGA-BQ-5885-01A-11D-1589-08 ENST00000268459 p.A395G TRPV3 chr17 3554832 3554832 Missense_Mutation C C T TCGA-BQ-5885-01A-11D-1589-08 ENST00000576742 p.E7K DNAH2 chr17 7770914 7770914 Missense_Mutation G G A TCGA-BQ-5885-01A-11D-1589-08 ENST00000389173 p.R1448H COX10 chr17 14074421 14074421 Missense_Mutation A A C TCGA-BQ-5885-01A-11D-1589-08 ENST00000261643 p.I48L LRRC37A4P chr17 45508092 45508096 3'Flank TGGGC TGGGC - TCGA-BQ-5885-01A-11D-1589-08 ENST00000581296 TBX4 chr17 61467552 61467552 Silent G G C TCGA-BQ-5885-01A-11D-1589-08 ENST00000240335 p.L148L TEX19 chr17 82362550 82362550 Missense_Mutation C C A TCGA-BQ-5885-01A-11D-1589-08 ENST00000333437 p.L134M PSMA8 chr18 26151888 26151888 Missense_Mutation A A G TCGA-BQ-5885-01A-11D-1589-08 ENST00000308268 p.N93S ZNF57 chr19 2917765 2917765 Missense_Mutation C C T TCGA-BQ-5885-01A-11D-1589-08 ENST00000306908 p.H382Y ZNF846 chr19 9757515 9757515 Missense_Mutation A A G TCGA-BQ-5885-01A-11D-1589-08 ENST00000397902 p.L521P GATAD2A chr19 19492324 19492324 Missense_Mutation G G T TCGA-BQ-5885-01A-11D-1589-08 ENST00000358713 p.R96S PAK4 chr19 39176627 39176627 Missense_Mutation G G T TCGA-BQ-5885-01A-11D-1589-08 ENST00000358301 p.S466I SIRPB1 chr20 1570858 1570858 Missense_Mutation T T A TCGA-BQ-5885-01A-11D-1589-08 ENST00000381605 p.Y344F SLMO2 chr20 59038635 59038635 Splice_Site C C T TCGA-BQ-5885-01A-11D-1589-08 ENST00000355937 p.X11_splice SF3A1 chr22 30341858 30341858 Missense_Mutation T T A TCGA-BQ-5885-01A-11D-1589-08 ENST00000215793 p.E302V APOBEC3G chr22 39086530 39086530 Silent C C G TCGA-BQ-5885-01A-11D-1589-08 ENST00000407997 p.A329A KLHL4 chrX 87632393 87632404 In_Frame_Del GGACTGTGATGC GGACTGTGATGC - TCGA-BQ-5885-01A-11D-1589-08 ENST00000373119 p.W503_P507delinsS KLHL4 chrX 87632410 87632410 Missense_Mutation A A G TCGA-BQ-5885-01A-11D-1589-08 ENST00000373119 p.M509V AGTR2 chrX 116172371 116172371 Missense_Mutation T T G TCGA-BQ-5885-01A-11D-1589-08 ENST00000371906 p.S31A KIF1B chr1 10375342 10375342 Missense_Mutation G G C TCGA-MH-A855-01A-11D-A34Z-10 ENST00000377086 p.A1793P DHDDS chr1 26432953 26432953 Missense_Mutation G G T TCGA-MH-A855-01A-11D-A34Z-10 ENST00000236342 p.W3L GON4L chr1 155815871 155815871 Missense_Mutation T T A TCGA-MH-A855-01A-11D-A34Z-10 ENST00000368331 p.E365D KDM3A chr2 86466506 86466506 Missense_Mutation A A G TCGA-MH-A855-01A-11D-A34Z-10 ENST00000312912 p.K381R CACNB4 chr2 151839126 151839126 Missense_Mutation C C G TCGA-MH-A855-01A-11D-A34Z-10 ENST00000539935 p.R519T ZPLD1 chr3 102453136 102453136 Silent G G A TCGA-MH-A855-01A-11D-A34Z-10 ENST00000466937 p.L108L TNFSF10 chr3 172514963 172514963 Silent A A G TCGA-MH-A855-01A-11D-A34Z-10 ENST00000241261 p.C56C CCDC39 chr3 180662002 180662002 Silent A A G TCGA-MH-A855-01A-11D-A34Z-10 ENST00000442201 p.L72L CHRD chr3 184381329 184381329 Missense_Mutation A A G TCGA-MH-A855-01A-11D-A34Z-10 ENST00000204604 p.Q116R ZNF721 chr4 442483 442483 Missense_Mutation T T A TCGA-MH-A855-01A-11D-A34Z-10 ENST00000338977 p.I650F MAB21L2 chr4 150584466 150584466 3'UTR A A C TCGA-MH-A855-01A-11D-A34Z-10 ENST00000317605 TRIP13 chr5 914537 914537 Missense_Mutation A A T TCGA-MH-A855-01A-11D-A34Z-10 ENST00000166345 p.N365Y CDO1 chr5 115816494 115816494 5'UTR G G A TCGA-MH-A855-01A-11D-A34Z-10 ENST00000250535 PGBD1 chr6 28301011 28301011 Missense_Mutation C C T TCGA-MH-A855-01A-11D-A34Z-10 ENST00000259883 p.P386L HOXA2 chr7 27100801 27100801 Silent T T A TCGA-MH-A855-01A-11D-A34Z-10 ENST00000222718 p.V352V BOP1 chr8 144264930 144264930 Missense_Mutation C C A TCGA-MH-A855-01A-11D-A34Z-10 ENST00000569669 p.D178Y CNTLN chr9 17298347 17298348 Frame_Shift_Ins - - A TCGA-MH-A855-01A-11D-A34Z-10 ENST00000380647 p.L383Tfs*4 FOXD4L4 chr9 65737188 65737188 Missense_Mutation C C T TCGA-MH-A855-01A-11D-A34Z-10 ENST00000377413 p.R15C ADIRF chr10 86968448 86968448 5'UTR G G T TCGA-MH-A855-01A-11D-A34Z-10 ENST00000372013 OR52J3 chr11 5046747 5046747 Silent C C G TCGA-MH-A855-01A-11D-A34Z-10 ENST00000380370 p.A74A PLCB3 chr11 64266316 64266316 Missense_Mutation G G A TCGA-MH-A855-01A-11D-A34Z-10 ENST00000279230 p.E1090K DENR chr12 122769319 122769320 3'UTR - - AT TCGA-MH-A855-01A-11D-A34Z-10 ENST00000280557 NUPL1 chr13 25335976 25335976 Intron A A - TCGA-MH-A855-01A-11D-A34Z-10 ENST00000381736 CNGB1 chr16 57923349 57923351 In_Frame_Del CAG CAG - TCGA-MH-A855-01A-11D-A34Z-10 ENST00000251102 p.A522del MMP28 chr17 35795296 35795296 Missense_Mutation C C T TCGA-MH-A855-01A-11D-A34Z-10 ENST00000605424 p.G28R RINL chr19 38868967 38868967 3'Flank T T - TCGA-MH-A855-01A-11D-A34Z-10 ENST00000591812 ATF5 chr19 49932777 49932777 Silent G G T TCGA-MH-A855-01A-11D-A34Z-10 ENST00000423777 p.P178P CEACAM18 chr19 51481530 51481530 Missense_Mutation C C T TCGA-MH-A855-01A-11D-A34Z-10 ENST00000396477 p.R180W ZNF584 chr19 58417183 58417183 Missense_Mutation C C A TCGA-MH-A855-01A-11D-A34Z-10 ENST00000306910 p.A222D SEC23B chr20 18548766 18548766 Missense_Mutation C C T TCGA-MH-A855-01A-11D-A34Z-10 ENST00000262544 p.P634L ZMYND8 chr20 47249373 47249373 Missense_Mutation A A C TCGA-MH-A855-01A-11D-A34Z-10 ENST00000311275 p.V543G HELZ2 chr20 63565404 63565404 Missense_Mutation C C T TCGA-MH-A855-01A-11D-A34Z-10 ENST00000467148 p.E1140K EFCAB6 chr22 43668874 43668874 Missense_Mutation C C G TCGA-MH-A855-01A-11D-A34Z-10 ENST00000262726 p.E604D SEPT6 chrX 119675599 119675599 Missense_Mutation T T C TCGA-MH-A855-01A-11D-A34Z-10 ENST00000343984 p.N34D RERE chr1 8360137 8360137 Missense_Mutation G G C TCGA-BQ-5886-01A-11D-1589-08 ENST00000337907 p.P1124A WLS chr1 68098819 68098819 Intron T T - TCGA-BQ-5886-01A-11D-1589-08 ENST00000354777 SLC6A17 chr1 110166943 110166943 Missense_Mutation G G A TCGA-BQ-5886-01A-11D-1589-08 ENST00000331565 p.S5N ELF3 chr1 202015250 202015250 Missense_Mutation G G C TCGA-BQ-5886-01A-11D-1589-08 ENST00000359651 p.R348P CAPN9 chr1 230747518 230747518 Missense_Mutation C C G TCGA-BQ-5886-01A-11D-1589-08 ENST00000271971 p.P8A FAM161A chr2 61839671 61839671 Missense_Mutation G G A TCGA-BQ-5886-01A-11D-1589-08 ENST00000405894 p.H445Y LMAN2L chr2 96707783 96707783 Missense_Mutation T T C TCGA-BQ-5886-01A-11D-1589-08 ENST00000264963 p.T279A LRP2 chr2 169216343 169216343 Silent A A G TCGA-BQ-5886-01A-11D-1589-08 ENST00000263816 p.T1912T GOLGA4 chr3 37299358 37299358 Missense_Mutation T T C TCGA-BQ-5886-01A-11D-1589-08 ENST00000361924 p.L358P MORC1 chr3 109069662 109069662 Missense_Mutation T T A TCGA-BQ-5886-01A-11D-1589-08 ENST00000232603 p.K262I DAPP1 chr4 99866123 99866123 Splice_Site T T G TCGA-BQ-5886-01A-11D-1589-08 ENST00000512369 p.X258_splice SLC30A5 chr5 69104008 69104008 Intron A A G TCGA-BQ-5886-01A-11D-1589-08 ENST00000396591 F2RL2 chr5 76617910 76617910 Missense_Mutation A A G TCGA-BQ-5886-01A-11D-1589-08 ENST00000296641 p.L266S BHMT chr5 79119259 79119259 Missense_Mutation T T C TCGA-BQ-5886-01A-11D-1589-08 ENST00000274353 p.V56A PCDHB3 chr5 141101594 141101594 Silent T T C TCGA-BQ-5886-01A-11D-1589-08 ENST00000231130 p.Y315Y PCDHB9 chr5 141187544 141187544 Missense_Mutation C C T TCGA-BQ-5886-01A-11D-1589-08 ENST00000316105 p.L76F TENM2 chr5 168247291 168247291 Missense_Mutation C C A TCGA-BQ-5886-01A-11D-1589-08 ENST00000518659 p.R2118S PFN3 chr5 177400190 177400190 Missense_Mutation T T C TCGA-BQ-5886-01A-11D-1589-08 ENST00000358571 p.I129M VARS2 chr6 30925606 30925606 Missense_Mutation G G C TCGA-BQ-5886-01A-11D-1589-08 ENST00000321897 p.G950R TTBK1 chr6 43259218 43259218 Silent C C G TCGA-BQ-5886-01A-11D-1589-08 ENST00000259750 p.V399V ADGRF1 chr6 47009307 47009307 Missense_Mutation G G A TCGA-BQ-5886-01A-11D-1589-08 ENST00000371253 p.P710S TBC1D32 chr6 121255375 121255375 Silent T T A TCGA-BQ-5886-01A-11D-1589-08 ENST00000398212 p.V657V HIVEP2 chr6 142770682 142770682 Missense_Mutation T T C TCGA-BQ-5886-01A-11D-1589-08 ENST00000012134 p.I1353V CADPS2 chr7 122629281 122629281 Silent A A G TCGA-BQ-5886-01A-11D-1589-08 ENST00000449022 p.D278D NUP205 chr7 135591509 135591509 Missense_Mutation T T G TCGA-BQ-5886-01A-11D-1589-08 ENST00000285968 p.I511M RGS20 chr8 53852011 53852012 Frame_Shift_Del AT AT - TCGA-BQ-5886-01A-11D-1589-08 ENST00000297313 p.I38Sfs*7 RGS20 chr8 53852013 53852013 Silent T T C TCGA-BQ-5886-01A-11D-1589-08 ENST00000297313 p.I38I FANCG chr9 35077005 35077005 Missense_Mutation A A G TCGA-BQ-5886-01A-11D-1589-08 ENST00000378643 p.V248A SMC2 chr9 104100426 104100426 Missense_Mutation T T C TCGA-BQ-5886-01A-11D-1589-08 ENST00000286398 p.L210S PTGR1 chr9 111597392 111597392 Missense_Mutation T T G TCGA-BQ-5886-01A-11D-1589-08 ENST00000309195 p.K11Q GAPVD1 chr9 125302189 125302189 Missense_Mutation C C T TCGA-BQ-5886-01A-11D-1589-08 ENST00000394104 p.T131I DNM1 chr9 128248589 128248589 Missense_Mutation G G A TCGA-BQ-5886-01A-11D-1589-08 ENST00000372923 p.E638K NPS chr10 127552565 127552565 Frame_Shift_Del T T - TCGA-BQ-5886-01A-11D-1589-08 ENST00000398023 p.F66Lfs*2 ST5 chr11 8730238 8730238 Missense_Mutation G G A TCGA-BQ-5886-01A-11D-1589-08 ENST00000313726 p.P351L TUT1 chr11 62578933 62578933 Missense_Mutation T T C TCGA-BQ-5886-01A-11D-1589-08 ENST00000476907 p.D263G ARHGEF12 chr11 120465335 120465335 Missense_Mutation G G T TCGA-BQ-5886-01A-11D-1589-08 ENST00000397843 p.K904N MON2 chr12 62578497 62578497 Missense_Mutation G G A TCGA-BQ-5886-01A-11D-1589-08 ENST00000393630 p.D1523N NAP1L1 chr12 76050647 76050647 Missense_Mutation C C T TCGA-BQ-5886-01A-11D-1589-08 ENST00000261182 p.D315N HMGB1 chr13 30462689 30462689 Missense_Mutation G G A TCGA-BQ-5886-01A-11D-1589-08 ENST00000339872 p.S107F HMGB1 chr13 30462699 30462699 Frame_Shift_Del G G - TCGA-BQ-5886-01A-11D-1589-08 ENST00000339872 p.L104Sfs*48 ELF1 chr13 40941173 40941173 Missense_Mutation G G A TCGA-BQ-5886-01A-11D-1589-08 ENST00000239882 p.P335L GPHN chr14 66922708 66922708 Missense_Mutation G G C TCGA-BQ-5886-01A-11D-1589-08 ENST00000315266 p.D167H FAM161B chr14 73950128 73950128 Missense_Mutation C C G TCGA-BQ-5886-01A-11D-1589-08 ENST00000286544 p.A30P ATG2B chr14 96295523 96295523 Missense_Mutation A A T TCGA-BQ-5886-01A-11D-1589-08 ENST00000359933 p.L1726H ZNF200 chr16 3223696 3223696 3'UTR T T C TCGA-BQ-5886-01A-11D-1589-08 ENST00000414144 ITGAX chr16 31359979 31359979 Silent G G A TCGA-BQ-5886-01A-11D-1589-08 ENST00000268296 p.R207R SLC13A5 chr17 6703013 6703013 Missense_Mutation T T G TCGA-BQ-5886-01A-11D-1589-08 ENST00000433363 p.T225P PIK3R5 chr17 8909138 8909138 Missense_Mutation A A G TCGA-BQ-5886-01A-11D-1589-08 ENST00000447110 p.L47P KIAA0100 chr17 28621397 28621397 Splice_Site A A G TCGA-BQ-5886-01A-11D-1589-08 ENST00000528896 p.X1687_splice TMEM101 chr17 44011903 44011904 3'UTR - - CAT TCGA-BQ-5886-01A-11D-1589-08 ENST00000206380 SAMD14 chr17 50115561 50115562 Splice_Region - - A TCGA-BQ-5886-01A-11D-1589-08 ENST00000330175 ITGB4 chr17 75756728 75756728 Missense_Mutation C C T TCGA-BQ-5886-01A-11D-1589-08 ENST00000200181 p.P1641L GADD45B chr19 2477584 2477584 Missense_Mutation T T A TCGA-BQ-5886-01A-11D-1589-08 ENST00000215631 p.S156T S1PR4 chr19 3179458 3179458 Silent C C T TCGA-BQ-5886-01A-11D-1589-08 ENST00000246115 p.L222L XAB2 chr19 7621283 7621283 Frame_Shift_Del G G - TCGA-BQ-5886-01A-11D-1589-08 ENST00000358368 p.I545Sfs*17 ZFP14 chr19 36340578 36340578 Silent G G A TCGA-BQ-5886-01A-11D-1589-08 ENST00000270001 p.S416S ZFP14 chr19 36340579 36340579 Missense_Mutation C C T TCGA-BQ-5886-01A-11D-1589-08 ENST00000270001 p.S416N BCAM chr19 44819711 44819711 Missense_Mutation G G T TCGA-BQ-5886-01A-11D-1589-08 ENST00000270233 p.R583L ZNF543 chr19 57327817 57327817 Frame_Shift_Del G G - TCGA-BQ-5886-01A-11D-1589-08 ENST00000321545 p.Q120Nfs*16 PTPRA chr20 3035633 3035633 Missense_Mutation G G T TCGA-BQ-5886-01A-11D-1589-08 ENST00000380393 p.D657Y PARD6B chr20 50750070 50750070 Missense_Mutation T T C TCGA-BQ-5886-01A-11D-1589-08 ENST00000371610 p.M234T EMID1 chr22 29231019 29231019 Splice_Site G G T TCGA-BQ-5886-01A-11D-1589-08 ENST00000334018 p.X156_splice SBF1 chr22 50447230 50447230 Missense_Mutation G G C TCGA-BQ-5886-01A-11D-1589-08 ENST00000380817 p.T1865R EIF2S3 chrX 24071698 24071698 Missense_Mutation C C T TCGA-BQ-5886-01A-11D-1589-08 ENST00000253039 p.R385C KDM6A chrX 45089776 45089776 Nonsense_Mutation G G A TCGA-BQ-5886-01A-11D-1589-08 ENST00000377967 p.W1194* PHC2 chr1 33324979 33324979 Missense_Mutation G G C TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000257118 p.I821M PTPRF chr1 43569765 43569765 Missense_Mutation G G T TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000359947 p.K185N CELSR2 chr1 109258523 109258523 Silent G G A TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000271332 p.E1134E PTPN22 chr1 113854952 113854952 Missense_Mutation C C T TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000359785 p.R213H SYCP1 chr1 114910502 114910502 Splice_Site G G A TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000369518 p.X475_splice RP11-25K21.6 chr1 161606484 161606484 3'Flank C C A TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000537821 RAB3GAP2 chr1 220172046 220172046 Missense_Mutation G G A TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000358951 p.A807V OBSCN chr1 228280360 228280360 Silent A A G TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000422127 p.V2615V MT1HL1 chr1 237004298 237004306 In_Frame_Del TTTGCACTT TTTGCACTT - TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000464121 p.K23_K25del SNRNP200 chr2 96284582 96284602 Splice_Site ATACCTGGCGGGCAGAGGAGG ATACCTGGCGGGCAGAGGAGG - TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000323853 p.X1389_splice LMAN2L chr2 96734494 96734494 Silent C C T TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000264963 p.V113V TISP43 chr2 130574508 130574508 Missense_Mutation C C A TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000409982 p.D52E FN1 chr2 215404416 215404416 Missense_Mutation G G A TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000359671 p.P1076S COL4A3 chr2 227307774 227307774 Silent A A C TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000396578 p.A1439A CAPN7 chr3 15251427 15251428 3'UTR - - A TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000253693 MUC4 chr3 195779231 195779231 Missense_Mutation C C T TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000463781 p.D4117N BLOC1S4 chr4 6717059 6717059 3'UTR G G A TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000320776 KIAA0232 chr4 6880855 6880855 Silent C C T TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000307659 p.R1359R SH3TC1 chr4 8236428 8236428 Missense_Mutation G G C TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000245105 p.G1186R ARHGAP24 chr4 85570564 85570564 Missense_Mutation C C T TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000395184 p.T8M ANKRD37 chr4 185396874 185396874 5'UTR C C T TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000335174 ZSWIM6 chr5 61543632 61543632 Missense_Mutation C C T TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000252744 p.A988V CD180 chr5 67183546 67183546 Missense_Mutation G G T TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000256447 p.H433N BHMT chr5 79111847 79111847 5'UTR T T C TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000274353 KDM3B chr5 138393231 138393231 Missense_Mutation C C T TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000314358 p.P897L MMS22L chr6 97254601 97254601 Missense_Mutation C C T TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000275053 p.A359T TTYH3 chr7 2632183 2632183 Missense_Mutation T T C TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000258796 p.W10R ACTB chr7 5528964 5528964 Intron A A T TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000331789 KCTD7 chr7 66638386 66638386 Missense_Mutation G G A TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000275532 p.E150K MEPCE chr7 100431324 100431324 Missense_Mutation G G C TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000310512 p.V436L PAXIP1 chr7 154968717 154968717 Missense_Mutation T T A TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000397192 p.H495L LYPD2 chr8 142752506 142752506 5'UTR A A T TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000359228 ZNF462 chr9 106974218 106974219 Frame_Shift_Del CC CC - TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000277225 p.Y2261Sfs*10 SC5D chr11 121303407 121303407 Missense_Mutation A A T TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000264027 p.Y11F HOXC11 chr12 53973179 53973179 5'UTR A A G TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000546378 METTL21C chr13 102690850 102690850 Missense_Mutation T T A TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000267273 p.E82V NTRK3 chr15 88032973 88032973 Missense_Mutation G G T TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000360948 p.T490K DDX5 chr17 64500615 64500615 Missense_Mutation C C G TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000225792 p.V459L RECQL5 chr17 75658420 75658420 Missense_Mutation A A G TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000317905 p.Y343H ZNF257 chr19 22089278 22089282 Frame_Shift_Del ACTGG ACTGG - TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000594947 p.T510Rfs*7 CEACAM3 chr19 41810834 41810834 Missense_Mutation G G A TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000357396 p.M210I C19orf48 chr19 50798674 50798674 5'UTR A A T TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000345523 ZNF813 chr19 53492088 53492088 3'UTR A A G TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000396403 ADAMTS1 chr21 26841081 26841081 Missense_Mutation G G A TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000284984 p.S432L KCNJ15 chr21 38299297 38299297 Silent C C A TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000328656 p.P12P PSMG1 chr21 39183374 39183374 Silent C C T TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000331573 p.T4T SREBF2 chr22 41878009 41878009 Silent C C T TCGA-B3-A6W5-01A-12D-A33Q-10 ENST00000361204 p.V549V MRPL37 chr1 54205364 54205364 Silent G G A TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000360840 p.R200R ABCA4 chr1 94056629 94056629 Missense_Mutation C C T TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000370225 p.R785H DPH5 chr1 100990600 100990600 Silent T T C TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000370109 p.L222L ALX3 chr1 110060930 110060930 Missense_Mutation C C A TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000369792 p.G279W SCN9A chr2 166199398 166199398 Silent G G T TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000303354 p.S1747S NDUFS1 chr2 206124092 206124092 3'UTR T T - TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000233190 VILL chr3 38001510 38001510 Missense_Mutation C C G TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000283713 p.Q413E ZPLD1 chr3 102469084 102469085 Frame_Shift_Del GC GC - TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000466937 p.H295Lfs*10 ASTE1 chr3 131024675 131024675 Missense_Mutation T T A TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000264992 p.N211I WWTR1 chr3 149526115 149526115 Missense_Mutation G G A TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000360632 p.H306Y MRFAP1 chr4 6640978 6640978 Missense_Mutation T T C TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000320912 p.I39T SLC4A4 chr4 71350046 71350046 Missense_Mutation A A T TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000264485 p.E175V AGPAT9 chr4 83594859 83594859 Silent T T C TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000264409 p.H251H HERC6 chr4 88379077 88379077 Missense_Mutation G G C TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000264346 p.R52S SPOCK3 chr4 167234246 167234246 Intron C C T TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000357154 CLCN3 chr4 169689068 169689068 Silent T T A TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000513761 p.I148I MED10 chr5 6372525 6372525 Missense_Mutation C C A TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000255764 p.G129V CAMK4 chr5 111473384 111473384 Frame_Shift_Del C C - TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000282356 p.L234Yfs*22 LVRN chr5 116015721 116015721 Silent C C G TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000357872 p.V904V MARCH3 chr5 126918093 126918093 Missense_Mutation C C G TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000308660 p.V27L GRXCR2 chr5 145866725 145866725 Missense_Mutation G G T TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000377976 p.L114I HMGXB3 chr5 150006599 150006599 Silent G G A TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000613459 p.R334R CDHR2 chr5 176581529 176581529 Missense_Mutation G G A TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000261944 p.D669N PAK1IP1 chr6 10709515 10709515 3'UTR T T - TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000379568 AGPAT1 chr6 32171336 32171336 Missense_Mutation G G T TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000336984 p.P54H OOEP chr6 73369262 73369262 Missense_Mutation C C A TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000370359 p.R105L ROS1 chr6 117365616 117365616 Missense_Mutation C C G TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000368508 p.V980L TXLNB chr6 139242532 139242532 Silent G G T TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000358430 p.V683V HECW1 chr7 43445558 43445558 Missense_Mutation A A G TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000395891 p.N796D POM121 chr7 72942166 72942166 Missense_Mutation C C T TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000434423 p.P725S CLDN12 chr7 90415586 90415586 3'UTR T T G TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000287916 WASL chr7 123689098 123689098 Missense_Mutation A A G TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000223023 p.I467T SLC13A4 chr7 135727493 135727493 Missense_Mutation C C A TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000354042 p.G2C FER1L6 chr8 124049646 124049646 Missense_Mutation G G A TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000399018 p.V922I RASEF chr9 83015816 83015816 Missense_Mutation T T C TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000376447 p.K252E PARG chr10 49933708 49933709 Frame_Shift_Ins - - A TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000402038 p.C247Lfs*8 CDH23 chr10 71439830 71439830 Missense_Mutation C C A TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000224721 p.A45D EIF5AL1 chr10 79514130 79514130 3'UTR G G C TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000520547 IFIT5 chr10 89418812 89418812 3'UTR G G T TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000371795 TALDO1 chr11 747455 747455 5'UTR C C T TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000319006 TRIM22 chr11 5698202 5698202 Intron A A G TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000379965 LGR4 chr11 27392451 27392452 Frame_Shift_Ins - - T TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000379214 p.V109Sfs*7 DNAJC24 chr11 31430278 31430278 Missense_Mutation C C A TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000465995 p.H109Q C11orf24 chr11 68263743 68263743 Frame_Shift_Del A A - TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000304271 p.W9Gfs*29 CEP57 chr11 95831066 95831066 Missense_Mutation A A G TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000325542 p.K438R DYNC2H1 chr11 103256227 103256227 Missense_Mutation T T A TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000375735 p.I3483N EXPH5 chr11 108514262 108514262 Nonsense_Mutation A A T TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000265843 p.Y415* TULP3 chr12 2890979 2890979 Missense_Mutation G G A TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000448120 p.S11N VWF chr12 5952452 5952452 Frame_Shift_Del A A - TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000261405 p.F2685Sfs*25 PTPRB chr12 70622447 70622447 Silent A A G TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000334414 p.I217I KRR1 chr12 75498640 75498640 3'UTR C C T TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000229214 LHX5 chr12 113471493 113471493 Missense_Mutation C C T TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000261731 p.M2I RHOT1P3 chr13 18837861 18837861 RNA A A C TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000436571 WDR25 chr14 100381469 100381469 Missense_Mutation G G T TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000335290 p.R182I PLA2G4F chr15 42146156 42146156 Missense_Mutation C C T TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000397272 p.R502H LOXL1 chr15 73949463 73949463 Missense_Mutation A A C TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000261921 p.H536P NUDT21 chr16 56439673 56439673 Missense_Mutation T T A TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000300291 p.N152I FOXL1 chr16 86578897 86578897 Silent C C A TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000320241 p.I58I SMG6 chr17 2282679 2282679 Missense_Mutation C C T TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000263073 p.E877K OR1A1 chr17 3216313 3216313 Missense_Mutation G G T TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000304094 p.K231N TVP23C-CDRT4 chr17 15563456 15563456 5'UTR C C T TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000522212 ACACA chr17 37192297 37192297 Missense_Mutation C C A TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000616317 p.E1403D BPTF chr17 67922965 67922966 Frame_Shift_Ins - - G TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000321892 p.E2022Gfs*7 ST8SIA5 chr18 46680011 46680011 3'UTR G G A TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000315087 CACNA1A chr19 13299037 13299037 Missense_Mutation C C G TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000360228 p.D866H KCNN1 chr19 17985427 17985431 Frame_Shift_Del GGTGT GGTGT - TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000222249 p.G345Vfs*29 ZNF792 chr19 34959415 34959415 Frame_Shift_Del A A - TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000404801 p.L147Wfs*20 FBL chr19 39837832 39837832 Silent G G A TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000221801 p.V187V CNOT3 chr19 54144017 54144017 Silent G G C TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000221232 p.R90R ZNF335 chr20 45952469 45952469 Missense_Mutation C C A TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000322927 p.G956V ITSN1 chr21 33836633 33836633 Splice_Site G G A TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000381318 p.X1221_splice GRAP2 chr22 39947026 39947026 Intron A A G TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000344138 MED14 chrX 40651709 40651709 3'UTR A A - TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000324817 FOXO4 chrX 71096748 71096748 Missense_Mutation C A A TCGA-UZ-A9PV-01A-11D-A42J-10 ENST00000374259 p.P74T EPHA8 chr1 22576863 22576863 Missense_Mutation G G C TCGA-B9-4115-01A-01D-1553-08 ENST00000166244 p.R269P PIGV chr1 26794568 26794568 Silent C C T TCGA-B9-4115-01A-01D-1553-08 ENST00000078527 p.F178F AGO1 chr1 35894387 35894387 Missense_Mutation C C T TCGA-B9-4115-01A-01D-1553-08 ENST00000373204 p.P286L MACF1 chr1 39442023 39442023 Missense_Mutation T T G TCGA-B9-4115-01A-01D-1553-08 ENST00000372915 p.N6147K NEGR1 chr1 72282427 72282427 Missense_Mutation C C T TCGA-B9-4115-01A-01D-1553-08 ENST00000357731 p.S23N MCOLN3 chr1 85026017 85026017 Silent A A G TCGA-B9-4115-01A-01D-1553-08 ENST00000370589 p.N339N ATP1A2 chr1 160123250 160123250 Missense_Mutation G G T TCGA-B9-4115-01A-01D-1553-08 ENST00000361216 p.R72L ATP1A2 chr1 160135514 160135514 Silent C C A TCGA-B9-4115-01A-01D-1553-08 ENST00000361216 p.G732G IRF6 chr1 209790744 209790744 Missense_Mutation G G C TCGA-B9-4115-01A-01D-1553-08 ENST00000367021 p.L271V PRKCE chr2 45652368 45652368 Missense_Mutation G G C TCGA-B9-4115-01A-01D-1553-08 ENST00000306156 p.G90R REV1 chr2 99402703 99402703 Missense_Mutation C C T TCGA-B9-4115-01A-01D-1553-08 ENST00000258428 p.G1161E NUP210 chr3 13373870 13373870 Missense_Mutation G G A TCGA-B9-4115-01A-01D-1553-08 ENST00000254508 p.H479Y TRANK1 chr3 36831564 36831564 Silent C C T TCGA-B9-4115-01A-01D-1553-08 ENST00000429976 p.L2629L ACAA1 chr3 38136643 38136643 Missense_Mutation C C G TCGA-B9-4115-01A-01D-1553-08 ENST00000333167 p.V72L CTBP1 chr4 1238228 1238228 Frame_Shift_Del A A - TCGA-B9-4115-01A-01D-1553-08 ENST00000290921 p.V51Wfs*17 HPSE chr4 83322241 83322241 Silent G G A TCGA-B9-4115-01A-01D-1553-08 ENST00000311412 p.Y117Y FAM198B chr4 158171250 158171250 Silent A A T TCGA-B9-4115-01A-01D-1553-08 ENST00000296530 p.T42T FAM173B chr5 10249861 10249861 Missense_Mutation C C T TCGA-B9-4115-01A-01D-1553-08 ENST00000511437 p.G5R MAST4 chr5 67142184 67142194 Frame_Shift_Del AGGCAGAATTT AGGCAGAATTT - TCGA-B9-4115-01A-01D-1553-08 ENST00000403625 p.K855Nfs*7 ARHGEF28 chr5 73867971 73867971 Missense_Mutation G G C TCGA-B9-4115-01A-01D-1553-08 ENST00000426542 p.G750R NSA2 chr5 74767339 74767339 5'UTR T T A TCGA-B9-4115-01A-01D-1553-08 ENST00000610426 SHROOM1 chr5 132824786 132824786 Missense_Mutation G G T TCGA-B9-4115-01A-01D-1553-08 ENST00000378679 p.P357H SEC24A chr5 134666997 134666997 Splice_Site G G A TCGA-B9-4115-01A-01D-1553-08 ENST00000398844 p.X247_splice HIST1H2AD chr6 26198880 26198881 Frame_Shift_Del CA CA - TCGA-B9-4115-01A-01D-1553-08 ENST00000341023 p.H124Pfs*? BTN3A2 chr6 26370577 26370577 Frame_Shift_Del A A - TCGA-B9-4115-01A-01D-1553-08 ENST00000356386 p.K231Rfs*47 GPX5 chr6 28534175 28534175 3'UTR G G T TCGA-B9-4115-01A-01D-1553-08 ENST00000412168 KIF6 chr6 39345712 39345712 Missense_Mutation G G T TCGA-B9-4115-01A-01D-1553-08 ENST00000287152 p.P770Q NR2E1 chr6 108178179 108178179 Missense_Mutation T T G TCGA-B9-4115-01A-01D-1553-08 ENST00000368986 p.F194V HIPK2 chr7 139614355 139614355 Missense_Mutation T T C TCGA-B9-4115-01A-01D-1553-08 ENST00000406875 p.T641A TRBV20-1 chr7 142627382 142627382 Silent C C T TCGA-B9-4115-01A-01D-1553-08 ENST00000390394 p.Y106Y KCNU1 chr8 36840956 36840956 Silent C C A TCGA-B9-4115-01A-01D-1553-08 ENST00000399881 p.L552L BAG4 chr8 38177081 38177081 Missense_Mutation G G A TCGA-B9-4115-01A-01D-1553-08 ENST00000287322 p.G71D BHLHE22 chr8 64581942 64581942 3'UTR C C T TCGA-B9-4115-01A-01D-1553-08 ENST00000321870 ERMP1 chr9 5801231 5801231 Missense_Mutation A A T TCGA-B9-4115-01A-01D-1553-08 ENST00000339450 p.F671Y TYRP1 chr9 12694339 12694339 Missense_Mutation C C G TCGA-B9-4115-01A-01D-1553-08 ENST00000388918 p.P115A KIF12 chr9 114097340 114097340 Missense_Mutation A A T TCGA-B9-4115-01A-01D-1553-08 ENST00000374118 p.F65I METTL10 chr10 124789082 124789082 Silent A A G TCGA-B9-4115-01A-01D-1553-08 ENST00000368836 p.L84L TRIM3 chr11 6465582 6465582 Silent C C T TCGA-B9-4115-01A-01D-1553-08 ENST00000345851 p.L38L OTUB1 chr11 63988683 63988683 Missense_Mutation G G T TCGA-B9-4115-01A-01D-1553-08 ENST00000428192 p.E50D IGSF9B chr11 133944284 133944284 Silent C C A TCGA-B9-4115-01A-01D-1553-08 ENST00000321016 p.V115V RDH5 chr12 55721229 55721229 Silent G G A TCGA-B9-4115-01A-01D-1553-08 ENST00000257895 p.L15L RDH5 chr12 55721260 55721260 Missense_Mutation G G A TCGA-B9-4115-01A-01D-1553-08 ENST00000257895 p.A26T DOCK9 chr13 98829459 98829459 Missense_Mutation T T C TCGA-B9-4115-01A-01D-1553-08 ENST00000376460 p.T1582A ATP11A chr13 112862510 112862510 Missense_Mutation G G A TCGA-B9-4115-01A-01D-1553-08 ENST00000375645 p.A976T ATP11A chr13 112862511 112862511 Missense_Mutation C C G TCGA-B9-4115-01A-01D-1553-08 ENST00000375645 p.A976G ZFYVE26 chr14 67815942 67815942 Nonsense_Mutation C C A TCGA-B9-4115-01A-01D-1553-08 ENST00000347230 p.E8* DICER1 chr14 95090543 95090543 Silent G G T TCGA-B9-4115-01A-01D-1553-08 ENST00000343455 p.A1908A SIVA1 chr14 104755676 104755676 Silent C C T TCGA-B9-4115-01A-01D-1553-08 ENST00000329967 p.D55D KIAA0430 chr16 15623079 15623079 Frame_Shift_Del A A - TCGA-B9-4115-01A-01D-1553-08 ENST00000396368 p.F772Sfs*27 TMC5 chr16 19487006 19487006 Missense_Mutation T T G TCGA-B9-4115-01A-01D-1553-08 ENST00000396229 p.F809V CES4A chr16 67004134 67004134 Missense_Mutation C C A TCGA-B9-4115-01A-01D-1553-08 ENST00000540947 p.D330E C17orf107 chr17 4902400 4902400 3'UTR A A G TCGA-B9-4115-01A-01D-1553-08 ENST00000381365 TNFSF13 chr17 7560824 7560824 Silent G G A TCGA-B9-4115-01A-01D-1553-08 ENST00000338784 p.V248V KAT7 chr17 49791888 49791888 Missense_Mutation G G T TCGA-B9-4115-01A-01D-1553-08 ENST00000259021 p.R6S CEP192 chr18 13049325 13049325 Frame_Shift_Del T T - TCGA-B9-4115-01A-01D-1553-08 ENST00000506447 p.Y846Mfs*16 COX7A1 chr19 36151498 36151500 In_Frame_Del TGT TGT - TCGA-B9-4115-01A-01D-1553-08 ENST00000292907 p.N50del ITPKC chr19 40717480 40717480 Silent A A T TCGA-B9-4115-01A-01D-1553-08 ENST00000263370 p.P115P ERF chr19 42248637 42248638 In_Frame_Ins - - AAA TCGA-B9-4115-01A-01D-1553-08 ENST00000222329 p.D491_C492insF ALDH16A1 chr19 49468510 49468510 Missense_Mutation A A T TCGA-B9-4115-01A-01D-1553-08 ENST00000293350 p.T690S ZNF134 chr19 57620335 57620335 Missense_Mutation C C A TCGA-B9-4115-01A-01D-1553-08 ENST00000396161 p.H72Q CBFA2T2 chr20 33611216 33611216 Missense_Mutation A A G TCGA-B9-4115-01A-01D-1553-08 ENST00000346541 p.T110A CACNA1I chr22 39665907 39665907 Missense_Mutation T T G TCGA-B9-4115-01A-01D-1553-08 ENST00000402142 p.C1335W HTATSF1 chrX 136511874 136511874 Missense_Mutation A A T TCGA-B9-4115-01A-01D-1553-08 ENST00000218364 p.E710V PLEKHG5 chr1 6474937 6474937 Intron C C T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000400915 DDI2 chr1 15630438 15630438 Missense_Mutation T T G TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000480945 p.S128A ZNF436 chr1 23369550 23369550 5'Flank A A C TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000314011 FUBP1 chr1 77949284 77949284 Silent A A G TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000370768 p.A599A LRRC8C chr1 89713629 89713629 Silent T T C TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000370454 p.Y353Y IQGAP3 chr1 156548124 156548125 Frame_Shift_Del AG AG - TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000361170 p.A751Gfs*24 LY9 chr1 160816772 160816772 Missense_Mutation A A C TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000263285 p.R417S SLC19A2 chr1 169477512 169477512 Silent G G A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000236137 p.D150D CACNA1E chr1 181732492 181732492 Silent G G A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000367573 p.A802A ADCK3 chr1 226985263 226985263 Missense_Mutation G G A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000366777 p.A528T FMN2 chr1 240207277 240207277 Missense_Mutation A A T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000319653 p.Q822L VWA3B chr2 98290579 98290579 Silent G G A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000477737 p.Q1038Q NEB chr2 151570098 151570098 Missense_Mutation A A T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000172853 p.Y4104N PLCL1 chr2 198084835 198084835 Missense_Mutation C C G TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000428675 p.R440G CPS1 chr2 210606881 210606881 Missense_Mutation G G T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000233072 p.C711F IKZF2 chr2 213007925 213007925 Missense_Mutation T T C TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000434687 p.H339R ABCB6 chr2 219210288 219210288 Missense_Mutation C C A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000265316 p.V788L ABCB6 chr2 219210289 219210289 Silent A A G TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000265316 p.T787T KCNE4 chr2 223054745 223054745 3'UTR G G C TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000281830 EIF4E2 chr2 232564279 232564279 Missense_Mutation G G T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000258416 p.M101I SMARCC1 chr3 47676682 47676682 Missense_Mutation C C A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000254480 p.V558L COL7A1 chr3 48566960 48566960 Missense_Mutation C C A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000328333 p.G2725W APEH chr3 49680586 49680586 Missense_Mutation T T C TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000296456 p.L419P CACNA1D chr3 53810298 53810298 Frame_Shift_Del A A - TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000350061 p.V2065Sfs*2 SLC15A2 chr3 121930934 121930934 Missense_Mutation A A G TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000489711 p.T550A HEG1 chr3 125029287 125029287 Missense_Mutation C C T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000311127 p.S173N COL6A5 chr3 130376683 130376683 Missense_Mutation G G T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000312481 p.A172S KLHL24 chr3 183663616 183663616 Missense_Mutation C C A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000242810 p.A360D YEATS2 chr3 183758876 183758876 Frame_Shift_Del A A - TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000305135 p.K523Rfs*25 PARL chr3 183829513 183829513 3'UTR G G T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000317096 BLOC1S4 chr4 6717101 6717101 3'UTR C C A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000320776 CNGA1 chr4 47936960 47936960 Frame_Shift_Del T T - TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000358519 p.I512Sfs*27 WDFY3 chr4 84794942 84794942 Missense_Mutation G G T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000295888 p.P1069T STPG2 chr4 97972378 97972378 Missense_Mutation T T C TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000295268 p.K279E NR3C2 chr4 148435264 148435264 Missense_Mutation T T C TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000344721 p.I533V NAF1 chr4 163140357 163140357 Silent T T C TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000274054 p.A248A C5orf42 chr5 37121678 37121678 Silent A A G TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000425232 p.L2988L ADAMTS6 chr5 65291444 65291444 Missense_Mutation T T A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000381055 p.N466I UTP15 chr5 73568554 73568554 Silent T T A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000296792 p.L106L ANKRD32 chr5 94678803 94678803 Splice_Region G G - TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000265140 CCDC112 chr5 115267883 115267884 Frame_Shift_Ins - - TT TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000395557 p.R445Kfs*12 CRIP3 chr6 43305993 43305993 Silent T T C TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000274990 p.V209V DEFB113 chr6 49968845 49968845 Silent T T C TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000398718 p.E27E PKHD1 chr6 51885869 51885869 Missense_Mutation G G T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000371117 p.Q2405K COL9A1 chr6 70216979 70216979 Missense_Mutation G G T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000357250 p.P895H ALDH8A1 chr6 134939364 134939364 Missense_Mutation A A G TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000265605 p.I165T SCAF8 chr6 154832914 154832914 Missense_Mutation G G A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000367178 p.G1112D LPA chr6 160650491 160650491 Missense_Mutation G G T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000316300 p.P19H SEPT7 chr7 35883966 35883966 Missense_Mutation T T A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000350320 p.Y267N ZNF273 chr7 64903287 64903287 5'UTR T T - TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000476120 AKAP9 chr7 92001907 92001907 Nonsense_Mutation A A T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000356239 p.K664* NPTX2 chr7 98628455 98628455 Frame_Shift_Del C C - TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000265634 p.Q375Sfs*124 METTL2B chr7 128479233 128479233 Missense_Mutation G G T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000262432 p.R93I KRBA1 chr7 149733724 149733724 Missense_Mutation C C G TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000319551 p.P924A MTUS1 chr8 17755294 17755294 Missense_Mutation A A G TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000262102 p.F172L KAT6A chr8 41937427 41937427 Missense_Mutation A A T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000265713 p.L1061I WWP1 chr8 86411732 86411732 Missense_Mutation G G C TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000265428 p.A307P EIF3H chr8 116648912 116648912 Missense_Mutation T T G TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000521861 p.K241T KANK1 chr9 744648 744648 Intron C C A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000382297 PLIN2 chr9 19126160 19126160 Silent C C A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000276914 p.V60V AGTPBP1 chr9 85619054 85619054 Missense_Mutation C C G TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000357081 p.G755A RP11-213G2.3 chr9 85840777 85840777 RNA G G A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000431724 PHPT1 chr9 136850130 136850130 Missense_Mutation A A G TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000247665 p.Y93C ERCC6-PGBD3 chr10 49515295 49515295 3'UTR A A - TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000515869 NOLC1 chr10 102158115 102158115 Missense_Mutation G G A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000605788 p.D170N CNGA4 chr11 6240638 6240638 Missense_Mutation G G C TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000379936 p.D282H OR2AG2 chr11 6768139 6768139 Silent G G T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000338569 p.I273I CD82 chr11 44619220 44619220 3'UTR A A G TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000227155 RBM14 chr11 66617013 66617013 Missense_Mutation T T C TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000310137 p.L98P AQP11 chr11 77590501 77590501 Missense_Mutation A A G TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000313578 p.E170G MAML2 chr11 95979275 95979276 Frame_Shift_Ins - - T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000524717 p.N1048Kfs*14 OR8B2 chr11 124382788 124382796 In_Frame_Del GGAGGAGGG GGAGGAGGG - TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000375013 p.P183_L185del CACNA1C chr12 2653891 2653891 Silent C C T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000347598 p.I1425I A2M chr12 9090021 9090021 Missense_Mutation T T A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000318602 p.N867Y PTPRB chr12 70609208 70609208 Silent G G A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000261266 p.T62T HIP1R chr12 122858375 122858375 Missense_Mutation G G A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000253083 p.A664T MTRF1 chr13 41217216 41217216 Missense_Mutation C C T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000379477 p.G413S BCL2L2 chr14 23307776 23307776 Silent C C A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000250405 p.T3T SAV1 chr14 50665387 50665388 Frame_Shift_Del CT CT - TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000324679 p.E109Vfs*12 PPP1R36 chr14 64586988 64586988 Intron T T A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000298705 HERC2P9 chr15 28637439 28637439 RNA A A G TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000529624 MAP1A chr15 43525590 43525590 Missense_Mutation A A G TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000300231 p.T1373A PEX11A chr15 89690686 89690686 5'UTR G G T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000300056 PRR14 chr16 30654816 30654816 Silent G G A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000300835 p.L282L ITGAX chr16 31362685 31362685 Missense_Mutation G G C TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000268296 p.G431R KCTD11 chr17 7353960 7353960 3'UTR T T C TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000333751 ALOX12B chr17 8087381 8087381 Missense_Mutation G G C TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000319144 p.S21C MMD chr17 55407776 55407777 Frame_Shift_Ins - - AG TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000262065 p.Y105Sfs*13 KCNH6 chr17 63538649 63538649 Silent C C G TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000583023 p.V647V RNF213 chr17 80376339 80376341 In_Frame_Del GAT GAT - TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000582970 p.K4408_I4409delinsN DOT1L chr19 2210831 2210831 Nonsense_Mutation C C T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000398665 p.Q443* TSPAN16 chr19 11298323 11298323 Missense_Mutation G G A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000316737 p.R84K HAPLN4 chr19 19260916 19260916 Silent G G A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000291481 p.S127S GRAMD1A chr19 35009247 35009247 Missense_Mutation A A C TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000317991 p.D46A FOSB chr19 45470564 45470564 Intron G G T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000353609 ZNF418 chr19 57927354 57927354 Missense_Mutation T T A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000396147 p.H276L PSMF1 chr20 1166131 1166131 3'UTR C C T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000333082 PRNP chr20 4700405 4700405 3'UTR G G T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000379440 CST9L chr20 23566059 23566059 Missense_Mutation T T G TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000376979 p.E90A DHX35 chr20 39025335 39025335 Nonsense_Mutation C C T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000252011 p.Q593* SLC9A8 chr20 49815029 49815029 Silent T T C TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000361573 p.H16H IGLV5-37 chr22 22427953 22427953 Missense_Mutation A A C TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000390300 p.N96T POM121L9P chr22 24261019 24261019 RNA A A G TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000414583 GGT1 chr22 24610286 24610286 5'UTR A A G TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000248923 MYO18B chr22 26026706 26026706 Silent C C T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000536101 p.P2244P GRAP2 chr22 39971063 39971063 Silent C C T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000344138 p.Y324Y SMC1B chr22 45389749 45389749 Missense_Mutation G G C TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000357450 p.A565G SMC1B chr22 45389750 45389750 Missense_Mutation C C T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000357450 p.A565T SHANK3 chr22 50721398 50721398 RNA G G A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000414786 BMP15 chrX 50915965 50915965 Silent C C T TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000252677 p.N179N ZCCHC5 chrX 78657862 78657862 Missense_Mutation G G A TCGA-HE-A5NK-01A-11D-A26P-10 ENST00000321110 p.P187S FUCA1 chr1 23865612 23865612 Missense_Mutation T T C TCGA-B9-7268-01A-11D-2136-08 ENST00000374479 p.T135A MACF1 chr1 39332009 39332009 Missense_Mutation G G C TCGA-B9-7268-01A-11D-2136-08 ENST00000372915 p.Q1812H PABPC4 chr1 39563858 39563858 Silent C C T TCGA-B9-7268-01A-11D-2136-08 ENST00000372857 p.L490L RNF220 chr1 44650028 44650028 Intron G G T TCGA-B9-7268-01A-11D-2136-08 ENST00000355387 STXBP3 chr1 108760003 108760003 Missense_Mutation T T G TCGA-B9-7268-01A-11D-2136-08 ENST00000370008 p.F119C C1orf54 chr1 150275800 150275803 Splice_Site GTGA GTGA - TCGA-B9-7268-01A-11D-2136-08 ENST00000369099 p.X63_splice ZNF687 chr1 151286897 151286897 Silent C C G TCGA-B9-7268-01A-11D-2136-08 ENST00000324048 p.A202A LTBP1 chr2 33186933 33186933 Frame_Shift_Del G G - TCGA-B9-7268-01A-11D-2136-08 ENST00000404816 p.G427Efs*40 LTBP1 chr2 33186939 33186939 Missense_Mutation C C A TCGA-B9-7268-01A-11D-2136-08 ENST00000404816 p.L429I GGCX chr2 85550562 85550562 Missense_Mutation G G T TCGA-B9-7268-01A-11D-2136-08 ENST00000233838 p.R693S NEB chr2 151650819 151650819 Missense_Mutation C C T TCGA-B9-7268-01A-11D-2136-08 ENST00000172853 p.D2328N RAPGEF4 chr2 172967314 172967314 Missense_Mutation G G A TCGA-B9-7268-01A-11D-2136-08 ENST00000397081 p.D292N TNS1 chr2 217848261 217848261 Silent G G C TCGA-B9-7268-01A-11D-2136-08 ENST00000171887 p.P627P MYEOV2 chr2 240133954 240133954 Missense_Mutation C C G TCGA-B9-7268-01A-11D-2136-08 ENST00000607357 p.V39L TTLL3 chr3 9835397 9835397 Missense_Mutation G G A TCGA-B9-7268-01A-11D-2136-08 ENST00000426895 p.V886M CCDC12 chr3 46923267 46923267 Intron C C - TCGA-B9-7268-01A-11D-2136-08 ENST00000425441 NISCH chr3 52492291 52492291 Missense_Mutation C C A TCGA-B9-7268-01A-11D-2136-08 ENST00000345716 p.L1442I CADM2 chr3 86066801 86066801 3'UTR T T C TCGA-B9-7268-01A-11D-2136-08 ENST00000407528 KIAA2018 chr3 113657833 113657833 Silent G G T TCGA-B9-7268-01A-11D-2136-08 ENST00000316407 p.G1283G KIAA1109 chr4 122333685 122333685 Missense_Mutation A A G TCGA-B9-7268-01A-11D-2136-08 ENST00000264501 p.K3841R NUDT6 chr4 122922505 122922505 Missense_Mutation G G A TCGA-B9-7268-01A-11D-2136-08 ENST00000304430 p.S23L CBR4 chr4 169010057 169010057 Silent G G T TCGA-B9-7268-01A-11D-2136-08 ENST00000306193 p.S11S ARHGEF28 chr5 73840602 73840602 Silent T T C TCGA-B9-7268-01A-11D-2136-08 ENST00000426542 p.S423S BRD2 chr6 32972761 32972761 5'UTR A A G TCGA-B9-7268-01A-11D-2136-08 ENST00000374825 DNAH8 chr6 38737206 38737206 Missense_Mutation A A T TCGA-B9-7268-01A-11D-2136-08 ENST00000359357 p.E84V PRPH2 chr6 42698192 42698192 3'UTR C C T TCGA-B9-7268-01A-11D-2136-08 ENST00000230381 BCLAF1 chr6 136261412 136261412 Frame_Shift_Del T T - TCGA-B9-7268-01A-11D-2136-08 ENST00000531224 p.Q870Hfs*77 DFNA5 chr7 24706198 24706198 Missense_Mutation A A T TCGA-B9-7268-01A-11D-2136-08 ENST00000342947 p.V390D REPIN1 chr7 150371774 150371775 Frame_Shift_Ins - - A TCGA-B9-7268-01A-11D-2136-08 ENST00000397281 p.C179Mfs*24 SGK223 chr8 8377593 8377593 Silent A A T TCGA-B9-7268-01A-11D-2136-08 ENST00000622241 p.T272T CSPP1 chr8 67158520 67158520 Frame_Shift_Del G G - TCGA-B9-7268-01A-11D-2136-08 ENST00000262210 p.A769Qfs*27 NIPAL2 chr8 98203136 98203136 Silent A A T TCGA-B9-7268-01A-11D-2136-08 ENST00000341166 p.I284I C9orf91 chr9 114638571 114638571 Silent T T C TCGA-B9-7268-01A-11D-2136-08 ENST00000288502 p.L232L LIPA chr10 89214989 89214989 Frame_Shift_Del G G - TCGA-B9-7268-01A-11D-2136-08 ENST00000336233 p.A348Qfs*10 CUTC chr10 99747303 99747303 Missense_Mutation A A C TCGA-B9-7268-01A-11D-2136-08 ENST00000370476 p.L162F MCMBP chr10 119838572 119838572 Silent A A G TCGA-B9-7268-01A-11D-2136-08 ENST00000360003 p.D459D STIP1 chr11 64204186 64204186 3'UTR C C A TCGA-B9-7268-01A-11D-2136-08 ENST00000305218 ENDOD1 chr11 95128993 95128993 Missense_Mutation C C G TCGA-B9-7268-01A-11D-2136-08 ENST00000278505 p.S306C UBE4A chr11 118373124 118373124 Missense_Mutation G G A TCGA-B9-7268-01A-11D-2136-08 ENST00000252108 p.E254K MCAM chr11 119312291 119312291 Missense_Mutation A A C TCGA-B9-7268-01A-11D-2136-08 ENST00000264036 p.S333R APOLD1 chr12 12787248 12787248 Missense_Mutation C C T TCGA-B9-7268-01A-11D-2136-08 ENST00000326765 p.R146W ANP32D chr12 48472714 48472714 Missense_Mutation C C A TCGA-B9-7268-01A-11D-2136-08 ENST00000266594 p.S17Y KRT4 chr12 52811862 52811862 Missense_Mutation C C G TCGA-B9-7268-01A-11D-2136-08 ENST00000551956 p.S193T LRRIQ1 chr12 85056074 85056074 Silent G G T TCGA-B9-7268-01A-11D-2136-08 ENST00000393217 p.V427V METAP2 chr12 95474058 95474058 5'UTR G G T TCGA-B9-7268-01A-11D-2136-08 ENST00000323666 SYCP3 chr12 101731631 101731631 Silent T T C TCGA-B9-7268-01A-11D-2136-08 ENST00000266743 p.Q163Q GATC chr12 120446708 120446708 Missense_Mutation C C T TCGA-B9-7268-01A-11D-2136-08 ENST00000551765 p.L45F MNAT1 chr14 60968241 60968241 Silent T T C TCGA-B9-7268-01A-11D-2136-08 ENST00000261245 p.H274H TERF2 chr16 69368442 69368442 Missense_Mutation C C G TCGA-B9-7268-01A-11D-2136-08 ENST00000254942 p.S294T GINS2 chr16 85681606 85681606 Missense_Mutation T T C TCGA-B9-7268-01A-11D-2136-08 ENST00000253462 p.E94G COX10 chr17 14102191 14102191 Silent T T A TCGA-B9-7268-01A-11D-2136-08 ENST00000261643 p.L191L POTEC chr18 14513781 14513781 Nonsense_Mutation C C A TCGA-B9-7268-01A-11D-2136-08 ENST00000358970 p.E472* SMARCA4 chr19 11033793 11033793 Silent C C A TCGA-B9-7268-01A-11D-2136-08 ENST00000344626 p.G1267G FAM187B chr19 35227971 35227971 Missense_Mutation C C T TCGA-B9-7268-01A-11D-2136-08 ENST00000324675 p.G237E ZNF780B chr19 40034887 40034887 Missense_Mutation G G C TCGA-B9-7268-01A-11D-2136-08 ENST00000434248 p.Q658E BCKDHA chr19 41424636 41424636 3'UTR C C G TCGA-B9-7268-01A-11D-2136-08 ENST00000269980 ATP1A3 chr19 41988093 41988093 Missense_Mutation G G A TCGA-B9-7268-01A-11D-2136-08 ENST00000302102 p.P67L ZNF836 chr19 52156843 52156843 Silent G G A TCGA-B9-7268-01A-11D-2136-08 ENST00000597252 p.G280G SCARF2 chr22 20437610 20437610 Missense_Mutation G G T TCGA-B9-7268-01A-11D-2136-08 ENST00000622235 p.R49S BMS1P20 chr22 22307199 22307199 RNA C C G TCGA-B9-7268-01A-11D-2136-08 ENST00000426066 APOL6 chr22 35656381 35656381 Splice_Region A A T TCGA-B9-7268-01A-11D-2136-08 ENST00000409652 ALK chr2 29209864 29209864 Missense_Mutation C C G TCGA-B3-3926-01A-01D-1252-08 ENST00000389048 p.R1253T TTN chr2 178611826 178611826 Missense_Mutation G G T TCGA-B3-3926-01A-01D-1252-08 ENST00000591111 p.A15187D PLXND1 chr3 129565907 129565907 Missense_Mutation C C A TCGA-B3-3926-01A-01D-1252-08 ENST00000324093 p.K1434N CLSTN2 chr3 140403668 140403668 Missense_Mutation C C A TCGA-B3-3926-01A-01D-1252-08 ENST00000458420 p.P91H RBAK chr7 5065596 5065596 Missense_Mutation C C T TCGA-B3-3926-01A-01D-1252-08 ENST00000353796 p.L714F EPDR1 chr7 37921165 37921165 Missense_Mutation G G T TCGA-B3-3926-01A-01D-1252-08 ENST00000199448 p.V76L RP11-396K3.1 chr7 73199760 73199760 RNA C C T TCGA-B3-3926-01A-01D-1252-08 ENST00000544802 CREB3 chr9 35733062 35733062 Missense_Mutation A A G TCGA-B3-3926-01A-01D-1252-08 ENST00000353704 p.I66V HECTD2 chr10 91484496 91484496 Intron A A G TCGA-B3-3926-01A-01D-1252-08 ENST00000298068 TEAD1 chr11 12930171 12930171 Splice_Region C C T TCGA-B3-3926-01A-01D-1252-08 ENST00000527636 MRGPRX4 chr11 18173701 18173701 Silent C C T TCGA-B3-3926-01A-01D-1252-08 ENST00000314254 p.L149L TAOK3 chr12 118161832 118161832 Nonsense_Mutation T T A TCGA-B3-3926-01A-01D-1252-08 ENST00000392533 p.R699* REC8 chr14 24177373 24177373 Missense_Mutation G G C TCGA-B3-3926-01A-01D-1252-08 ENST00000611366 p.A243P NEMF chr14 49852775 49852775 5'UTR C C A TCGA-B3-3926-01A-01D-1252-08 ENST00000298310 SAV1 chr14 50665404 50665411 Frame_Shift_Del CTAGACTT CTAGACTT - TCGA-B3-3926-01A-01D-1252-08 ENST00000324679 p.R101Sfs*5 MRC2 chr17 62688962 62688962 Splice_Site T T C TCGA-B3-3926-01A-01D-1252-08 ENST00000303375 p.X1112_splice UBA52 chr19 18574947 18574947 Missense_Mutation A A T TCGA-B3-3926-01A-01D-1252-08 ENST00000430157 p.N90Y HNRNPUL1 chr19 41302714 41302714 Missense_Mutation C C G TCGA-B3-3926-01A-01D-1252-08 ENST00000392006 p.F579L ELF4 chrX 130069469 130069469 Missense_Mutation G G A TCGA-B3-3926-01A-01D-1252-08 ENST00000308167 p.P340S ADGRB2 chr1 31740140 31740140 Missense_Mutation T T G TCGA-IA-A40U-01A-11D-A25F-10 ENST00000373658 p.E676D PMF1 chr1 156239601 156239601 Nonstop_Mutation A A C TCGA-IA-A40U-01A-11D-A25F-10 ENST00000368277 p.*206Cext*70 OR2T3 chr1 248473874 248473874 Missense_Mutation A A C TCGA-IA-A40U-01A-11D-A25F-10 ENST00000359594 p.Q175P WDR54 chr2 74423981 74423981 Missense_Mutation A A G TCGA-IA-A40U-01A-11D-A25F-10 ENST00000348227 p.Q178R DPP10 chr2 114442626 114442626 5'UTR G G C TCGA-IA-A40U-01A-11D-A25F-10 ENST00000410059 INO80D chr2 206056907 206056907 Silent G G A TCGA-IA-A40U-01A-11D-A25F-10 ENST00000403263 p.I85I ERBB4 chr2 211383724 211383724 Missense_Mutation C C T TCGA-IA-A40U-01A-11D-A25F-10 ENST00000342788 p.R1273Q ZNF501 chr3 44736860 44736860 3'UTR A A G TCGA-IA-A40U-01A-11D-A25F-10 ENST00000396048 TKT chr3 53255998 53255998 5'UTR C C T TCGA-IA-A40U-01A-11D-A25F-10 ENST00000423525 CCDC66 chr3 56593011 56593011 Missense_Mutation A A C TCGA-IA-A40U-01A-11D-A25F-10 ENST00000394672 p.Q326H TRIM42 chr3 140682912 140682912 Silent G G A TCGA-IA-A40U-01A-11D-A25F-10 ENST00000286349 p.K264K PRKCI chr3 170295920 170295920 Frame_Shift_Del A A - TCGA-IA-A40U-01A-11D-A25F-10 ENST00000295797 p.K477Nfs*11 CDKL2 chr4 75607249 75607249 Missense_Mutation G G A TCGA-IA-A40U-01A-11D-A25F-10 ENST00000429927 p.T159I FAT4 chr4 125319844 125319844 Missense_Mutation G G A TCGA-IA-A40U-01A-11D-A25F-10 ENST00000394329 p.D1145N NUP155 chr5 37307307 37307307 Missense_Mutation A A G TCGA-IA-A40U-01A-11D-A25F-10 ENST00000231498 p.F965L RNF14 chr5 141978374 141978374 Missense_Mutation G G T TCGA-IA-A40U-01A-11D-A25F-10 ENST00000347642 p.W126C GEMIN5 chr5 154898553 154898553 Missense_Mutation C C T TCGA-IA-A40U-01A-11D-A25F-10 ENST00000285873 p.V1078I TULP1 chr6 35503829 35503829 Missense_Mutation G G C TCGA-IA-A40U-01A-11D-A25F-10 ENST00000229771 p.R378G COL12A1 chr6 75175086 75175086 Missense_Mutation C C T TCGA-IA-A40U-01A-11D-A25F-10 ENST00000322507 p.A888T CNKSR3 chr6 154410976 154410976 Missense_Mutation T T C TCGA-IA-A40U-01A-11D-A25F-10 ENST00000607772 p.N413D SLC12A9 chr7 100855648 100855648 Intron C C G TCGA-IA-A40U-01A-11D-A25F-10 ENST00000354161 MET chr7 116757489 116757489 Missense_Mutation A A C TCGA-IA-A40U-01A-11D-A25F-10 ENST00000397752 p.I639L COPG2 chr7 130652905 130652905 Missense_Mutation G G C TCGA-IA-A40U-01A-11D-A25F-10 ENST00000425248 p.A96G C9orf89 chr9 93112272 93112272 3'UTR T T G TCGA-IA-A40U-01A-11D-A25F-10 ENST00000466409 C9orf89 chr9 93112273 93112273 3'UTR G G T TCGA-IA-A40U-01A-11D-A25F-10 ENST00000466409 CCDC3 chr10 13001327 13001327 Missense_Mutation G G T TCGA-IA-A40U-01A-11D-A25F-10 ENST00000378825 p.L82M VSTM4 chr10 49103787 49103790 Intron GGGC GGGC - TCGA-IA-A40U-01A-11D-A25F-10 ENST00000332853 C10orf76 chr10 102029740 102029740 Silent C C T TCGA-IA-A40U-01A-11D-A25F-10 ENST00000370033 p.L104L PSD chr10 102413873 102413873 Missense_Mutation C C A TCGA-IA-A40U-01A-11D-A25F-10 ENST00000020673 p.E483D PSMA1 chr11 14514475 14514475 Nonsense_Mutation C C A TCGA-IA-A40U-01A-11D-A25F-10 ENST00000396394 p.E91* INPPL1 chr11 72233120 72233120 Missense_Mutation G G T TCGA-IA-A40U-01A-11D-A25F-10 ENST00000298229 p.G666V MMP27 chr11 102692958 102692958 Missense_Mutation T T G TCGA-IA-A40U-01A-11D-A25F-10 ENST00000260229 p.D426A PAFAH1B2 chr11 117167648 117167648 Missense_Mutation C C G TCGA-IA-A40U-01A-11D-A25F-10 ENST00000527958 p.I213M RECQL chr12 21470211 21470211 Missense_Mutation T T G TCGA-IA-A40U-01A-11D-A25F-10 ENST00000421138 p.K645Q HOXC10 chr12 53989205 53989205 Missense_Mutation T T C TCGA-IA-A40U-01A-11D-A25F-10 ENST00000303460 p.L263P LRIG3 chr12 58914266 58914266 Missense_Mutation C C T TCGA-IA-A40U-01A-11D-A25F-10 ENST00000320743 p.V103M RBM19 chr12 113962414 113962414 Missense_Mutation T T C TCGA-IA-A40U-01A-11D-A25F-10 ENST00000261741 p.M13V RBM19 chr12 113962415 113962415 Splice_Site C C T TCGA-IA-A40U-01A-11D-A25F-10 ENST00000261741 p.X13_splice UBC chr12 124913109 124913109 Silent C C A TCGA-IA-A40U-01A-11D-A25F-10 ENST00000339647 p.L221L CLMN chr14 95204043 95204043 Missense_Mutation G G A TCGA-IA-A40U-01A-11D-A25F-10 ENST00000298912 p.P436S CHRFAM7A chr15 30373016 30373017 Frame_Shift_Del AT AT - TCGA-IA-A40U-01A-11D-A25F-10 ENST00000299847 p.I97Qfs*20 CSPG4 chr15 75675868 75675868 Missense_Mutation G G C TCGA-IA-A40U-01A-11D-A25F-10 ENST00000308508 p.F2217L RHCG chr15 89486907 89486907 Missense_Mutation G G A TCGA-IA-A40U-01A-11D-A25F-10 ENST00000268122 p.A88V FES chr15 90895566 90895566 3'UTR A A - TCGA-IA-A40U-01A-11D-A25F-10 ENST00000328850 STUB1 chr16 682019 682019 Splice_Site G G T TCGA-IA-A40U-01A-11D-A25F-10 ENST00000219548 p.X205_splice DNASE1L2 chr16 2238414 2238416 Nonstop_Mutation GAT GAT - TCGA-IA-A40U-01A-11D-A25F-10 ENST00000320700 p.*300delext*14 NPIPB6 chr16 28342989 28342989 Frame_Shift_Del T T - TCGA-IA-A40U-01A-11D-A25F-10 ENST00000532254 p.N299Ifs*23 GLG1 chr16 74471267 74471267 Missense_Mutation A A C TCGA-IA-A40U-01A-11D-A25F-10 ENST00000422840 p.I712R C16orf46 chr16 81061367 81061367 Nonsense_Mutation G G A TCGA-IA-A40U-01A-11D-A25F-10 ENST00000299578 p.Q328* NCOR1 chr17 16065638 16065638 Missense_Mutation G G T TCGA-IA-A40U-01A-11D-A25F-10 ENST00000268712 p.Q1600K LRRC37A chr17 46332651 46332652 Frame_Shift_Ins - - T TCGA-IA-A40U-01A-11D-A25F-10 ENST00000320254 p.V1603Cfs*13 DNAH17 chr17 78453453 78453453 Silent G G T TCGA-IA-A40U-01A-11D-A25F-10 ENST00000389840 p.V3473V RDH8 chr19 10021806 10021806 3'UTR T T A TCGA-IA-A40U-01A-11D-A25F-10 ENST00000591589 MAP4K1 chr19 38611109 38611115 Frame_Shift_Del ATGAAGT ATGAAGT - TCGA-IA-A40U-01A-11D-A25F-10 ENST00000591517 p.N249Tfs*5 MZF1 chr19 58571332 58571332 Missense_Mutation C C T TCGA-IA-A40U-01A-11D-A25F-10 ENST00000215057 p.V20I URB1 chr21 32355556 32355556 Missense_Mutation C C A TCGA-IA-A40U-01A-11D-A25F-10 ENST00000382751 p.D667Y KB-1572G7.2 chr22 23715124 23715124 RNA T T C TCGA-IA-A40U-01A-11D-A25F-10 ENST00000421064 TAB1 chr22 39418790 39418790 Silent G G A TCGA-IA-A40U-01A-11D-A25F-10 ENST00000216160 p.L203L CA6 chr1 8949317 8949317 Frame_Shift_Del A A - TCGA-B9-4116-01A-01D-1252-08 ENST00000377443 p.Q45Rfs*19 PRAMEF19 chr1 13369096 13369096 Missense_Mutation T T G TCGA-B9-4116-01A-01D-1252-08 ENST00000376101 p.N402H FGR chr1 27616997 27616997 Missense_Mutation G G A TCGA-B9-4116-01A-01D-1252-08 ENST00000374003 p.S181F PABPC4 chr1 39572570 39572570 Frame_Shift_Del G G - TCGA-B9-4116-01A-01D-1252-08 ENST00000372857 p.D70Efs*3 PABPC4 chr1 39572572 39572572 Missense_Mutation C C A TCGA-B9-4116-01A-01D-1252-08 ENST00000372857 p.D70Y PBX1 chr1 164792559 164792559 Missense_Mutation A A T TCGA-B9-4116-01A-01D-1252-08 ENST00000420696 p.M111L CACNA1S chr1 201070354 201070354 Missense_Mutation G G A TCGA-B9-4116-01A-01D-1252-08 ENST00000362061 p.P760S EGLN1 chr1 231366446 231366446 Nonsense_Mutation T T A TCGA-B9-4116-01A-01D-1252-08 ENST00000366641 p.K416* MYCN chr2 15945936 15945936 Missense_Mutation G G C TCGA-B9-4116-01A-01D-1252-08 ENST00000281043 p.V412L LCLAT1 chr2 30640299 30640307 In_Frame_Del GAAGAGAAA GAAGAGAAA - TCGA-B9-4116-01A-01D-1252-08 ENST00000309052 p.K311_E313del MAT2A chr2 85541971 85541974 Splice_Site AAGT AAGT - TCGA-B9-4116-01A-01D-1252-08 ENST00000306434 p.X183_splice C2orf80 chr2 208180809 208180809 Missense_Mutation A A C TCGA-B9-4116-01A-01D-1252-08 ENST00000341287 p.I101S ZFAND2B chr2 219207276 219207278 Intron AGA AGA - TCGA-B9-4116-01A-01D-1252-08 ENST00000289528 OGG1 chr3 9751913 9751913 Missense_Mutation A A G TCGA-B9-4116-01A-01D-1252-08 ENST00000344629 p.T177A MON1A chr3 49909023 49909023 Silent G G A TCGA-B9-4116-01A-01D-1252-08 ENST00000296473 p.L650L TMF1 chr3 69047556 69047556 Silent T T C TCGA-B9-4116-01A-01D-1252-08 ENST00000398559 p.T383T ZBTB11 chr3 101651403 101651403 Missense_Mutation T T G TCGA-B9-4116-01A-01D-1252-08 ENST00000312938 p.Q975H PVRL3 chr3 111112142 111112142 Nonsense_Mutation G G A TCGA-B9-4116-01A-01D-1252-08 ENST00000485303 p.W91* C3orf17 chr3 113017519 113017521 In_Frame_Del CAT CAT - TCGA-B9-4116-01A-01D-1252-08 ENST00000314400 p.D63del ZDHHC19 chr3 196209363 196209363 Intron G G C TCGA-B9-4116-01A-01D-1252-08 ENST00000296326 PIGZ chr3 196948249 196948249 Silent A A T TCGA-B9-4116-01A-01D-1252-08 ENST00000412723 p.L216L RFC1 chr4 39323412 39323412 Silent C C T TCGA-B9-4116-01A-01D-1252-08 ENST00000381897 p.E216E UGT2B7 chr4 69102925 69102925 Missense_Mutation A A T TCGA-B9-4116-01A-01D-1252-08 ENST00000305231 p.Q330L ANTXR2 chr4 80071655 80071655 Splice_Site C C A TCGA-B9-4116-01A-01D-1252-08 ENST00000307333 p.X51_splice STPG2 chr4 97943961 97943961 Missense_Mutation T T G TCGA-B9-4116-01A-01D-1252-08 ENST00000295268 p.N327T NPY2R chr4 155214907 155214907 Missense_Mutation T T G TCGA-B9-4116-01A-01D-1252-08 ENST00000329476 p.L323R FAT1 chr4 186628253 186628253 Missense_Mutation C C A TCGA-B9-4116-01A-01D-1252-08 ENST00000441802 p.V1571F CDH9 chr5 26906052 26906052 Missense_Mutation C C T TCGA-B9-4116-01A-01D-1252-08 ENST00000231021 p.D240N MED7 chr5 157138876 157138876 Missense_Mutation T T G TCGA-B9-4116-01A-01D-1252-08 ENST00000286317 p.T186P SLC25A27 chr6 46662396 46662396 Missense_Mutation T T C TCGA-B9-4116-01A-01D-1252-08 ENST00000371347 p.M135T SLC22A16 chr6 110435903 110435903 Missense_Mutation G G A TCGA-B9-4116-01A-01D-1252-08 ENST00000368919 p.A457V MAP7 chr6 136388489 136388489 Missense_Mutation G G A TCGA-B9-4116-01A-01D-1252-08 ENST00000354570 p.R144W OLIG3 chr6 137494239 137494239 5'UTR A A - TCGA-B9-4116-01A-01D-1252-08 ENST00000367734 SYNJ2 chr6 158028937 158028937 Silent A A T TCGA-B9-4116-01A-01D-1252-08 ENST00000355585 p.S132S NOD1 chr7 30436035 30436035 Missense_Mutation T T A TCGA-B9-4116-01A-01D-1252-08 ENST00000222823 p.R862W EIF4H chr7 74187663 74187663 Missense_Mutation A A G TCGA-B9-4116-01A-01D-1252-08 ENST00000265753 p.T38A BAIAP2L1 chr7 98304349 98304349 Silent G G A TCGA-B9-4116-01A-01D-1252-08 ENST00000005260 p.T423T ANKRD7 chr7 118239935 118239935 Missense_Mutation C C A TCGA-B9-4116-01A-01D-1252-08 ENST00000265224 p.H247N PRKAG2 chr7 151565886 151565886 Splice_Site C C T TCGA-B9-4116-01A-01D-1252-08 ENST00000287878 p.X412_splice FAM84B chr8 126557005 126557005 Missense_Mutation G G C TCGA-B9-4116-01A-01D-1252-08 ENST00000304916 p.Q129E ARHGEF39 chr9 35660720 35660720 3'UTR G G A TCGA-B9-4116-01A-01D-1252-08 ENST00000378387 SEC16A chr9 136474743 136474743 Frame_Shift_Del G G - TCGA-B9-4116-01A-01D-1252-08 ENST00000313050 p.P958Lfs*9 ADIRF chr10 86968492 86968492 5'UTR G G A TCGA-B9-4116-01A-01D-1252-08 ENST00000372013 FAM45A chr10 119120361 119120361 Missense_Mutation A A T TCGA-B9-4116-01A-01D-1252-08 ENST00000361432 p.M168L LRRC4C chr11 40115076 40115080 Frame_Shift_Del AGCAC AGCAC - TCGA-B9-4116-01A-01D-1252-08 ENST00000278198 p.V405Qfs*2 TRIM48 chr11 55265253 55265253 Missense_Mutation G G T TCGA-B9-4116-01A-01D-1252-08 ENST00000417545 p.S133I COX8A chr11 63976293 63976293 Missense_Mutation C C G TCGA-B9-4116-01A-01D-1252-08 ENST00000314133 p.H61Q SCYL1 chr11 65538023 65538023 Nonsense_Mutation G G A TCGA-B9-4116-01A-01D-1252-08 ENST00000270176 p.W696* FGF3 chr11 69810695 69810696 Frame_Shift_Ins - - T TCGA-B9-4116-01A-01D-1252-08 ENST00000334134 p.H110Qfs*18 FGF3 chr11 69810697 69810697 Missense_Mutation G G T TCGA-B9-4116-01A-01D-1252-08 ENST00000334134 p.H110N IGSF9B chr11 133935763 133935763 Splice_Site C C T TCGA-B9-4116-01A-01D-1252-08 ENST00000321016 p.X274_splice MFSD5 chr12 53253491 53253491 Missense_Mutation T T G TCGA-B9-4116-01A-01D-1252-08 ENST00000329548 p.L219R ITGA7 chr12 55703086 55703086 Frame_Shift_Del T T - TCGA-B9-4116-01A-01D-1252-08 ENST00000555728 p.E100Gfs*60 SMARCC2 chr12 56165698 56165698 Missense_Mutation A A G TCGA-B9-4116-01A-01D-1252-08 ENST00000267064 p.L920P PPFIA2 chr12 81267941 81267941 Silent A A G TCGA-B9-4116-01A-01D-1252-08 ENST00000549396 p.L1153L KIAA1033 chr12 105118479 105118481 In_Frame_Del GTG GTG - TCGA-B9-4116-01A-01D-1252-08 ENST00000332180 p.V158del ATXN2 chr12 111525248 111525248 Missense_Mutation A A G TCGA-B9-4116-01A-01D-1252-08 ENST00000377617 p.W374R ZNF10 chr12 133155694 133155694 Missense_Mutation G G C TCGA-B9-4116-01A-01D-1252-08 ENST00000248211 p.V150L IL17D chr13 20721855 20721855 Silent C C T TCGA-B9-4116-01A-01D-1252-08 ENST00000304920 p.V170V FGF9 chr13 21671795 21671796 5'UTR - - G TCGA-B9-4116-01A-01D-1252-08 ENST00000382353 COQ6 chr14 73950182 73950182 5'Flank T T C TCGA-B9-4116-01A-01D-1252-08 ENST00000334571 SNX22 chr15 64153438 64153438 Intron C C A TCGA-B9-4116-01A-01D-1252-08 ENST00000325881 IGF1R chr15 98922403 98922403 Missense_Mutation C C A TCGA-B9-4116-01A-01D-1252-08 ENST00000268035 p.N819K MKL2 chr16 14252371 14252371 Missense_Mutation T T G TCGA-B9-4116-01A-01D-1252-08 ENST00000318282 p.S808A BFAR chr16 14661943 14661943 Missense_Mutation C C G TCGA-B9-4116-01A-01D-1252-08 ENST00000261658 p.P279A GPRC5B chr16 19872726 19872726 Silent G G A TCGA-B9-4116-01A-01D-1252-08 ENST00000300571 p.D40D BCL7C chr16 30887866 30887866 Silent C C T TCGA-B9-4116-01A-01D-1252-08 ENST00000215115 p.*218* ZNF423 chr16 49637367 49637367 Missense_Mutation G G T TCGA-B9-4116-01A-01D-1252-08 ENST00000262383 p.H595Q BBS2 chr16 56497751 56497751 Silent G G A TCGA-B9-4116-01A-01D-1252-08 ENST00000245157 p.L597L NPIPB15 chr16 74391545 74391545 Missense_Mutation C C A TCGA-B9-4116-01A-01D-1252-08 ENST00000429990 p.P266H ZC3H18 chr16 88586615 88586615 Nonsense_Mutation G G T TCGA-B9-4116-01A-01D-1252-08 ENST00000301011 p.E207* MINK1 chr17 4897245 4897245 Silent T T G TCGA-B9-4116-01A-01D-1252-08 ENST00000355280 p.V1319V SLC16A13 chr17 7038849 7038850 In_Frame_Ins - - ATA TCGA-B9-4116-01A-01D-1252-08 ENST00000308027 p.I348dup YBX2 chr17 7290013 7290013 Missense_Mutation C C A TCGA-B9-4116-01A-01D-1252-08 ENST00000007699 p.G268V SPEM1 chr17 7420948 7420948 Silent C C A TCGA-B9-4116-01A-01D-1252-08 ENST00000323675 p.V91V GUCY2D chr17 8015987 8015987 Missense_Mutation A A C TCGA-B9-4116-01A-01D-1252-08 ENST00000254854 p.Y1035S NCOR1 chr17 16061420 16061420 Silent A A G TCGA-B9-4116-01A-01D-1252-08 ENST00000268712 p.S1954S PLEKHH3 chr17 42669459 42669459 Nonsense_Mutation C C A TCGA-B9-4116-01A-01D-1252-08 ENST00000591022 p.E726* UBTF chr17 44212350 44212350 Missense_Mutation C C G TCGA-B9-4116-01A-01D-1252-08 ENST00000302904 p.E255D GTF2F1 chr19 6393053 6393053 5'UTR C C A TCGA-B9-4116-01A-01D-1252-08 ENST00000394456 TIMM44 chr19 7938112 7938112 Missense_Mutation T T A TCGA-B9-4116-01A-01D-1252-08 ENST00000270538 p.E76V RAB11B chr19 8403446 8403447 Frame_Shift_Del CA CA - TCGA-B9-4116-01A-01D-1252-08 ENST00000328024 p.A182Gfs*100 OR7E24 chr19 9251599 9251599 Missense_Mutation T T G TCGA-B9-4116-01A-01D-1252-08 ENST00000456448 p.C186G RDH8 chr19 10021542 10021542 Silent C C A TCGA-B9-4116-01A-01D-1252-08 ENST00000591589 p.V263V UPF1 chr19 18852999 18852999 Missense_Mutation A A G TCGA-B9-4116-01A-01D-1252-08 ENST00000599848 p.I329V HSD17B14 chr19 48813278 48813278 Missense_Mutation A A C TCGA-B9-4116-01A-01D-1252-08 ENST00000263278 p.F237C CHGB chr20 5922381 5922381 Silent A A G TCGA-B9-4116-01A-01D-1252-08 ENST00000378961 p.T79T NKX2-4 chr20 21395938 21395938 Silent G G T TCGA-B9-4116-01A-01D-1252-08 ENST00000351817 p.A346A CEP250 chr20 35503623 35503623 Frame_Shift_Del A A - TCGA-B9-4116-01A-01D-1252-08 ENST00000397527 p.D1753Tfs*14 ACTR5 chr20 38771676 38771676 Missense_Mutation G G C TCGA-B9-4116-01A-01D-1252-08 ENST00000243903 p.G562R ZNFX1 chr20 49247489 49247489 Silent G G A TCGA-B9-4116-01A-01D-1252-08 ENST00000371752 p.H1845H ZNFX1 chr20 49247490 49247490 Missense_Mutation T T G TCGA-B9-4116-01A-01D-1252-08 ENST00000371752 p.H1845P YTHDF1 chr20 63202440 63202440 Silent T T C TCGA-B9-4116-01A-01D-1252-08 ENST00000370339 p.K500K PRDM15 chr21 41801629 41801629 Missense_Mutation C C G TCGA-B9-4116-01A-01D-1252-08 ENST00000269844 p.A1379P CECR2 chr22 17548890 17548890 Silent T T A TCGA-B9-4116-01A-01D-1252-08 ENST00000342247 p.P1221P RGL4 chr22 23698861 23698861 Missense_Mutation A A T TCGA-B9-4116-01A-01D-1252-08 ENST00000290691 p.Q467L EP300 chr22 41176947 41176947 Missense_Mutation T T A TCGA-B9-4116-01A-01D-1252-08 ENST00000263253 p.C1746S ZDHHC15 chrX 75523074 75523074 5'UTR C C T TCGA-B9-4116-01A-01D-1252-08 ENST00000373367 CPSF3L chr1 1312841 1312841 Missense_Mutation G G A TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000435064 p.H414Y MTHFR chr1 11803219 11803219 Intron C C G TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000376590 ZBTB40 chr1 22490156 22490156 Missense_Mutation G G A TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000375647 p.E70K ZMYM6 chr1 34987942 34987942 Missense_Mutation G G A TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000357182 p.S1047L ZFYVE9 chr1 52238425 52238425 Silent T T C TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000287727 p.G336G TTC4 chr1 54716128 54716128 Intron C C A TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000371281 GSTM3 chr1 109737005 109737005 3'UTR A A C TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000256594 PPOX chr1 161170750 161170751 Frame_Shift_Ins - - CTTGGTCCATCTA TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000352210 p.H415Lfs*24 SELE chr1 169733655 169733655 5'UTR A A G TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000333360 TNFSF4 chr1 173205338 173205339 Intron - - A TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000281834 RASAL2 chr1 178094651 178094651 Silent T T C TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000367649 p.L53L CDC73 chr1 193150365 193150365 Missense_Mutation G G C TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000367435 p.R297T DISP1 chr1 223003506 223003506 Silent A A G TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000284476 p.R703R DISC1 chr1 231958828 231958828 Missense_Mutation A A G TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000439617 p.E661G C2orf70 chr2 26576013 26576013 Silent T T C TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000329615 p.T62T CEBPZOS chr2 37202644 37202644 Intron C C T TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000392061 MTA3 chr2 42704295 42704295 Missense_Mutation G G A TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000405094 p.G376E ASPRV1 chr2 69961318 69961318 Missense_Mutation T T C TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000320256 p.N124S ANKRD36 chr2 97183591 97183591 Frame_Shift_Del A A - TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000420699 p.K627Rfs*6 WDR33 chr2 127725117 127725117 Missense_Mutation A A C TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000322313 p.I317S MBD5 chr2 148485751 148485751 Missense_Mutation C C T TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000407073 p.S952L TTN chr2 178741672 178741672 Missense_Mutation A A T TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000591111 p.F3537Y MYO1B chr2 191341503 191341504 Frame_Shift_Ins - - A TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000304164 p.G132Rfs*5 UNC80 chr2 209959707 209959707 Missense_Mutation G G C TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000439458 p.R2536T KCNE4 chr2 223055455 223055455 3'UTR C C T TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000281830 COL4A3 chr2 227311814 227311814 Frame_Shift_Del G G - TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000396578 p.E1654Nfs*2 TRIP12 chr2 229807631 229807637 Intron ATCCACC ATCCACC - TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000283943 UGT1A9 chr2 233672449 233672449 Missense_Mutation T T C TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000354728 p.I172T ZNF660 chr3 44595101 44595101 Missense_Mutation A A T TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000322734 p.K303I RNF123 chr3 49702728 49702729 Frame_Shift_Ins - - A TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000327697 p.N576Kfs*8 ITIH1 chr3 52788019 52788019 Missense_Mutation C C A TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000273283 p.T653N EPHA6 chr3 97592622 97592622 Silent G G A TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000389672 p.P799P ABI3BP chr3 100846490 100846490 Intron G G A TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000284322 MBNL1 chr3 152414990 152414990 Missense_Mutation T T C TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000282486 p.L75S TNFSF10 chr3 172506528 172506528 Silent A A G TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000241261 p.H270H EHHADH chr3 185229489 185229489 Missense_Mutation T T C TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000231887 p.T136A TMEM156 chr4 38988849 38988849 Splice_Site A A C TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000381938 p.X247_splice SHROOM3 chr4 76436043 76436043 5'UTR T T C TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000296043 RASGEF1B chr4 81448281 81448281 Missense_Mutation T T C TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000264400 p.T148A WDFY3 chr4 84810016 84810016 Nonsense_Mutation G G T TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000295888 p.S739* ANK2 chr4 113232259 113232259 Splice_Region G G A TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000357077 p.E161E CCNA2 chr4 121818912 121818912 Missense_Mutation A A C TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000274026 p.F335C ZNF827 chr4 145765552 145765552 Missense_Mutation T T C TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000508784 p.E1016G SLC45A2 chr5 33954485 33954485 Nonsense_Mutation A A T TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000296589 p.L303* DAB2 chr5 39383089 39383089 Silent A A G TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000320816 p.P290P ELL2 chr5 95898535 95898536 Frame_Shift_Ins - - AGGTCTTG TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000237853 p.P411Kfs*38 FTMT chr5 121852047 121852047 Silent C C A TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000321339 p.L28L SLC23A1 chr5 139380364 139380365 Frame_Shift_Ins - - T TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000348729 p.S164Kfs*132 PCDHGB3 chr5 141372287 141372287 Silent C C A TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000576222 p.T631T WWC1 chr5 168385367 168385367 Missense_Mutation A A T TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000265293 p.Q129L MCM3 chr6 52276475 52276475 Splice_Region T A A TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000229854 p.G389G KIAA1586 chr6 57052774 57052774 Missense_Mutation A C C TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000370733 p.E92A HBS1L chr6 135036899 135036899 Intron G C C TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000367837 TTLL2 chr6 167325168 167325168 5'UTR C T T TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000239587 PCLO chr7 82949624 82949624 Missense_Mutation T T G TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000333891 p.K3655T ZAN chr7 100752070 100752070 Silent C C A TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000613979 p.T655T ZAN chr7 100752071 100752071 Missense_Mutation G G A TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000613979 p.V656I FAM71F2 chr7 128675770 128675770 Frame_Shift_Del T T - TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000480462 p.N92Kfs*4 FAM71F2 chr7 128675771 128675771 Missense_Mutation G G A TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000480462 p.V93I KDM7A chr7 140119190 140119190 Frame_Shift_Del G G - TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000397560 p.T390Nfs*17 SLC4A2 chr7 151076101 151076101 Missense_Mutation T T C TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000413384 p.L1187P AP3M2 chr8 42158066 42158066 Silent C C T TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000174653 p.L133L ARMC1 chr8 65605429 65605429 Missense_Mutation T T G TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000276569 p.K192T TP53INP1 chr8 94930275 94930275 3'UTR A A - TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000342697 TLN1 chr9 35697813 35697813 Nonsense_Mutation G G T TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000314888 p.S2535* CREB3 chr9 35736486 35736487 Frame_Shift_Ins - - A TCGA-SX-A7SS-01A-11D-A35Z-10 ENST00000353704 p.Q293Tfs*39 SPTLC1 chr9 92059304 92059322 Splice_Site TATCTCTGCAAGGAAAAGA TATCTCTGCAAGGAAAAGA - TCGA-SX-A7SS-01A-11D-A35Z-10 ENST000002625