Hugo_Symbol Chromosome Start_Position End_Position Variant_Classification Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 Tumor_Sample_Barcode transcript_name amino_acid_change LARP4 chr12 50437793 50437797 Frame_Shift_Del TTGTA TTGTA - TCGA-B0-5117-01A-01D-1421-08 ENST00000398473 p.I200Nfs*3 NCOR2 chr12 124372290 124372291 Frame_Shift_Ins - - G TCGA-B0-5117-01A-01D-1421-08 ENST00000405201 p.A847Rfs*3 SGCG chr13 23295473 23295473 Silent G G T TCGA-B0-5117-01A-01D-1421-08 ENST00000218867 p.P188P SLC16A13 chr17 7038174 7038174 Silent C C T TCGA-B0-5117-01A-01D-1421-08 ENST00000308027 p.F122F TP53 chr17 7674954 7674954 Missense_Mutation G G A TCGA-B0-5117-01A-01D-1421-08 ENST00000269305 p.H193Y UQCR10 chr22 29767428 29767428 Silent G G A TCGA-B0-5117-01A-01D-1421-08 ENST00000330029 p.L10L PLP2 chrX 49172095 49172096 Frame_Shift_Ins - - G TCGA-B0-5117-01A-01D-1421-08 ENST00000376327 p.I32Mfs*25 PRAMEF19 chr1 13370746 13370746 Missense_Mutation C C A TCGA-B0-5109-01A-02D-1421-08 ENST00000376101 p.A188S PI4KB chr1 151315660 151315660 Silent G G A TCGA-B0-5109-01A-02D-1421-08 ENST00000368873 p.R274R ILDR2 chr1 166939518 166939518 Missense_Mutation C C T TCGA-B0-5109-01A-02D-1421-08 ENST00000271417 p.M184I ZNF670 chr1 247039538 247039538 Splice_Site C C T TCGA-B0-5109-01A-02D-1421-08 ENST00000366503 p.X2_splice HSPD1 chr2 197495230 197495230 Intron A A - TCGA-B0-5109-01A-02D-1421-08 ENST00000345042 SPHKAP chr2 228016644 228016644 Missense_Mutation C C G TCGA-B0-5109-01A-02D-1421-08 ENST00000392056 p.E1404Q IL17RC chr3 9918574 9918574 Missense_Mutation G G T TCGA-B0-5109-01A-02D-1421-08 ENST00000295981 p.V215L NPHP3 chr3 132697363 132697363 Splice_Site C C A TCGA-B0-5109-01A-02D-1421-08 ENST00000337331 p.X662_splice CLCN2 chr3 184346661 184346661 Missense_Mutation C C T TCGA-B0-5109-01A-02D-1421-08 ENST00000265593 p.R881H FGFR3 chr4 1802969 1802969 Intron C C A TCGA-B0-5109-01A-02D-1421-08 ENST00000260795 GBA3 chr4 22818742 22818742 Missense_Mutation A A G TCGA-B0-5109-01A-02D-1421-08 ENST00000508166 p.N410S PTGER4 chr5 40692372 40692373 Frame_Shift_Del TA TA - TCGA-B0-5109-01A-02D-1421-08 ENST00000302472 p.*489I TRIM36 chr5 115177832 115177832 Intron C C T TCGA-B0-5109-01A-02D-1421-08 ENST00000282369 PCDHGB3 chr5 141370983 141370983 Nonsense_Mutation A A T TCGA-B0-5109-01A-02D-1421-08 ENST00000576222 p.K197* CCNJL chr5 160253460 160253460 Missense_Mutation G G C TCGA-B0-5109-01A-02D-1421-08 ENST00000393977 p.P409R MAP7 chr6 136361129 136361129 Missense_Mutation C C T TCGA-B0-5109-01A-02D-1421-08 ENST00000354570 p.R526H HNRNPA2B1 chr7 26195892 26195892 Missense_Mutation G G T TCGA-B0-5109-01A-02D-1421-08 ENST00000354667 p.R238S SPDYE1 chr7 44000986 44000986 5'UTR G G C TCGA-B0-5109-01A-02D-1421-08 ENST00000258704 FKBP6 chr7 73331744 73331744 Missense_Mutation C C T TCGA-B0-5109-01A-02D-1421-08 ENST00000252037 p.R186C STAG3L2 chr7 74884178 74884178 RNA C C T TCGA-B0-5109-01A-02D-1421-08 ENST00000426587 ZSCAN21 chr7 100064382 100064382 Missense_Mutation G G A TCGA-B0-5109-01A-02D-1421-08 ENST00000292450 p.S396N PODXL chr7 131509569 131509569 Silent C C T TCGA-B0-5109-01A-02D-1421-08 ENST00000378555 p.S273S PRKAG2 chr7 151565731 151565731 Missense_Mutation A A C TCGA-B0-5109-01A-02D-1421-08 ENST00000287878 p.V463G CHD7 chr8 60865389 60865389 Missense_Mutation A A G TCGA-B0-5109-01A-02D-1421-08 ENST00000423902 p.N2817S CLVS1 chr8 61299874 61299874 Missense_Mutation G G T TCGA-B0-5109-01A-02D-1421-08 ENST00000325897 p.W16L VPS13A chr9 77293345 77293345 Frame_Shift_Del T T - TCGA-B0-5109-01A-02D-1421-08 ENST00000360280 p.Y1116Ifs*27 OMD chr9 92415256 92415256 Missense_Mutation C C A TCGA-B0-5109-01A-02D-1421-08 ENST00000375550 p.D388Y ABCA1 chr9 104796089 104796089 Missense_Mutation G G C TCGA-B0-5109-01A-02D-1421-08 ENST00000374736 p.S1782R SPTAN1 chr9 128582807 128582807 Missense_Mutation G G C TCGA-B0-5109-01A-02D-1421-08 ENST00000372731 p.W588C ABCA2 chr9 137015519 137015519 Missense_Mutation C C A TCGA-B0-5109-01A-02D-1421-08 ENST00000341511 p.G1198W HECTD2 chr10 91499049 91499049 Missense_Mutation G G A TCGA-B0-5109-01A-02D-1421-08 ENST00000298068 p.V617I IPO7 chr11 9425207 9425207 Missense_Mutation G G A TCGA-B0-5109-01A-02D-1421-08 ENST00000379719 p.R427Q PDE3B chr11 14772010 14772010 Intron A A C TCGA-B0-5109-01A-02D-1421-08 ENST00000282096 GPR162 chr12 6826852 6826852 Missense_Mutation A A T TCGA-B0-5109-01A-02D-1421-08 ENST00000311268 p.E472V LUM chr12 91108920 91108920 Nonsense_Mutation G G C TCGA-B0-5109-01A-02D-1421-08 ENST00000266718 p.Y20* ANO4 chr12 101110556 101110556 Missense_Mutation G G C TCGA-B0-5109-01A-02D-1421-08 ENST00000392977 p.G768R MYCBP2 chr13 77243100 77243100 Missense_Mutation C C G TCGA-B0-5109-01A-02D-1421-08 ENST00000357337 p.R825P MYH7 chr14 23421006 23421006 Missense_Mutation A A T TCGA-B0-5109-01A-02D-1421-08 ENST00000355349 p.D1096E ARID4A chr14 58364834 58364834 Silent A A C TCGA-B0-5109-01A-02D-1421-08 ENST00000355431 p.I915I CSPG4 chr15 75685416 75685416 Missense_Mutation G G C TCGA-B0-5109-01A-02D-1421-08 ENST00000308508 p.P1359A JMJD8 chr16 681897 681897 3'UTR C C A TCGA-B0-5109-01A-02D-1421-08 ENST00000412368 ATF7IP2 chr16 10431305 10431305 Missense_Mutation G G T TCGA-B0-5109-01A-02D-1421-08 ENST00000356427 p.V229F DDX28 chr16 68021869 68021869 Missense_Mutation T T C TCGA-B0-5109-01A-02D-1421-08 ENST00000332395 p.K445R DNAH2 chr17 7797787 7797787 Missense_Mutation G G A TCGA-B0-5109-01A-02D-1421-08 ENST00000389173 p.V2730M MYH8 chr17 10406208 10406208 Intron C C T TCGA-B0-5109-01A-02D-1421-08 ENST00000403437 SOX9 chr17 72123560 72123560 Missense_Mutation C C G TCGA-B0-5109-01A-02D-1421-08 ENST00000245479 p.P235A ST6GALNAC1 chr17 76625269 76625269 3'UTR G G C TCGA-B0-5109-01A-02D-1421-08 ENST00000156626 SLC39A6 chr18 36109614 36109614 Silent G G A TCGA-B0-5109-01A-02D-1421-08 ENST00000269187 p.I749I ZNF180 chr19 44478048 44478048 Frame_Shift_Del C C - TCGA-B0-5109-01A-02D-1421-08 ENST00000221327 p.D145Mfs*57 CSE1L chr20 49066405 49066405 Missense_Mutation C C A TCGA-B0-5109-01A-02D-1421-08 ENST00000262982 p.P124Q RSPH1 chr21 42477307 42477307 Silent G G A TCGA-B0-5109-01A-02D-1421-08 ENST00000291536 p.D237D TRIOBP chr22 37755610 37755610 Nonsense_Mutation G G T TCGA-B0-5109-01A-02D-1421-08 ENST00000406386 p.E1880* CHST7 chrX 46574269 46574269 Missense_Mutation G G A TCGA-B0-5109-01A-02D-1421-08 ENST00000276055 p.G113D RPL22 chr1 6186802 6186802 Missense_Mutation A A G TCGA-A3-3367-01A-02D-1421-08 ENST00000234875 p.L86P EPHA2 chr1 16132091 16132091 Silent G G A TCGA-A3-3367-01A-02D-1421-08 ENST00000358432 p.D766D UBR4 chr1 19074780 19074780 3'UTR G G C TCGA-A3-3367-01A-02D-1421-08 ENST00000375254 USP33 chr1 77697184 77697184 3'UTR T T C TCGA-A3-3367-01A-02D-1421-08 ENST00000357428 VHLL chr1 156298756 156298756 3'UTR G G C TCGA-A3-3367-01A-02D-1421-08 ENST00000339922 RC3H1 chr1 173980924 173980936 Frame_Shift_Del GAGTCATGTTCTC GAGTCATGTTCTC - TCGA-A3-3367-01A-02D-1421-08 ENST00000258349 p.R281Pfs*3 CFHR4 chr1 196910448 196910448 Missense_Mutation G G T TCGA-A3-3367-01A-02D-1421-08 ENST00000367416 p.D322Y KIF21B chr1 200986913 200986918 In_Frame_Del CTAGGG CTAGGG - TCGA-A3-3367-01A-02D-1421-08 ENST00000422435 p.F1205_R1207delinsL SRP9 chr1 225783300 225783300 Missense_Mutation G G A TCGA-A3-3367-01A-02D-1421-08 ENST00000304786 p.A25T ZP4 chr1 237885191 237885191 Missense_Mutation C C A TCGA-A3-3367-01A-02D-1421-08 ENST00000366570 p.V429L GREB1 chr2 11631964 11631964 Missense_Mutation A A G TCGA-A3-3367-01A-02D-1421-08 ENST00000234142 p.H1556R CHRNA1 chr2 174750066 174750066 Silent A A G TCGA-A3-3367-01A-02D-1421-08 ENST00000261007 p.I319I COL6A3 chr2 237341056 237341056 Missense_Mutation C C T TCGA-A3-3367-01A-02D-1421-08 ENST00000295550 p.M2620I VHL chr3 10146578 10146579 Frame_Shift_Ins - - TTTT TCGA-A3-3367-01A-02D-1421-08 ENST00000256474 p.V137Ffs*8 CXCR6 chr3 45947316 45947316 Silent C C T TCGA-A3-3367-01A-02D-1421-08 ENST00000304552 p.L279L SETD2 chr3 47017155 47017156 Frame_Shift_Ins - - A TCGA-A3-3367-01A-02D-1421-08 ENST00000409792 p.K2545* SETD2 chr3 47019749 47019759 Splice_Site CCAAACCTTAC CCAAACCTTAC - TCGA-A3-3367-01A-02D-1421-08 ENST00000409792 p.X2477_splice PBRM1 chr3 52617323 52617323 Missense_Mutation A A G TCGA-A3-3367-01A-02D-1421-08 ENST00000296302 p.M586T COL6A6 chr3 130567216 130567219 Frame_Shift_Del GAAA GAAA - TCGA-A3-3367-01A-02D-1421-08 ENST00000358511 p.K600Tfs*2 MME chr3 155144361 155144361 Splice_Region C C A TCGA-A3-3367-01A-02D-1421-08 ENST00000360490 p.V440V UGT2A3 chr4 68951785 68951785 5'UTR T T A TCGA-A3-3367-01A-02D-1421-08 ENST00000251566 UGT3A1 chr5 35991087 35991087 Intron C C T TCGA-A3-3367-01A-02D-1421-08 ENST00000274278 IL3 chr5 132061007 132061007 Missense_Mutation T T A TCGA-A3-3367-01A-02D-1421-08 ENST00000296870 p.M68K TAF7 chr5 141320127 141320127 5'UTR G G C TCGA-A3-3367-01A-02D-1421-08 ENST00000313368 PPP2R2B chr5 146856528 146856528 Intron T T A TCGA-A3-3367-01A-02D-1421-08 ENST00000394409 MCHR2 chr6 99947880 99947880 Missense_Mutation G G T TCGA-A3-3367-01A-02D-1421-08 ENST00000281806 p.Q92K STAG3L2 chr7 74883797 74883797 RNA C C - TCGA-A3-3367-01A-02D-1421-08 ENST00000426587 GIMAP4 chr7 150573067 150573067 3'UTR T T C TCGA-A3-3367-01A-02D-1421-08 ENST00000255945 MTUS1 chr8 17755176 17755176 Missense_Mutation G G T TCGA-A3-3367-01A-02D-1421-08 ENST00000262102 p.S211Y CLVS1 chr8 61300130 61300130 Silent C C T TCGA-A3-3367-01A-02D-1421-08 ENST00000325897 p.R101R RMDN1 chr8 86488597 86488597 Missense_Mutation C C G TCGA-A3-3367-01A-02D-1421-08 ENST00000406452 p.G97A KLHL38 chr8 123652407 123652407 Missense_Mutation C C G TCGA-A3-3367-01A-02D-1421-08 ENST00000325995 p.E174Q SPATA31A6 chr9 42187315 42187315 Missense_Mutation A A G TCGA-A3-3367-01A-02D-1421-08 ENST00000332857 p.H538R GBGT1 chr9 133153907 133153907 Missense_Mutation C C G TCGA-A3-3367-01A-02D-1421-08 ENST00000372040 p.Q238H ATP5C1 chr10 7797128 7797128 Missense_Mutation G G T TCGA-A3-3367-01A-02D-1421-08 ENST00000356708 p.R58L ARMC4 chr10 27944883 27944883 Missense_Mutation G G T TCGA-A3-3367-01A-02D-1421-08 ENST00000305242 p.A489D FAM21A chr10 50078714 50078714 Missense_Mutation G G T TCGA-A3-3367-01A-02D-1421-08 ENST00000282633 p.A111S JMJD1C chr10 63176418 63176418 Missense_Mutation T T A TCGA-A3-3367-01A-02D-1421-08 ENST00000399262 p.Q2427L CDH23 chr10 71784933 71784933 Missense_Mutation C C T TCGA-A3-3367-01A-02D-1421-08 ENST00000224721 p.P1899S ABCC8 chr11 17397017 17397017 Missense_Mutation C C G TCGA-A3-3367-01A-02D-1421-08 ENST00000389817 p.D1340H CAT chr11 34468396 34468399 Splice_Site GTGA GTGA - TCGA-A3-3367-01A-02D-1421-08 ENST00000241052 p.X478_splice FNBP4 chr11 47753021 47753021 Missense_Mutation G G A TCGA-A3-3367-01A-02D-1421-08 ENST00000263773 p.P178S SLC22A8 chr11 62994722 62994723 Frame_Shift_Ins - - A TCGA-A3-3367-01A-02D-1421-08 ENST00000336232 p.M346Yfs*90 ANO1 chr11 70171007 70171007 Missense_Mutation G G A TCGA-A3-3367-01A-02D-1421-08 ENST00000355303 p.R773Q ANO1 chr11 70185687 70185687 Missense_Mutation G G A TCGA-A3-3367-01A-02D-1421-08 ENST00000355303 p.V896I MAP6 chr11 75587291 75587291 Missense_Mutation T T C TCGA-A3-3367-01A-02D-1421-08 ENST00000304771 p.N737S EXPH5 chr11 108510536 108510536 Silent G G A TCGA-A3-3367-01A-02D-1421-08 ENST00000265843 p.S1657S RDX chr11 110237670 110237671 Intron - - C TCGA-A3-3367-01A-02D-1421-08 ENST00000343115 LAYN chr11 111560341 111560341 Silent G G A TCGA-A3-3367-01A-02D-1421-08 ENST00000375615 p.V344V TMPRSS12 chr12 50887600 50887600 3'UTR A A C TCGA-A3-3367-01A-02D-1421-08 ENST00000398458 EP400 chr12 131961189 131961189 Missense_Mutation T T G TCGA-A3-3367-01A-02D-1421-08 ENST00000389562 p.F190L GPHN chr14 66924225 66924226 Intron - - C TCGA-A3-3367-01A-02D-1421-08 ENST00000315266 PGF chr14 74949356 74949356 Splice_Site C C T TCGA-A3-3367-01A-02D-1421-08 ENST00000405431 p.X105_splice ONECUT1 chr15 52789395 52789395 Missense_Mutation G G T TCGA-A3-3367-01A-02D-1421-08 ENST00000305901 p.L164I NMRAL1 chr16 4461891 4461891 Silent G G A TCGA-A3-3367-01A-02D-1421-08 ENST00000283429 p.F263F DNAH3 chr16 21136407 21136407 Missense_Mutation G G A TCGA-A3-3367-01A-02D-1421-08 ENST00000261383 p.T268M CHRNB1 chr17 7446922 7446926 Frame_Shift_Del TGACG TGACG - TCGA-A3-3367-01A-02D-1421-08 ENST00000306071 p.D112Gfs*7 CHRNB1 chr17 7446928 7446928 Silent G G T TCGA-A3-3367-01A-02D-1421-08 ENST00000306071 p.V113V ALOX15B chr17 8039183 8039183 Missense_Mutation A A G TCGA-A3-3367-01A-02D-1421-08 ENST00000380183 p.T10A PIRT chr17 10825497 10825497 Missense_Mutation T T A TCGA-A3-3367-01A-02D-1421-08 ENST00000580256 p.E50V ATPAF2 chr17 18026287 18026287 Intron C C A TCGA-A3-3367-01A-02D-1421-08 ENST00000474627 AOC3 chr17 42852854 42852854 Missense_Mutation C C A TCGA-A3-3367-01A-02D-1421-08 ENST00000308423 p.T504N DBF4B chr17 44751134 44751134 Missense_Mutation G G A TCGA-A3-3367-01A-02D-1421-08 ENST00000315005 p.A577T ROCK1 chr18 20969179 20969179 Missense_Mutation T T G TCGA-A3-3367-01A-02D-1421-08 ENST00000399799 p.K950N CDH7 chr18 65880498 65880498 Missense_Mutation T T A TCGA-A3-3367-01A-02D-1421-08 ENST00000323011 p.D654E HMHA1 chr19 1074199 1074199 Missense_Mutation A A T TCGA-A3-3367-01A-02D-1421-08 ENST00000313093 p.M296L ZNF333 chr19 14718545 14718545 Silent C C T TCGA-A3-3367-01A-02D-1421-08 ENST00000292530 p.S406S ZNF91 chr19 23362529 23362529 Missense_Mutation C C G TCGA-A3-3367-01A-02D-1421-08 ENST00000300619 p.Q150H SIGLEC8 chr19 51454266 51454266 Frame_Shift_Del C C - TCGA-A3-3367-01A-02D-1421-08 ENST00000321424 p.D400Ifs*19 NLRP9 chr19 55732693 55732693 Missense_Mutation T T A TCGA-A3-3367-01A-02D-1421-08 ENST00000332836 p.S380C ZNF584 chr19 58410027 58410027 Missense_Mutation T T G TCGA-A3-3367-01A-02D-1421-08 ENST00000306910 p.N35K RASSF2 chr20 4790492 4790492 Missense_Mutation G G A TCGA-A3-3367-01A-02D-1421-08 ENST00000379376 p.R166C GAB4 chr22 17008182 17008182 5'UTR A A C TCGA-A3-3367-01A-02D-1421-08 ENST00000400588 GNB1L chr22 19788713 19788713 Missense_Mutation G G T TCGA-A3-3367-01A-02D-1421-08 ENST00000329517 p.A327E MYH9 chr22 36327458 36327459 Splice_Region - - A TCGA-A3-3367-01A-02D-1421-08 ENST00000216181 FBLN1 chr22 45563298 45563298 Intron T T A TCGA-A3-3367-01A-02D-1421-08 ENST00000327858 KLHL15 chrX 23988305 23988305 Silent C C A TCGA-A3-3367-01A-02D-1421-08 ENST00000328046 p.A477A FRMD7 chrX 132100653 132100653 Nonsense_Mutation C C A TCGA-A3-3367-01A-02D-1421-08 ENST00000298542 p.E41* ZCCHC17 chr1 31310123 31310123 Missense_Mutation A A G TCGA-B0-5120-01A-01D-1421-08 ENST00000344147 p.M9V SNX27 chr1 151639109 151639109 Missense_Mutation A A G TCGA-B0-5120-01A-01D-1421-08 ENST00000458013 p.E178G LAMC1 chr1 183117325 183117325 Missense_Mutation G G T TCGA-B0-5120-01A-01D-1421-08 ENST00000258341 p.D524Y CACNA1S chr1 201077989 201077989 Silent C C A TCGA-B0-5120-01A-01D-1421-08 ENST00000362061 p.V503V MIA3 chr1 222653303 222653303 Missense_Mutation A A T TCGA-B0-5120-01A-01D-1421-08 ENST00000344922 p.N1429Y DISP1 chr1 223005360 223005360 Silent T T C TCGA-B0-5120-01A-01D-1421-08 ENST00000284476 p.A1321A NUP133 chr1 229466757 229466757 Splice_Site C C A TCGA-B0-5120-01A-01D-1421-08 ENST00000261396 p.X693_splice WDR35 chr2 19938308 19938308 Missense_Mutation C C T TCGA-B0-5120-01A-01D-1421-08 ENST00000345530 p.D685N MFSD2B chr2 24013357 24013357 Frame_Shift_Del G G - TCGA-B0-5120-01A-01D-1421-08 ENST00000406420 p.A57Pfs*16 DNMT3A chr2 25244253 25244253 Missense_Mutation T T G TCGA-B0-5120-01A-01D-1421-08 ENST00000264709 p.M585L EMILIN1 chr2 27082289 27082289 Missense_Mutation A A T TCGA-B0-5120-01A-01D-1421-08 ENST00000380320 p.I240F ATP6V1B1 chr2 70935952 70935952 5'UTR T T G TCGA-B0-5120-01A-01D-1421-08 ENST00000234396 ALMS1 chr2 73424590 73424590 Missense_Mutation C C A TCGA-B0-5120-01A-01D-1421-08 ENST00000613296 p.Q309K SNRNP200 chr2 96296979 96296979 Missense_Mutation C C T TCGA-B0-5120-01A-01D-1421-08 ENST00000323853 p.R490H PLA2R1 chr2 159956592 159956592 Silent A A G TCGA-B0-5120-01A-01D-1421-08 ENST00000283243 p.S980S TTN chr2 178611674 178611674 Missense_Mutation G G A TCGA-B0-5120-01A-01D-1421-08 ENST00000591111 p.P15211L PBRM1 chr3 52662261 52662262 Frame_Shift_Ins - - T TCGA-B0-5120-01A-01D-1421-08 ENST00000296302 p.Y134Ifs*2 PCDHB14 chr5 141224982 141224982 Missense_Mutation C C T TCGA-B0-5120-01A-01D-1421-08 ENST00000239449 p.P493S DDR1 chr6 30899035 30899035 Nonsense_Mutation C C T TCGA-B0-5120-01A-01D-1421-08 ENST00000324771 p.Q867* UFL1 chr6 96549577 96549577 Splice_Region A A G TCGA-B0-5120-01A-01D-1421-08 ENST00000369278 p.A562A RNF217-AS1 chr6 124912462 124912462 RNA T T C TCGA-B0-5120-01A-01D-1421-08 ENST00000439075 STXBP5 chr6 147364064 147364064 Silent C C T TCGA-B0-5120-01A-01D-1421-08 ENST00000321680 p.A993A SFRP4 chr7 37909674 37909674 Missense_Mutation C C A TCGA-B0-5120-01A-01D-1421-08 ENST00000436072 p.M266I ZNF680 chr7 64521407 64521407 Silent A A G TCGA-B0-5120-01A-01D-1421-08 ENST00000309683 p.L449L LAMB4 chr7 108123137 108123137 Missense_Mutation G G A TCGA-B0-5120-01A-01D-1421-08 ENST00000205386 p.H10Y SLC18A1 chr8 20180858 20180858 Missense_Mutation A A T TCGA-B0-5120-01A-01D-1421-08 ENST00000276373 p.M36K RP1 chr8 54626771 54626771 Missense_Mutation A A T TCGA-B0-5120-01A-01D-1421-08 ENST00000220676 p.K963N DCAF13 chr8 103432738 103432738 Missense_Mutation A A T TCGA-B0-5120-01A-01D-1421-08 ENST00000612750 p.Y261F ANGPT1 chr8 107284603 107284603 Intron T T A TCGA-B0-5120-01A-01D-1421-08 ENST00000517746 C9orf66 chr9 214612 214612 Missense_Mutation C C A TCGA-B0-5120-01A-01D-1421-08 ENST00000382387 p.R262L ZNF782 chr9 96818040 96818040 Silent G G A TCGA-B0-5120-01A-01D-1421-08 ENST00000481138 p.L661L TXN chr9 110256431 110256431 Missense_Mutation A A T TCGA-B0-5120-01A-01D-1421-08 ENST00000374517 p.V2E MRC1 chr10 17879720 17879720 Splice_Site G G A TCGA-B0-5120-01A-01D-1421-08 ENST00000569591 p.X873_splice LOXL4 chr10 98259125 98259125 Missense_Mutation G G C TCGA-B0-5120-01A-01D-1421-08 ENST00000260702 p.R269G PDZD8 chr10 117290280 117290280 Silent C C A TCGA-B0-5120-01A-01D-1421-08 ENST00000334464 p.G389G MS4A14 chr11 60396636 60396636 Missense_Mutation G G C TCGA-B0-5120-01A-01D-1421-08 ENST00000300187 p.E20Q SLC22A10 chr11 63290243 63290243 Silent C C G TCGA-B0-5120-01A-01D-1421-08 ENST00000332793 p.P26P DRD2 chr11 113424366 113424366 Splice_Site C C T TCGA-B0-5120-01A-01D-1421-08 ENST00000362072 p.X95_splice SLC2A14 chr12 7814430 7814430 Missense_Mutation C C A TCGA-B0-5120-01A-01D-1421-08 ENST00000396589 p.E483D M6PR chr12 8945502 8945502 Missense_Mutation C C A TCGA-B0-5120-01A-01D-1421-08 ENST00000000412 p.G87W PPHLN1 chr12 42355165 42355165 Missense_Mutation A A T TCGA-B0-5120-01A-01D-1421-08 ENST00000395568 p.E81V PFKM chr12 48122796 48122796 Missense_Mutation G G C TCGA-B0-5120-01A-01D-1421-08 ENST00000312352 p.A8P AMHR2 chr12 53425832 53425832 Missense_Mutation C C A TCGA-B0-5120-01A-01D-1421-08 ENST00000257863 p.D255E RN7SL319P chr15 75780864 75780864 5'Flank C C T TCGA-B0-5120-01A-01D-1421-08 ENST00000480656 SNX29 chr16 12042993 12042993 Missense_Mutation G G T TCGA-B0-5120-01A-01D-1421-08 ENST00000566228 p.G115V CMTM1 chr16 66578894 66578894 Missense_Mutation A A G TCGA-B0-5120-01A-01D-1421-08 ENST00000457188 p.R135G SERPINF2 chr17 1745393 1745393 Nonsense_Mutation C C T TCGA-B0-5120-01A-01D-1421-08 ENST00000324015 p.Q55* POLR2A chr17 7501098 7501098 Frame_Shift_Del C C - TCGA-B0-5120-01A-01D-1421-08 ENST00000617998 p.L681Sfs*33 ABCA10 chr17 69190421 69190421 Frame_Shift_Del A A - TCGA-B0-5120-01A-01D-1421-08 ENST00000269081 p.S690Qfs*2 COLEC12 chr18 480713 480713 Silent G G T TCGA-B0-5120-01A-01D-1421-08 ENST00000400256 p.R18R USHBP1 chr19 17255526 17255526 Silent G G A TCGA-B0-5120-01A-01D-1421-08 ENST00000252597 p.L517L ZNF708 chr19 21309248 21309248 Missense_Mutation G G A TCGA-B0-5120-01A-01D-1421-08 ENST00000356929 p.P75L CD22 chr19 35340989 35340989 Missense_Mutation G G C TCGA-B0-5120-01A-01D-1421-08 ENST00000085219 p.R453P SNRPD2 chr19 45688386 45688386 Splice_Site C C - TCGA-B0-5120-01A-01D-1421-08 ENST00000342669 p.X61_splice TFPT chr19 54115299 54115299 5'UTR A A T TCGA-B0-5120-01A-01D-1421-08 ENST00000391759 PIGP chr21 37072509 37072509 Nonsense_Mutation C C A TCGA-B0-5120-01A-01D-1421-08 ENST00000464265 p.E27* CCDC157 chr22 30370364 30370364 Silent C C A TCGA-B0-5120-01A-01D-1421-08 ENST00000338306 p.P153P MIEF1 chr22 39512340 39512340 Missense_Mutation G G A TCGA-B0-5120-01A-01D-1421-08 ENST00000325301 p.R144Q ALG12 chr22 49909967 49909967 Silent C C T TCGA-B0-5120-01A-01D-1421-08 ENST00000330817 p.L197L MAP3K15 chrX 19392045 19392045 Silent C C T TCGA-B0-5120-01A-01D-1421-08 ENST00000338883 p.S796S SUV39H1 chrX 48699017 48699017 Silent C C A TCGA-B0-5120-01A-01D-1421-08 ENST00000376687 p.V45V PFKFB1 chrX 54956170 54956170 Silent C C T TCGA-B0-5120-01A-01D-1421-08 ENST00000375006 p.L207L TEX11 chrX 70722625 70722625 Missense_Mutation G G A TCGA-B0-5120-01A-01D-1421-08 ENST00000344304 p.H348Y XIST chrX 73848593 73848593 RNA G G C TCGA-B0-5120-01A-01D-1421-08 ENST00000429829 TEX13B chrX 107981023 107981024 3'UTR - - T TCGA-B0-5120-01A-01D-1421-08 ENST00000302917 NT5C1A chr1 39665623 39665623 Missense_Mutation G G A TCGA-CZ-5453-01A-01D-1501-10 ENST00000235628 p.R111W IPO13 chr1 43956385 43956385 Missense_Mutation C C T TCGA-CZ-5453-01A-01D-1501-10 ENST00000372343 p.A296V OSBPL9 chr1 51783967 51783967 Missense_Mutation T T A TCGA-CZ-5453-01A-01D-1501-10 ENST00000428468 p.H522Q POLR3C chr1 145837586 145837586 Missense_Mutation G G A TCGA-CZ-5453-01A-01D-1501-10 ENST00000334163 p.V354I PBXIP1 chr1 154948150 154948150 Missense_Mutation C C T TCGA-CZ-5453-01A-01D-1501-10 ENST00000368463 p.G209E FCGR3B chr1 161626203 161626203 Silent C C T TCGA-CZ-5453-01A-01D-1501-10 ENST00000294800 p.R173R EPHX1 chr1 225842414 225842414 Missense_Mutation A A G TCGA-CZ-5453-01A-01D-1501-10 ENST00000272167 p.E327G HADHB chr2 26279145 26279145 Missense_Mutation T T C TCGA-CZ-5453-01A-01D-1501-10 ENST00000317799 p.V214A CAD chr2 27233781 27233781 Silent C C T TCGA-CZ-5453-01A-01D-1501-10 ENST00000264705 p.V1124V AC007040.8 chr2 71029112 71029112 Intron T T C TCGA-CZ-5453-01A-01D-1501-10 ENST00000434990 TANK chr2 161235379 161235379 Missense_Mutation C C T TCGA-CZ-5453-01A-01D-1501-10 ENST00000259075 p.S380L VHL chr3 10149840 10149840 Nonsense_Mutation G G T TCGA-CZ-5453-01A-01D-1501-10 ENST00000256474 p.E173* PBRM1 chr3 52643249 52643249 Frame_Shift_Del G G - TCGA-CZ-5453-01A-01D-1501-10 ENST00000296302 p.R332Vfs*30 SLC9C1 chr3 112204357 112204357 Missense_Mutation A A C TCGA-CZ-5453-01A-01D-1501-10 ENST00000305815 p.F678C COL6A6 chr3 130675228 130675228 Frame_Shift_Del C C - TCGA-CZ-5453-01A-01D-1501-10 ENST00000358511 p.L2209Sfs*21 BOD1L1 chr4 13599649 13599650 Frame_Shift_Del AG AG - TCGA-CZ-5453-01A-01D-1501-10 ENST00000040738 p.S2417Cfs*57 FRYL chr4 48499329 48499329 3'UTR A A T TCGA-CZ-5453-01A-01D-1501-10 ENST00000358350 TMPRSS11F chr4 68129809 68129809 Splice_Site C C T TCGA-CZ-5453-01A-01D-1501-10 ENST00000356291 p.X4_splice TSPAN5 chr4 98486778 98486778 Missense_Mutation C C T TCGA-CZ-5453-01A-01D-1501-10 ENST00000305798 p.C80Y NNT chr5 43702713 43702713 Missense_Mutation C C A TCGA-CZ-5453-01A-01D-1501-10 ENST00000264663 p.L1030I ADGRV1 chr5 90853410 90853410 Silent A A G TCGA-CZ-5453-01A-01D-1501-10 ENST00000405460 p.L5777L SLCO4C1 chr5 102257253 102257253 Nonsense_Mutation G G C TCGA-CZ-5453-01A-01D-1501-10 ENST00000310954 p.S444* REEP2 chr5 138441043 138441043 Silent C C T TCGA-CZ-5453-01A-01D-1501-10 ENST00000254901 p.A20A LARP1 chr5 154802115 154802116 Frame_Shift_Del TT TT - TCGA-CZ-5453-01A-01D-1501-10 ENST00000336314 p.F532* STC2 chr5 173318136 173318136 Missense_Mutation A A G TCGA-CZ-5453-01A-01D-1501-10 ENST00000265087 p.I207T CPLX2 chr5 175879019 175879019 Missense_Mutation G G C TCGA-CZ-5453-01A-01D-1501-10 ENST00000359546 p.R48P TBC1D22B chr6 37257937 37257937 Missense_Mutation A A G TCGA-CZ-5453-01A-01D-1501-10 ENST00000373491 p.K7R SNX8 chr7 2275188 2275188 Silent C C T TCGA-CZ-5453-01A-01D-1501-10 ENST00000222990 p.V114V USP42 chr7 6115326 6115326 Missense_Mutation T T C TCGA-CZ-5453-01A-01D-1501-10 ENST00000306177 p.L82P DLX6 chr7 97009890 97009890 Missense_Mutation C C T TCGA-CZ-5453-01A-01D-1501-10 ENST00000518156 p.A242V POT1 chr7 124863348 124863348 Splice_Site A A T TCGA-CZ-5453-01A-01D-1501-10 ENST00000357628 p.X182_splice AKR1B1 chr7 134459060 134459060 Translation_Start_Site C C T TCGA-CZ-5453-01A-01D-1501-10 ENST00000285930 p.M1? FASTK chr7 151077857 151077857 Intron G G T TCGA-CZ-5453-01A-01D-1501-10 ENST00000297532 PTK2B chr8 27430401 27430401 Missense_Mutation A A G TCGA-CZ-5453-01A-01D-1501-10 ENST00000346049 p.M218V NBN chr8 89958779 89958779 Frame_Shift_Del G G - TCGA-CZ-5453-01A-01D-1501-10 ENST00000265433 p.P357Qfs*2 AGO2 chr8 140535489 140535489 Silent C C A TCGA-CZ-5453-01A-01D-1501-10 ENST00000220592 p.L750L VPS13A chr9 77321529 77321529 Silent C C T TCGA-CZ-5453-01A-01D-1501-10 ENST00000360280 p.F1871F SURF6 chr9 133334489 133334489 Silent G G A TCGA-CZ-5453-01A-01D-1501-10 ENST00000372022 p.S69S CCAR1 chr10 68742382 68742382 Missense_Mutation G G T TCGA-CZ-5453-01A-01D-1501-10 ENST00000265872 p.V111F CAMK2G chr10 73815187 73815187 Missense_Mutation A A G TCGA-CZ-5453-01A-01D-1501-10 ENST00000322680 p.I500T SAMD8 chr10 75150548 75150548 Missense_Mutation T T A TCGA-CZ-5453-01A-01D-1501-10 ENST00000542569 p.L7H ATE1 chr10 121924286 121924286 Silent G G A TCGA-CZ-5453-01A-01D-1501-10 ENST00000224652 p.L50L GPR26 chr10 123688039 123688039 Missense_Mutation G G A TCGA-CZ-5453-01A-01D-1501-10 ENST00000284674 p.R298Q LSP1 chr11 1887534 1887534 Missense_Mutation G G T TCGA-CZ-5453-01A-01D-1501-10 ENST00000311604 p.V331L ACP2 chr11 47245740 47245740 Missense_Mutation T T A TCGA-CZ-5453-01A-01D-1501-10 ENST00000256997 p.N131I TMEM133 chr11 100992460 100992460 Missense_Mutation A A G TCGA-CZ-5453-01A-01D-1501-10 ENST00000303130 p.Y51C ANKK1 chr11 113400048 113400048 Missense_Mutation G G T TCGA-CZ-5453-01A-01D-1501-10 ENST00000303941 p.W693C BACE1 chr11 117315611 117315611 Missense_Mutation T T C TCGA-CZ-5453-01A-01D-1501-10 ENST00000313005 p.E62G MANSC4 chr12 27763148 27763148 Missense_Mutation A A T TCGA-CZ-5453-01A-01D-1501-10 ENST00000381273 p.S205T CALCOCO1 chr12 53711910 53711911 3'UTR GA GA - TCGA-CZ-5453-01A-01D-1501-10 ENST00000550804 ZMYM2 chr13 20064516 20064516 Missense_Mutation G G C TCGA-CZ-5453-01A-01D-1501-10 ENST00000382871 p.E1035Q ATP12A chr13 24711491 24711491 Splice_Region C C A TCGA-CZ-5453-01A-01D-1501-10 ENST00000381946 DNAJC3 chr13 95709250 95709250 Missense_Mutation G G A TCGA-CZ-5453-01A-01D-1501-10 ENST00000602402 p.D36N ATP11A chr13 112810656 112810656 Missense_Mutation C C T TCGA-CZ-5453-01A-01D-1501-10 ENST00000375645 p.A124V POLE2 chr14 49669539 49669539 Silent G G A TCGA-CZ-5453-01A-01D-1501-10 ENST00000216367 p.S159S LCMT2 chr15 43328294 43328294 3'UTR T T - TCGA-CZ-5453-01A-01D-1501-10 ENST00000305641 ZSCAN29 chr15 43369071 43369071 Silent T T C TCGA-CZ-5453-01A-01D-1501-10 ENST00000396976 p.K125K KIAA1024 chr15 79456365 79456365 Missense_Mutation T T A TCGA-CZ-5453-01A-01D-1501-10 ENST00000305428 p.V73E SEMA4B chr15 90225333 90225333 Missense_Mutation T T A TCGA-CZ-5453-01A-01D-1501-10 ENST00000411539 p.I486N SYNGR3 chr16 1993316 1993316 3'UTR G G A TCGA-CZ-5453-01A-01D-1501-10 ENST00000248121 HIRIP3 chr16 29995134 29995134 Silent C C T TCGA-CZ-5453-01A-01D-1501-10 ENST00000279392 p.E90E FRG2DP chr16 35479307 35479307 Intron T T C TCGA-CZ-5453-01A-01D-1501-10 ENST00000569028 PAPD5 chr16 50227938 50227938 Nonsense_Mutation C C T TCGA-CZ-5453-01A-01D-1501-10 ENST00000436909 p.Q619* RSPRY1 chr16 57231255 57231255 Frame_Shift_Del A A - TCGA-CZ-5453-01A-01D-1501-10 ENST00000394420 p.M489* SLC7A6 chr16 68294753 68294753 Silent C C A TCGA-CZ-5453-01A-01D-1501-10 ENST00000219343 p.S357S AMZ2 chr17 68255803 68255803 Missense_Mutation C C A TCGA-CZ-5453-01A-01D-1501-10 ENST00000359904 p.P285H FN3K chr17 82748872 82748872 Silent T T C TCGA-CZ-5453-01A-01D-1501-10 ENST00000300784 p.D162D PSTPIP2 chr18 45992203 45992203 Splice_Site C C A TCGA-CZ-5453-01A-01D-1501-10 ENST00000409746 p.X248_splice ZNF236 chr18 76908452 76908452 Silent G G A TCGA-CZ-5453-01A-01D-1501-10 ENST00000253159 p.T808T MRPL54 chr19 3765313 3765313 Missense_Mutation A A T TCGA-CZ-5453-01A-01D-1501-10 ENST00000330133 p.D89V HDGFRP2 chr19 4491827 4491827 Frame_Shift_Del A A - TCGA-CZ-5453-01A-01D-1501-10 ENST00000616600 p.K226Rfs*45 SMARCA4 chr19 11003133 11003133 Silent G G T TCGA-CZ-5453-01A-01D-1501-10 ENST00000344626 p.L639L CCDC159 chr19 11353792 11353793 Frame_Shift_Ins - - TC TCGA-CZ-5453-01A-01D-1501-10 ENST00000588790 p.A232Lfs*10 NANOS3 chr19 13874875 13874875 5'Flank G G A TCGA-CZ-5453-01A-01D-1501-10 ENST00000397555 TECR chr19 14563169 14563169 Intron C C A TCGA-CZ-5453-01A-01D-1501-10 ENST00000215567 BRD4 chr19 15265501 15265503 In_Frame_Del GAC GAC - TCGA-CZ-5453-01A-01D-1501-10 ENST00000263377 p.V234del BRD4 chr19 15265505 15265505 Missense_Mutation A A T TCGA-CZ-5453-01A-01D-1501-10 ENST00000263377 p.I233N OR10H3 chr19 15741794 15741794 Silent C C T TCGA-CZ-5453-01A-01D-1501-10 ENST00000305892 p.N134N OCEL1 chr19 17227981 17227981 Missense_Mutation C C G TCGA-CZ-5453-01A-01D-1501-10 ENST00000215061 p.S198R PDCD2L chr19 34413735 34413735 Splice_Site A A C TCGA-CZ-5453-01A-01D-1501-10 ENST00000246535 p.X229_splice AC092071.1 chr19 40942175 40942175 5'Flank C C T TCGA-CZ-5453-01A-01D-1501-10 ENST00000597260 FOSB chr19 45471273 45471273 Missense_Mutation G G A TCGA-CZ-5453-01A-01D-1501-10 ENST00000353609 p.R176Q C22orf23 chr22 37944055 37944055 3'UTR G G - TCGA-CZ-5453-01A-01D-1501-10 ENST00000249079 BRD1 chr22 49794256 49794256 Missense_Mutation C C T TCGA-CZ-5453-01A-01D-1501-10 ENST00000216267 p.G713S MID1 chrX 10459668 10459668 Frame_Shift_Del C - - TCGA-CZ-5453-01A-01D-1501-10 ENST00000317552 p.E475Dfs*5 ZMAT1 chrX 101883825 101883836 In_Frame_Del ATGACCTGCTTG ATGACCTGCTTG - TCGA-CZ-5453-01A-01D-1501-10 ENST00000372782 p.Q531_H534del ZMAT1 chrX 101883838 101883838 Missense_Mutation T T A TCGA-CZ-5453-01A-01D-1501-10 ENST00000372782 p.H530L RENBP chrX 153940136 153940136 Missense_Mutation A A G TCGA-CZ-5453-01A-01D-1501-10 ENST00000393700 p.L348P ATP6V0B chr1 43976659 43976659 Frame_Shift_Del G G - TCGA-BP-5189-01A-02D-1429-08 ENST00000472174 ROR1 chr1 64177928 64177928 Silent A A G TCGA-BP-5189-01A-02D-1429-08 ENST00000371079 p.V629V SORT1 chr1 109345828 109345828 Missense_Mutation A A G TCGA-BP-5189-01A-02D-1429-08 ENST00000256637 p.F296L OTUD7B chr1 149949055 149949055 Silent A A G TCGA-BP-5189-01A-02D-1429-08 ENST00000581312 p.Y384Y TMOD4 chr1 151170577 151170578 Frame_Shift_Del AA AA - TCGA-BP-5189-01A-02D-1429-08 ENST00000295314 p.F319Yfs*18 ATP1A2 chr1 160129007 160129007 Missense_Mutation C C T TCGA-BP-5189-01A-02D-1429-08 ENST00000361216 p.T415M TMEM206 chr1 212365064 212365064 3'UTR G G C TCGA-BP-5189-01A-02D-1429-08 ENST00000261455 LYST chr1 235806357 235806357 Frame_Shift_Del A A - TCGA-BP-5189-01A-02D-1429-08 ENST00000389793 p.S927Lfs*11 NAT8 chr2 73640968 73640968 Missense_Mutation A A G TCGA-BP-5189-01A-02D-1429-08 ENST00000272425 p.S221P RGPD1 chr2 86986992 86986992 Missense_Mutation C C G TCGA-BP-5189-01A-02D-1429-08 ENST00000409776 p.Q1357E STAT4 chr2 191036208 191036208 Missense_Mutation C C A TCGA-BP-5189-01A-02D-1429-08 ENST00000358470 p.G509V CLK1 chr2 200854640 200854640 Missense_Mutation G G C TCGA-BP-5189-01A-02D-1429-08 ENST00000321356 p.P399R PBRM1 chr3 52561806 52561806 Missense_Mutation A A C TCGA-BP-5189-01A-02D-1429-08 ENST00000296302 p.W1417G PBRM1 chr3 52561813 52561813 Frame_Shift_Del C C - TCGA-BP-5189-01A-02D-1429-08 ENST00000296302 p.T1415Qfs*66 UBA5 chr3 132672084 132672085 Frame_Shift_Ins - - TGAT TCGA-BP-5189-01A-02D-1429-08 ENST00000356232 p.E241Dfs*2 GBA3 chr4 22747995 22747995 Missense_Mutation A A G TCGA-BP-5189-01A-02D-1429-08 ENST00000508166 p.D329G EPHA5 chr4 65324151 65324151 Frame_Shift_Del A A - TCGA-BP-5189-01A-02D-1429-08 ENST00000273854 p.M1026Rfs*6 ANKRD34B chr5 80558851 80558851 Missense_Mutation A A T TCGA-BP-5189-01A-02D-1429-08 ENST00000338682 p.L390H UBLCP1 chr5 159269059 159269059 Silent C C G TCGA-BP-5189-01A-02D-1429-08 ENST00000296786 p.L48L SASH1 chr6 148532808 148532808 Missense_Mutation G G C TCGA-BP-5189-01A-02D-1429-08 ENST00000367467 p.V526L GTF2IRD2B chr7 75148882 75148882 Missense_Mutation T T C TCGA-BP-5189-01A-02D-1429-08 ENST00000472837 p.V812A AKAP9 chr7 92107404 92107404 Missense_Mutation C C T TCGA-BP-5189-01A-02D-1429-08 ENST00000356239 p.P3843L ZNF212 chr7 149250784 149250784 Missense_Mutation A A G TCGA-BP-5189-01A-02D-1429-08 ENST00000335870 p.N173S CTSB chr8 11845707 11845707 Silent G G T TCGA-BP-5189-01A-02D-1429-08 ENST00000345125 p.P292P COLEC10 chr8 119105993 119105993 Silent T T C TCGA-BP-5189-01A-02D-1429-08 ENST00000332843 p.N212N CYP11B2 chr8 142912861 142912861 Missense_Mutation C C A TCGA-BP-5189-01A-02D-1429-08 ENST00000323110 p.L382F TNC chr9 115086375 115086375 Silent G G A TCGA-BP-5189-01A-02D-1429-08 ENST00000350763 p.G452G GTPBP4 chr10 997056 997056 Intron T T G TCGA-BP-5189-01A-02D-1429-08 ENST00000360803 C10orf71 chr10 49324571 49324571 Missense_Mutation G G A TCGA-BP-5189-01A-02D-1429-08 ENST00000374144 p.V676M CFAP58 chr10 104450192 104450192 Missense_Mutation A A T TCGA-BP-5189-01A-02D-1429-08 ENST00000369704 p.E833V PLEKHA7 chr11 16817291 16817291 Missense_Mutation C C T TCGA-BP-5189-01A-02D-1429-08 ENST00000355661 p.G459S PLEKHA7 chr11 16826405 16826405 Missense_Mutation T T G TCGA-BP-5189-01A-02D-1429-08 ENST00000355661 p.E353A ZCCHC8 chr12 122473435 122473435 3'UTR C C T TCGA-BP-5189-01A-02D-1429-08 ENST00000543897 ULK1 chr12 131915926 131915926 Missense_Mutation G G A TCGA-BP-5189-01A-02D-1429-08 ENST00000321867 p.G549R RALGAPA1 chr14 35655875 35655875 Missense_Mutation C C T TCGA-BP-5189-01A-02D-1429-08 ENST00000389698 p.E1304K KIAA0586 chr14 58470724 58470724 Splice_Site G G T TCGA-BP-5189-01A-02D-1429-08 ENST00000619416 p.X836_splice SIPA1L1 chr14 71650395 71650395 Frame_Shift_Del G G - TCGA-BP-5189-01A-02D-1429-08 ENST00000555818 p.E627Rfs*75 EIF2B2 chr14 75009091 75009091 Missense_Mutation T T C TCGA-BP-5189-01A-02D-1429-08 ENST00000266126 p.L320P RYR3 chr15 33530592 33530592 Missense_Mutation G G A TCGA-BP-5189-01A-02D-1429-08 ENST00000389232 p.A94T PARP16 chr15 65259462 65259462 Missense_Mutation A A C TCGA-BP-5189-01A-02D-1429-08 ENST00000261888 p.V306G LOXL1 chr15 73947223 73947223 Splice_Region G G A TCGA-BP-5189-01A-02D-1429-08 ENST00000261921 p.Q502Q SCAMP2 chr15 74850611 74850611 Missense_Mutation A A C TCGA-BP-5189-01A-02D-1429-08 ENST00000268099 p.S179A FHOD1 chr16 67231276 67231276 Missense_Mutation A A C TCGA-BP-5189-01A-02D-1429-08 ENST00000258201 p.L860R FAM65A chr16 67545389 67545389 Missense_Mutation C C G TCGA-BP-5189-01A-02D-1429-08 ENST00000379312 p.F1019L MLYCD chr16 83907004 83907004 Silent G G T TCGA-BP-5189-01A-02D-1429-08 ENST00000262430 p.L182L MYH4 chr17 10448125 10448125 Missense_Mutation G G A TCGA-BP-5189-01A-02D-1429-08 ENST00000255381 p.A1553V SEC14L1 chr17 77213413 77213413 Missense_Mutation G G A TCGA-BP-5189-01A-02D-1429-08 ENST00000430767 p.V655M ZNF93 chr19 19933722 19933722 Missense_Mutation C C A TCGA-BP-5189-01A-02D-1429-08 ENST00000343769 p.P256H FTL chr19 48965910 48965910 Silent C C T TCGA-BP-5189-01A-02D-1429-08 ENST00000331825 p.D81D PTPRH chr19 55198754 55198754 Missense_Mutation C C T TCGA-BP-5189-01A-02D-1429-08 ENST00000376350 p.G527S KDM5C chrX 53196705 53196705 Frame_Shift_Del G G - TCGA-BP-5189-01A-02D-1429-08 ENST00000375401 p.H988Tfs*18 MTOR chr1 11150141 11150141 Missense_Mutation C C T TCGA-CJ-6027-01A-11D-1669-08 ENST00000361445 p.A1519T PHACTR4 chr1 28473957 28473957 Silent C C A TCGA-CJ-6027-01A-11D-1669-08 ENST00000373839 p.P409P PPIE chr1 39743842 39743842 Missense_Mutation G G T TCGA-CJ-6027-01A-11D-1669-08 ENST00000324379 p.W101L PCSK9 chr1 55043906 55043906 Missense_Mutation T T A TCGA-CJ-6027-01A-11D-1669-08 ENST00000302118 p.S91T PCSK9 chr1 55043907 55043907 Missense_Mutation C C T TCGA-CJ-6027-01A-11D-1669-08 ENST00000302118 p.S91L INADL chr1 61771440 61771440 Silent A A G TCGA-CJ-6027-01A-11D-1669-08 ENST00000371158 p.R178R IL23R chr1 67240216 67240216 Missense_Mutation C C G TCGA-CJ-6027-01A-11D-1669-08 ENST00000347310 p.I361M SH3GLB1 chr1 86735113 86735113 Missense_Mutation A A T TCGA-CJ-6027-01A-11D-1669-08 ENST00000370558 p.E232V PKN2 chr1 88770412 88770412 Missense_Mutation G G T TCGA-CJ-6027-01A-11D-1669-08 ENST00000370521 p.V189F CD101 chr1 117025582 117025582 Silent C C T TCGA-CJ-6027-01A-11D-1669-08 ENST00000256652 p.C834C S100A7A chr1 153419294 153419294 Silent T T C TCGA-CJ-6027-01A-11D-1669-08 ENST00000329256 p.S97S LAMC2 chr1 183207962 183207962 Missense_Mutation T T A TCGA-CJ-6027-01A-11D-1669-08 ENST00000264144 p.L54H LAMC2 chr1 183207963 183207963 Silent C C A TCGA-CJ-6027-01A-11D-1669-08 ENST00000264144 p.L54L LMOD1 chr1 201900529 201900529 Missense_Mutation G G A TCGA-CJ-6027-01A-11D-1669-08 ENST00000367288 p.R162W CNTN2 chr1 205065904 205065904 Missense_Mutation T T A TCGA-CJ-6027-01A-11D-1669-08 ENST00000331830 p.V604D KLF11 chr2 10046388 10046388 Missense_Mutation T T C TCGA-CJ-6027-01A-11D-1669-08 ENST00000305883 p.L94P KHK chr2 27094935 27094935 Splice_Site G G A TCGA-CJ-6027-01A-11D-1669-08 ENST00000260598 p.X115_splice ABCG8 chr2 43846215 43846215 Missense_Mutation A A G TCGA-CJ-6027-01A-11D-1669-08 ENST00000272286 p.T76A RETSAT chr2 85354509 85354509 5'UTR A A T TCGA-CJ-6027-01A-11D-1669-08 ENST00000295802 POLR1A chr2 86039352 86039353 In_Frame_Ins - - GCTTCTTCA TCGA-CJ-6027-01A-11D-1669-08 ENST00000263857 p.L1281_K1283dup FAP chr2 162243435 162243435 5'UTR G G C TCGA-CJ-6027-01A-11D-1669-08 ENST00000188790 SMARCAL1 chr2 216478275 216478275 Silent A A G TCGA-CJ-6027-01A-11D-1669-08 ENST00000357276 p.T867T VHL chr3 10142113 10142113 Missense_Mutation T T C TCGA-CJ-6027-01A-11D-1669-08 ENST00000256474 p.L89P GATA2 chr3 128481909 128481910 Frame_Shift_Ins - - T TCGA-CJ-6027-01A-11D-1669-08 ENST00000341105 p.N351Kfs*33 APBB2 chr4 41013668 41013668 Silent G G A TCGA-CJ-6027-01A-11D-1669-08 ENST00000295974 p.I250I GABRB1 chr4 47406756 47406757 Frame_Shift_Del AA AA - TCGA-CJ-6027-01A-11D-1669-08 ENST00000295454 p.K304Sfs*3 SCARB2 chr4 76163353 76163353 Nonsense_Mutation G G A TCGA-CJ-6027-01A-11D-1669-08 ENST00000264896 p.R424* GPRIN3 chr4 89249395 89249395 Missense_Mutation G G T TCGA-CJ-6027-01A-11D-1669-08 ENST00000333209 p.T239N HHIP chr4 144714262 144714262 Silent T T C TCGA-CJ-6027-01A-11D-1669-08 ENST00000296575 p.S487S FNIP2 chr4 158869172 158869172 Missense_Mutation G G A TCGA-CJ-6027-01A-11D-1669-08 ENST00000264433 p.E846K TRAPPC11 chr4 183697763 183697763 Missense_Mutation A A G TCGA-CJ-6027-01A-11D-1669-08 ENST00000334690 p.I927V ZFR chr5 32390337 32390337 Missense_Mutation G G C TCGA-CJ-6027-01A-11D-1669-08 ENST00000265069 p.P694A RASGRF2 chr5 81212514 81212514 Missense_Mutation G G A TCGA-CJ-6027-01A-11D-1669-08 ENST00000265080 p.R1102K PPIP5K2 chr5 103167289 103167289 Missense_Mutation C C G TCGA-CJ-6027-01A-11D-1669-08 ENST00000358359 p.I677M SLC22A4 chr5 132295000 132295000 Silent C C T TCGA-CJ-6027-01A-11D-1669-08 ENST00000200652 p.V128V CDC23 chr5 138206668 138206668 Missense_Mutation A A G TCGA-CJ-6027-01A-11D-1669-08 ENST00000394886 p.M84T PCDHGB1 chr5 141352497 141352497 Missense_Mutation A A C TCGA-CJ-6027-01A-11D-1669-08 ENST00000523390 p.Y746S ATP10B chr5 160688087 160688087 5'UTR G G A TCGA-CJ-6027-01A-11D-1669-08 ENST00000327245 NEDD9 chr6 11213315 11213315 Missense_Mutation A A G TCGA-CJ-6027-01A-11D-1669-08 ENST00000379446 p.I142T BRPF3 chr6 36209892 36209892 Missense_Mutation G G A TCGA-CJ-6027-01A-11D-1669-08 ENST00000357641 p.A615T FAM188B chr7 30892008 30892008 3'UTR G G A TCGA-CJ-6027-01A-11D-1669-08 ENST00000265299 AVL9 chr7 32544702 32544702 Frame_Shift_Del T T - TCGA-CJ-6027-01A-11D-1669-08 ENST00000318709 p.H77Tfs*26 DPY19L1 chr7 35017937 35017937 Missense_Mutation C C G TCGA-CJ-6027-01A-11D-1669-08 ENST00000310974 p.R46P PKD1L1 chr7 47834385 47834385 Missense_Mutation C C A TCGA-CJ-6027-01A-11D-1669-08 ENST00000289672 p.G2043V PAX4 chr7 127611977 127611977 Missense_Mutation G G T TCGA-CJ-6027-01A-11D-1669-08 ENST00000341640 p.P239T PLEC chr8 143925717 143925717 Silent C C G TCGA-CJ-6027-01A-11D-1669-08 ENST00000322810 p.R1541R IARS chr9 92258982 92258982 Missense_Mutation A A T TCGA-CJ-6027-01A-11D-1669-08 ENST00000375643 p.S630T NR4A3 chr9 99828304 99828304 Nonsense_Mutation G G T TCGA-CJ-6027-01A-11D-1669-08 ENST00000395097 p.E88* TTF1 chr9 132375909 132375910 3'UTR CT CT - TCGA-CJ-6027-01A-11D-1669-08 ENST00000334270 NEBL chr10 20835581 20835581 Nonsense_Mutation C C A TCGA-CJ-6027-01A-11D-1669-08 ENST00000377122 p.G461* OPN4 chr10 86658672 86658672 Missense_Mutation C C A TCGA-CJ-6027-01A-11D-1669-08 ENST00000241891 p.P205T TECTB chr10 112293751 112293751 Missense_Mutation C C G TCGA-CJ-6027-01A-11D-1669-08 ENST00000369422 p.S166C YIF1A chr11 66285521 66285525 Frame_Shift_Del CACCT CACCT - TCGA-CJ-6027-01A-11D-1669-08 ENST00000376901 p.E166Afs*31 C2CD3 chr11 74042071 74042071 Silent G G T TCGA-CJ-6027-01A-11D-1669-08 ENST00000334126 p.S1881S TENM4 chr11 78658086 78658086 Missense_Mutation A A G TCGA-CJ-6027-01A-11D-1669-08 ENST00000278550 p.M2761T RBM7 chr11 114401827 114401827 Missense_Mutation T T C TCGA-CJ-6027-01A-11D-1669-08 ENST00000540163 p.Y76H NOP2 chr12 6560961 6560962 Frame_Shift_Ins - - AT TCGA-CJ-6027-01A-11D-1669-08 ENST00000322166 p.H441Afs*36 LACRT chr12 54632256 54632256 Nonsense_Mutation C C A TCGA-CJ-6027-01A-11D-1669-08 ENST00000257867 p.E80* ATP5B chr12 56642457 56642457 Splice_Site C C A TCGA-CJ-6027-01A-11D-1669-08 ENST00000262030 p.X358_splice MDM2 chr12 68809065 68809065 Intron C C G TCGA-CJ-6027-01A-11D-1669-08 ENST00000258149 FGD6 chr12 95081501 95081501 3'UTR A A G TCGA-CJ-6027-01A-11D-1669-08 ENST00000343958 ANKRD20A9P chr13 18838528 18838528 RNA C C T TCGA-CJ-6027-01A-11D-1669-08 ENST00000457997 STOML3 chr13 38990832 38990833 5'UTR GA GA - TCGA-CJ-6027-01A-11D-1669-08 ENST00000379631 BAZ1A chr14 34794864 34794864 Silent C C A TCGA-CJ-6027-01A-11D-1669-08 ENST00000360310 p.V416V KIAA0586 chr14 58465872 58465872 Missense_Mutation C C G TCGA-CJ-6027-01A-11D-1669-08 ENST00000619416 p.F684L BDKRB2 chr14 96237171 96237171 Missense_Mutation G G T TCGA-CJ-6027-01A-11D-1669-08 ENST00000554311 p.A22S PAPOLA chr14 96556339 96556339 Missense_Mutation A A G TCGA-CJ-6027-01A-11D-1669-08 ENST00000216277 p.T644A KNSTRN chr15 40393401 40393403 Intron ATT ATT - TCGA-CJ-6027-01A-11D-1669-08 ENST00000249776 PLA2G4D chr15 42087380 42087380 Missense_Mutation A A G TCGA-CJ-6027-01A-11D-1669-08 ENST00000290472 p.F59L DET1 chr15 88527603 88527603 Missense_Mutation G G A TCGA-CJ-6027-01A-11D-1669-08 ENST00000268148 p.R423C MMP2 chr16 55485414 55485414 Silent G G A TCGA-CJ-6027-01A-11D-1669-08 ENST00000219070 p.L215L MIEF2 chr17 18263083 18263083 Splice_Region C C G TCGA-CJ-6027-01A-11D-1669-08 ENST00000323019 ZPBP2 chr17 39875341 39875341 Missense_Mutation G G A TCGA-CJ-6027-01A-11D-1669-08 ENST00000348931 p.V266M HEXIM1 chr17 45149161 45149161 5'UTR A A C TCGA-CJ-6027-01A-11D-1669-08 ENST00000332499 GAA chr17 80117046 80117046 Silent C C T TCGA-CJ-6027-01A-11D-1669-08 ENST00000302262 p.L756L ATP8B3 chr19 1811646 1811646 Missense_Mutation A A T TCGA-CJ-6027-01A-11D-1669-08 ENST00000310127 p.S31T ACSBG2 chr19 6182792 6182792 Silent C C T TCGA-CJ-6027-01A-11D-1669-08 ENST00000586696 p.V316V ACTL9 chr19 8697582 8697582 Missense_Mutation G G A TCGA-CJ-6027-01A-11D-1669-08 ENST00000324436 p.P374S ZNF493 chr19 21425572 21425572 3'UTR C C T TCGA-CJ-6027-01A-11D-1669-08 ENST00000355504 SPTBN4 chr19 40560310 40560310 Missense_Mutation C C G TCGA-CJ-6027-01A-11D-1669-08 ENST00000352632 p.T1941R RABAC1 chr19 41958339 41958339 Missense_Mutation C C T TCGA-CJ-6027-01A-11D-1669-08 ENST00000222008 p.G105D ZNF45 chr19 43913930 43913930 Silent G G A TCGA-CJ-6027-01A-11D-1669-08 ENST00000269973 p.C502C ZSCAN1 chr19 58037897 58037897 Nonsense_Mutation G G T TCGA-CJ-6027-01A-11D-1669-08 ENST00000282326 p.E21* PROCR chr20 35176185 35176185 Missense_Mutation T T A TCGA-CJ-6027-01A-11D-1669-08 ENST00000216968 p.C114S FAM83C chr20 35287294 35287296 In_Frame_Del CTT CTT - TCGA-CJ-6027-01A-11D-1669-08 ENST00000374408 p.K495del C20orf24 chr20 36609618 36609618 Missense_Mutation C C T TCGA-CJ-6027-01A-11D-1669-08 ENST00000373852 p.A79V SPATA25 chr20 45886918 45886918 Missense_Mutation G G A TCGA-CJ-6027-01A-11D-1669-08 ENST00000372519 p.H95Y MORC3 chr21 36364115 36364115 Missense_Mutation G G A TCGA-CJ-6027-01A-11D-1669-08 ENST00000400485 p.R492Q HDAC6 chrX 48816201 48816201 Silent C C T TCGA-CJ-6027-01A-11D-1669-08 ENST00000334136 p.G518G AR chrX 67568899 67568899 Intron A A T TCGA-CJ-6027-01A-11D-1669-08 ENST00000374690 ATRX chrX 77696681 77696681 Missense_Mutation T T A TCGA-CJ-6027-01A-11D-1669-08 ENST00000373344 p.Y89F AIFM1 chrX 130155216 130155216 Intron G G A TCGA-CJ-6027-01A-11D-1669-08 ENST00000287295 TSPY1 chrY 9468368 9468368 Silent C C T TCGA-CJ-6027-01A-11D-1669-08 ENST00000451548 p.F211F AADACL4 chr1 12666731 12666731 Missense_Mutation T T C TCGA-B0-5692-01A-11D-1534-10 ENST00000376221 p.I407T ARID1A chr1 26731461 26731461 Frame_Shift_Del C C - TCGA-B0-5692-01A-11D-1534-10 ENST00000324856 p.P554Hfs*65 FAM76A chr1 27755223 27755223 Missense_Mutation C C A TCGA-B0-5692-01A-11D-1534-10 ENST00000373954 p.P210T PTP4A2 chr1 31911773 31911773 Nonsense_Mutation C C T TCGA-B0-5692-01A-11D-1534-10 ENST00000344035 p.W81* GJB4 chr1 34761932 34761932 Silent C C T TCGA-B0-5692-01A-11D-1534-10 ENST00000339480 p.C226C GRIK3 chr1 36806303 36806303 Missense_Mutation C C A TCGA-B0-5692-01A-11D-1534-10 ENST00000373091 p.E705D RLF chr1 40195704 40195704 Missense_Mutation G G A TCGA-B0-5692-01A-11D-1534-10 ENST00000372771 p.V183M COL11A1 chr1 102889481 102889481 Missense_Mutation C C T TCGA-B0-5692-01A-11D-1534-10 ENST00000370096 p.G1480R RPTN chr1 152157905 152157905 5'UTR T T A TCGA-B0-5692-01A-11D-1534-10 ENST00000316073 MNDA chr1 158842341 158842341 Missense_Mutation A A G TCGA-B0-5692-01A-11D-1534-10 ENST00000368141 p.D63G C1orf204 chr1 159841228 159841228 Missense_Mutation G G T TCGA-B0-5692-01A-11D-1534-10 ENST00000368102 p.P114T PYCR2 chr1 225920345 225920345 3'UTR C C A TCGA-B0-5692-01A-11D-1534-10 ENST00000343818 ARHGAP25 chr2 68807460 68807460 Silent G G A TCGA-B0-5692-01A-11D-1534-10 ENST00000409202 p.G218G RETSAT chr2 85351003 85351003 Missense_Mutation C C A TCGA-B0-5692-01A-11D-1534-10 ENST00000295802 p.R125L ITGB6 chr2 160138181 160138181 Missense_Mutation C C G TCGA-B0-5692-01A-11D-1534-10 ENST00000283249 p.E376Q MYO1B chr2 191364197 191364197 Nonsense_Mutation C C A TCGA-B0-5692-01A-11D-1534-10 ENST00000304164 p.S318* VHL chr3 10149844 10149845 Frame_Shift_Ins - - TT TCGA-B0-5692-01A-11D-1534-10 ENST00000256474 p.Y175Ffs*28 ZMYND10 chr3 50341424 50341424 Missense_Mutation C C A TCGA-B0-5692-01A-11D-1534-10 ENST00000231749 p.D437Y TACC3 chr4 1745027 1745027 3'UTR G G T TCGA-B0-5692-01A-11D-1534-10 ENST00000313288 WDFY3 chr4 84753717 84753717 Missense_Mutation T T C TCGA-B0-5692-01A-11D-1534-10 ENST00000295888 p.I1907V LARP1B chr4 128207309 128207309 Missense_Mutation A A G TCGA-B0-5692-01A-11D-1534-10 ENST00000326639 p.K825E NEK1 chr4 169400300 169400300 Frame_Shift_Del T T - TCGA-B0-5692-01A-11D-1534-10 ENST00000439128 p.I1230Ffs*16 AMACR chr5 33989416 33989416 Missense_Mutation C C T TCGA-B0-5692-01A-11D-1534-10 ENST00000335606 p.A276T DAB2 chr5 39376774 39376774 Silent T T A TCGA-B0-5692-01A-11D-1534-10 ENST00000320816 p.G671G ACSL6 chr5 131985432 131985432 Frame_Shift_Del A A - TCGA-B0-5692-01A-11D-1534-10 ENST00000379240 p.I272Mfs*30 PSD2 chr5 139837705 139837705 Silent G G A TCGA-B0-5692-01A-11D-1534-10 ENST00000274710 p.R582R FAM217A chr6 4068813 4068824 In_Frame_Del CTTTTTGGTCCC CTTTTTGGTCCC - TCGA-B0-5692-01A-11D-1534-10 ENST00000274673 p.G467_K470del CAP2 chr6 17556361 17556361 Splice_Region A A G TCGA-B0-5692-01A-11D-1534-10 ENST00000229922 p.R451R SCUBE3 chr6 35244771 35244771 Silent C C T TCGA-B0-5692-01A-11D-1534-10 ENST00000274938 p.S787S GSTA3 chr6 52899978 52899978 Missense_Mutation T T G TCGA-B0-5692-01A-11D-1534-10 ENST00000211122 p.I124L TRAF3IP2 chr6 111591592 111591593 Frame_Shift_Ins - - T TCGA-B0-5692-01A-11D-1534-10 ENST00000340026 p.N174Kfs*10 ABCB5 chr7 20646061 20646061 Frame_Shift_Del T T - TCGA-B0-5692-01A-11D-1534-10 ENST00000404938 p.Y302Mfs*11 ABCB5 chr7 20646063 20646063 Nonsense_Mutation T T A TCGA-B0-5692-01A-11D-1534-10 ENST00000404938 p.Y302* HOXA9 chr7 27163549 27163549 3'UTR G G C TCGA-B0-5692-01A-11D-1534-10 ENST00000343483 CRHR2 chr7 30662179 30662179 Silent G G T TCGA-B0-5692-01A-11D-1534-10 ENST00000471646 p.G245G SSPO chr7 149788408 149788408 Nonsense_Mutation G G A TCGA-B0-5692-01A-11D-1534-10 ENST00000378016 p.W1302* MYOM2 chr8 2057713 2057713 Missense_Mutation G G A TCGA-B0-5692-01A-11D-1534-10 ENST00000262113 p.V165I KIAA1456 chr8 13012704 13012707 Frame_Shift_Del CTTA CTTA - TCGA-B0-5692-01A-11D-1534-10 ENST00000524591 p.L59Kfs*2 FGF17 chr8 22046260 22046260 Silent C C A TCGA-B0-5692-01A-11D-1534-10 ENST00000359441 p.I73I ADGRA2 chr8 37835734 37835734 Missense_Mutation C C G TCGA-B0-5692-01A-11D-1534-10 ENST00000412232 p.R672G HEY1 chr8 79765059 79765059 3'UTR A A - TCGA-B0-5692-01A-11D-1534-10 ENST00000354724 RIMS2 chr8 103921770 103921770 Missense_Mutation T T C TCGA-B0-5692-01A-11D-1534-10 ENST00000262231 p.S583P FAM74A1 chr9 39371290 39371290 RNA C C T TCGA-B0-5692-01A-11D-1534-10 ENST00000465257 SPATA31D1 chr9 81994497 81994497 Nonsense_Mutation C C T TCGA-B0-5692-01A-11D-1534-10 ENST00000344803 p.Q1343* RBM17 chr10 6101357 6101357 Silent C C T TCGA-B0-5692-01A-11D-1534-10 ENST00000379888 p.D70D PTCHD3 chr10 27413254 27413254 Missense_Mutation G G T TCGA-B0-5692-01A-11D-1534-10 ENST00000438700 p.P333T MARCH5 chr10 92349726 92349726 Missense_Mutation T T G TCGA-B0-5692-01A-11D-1534-10 ENST00000358935 p.H203Q LDB1 chr10 102111110 102111111 Nonsense_Mutation TG TG - TCGA-B0-5692-01A-11D-1534-10 ENST00000425280 p.Y69* GPAM chr10 112157210 112157210 Intron T T C TCGA-B0-5692-01A-11D-1534-10 ENST00000348367 FIBP chr11 65886330 65886330 Silent C C T TCGA-B0-5692-01A-11D-1534-10 ENST00000338369 p.R168R SYTL2 chr11 85720897 85720897 Missense_Mutation G G A TCGA-B0-5692-01A-11D-1534-10 ENST00000528231 p.P508S HMBS chr11 119092196 119092196 Intron T T C TCGA-B0-5692-01A-11D-1534-10 ENST00000278715 SLC2A14 chr12 7828753 7828759 Frame_Shift_Del ACTTTCA ACTTTCA - TCGA-B0-5692-01A-11D-1534-10 ENST00000396589 p.E231Pfs*34 GRIN2B chr12 13866111 13866111 Missense_Mutation G G A TCGA-B0-5692-01A-11D-1534-10 ENST00000609686 p.P33L ZBTB39 chr12 57003077 57003077 Missense_Mutation A A G TCGA-B0-5692-01A-11D-1534-10 ENST00000300101 p.F614S ZFC3H1 chr12 71632407 71632407 Missense_Mutation T T A TCGA-B0-5692-01A-11D-1534-10 ENST00000378743 p.E975D ACTR6 chr12 100223836 100223836 Missense_Mutation A A G TCGA-B0-5692-01A-11D-1534-10 ENST00000188312 p.D371G N4BP2L2 chr13 32442465 32442465 Missense_Mutation C C G TCGA-B0-5692-01A-11D-1534-10 ENST00000399396 p.R691P AP1G2 chr14 23564118 23564118 Missense_Mutation T T C TCGA-B0-5692-01A-11D-1534-10 ENST00000308724 p.D340G YLPM1 chr14 74764014 74764014 Frame_Shift_Del C C - TCGA-B0-5692-01A-11D-1534-10 ENST00000325680 p.P177Rfs*42 RMDN3 chr15 40754696 40754696 Missense_Mutation G G T TCGA-B0-5692-01A-11D-1534-10 ENST00000260385 p.L30I VPS39 chr15 42208127 42208127 Silent C C T TCGA-B0-5692-01A-11D-1534-10 ENST00000348544 p.P9P CEP152 chr15 48796029 48796031 In_Frame_Del TTG TTG - TCGA-B0-5692-01A-11D-1534-10 ENST00000380950 p.Q224del CCNB2 chr15 59123625 59123625 Missense_Mutation A A T TCGA-B0-5692-01A-11D-1534-10 ENST00000288207 p.I362F ADAMTS7 chr15 78767443 78767443 Missense_Mutation G G A TCGA-B0-5692-01A-11D-1534-10 ENST00000388820 p.T932I RASGRF1 chr15 78971887 78971887 Silent G G A TCGA-B0-5692-01A-11D-1534-10 ENST00000419573 p.Y1236Y ANKS3 chr16 4726982 4726982 Silent G G C TCGA-B0-5692-01A-11D-1534-10 ENST00000304283 p.L122L MKL2 chr16 14210307 14210307 Splice_Region A A G TCGA-B0-5692-01A-11D-1534-10 ENST00000318282 p.P73P CDH1 chr16 68811795 68811795 Missense_Mutation A A G TCGA-B0-5692-01A-11D-1534-10 ENST00000261769 p.N315S ZNF469 chr16 88432058 88432058 Missense_Mutation C C T TCGA-B0-5692-01A-11D-1534-10 ENST00000437464 p.P1502S MYH13 chr17 10350575 10350575 Silent C C T TCGA-B0-5692-01A-11D-1534-10 ENST00000252172 p.A375A PIP4K2B chr17 38786911 38786911 Silent G G A TCGA-B0-5692-01A-11D-1534-10 ENST00000619039 p.L57L COL1A1 chr17 50189213 50189213 Silent A A G TCGA-B0-5692-01A-11D-1534-10 ENST00000225964 p.P964P PPP4R1 chr18 9570188 9570188 Silent T T A TCGA-B0-5692-01A-11D-1534-10 ENST00000400556 p.L514L FBN3 chr19 8118940 8118941 Frame_Shift_Del AC AC - TCGA-B0-5692-01A-11D-1534-10 ENST00000270509 p.C1098Sfs*5 ZNF317 chr19 9157955 9157955 Intron A A G TCGA-B0-5692-01A-11D-1534-10 ENST00000247956 ALKBH6 chr19 36013403 36013403 5'UTR C C T TCGA-B0-5692-01A-11D-1534-10 ENST00000252984 LILRB4 chr19 54662923 54662923 5'UTR C C A TCGA-B0-5692-01A-11D-1534-10 ENST00000391736 ZNF8 chr19 58294336 58294336 Silent C C G TCGA-B0-5692-01A-11D-1534-10 ENST00000621650 p.L176L PLAGL2 chr20 32196336 32196336 3'UTR T T - TCGA-B0-5692-01A-11D-1534-10 ENST00000246229 CHODL chr21 18256741 18256741 Nonsense_Mutation G G A TCGA-B0-5692-01A-11D-1534-10 ENST00000299295 p.W104* ATF4 chr22 39521905 39521907 In_Frame_Del GTG GTG - TCGA-B0-5692-01A-11D-1534-10 ENST00000337304 p.C120_D121delinsY SMC1B chr22 45383556 45383556 Missense_Mutation T T G TCGA-B0-5692-01A-11D-1534-10 ENST00000357450 p.S657R CXorf66 chrX 139956353 139956353 Missense_Mutation G G T TCGA-B0-5692-01A-11D-1534-10 ENST00000370540 p.P210H MUL1 chr1 20500943 20500943 Missense_Mutation C C T TCGA-CJ-5689-01A-11D-1534-10 ENST00000264198 p.R269H SYF2 chr1 25227512 25227512 Missense_Mutation G G A TCGA-CJ-5689-01A-11D-1534-10 ENST00000236273 p.R133C C1orf123 chr1 53216041 53216041 Missense_Mutation C C G TCGA-CJ-5689-01A-11D-1534-10 ENST00000294360 p.E119Q PKN2 chr1 88805499 88805499 Frame_Shift_Del A A - TCGA-CJ-5689-01A-11D-1534-10 ENST00000370521 p.T503Hfs*8 PRCC chr1 156800467 156800467 3'UTR G G A TCGA-CJ-5689-01A-11D-1534-10 ENST00000271526 LHX9 chr1 197929144 197929144 Missense_Mutation C C T TCGA-CJ-5689-01A-11D-1534-10 ENST00000367387 p.T360I DISC1 chr1 232008800 232008800 Silent G G T TCGA-CJ-5689-01A-11D-1534-10 ENST00000439617 p.L686L CHRM3 chr1 239907820 239907820 Silent T T C TCGA-CJ-5689-01A-11D-1534-10 ENST00000255380 p.N123N POLR1B chr2 112552793 112552793 Nonsense_Mutation C C T TCGA-CJ-5689-01A-11D-1534-10 ENST00000263331 p.Q379* LRP2 chr2 169137479 169137479 Silent G G T TCGA-CJ-5689-01A-11D-1534-10 ENST00000263816 p.V4511V pk chr2 173182945 173182945 Missense_Mutation T T G TCGA-CJ-5689-01A-11D-1534-10 ENST00000375213 p.D113E PIKFYVE chr2 208277569 208277569 Missense_Mutation T T A TCGA-CJ-5689-01A-11D-1534-10 ENST00000264380 p.D158E UGT1A3 chr2 233747998 233748001 Intron GATG GATG - TCGA-CJ-5689-01A-11D-1534-10 ENST00000482026 POU1F1 chr3 87260035 87260035 Missense_Mutation C C T TCGA-CJ-5689-01A-11D-1534-10 ENST00000350375 p.M245I KIAA1407 chr3 114042801 114042801 Missense_Mutation T T A TCGA-CJ-5689-01A-11D-1534-10 ENST00000295878 p.E106V PLSCR5 chr3 146593925 146593925 Nonsense_Mutation G G A TCGA-CJ-5689-01A-11D-1534-10 ENST00000443512 p.Q150* SCFD2 chr4 52920741 52920741 Missense_Mutation C C G TCGA-CJ-5689-01A-11D-1534-10 ENST00000401642 p.G564A ENAM chr4 70634492 70634492 Missense_Mutation A A C TCGA-CJ-5689-01A-11D-1534-10 ENST00000396073 p.K132T DSPP chr4 87614876 87614876 Silent C C T TCGA-CJ-5689-01A-11D-1534-10 ENST00000282478 p.S738S ANK2 chr4 113343026 113343026 Nonsense_Mutation G G T TCGA-CJ-5689-01A-11D-1534-10 ENST00000357077 p.G1378* RUNX2 chr6 45437985 45437985 Missense_Mutation C C T TCGA-CJ-5689-01A-11D-1534-10 ENST00000371438 p.P207S TMEM30A chr6 75267742 75267742 Frame_Shift_Del A A - TCGA-CJ-5689-01A-11D-1534-10 ENST00000230461 p.Y82Ifs*18 NKAIN2 chr6 124823341 124823341 3'UTR A A T TCGA-CJ-5689-01A-11D-1534-10 ENST00000368417 RHBDD2 chr7 75882043 75882043 Silent T T C TCGA-CJ-5689-01A-11D-1534-10 ENST00000006777 p.D131D RBM33 chr7 155700794 155700794 Missense_Mutation C C A TCGA-CJ-5689-01A-11D-1534-10 ENST00000401878 p.L197I SGK223 chr8 8328346 8328346 Silent G G T TCGA-CJ-5689-01A-11D-1534-10 ENST00000622241 p.P812P MUSK chr9 110800565 110800569 Frame_Shift_Del GAACT GAACT - TCGA-CJ-5689-01A-11D-1534-10 ENST00000374448 p.N730Pfs*28 MUSK chr9 110800570 110800570 Missense_Mutation G G T TCGA-CJ-5689-01A-11D-1534-10 ENST00000374448 p.C731F MUSK chr9 110800571 110800571 Silent C C T TCGA-CJ-5689-01A-11D-1534-10 ENST00000374448 p.C731C PTGES2 chr9 128125246 128125246 Missense_Mutation A A T TCGA-CJ-5689-01A-11D-1534-10 ENST00000338961 p.S159T RHOBTB1 chr10 60889140 60889140 Silent C C T TCGA-CJ-5689-01A-11D-1534-10 ENST00000337910 p.E176E IFIT3 chr10 89338859 89338859 Silent G G A TCGA-CJ-5689-01A-11D-1534-10 ENST00000371811 p.E68E POLL chr10 101585989 101585989 Missense_Mutation G G A TCGA-CJ-5689-01A-11D-1534-10 ENST00000299206 p.L95F PDCD11 chr10 103415150 103415150 Frame_Shift_Del G G - TCGA-CJ-5689-01A-11D-1534-10 ENST00000369797 MUC2 chr11 1097377 1097377 RNA T T C TCGA-CJ-5689-01A-11D-1534-10 ENST00000361558 OR10A3 chr11 7938660 7938660 Silent C C T TCGA-CJ-5689-01A-11D-1534-10 ENST00000360759 p.P287P OR4X1 chr11 48264764 48264764 Nonsense_Mutation G G T TCGA-CJ-5689-01A-11D-1534-10 ENST00000320048 p.G302* OR5L2 chr11 55827727 55827727 Missense_Mutation G G T TCGA-CJ-5689-01A-11D-1534-10 ENST00000378397 p.R170I MTA2 chr11 62595439 62595439 Silent A A C TCGA-CJ-5689-01A-11D-1534-10 ENST00000278823 p.P436P NEU3 chr11 75005689 75005689 Missense_Mutation G G A TCGA-CJ-5689-01A-11D-1534-10 ENST00000294064 p.G195S RP11-108O10.8 chr11 111878649 111878649 Missense_Mutation C C G TCGA-CJ-5689-01A-11D-1534-10 ENST00000622211 p.R79T MCAM chr11 119312353 119312353 Frame_Shift_Del C C - TCGA-CJ-5689-01A-11D-1534-10 ENST00000264036 p.E313Nfs*16 RASSF8 chr12 26065230 26065230 Missense_Mutation G G A TCGA-CJ-5689-01A-11D-1534-10 ENST00000282884 p.R279Q PDE1B chr12 54573660 54573660 Missense_Mutation C C G TCGA-CJ-5689-01A-11D-1534-10 ENST00000243052 p.H339D ANKRD52 chr12 56248868 56248868 Missense_Mutation C C G TCGA-CJ-5689-01A-11D-1534-10 ENST00000267116 p.C532S RASSF3 chr12 64691542 64691542 Missense_Mutation C C A TCGA-CJ-5689-01A-11D-1534-10 ENST00000336061 p.T177K SVOP chr12 108919757 108919757 Missense_Mutation G G A TCGA-CJ-5689-01A-11D-1534-10 ENST00000610966 p.R396C SGCG chr13 23234644 23234644 Missense_Mutation G G A TCGA-CJ-5689-01A-11D-1534-10 ENST00000218867 p.G77R RNASEH2B chr13 50934961 50934961 Missense_Mutation G G C TCGA-CJ-5689-01A-11D-1534-10 ENST00000336617 p.G133A GPC6 chr13 93227390 93227390 5'UTR G G A TCGA-CJ-5689-01A-11D-1534-10 ENST00000377047 BAG5 chr14 103560400 103560400 Silent A A G TCGA-CJ-5689-01A-11D-1534-10 ENST00000299204 p.Y255Y UACA chr15 70668888 70668888 Missense_Mutation T T A TCGA-CJ-5689-01A-11D-1534-10 ENST00000322954 p.E599V UACA chr15 70668889 70668889 Missense_Mutation C C T TCGA-CJ-5689-01A-11D-1534-10 ENST00000322954 p.E599K CHD2 chr15 92944296 92944296 Intron T T A TCGA-CJ-5689-01A-11D-1534-10 ENST00000394196 TSNAXIP1 chr16 67827935 67827935 Missense_Mutation G G A TCGA-CJ-5689-01A-11D-1534-10 ENST00000388833 p.R640Q C16orf74 chr16 85707803 85707803 3'UTR C C T TCGA-CJ-5689-01A-11D-1534-10 ENST00000284245 YBX2 chr17 7288807 7288807 Missense_Mutation G G T TCGA-CJ-5689-01A-11D-1534-10 ENST00000007699 p.T359N RPTOR chr17 80945725 80945725 Silent G G A TCGA-CJ-5689-01A-11D-1534-10 ENST00000306801 p.V1028V EPB41L3 chr18 5434059 5434059 Missense_Mutation A A C TCGA-CJ-5689-01A-11D-1534-10 ENST00000341928 p.V223G VPS4B chr18 63397067 63397067 Silent A A G TCGA-CJ-5689-01A-11D-1534-10 ENST00000238497 p.V353V SERPINB12 chr18 63567010 63567010 Frame_Shift_Del A A - TCGA-CJ-5689-01A-11D-1534-10 ENST00000269491 CNDP1 chr18 74583601 74583601 Silent C C G TCGA-CJ-5689-01A-11D-1534-10 ENST00000358821 p.T450T CTDP1 chr18 79729056 79729056 Missense_Mutation G G A TCGA-CJ-5689-01A-11D-1534-10 ENST00000613122 p.S856N ZNF433 chr19 12016247 12016247 Missense_Mutation A A C TCGA-CJ-5689-01A-11D-1534-10 ENST00000344980 p.L207W ARHGAP35 chr19 46918911 46918922 In_Frame_Del TTAGCCGCTCCC TTAGCCGCTCCC - TCGA-CJ-5689-01A-11D-1534-10 ENST00000404338 p.S80_L83del ARHGAP35 chr19 46918923 46918923 Missense_Mutation T T A TCGA-CJ-5689-01A-11D-1534-10 ENST00000404338 p.L83Q PPP1R15A chr19 48875884 48875884 Missense_Mutation A A G TCGA-CJ-5689-01A-11D-1534-10 ENST00000200453 p.T646A PPP1R15A chr19 48875885 48875885 Missense_Mutation C C T TCGA-CJ-5689-01A-11D-1534-10 ENST00000200453 p.T646I IDH3B chr20 2663542 2663544 Nonsense_Mutation GGA GGA - TCGA-CJ-5689-01A-11D-1534-10 ENST00000380843 p.F80_Q81delins* SGK2 chr20 43569508 43569508 Missense_Mutation G G A TCGA-CJ-5689-01A-11D-1534-10 ENST00000341458 p.G178R ZMYND8 chr20 47224417 47224417 Silent C C T TCGA-CJ-5689-01A-11D-1534-10 ENST00000311275 p.K1032K C20orf85 chr20 58151011 58151011 Missense_Mutation T T A TCGA-CJ-5689-01A-11D-1534-10 ENST00000371168 p.L16H DSCR3 chr21 37232438 37232438 Missense_Mutation T T A TCGA-CJ-5689-01A-11D-1534-10 ENST00000309117 p.K149M DSCAM chr21 40052016 40052016 Missense_Mutation T T A TCGA-CJ-5689-01A-11D-1534-10 ENST00000400454 p.Q1709H NDUFV3 chr21 42903421 42903421 Intron T T A TCGA-CJ-5689-01A-11D-1534-10 ENST00000340344 IGLV6-57 chr22 22196218 22196218 Missense_Mutation G G A TCGA-CJ-5689-01A-11D-1534-10 ENST00000390285 p.G99R MYH9 chr22 36285198 36285198 Silent C C T TCGA-CJ-5689-01A-11D-1534-10 ENST00000216181 p.K1802K CSF2RB chr22 36937422 36937422 Silent C C T TCGA-CJ-5689-01A-11D-1534-10 ENST00000403662 p.T538T TOB2 chr22 41433910 41433910 3'UTR T T - TCGA-CJ-5689-01A-11D-1534-10 ENST00000327492 RLIM chrX 74592852 74592852 Nonsense_Mutation C C A TCGA-CJ-5689-01A-11D-1534-10 ENST00000332687 p.E155* WRAP73 chr1 3647543 3647543 Nonsense_Mutation G G C TCGA-MM-A84U-01A-11D-A36X-10 ENST00000270708 p.Y29* MTOR chr1 11234211 11234211 Missense_Mutation G G A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000361445 p.R755C HTR6 chr1 19665606 19665606 5'UTR C C - TCGA-MM-A84U-01A-11D-A36X-10 ENST00000289753 HNRNPR chr1 23310381 23310382 3'UTR - - T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000302271 OPRD1 chr1 28863005 28863005 Missense_Mutation G G A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000234961 p.V281I FAF1 chr1 50535428 50535430 In_Frame_Del TCA TCA - TCGA-MM-A84U-01A-11D-A36X-10 ENST00000396153 p.M478del OSBPL9 chr1 51760611 51760611 Intron C C A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000428468 NTNG1 chr1 107480804 107480804 Silent C C T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000370068 p.T528T LMNA chr1 156138602 156138602 Missense_Mutation G G A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000368300 p.A605T NES chr1 156676913 156676913 Missense_Mutation C C T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000368223 p.A118T KIRREL chr1 157993616 157993616 5'UTR C C T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000359209 CFHR4 chr1 196905112 196905112 Silent A A G TCGA-MM-A84U-01A-11D-A36X-10 ENST00000367416 p.T86T LAD1 chr1 201386944 201386953 Frame_Shift_Del TTCCAGTTCC TTCCAGTTCC - TCGA-MM-A84U-01A-11D-A36X-10 ENST00000391967 p.E137Sfs*7 LAD1 chr1 201386955 201386955 Nonsense_Mutation T T A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000391967 p.K136* RYR2 chr1 237423135 237423135 Missense_Mutation C C T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000366574 p.R298C HPCAL1 chr2 10424564 10424564 Intron A A T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000307845 PREB chr2 27131408 27131408 3'UTR G G A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000260643 EHBP1 chr2 62990793 62990793 Missense_Mutation A A T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000263991 p.S967C TTN chr2 178543845 178543845 Missense_Mutation A A G TCGA-MM-A84U-01A-11D-A36X-10 ENST00000591111 p.V30459A C2orf83 chr2 227633204 227633204 5'Flank C C G TCGA-MM-A84U-01A-11D-A36X-10 ENST00000264387 EPHA6 chr3 97648442 97648442 Intron A A G TCGA-MM-A84U-01A-11D-A36X-10 ENST00000389672 KIAA1407 chr3 114005929 114005929 Missense_Mutation G G A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000295878 p.P483S C3orf30 chr3 119151286 119151286 Missense_Mutation G G T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000295622 p.Q535H CLSTN2 chr3 140404591 140404591 Silent C C T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000458420 p.N154N IFT80 chr3 160282556 160282556 Missense_Mutation C C T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000326448 p.A480T ACTL6A chr3 179581165 179581165 Missense_Mutation G G C TCGA-MM-A84U-01A-11D-A36X-10 ENST00000429709 p.G324A ADAMTS3 chr4 72339673 72339673 Missense_Mutation C C T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000286657 p.D228N CXCL1 chr4 73869770 73869770 Missense_Mutation C C T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000395761 p.H68Y NDST4 chr4 115076597 115076597 Missense_Mutation C C T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000264363 p.R147Q SCLT1 chr4 129093106 129093106 5'UTR C C T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000281142 INPP4B chr4 142086214 142086216 In_Frame_Del AGC AGC - TCGA-MM-A84U-01A-11D-A36X-10 ENST00000262992 p.L806del ITGA1 chr5 52881900 52881900 Missense_Mutation G G A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000282588 p.V218M SV2C chr5 76325452 76325452 Missense_Mutation A A C TCGA-MM-A84U-01A-11D-A36X-10 ENST00000502798 p.K697Q RHOBTB3 chr5 95737036 95737036 Missense_Mutation G G A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000379982 p.V126I RAD50 chr5 132591362 132591365 Frame_Shift_Del CATA CATA - TCGA-MM-A84U-01A-11D-A36X-10 ENST00000378823 p.H531Qfs*10 BRD8 chr5 138177644 138177644 Missense_Mutation G G T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000254900 p.P15T PCDHGC3 chr5 141477018 141477018 Missense_Mutation C C G TCGA-MM-A84U-01A-11D-A36X-10 ENST00000308177 p.T301S TENM2 chr5 168262602 168262602 Missense_Mutation C C T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000518659 p.T2706M CSNK2B-LY6G5B--991 chr6 31667934 31667934 Nonsense_Mutation C C T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000618754 p.R47* SLC17A5 chr6 73641887 73641887 Missense_Mutation C C A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000355773 p.W110L ENPP1 chr6 131864548 131864548 Missense_Mutation G G T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000360971 p.W356C CNKSR3 chr6 154422531 154422531 Missense_Mutation A A G TCGA-MM-A84U-01A-11D-A36X-10 ENST00000607772 p.L307P MLLT4 chr6 167825888 167825888 5'Flank A A T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000447894 LRRD1 chr7 92164418 92164418 Nonsense_Mutation A A T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000430130 p.L262* FBXL13 chr7 103025212 103025212 Nonsense_Mutation G G A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000313221 p.Q116* UBN2 chr7 139237028 139237028 Missense_Mutation C C G TCGA-MM-A84U-01A-11D-A36X-10 ENST00000473989 p.D164E ASIC3 chr7 151051275 151051275 Silent G G A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000349064 p.A390A KIF13B chr8 29191042 29191053 In_Frame_Del GATCATAAGCAA GATCATAAGCAA - TCGA-MM-A84U-01A-11D-A36X-10 ENST00000524189 p.F56_H60delinsY TAF1L chr9 32635628 32635628 5'UTR C C T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000242310 ROR2 chr9 91731126 91731126 Missense_Mutation C C A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000375708 p.D323Y TTC16 chr9 127727311 127727311 Missense_Mutation C C T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000373289 p.A537V C9orf9 chr9 132888604 132888604 Missense_Mutation A A C TCGA-MM-A84U-01A-11D-A36X-10 ENST00000356311 p.K221T TMEM254 chr10 80078694 80078694 5'UTR G G A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000372281 TMEM254 chr10 80078695 80078695 5'UTR C C G TCGA-MM-A84U-01A-11D-A36X-10 ENST00000372281 KRTAP5-1 chr11 1584688 1584688 Missense_Mutation C C T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000382171 p.G188S API5 chr11 43328858 43328858 Missense_Mutation A A C TCGA-MM-A84U-01A-11D-A36X-10 ENST00000531273 p.K364N OVOL1 chr11 65795101 65795101 Silent T T C TCGA-MM-A84U-01A-11D-A36X-10 ENST00000335987 p.S188S CHD4 chr12 6587916 6587916 Missense_Mutation T T C TCGA-MM-A84U-01A-11D-A36X-10 ENST00000357008 p.K1167E C1S chr12 7062476 7062476 Missense_Mutation T T A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000328916 p.C3S MANSC4 chr12 27762813 27762813 Missense_Mutation C C G TCGA-MM-A84U-01A-11D-A36X-10 ENST00000381273 p.Q316H RPL41 chr12 56116674 56116674 Intron G G T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000501597 SMARCC2 chr12 56181100 56181100 Missense_Mutation G G A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000267064 p.P320S TRIM13 chr13 50014149 50014149 3'UTR C C A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000378182 KIF26A chr14 104166899 104166899 Missense_Mutation C C T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000423312 p.P322S CAPN3 chr15 42411293 42411293 Missense_Mutation T T A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000397163 p.F796Y TLN2 chr15 62771074 62771074 Silent T T C TCGA-MM-A84U-01A-11D-A36X-10 ENST00000306829 p.T1769T SPG21 chr15 64981026 64981026 Splice_Site C C G TCGA-MM-A84U-01A-11D-A36X-10 ENST00000204566 p.X22_splice RAB40C chr16 590274 590274 5'UTR G G A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000248139 HAGH chr16 1809361 1809361 Silent G G A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000397356 p.H283H SRRM2 chr16 2757549 2757549 Missense_Mutation G G C TCGA-MM-A84U-01A-11D-A36X-10 ENST00000301740 p.G107A RBFOX1 chr16 7630604 7630604 Splice_Region C C T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000547338 p.G226G CETP chr16 56969461 56969461 Missense_Mutation T T G TCGA-MM-A84U-01A-11D-A36X-10 ENST00000200676 p.I103M CENPT chr16 67830532 67830532 Missense_Mutation G G T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000440851 p.D240E GPR179 chr17 38331419 38331419 Missense_Mutation C C T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000616987 p.R717H SLC35B1 chr17 49707737 49707737 Missense_Mutation C C T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000240333 p.E70K DNAI2 chr17 74305311 74305311 Silent C C T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000311014 p.F360F ARHGDIA chr17 81869738 81869738 Splice_Region C C A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000269321 ZNF271P chr18 35307597 35307597 RNA C C G TCGA-MM-A84U-01A-11D-A36X-10 ENST00000399070 LMAN1 chr18 59331099 59331099 Missense_Mutation G G C TCGA-MM-A84U-01A-11D-A36X-10 ENST00000251047 p.F509L FBN3 chr19 8081458 8081459 Frame_Shift_Del GA GA - TCGA-MM-A84U-01A-11D-A36X-10 ENST00000270509 p.V2412Afs*75 HPN chr19 35060724 35060724 Missense_Mutation C C G TCGA-MM-A84U-01A-11D-A36X-10 ENST00000262626 p.H240D ATP4A chr19 35555524 35555524 Missense_Mutation C C A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000262623 p.E691D HNRNPL chr19 38836662 38836662 3'UTR A A T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000221419 B9D2 chr19 41354798 41354798 Frame_Shift_Del C C - TCGA-MM-A84U-01A-11D-A36X-10 ENST00000243578 p.A144Pfs*68 ATP1A3 chr19 41967301 41967301 Silent G G T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000302102 p.L987L BIRC8 chr19 53290616 53290616 5'UTR G G A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000426466 ZNF761 chr19 53455677 53455678 Frame_Shift_Ins - - T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000432094 p.S392* ZNF761 chr19 53455683 53455683 Missense_Mutation T T A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000432094 p.S392R SOX12 chr20 328569 328570 3'UTR - - A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000342665 NAA20 chr20 20033355 20033355 3'UTR G G A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000334982 TPX2 chr20 31798392 31798392 Frame_Shift_Del A A - TCGA-MM-A84U-01A-11D-A36X-10 ENST00000300403 p.E658Dfs*24 C20orf24 chr20 36605876 36605876 5'UTR C C - TCGA-MM-A84U-01A-11D-A36X-10 ENST00000373852 ADNP chr20 50892847 50892847 Missense_Mutation G G T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000349014 p.L623I SALL4 chr20 51788906 51788906 Silent C C A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000217086 p.V899V MORC3 chr21 36356686 36356686 Silent T T C TCGA-MM-A84U-01A-11D-A36X-10 ENST00000400485 p.N390N RNF185 chr22 31204742 31204742 3'UTR T T A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000326132 TCF20 chr22 42212671 42212671 Frame_Shift_Del C C - TCGA-MM-A84U-01A-11D-A36X-10 ENST00000359486 p.D879Tfs*10 FGD1 chrX 54455503 54455503 Missense_Mutation G G C TCGA-MM-A84U-01A-11D-A36X-10 ENST00000375135 p.L654V GJB1 chrX 71223862 71223862 Missense_Mutation T T C TCGA-MM-A84U-01A-11D-A36X-10 ENST00000361726 p.I52T MORC4 chrX 106942570 106942570 Missense_Mutation C C T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000355610 p.R774K KCNE5 chrX 109625026 109625026 5'UTR T T A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000372101 KCNE5 chrX 109625027 109625027 5'UTR C C T TCGA-MM-A84U-01A-11D-A36X-10 ENST00000372101 CHRDL1 chrX 110719859 110719859 Missense_Mutation C C G TCGA-MM-A84U-01A-11D-A36X-10 ENST00000372045 p.D166H DNASE1L1 chrX 154402683 154402683 3'UTR G G A TCGA-MM-A84U-01A-11D-A36X-10 ENST00000014935 DNAH14 chr1 225338097 225338097 Intron A A G TCGA-CJ-5681-01A-11D-1534-10 ENST00000445597 GLI2 chr2 120927447 120927450 Frame_Shift_Del TCTG TCTG - TCGA-CJ-5681-01A-11D-1534-10 ENST00000361492 p.V80Tfs*20 CRYGA chr2 208160870 208160870 Missense_Mutation C C G TCGA-CJ-5681-01A-11D-1534-10 ENST00000304502 p.R153S NPRL2 chr3 50349385 50349385 Splice_Site C C G TCGA-CJ-5681-01A-11D-1534-10 ENST00000232501 p.X150_splice TNFSF10 chr3 172523394 172523395 5'UTR AG AG - TCGA-CJ-5681-01A-11D-1534-10 ENST00000241261 DST chr6 56617078 56617078 Intron T T C TCGA-CJ-5681-01A-11D-1534-10 ENST00000312431 SOBP chr6 107490662 107490662 Missense_Mutation A A G TCGA-CJ-5681-01A-11D-1534-10 ENST00000317357 p.S16G SEMA3A chr7 84011238 84011238 Silent A A G TCGA-CJ-5681-01A-11D-1534-10 ENST00000265362 p.R290R PLOD3 chr7 101216778 101216778 Missense_Mutation G G T TCGA-CJ-5681-01A-11D-1534-10 ENST00000223127 p.L40M PLOD3 chr7 101216779 101216779 Silent C C A TCGA-CJ-5681-01A-11D-1534-10 ENST00000223127 p.L39L FAM71F2 chr7 128683082 128683082 Missense_Mutation G G A TCGA-CJ-5681-01A-11D-1534-10 ENST00000480462 p.E285K SLC35G5 chr8 11332187 11332187 3'UTR A A - TCGA-CJ-5681-01A-11D-1534-10 ENST00000382435 CHD7 chr8 60842025 60842025 Missense_Mutation G G A TCGA-CJ-5681-01A-11D-1534-10 ENST00000423902 p.R1608K KIF27 chr9 83859242 83859242 Missense_Mutation C C A TCGA-CJ-5681-01A-11D-1534-10 ENST00000297814 p.V1022F SLC16A9 chr10 59672781 59672781 Missense_Mutation C C G TCGA-CJ-5681-01A-11D-1534-10 ENST00000395347 p.G110A OR5W2 chr11 55914373 55914373 Missense_Mutation A A T TCGA-CJ-5681-01A-11D-1534-10 ENST00000344514 p.D70E MSI1 chr12 120353300 120353300 Splice_Region G G A TCGA-CJ-5681-01A-11D-1534-10 ENST00000257552 p.P244P ZNF84 chr12 133056981 133056981 Missense_Mutation T T A TCGA-CJ-5681-01A-11D-1534-10 ENST00000327668 p.M89K MZT1 chr13 72718996 72718996 Missense_Mutation A A C TCGA-CJ-5681-01A-11D-1534-10 ENST00000377818 p.S61A ZFHX3 chr16 72797226 72797226 Missense_Mutation C C A TCGA-CJ-5681-01A-11D-1534-10 ENST00000268489 p.S1819I ZCCHC14 chr16 87460011 87460015 Frame_Shift_Del TGCTG TGCTG - TCGA-CJ-5681-01A-11D-1534-10 ENST00000268616 p.H92Qfs*5 PDIK1L chr1 26122705 26122705 3'UTR T T - TCGA-B2-5636-01A-02D-1534-10 ENST00000374269 NBPF15 chr1 144436988 144436988 Missense_Mutation C C A TCGA-B2-5636-01A-02D-1534-10 ENST00000488031 p.D134Y COX7A2L chr2 42351135 42351135 3'UTR A A - TCGA-B2-5636-01A-02D-1534-10 ENST00000234301 TTN chr2 178546021 178546021 Missense_Mutation C C G TCGA-B2-5636-01A-02D-1534-10 ENST00000591111 p.E30098Q TAMM41 chr3 11844072 11844072 Missense_Mutation C C A TCGA-B2-5636-01A-02D-1534-10 ENST00000444133 p.G92V RB1CC1 chr8 52657404 52657404 Missense_Mutation G G T TCGA-B2-5636-01A-02D-1534-10 ENST00000025008 p.H809N ATP6V1H chr8 53715888 53715888 3'UTR G G A TCGA-B2-5636-01A-02D-1534-10 ENST00000359530 ZNF16 chr8 144930998 144930998 Missense_Mutation C C T TCGA-B2-5636-01A-02D-1534-10 ENST00000276816 p.G597R RUFY2 chr10 68379422 68379422 Splice_Site A A T TCGA-B2-5636-01A-02D-1534-10 ENST00000388768 p.X437_splice INPP5F chr10 119797461 119797461 Missense_Mutation G G A TCGA-B2-5636-01A-02D-1534-10 ENST00000361976 p.G290E ACSM4 chr12 7317140 7317140 Silent C C T TCGA-B2-5636-01A-02D-1534-10 ENST00000399422 p.F208F KRT6C chr12 52472124 52472124 Missense_Mutation C C T TCGA-B2-5636-01A-02D-1534-10 ENST00000252250 p.G233S RILPL2 chr12 123436208 123436208 Silent G G A TCGA-B2-5636-01A-02D-1534-10 ENST00000280571 p.V71V OR4K15 chr14 19976426 19976426 Missense_Mutation C C T TCGA-B2-5636-01A-02D-1534-10 ENST00000305051 p.T303M LRRC16B chr14 24060697 24060697 Missense_Mutation G G A TCGA-B2-5636-01A-02D-1534-10 ENST00000342740 p.V711M C16orf96 chr16 4575363 4575363 Missense_Mutation G G T TCGA-B2-5636-01A-02D-1534-10 ENST00000444310 p.A295S MYO1D chr17 32760561 32760561 Missense_Mutation A A G TCGA-B2-5636-01A-02D-1534-10 ENST00000318217 p.Y368H SNRPA chr19 40763038 40763038 Silent G G A TCGA-B2-5636-01A-02D-1534-10 ENST00000243563 p.Q188Q TSHZ2 chr20 53255510 53255510 Missense_Mutation C C G TCGA-B2-5636-01A-02D-1534-10 ENST00000371497 p.N684K MFNG chr22 37474656 37474656 Silent T T G TCGA-B2-5636-01A-02D-1534-10 ENST00000356998 p.T223T IQSEC2 chrX 53234949 53234951 In_Frame_Del TGG TGG - TCGA-B2-5636-01A-02D-1534-10 ENST00000396435 p.H1247del EXOSC10 chr1 11095845 11095845 Frame_Shift_Del G G - TCGA-A3-3308-01A-01D-0966-08 ENST00000376936 p.S95Rfs*9 RCC1 chr1 28531848 28531848 Missense_Mutation T T A TCGA-A3-3308-01A-01D-0966-08 ENST00000373832 p.L40Q MANEAL chr1 37794590 37794590 Missense_Mutation G G T TCGA-A3-3308-01A-01D-0966-08 ENST00000373045 p.K136N CCDC163P chr1 45496590 45496590 Missense_Mutation G G C TCGA-A3-3308-01A-01D-0966-08 ENST00000629482 p.A99G CDCP2 chr1 54144543 54144543 Missense_Mutation G G A TCGA-A3-3308-01A-01D-0966-08 ENST00000371330 p.S117F INADL chr1 61822955 61822955 Missense_Mutation T T C TCGA-A3-3308-01A-01D-0966-08 ENST00000371158 p.I565T RPE65 chr1 68440856 68440856 Missense_Mutation C C A TCGA-A3-3308-01A-01D-0966-08 ENST00000262340 p.A214S LINC00869 chr1 149677509 149677509 RNA C C A TCGA-A3-3308-01A-01D-0966-08 ENST00000610578 TDRD10 chr1 154521403 154521403 Missense_Mutation G G A TCGA-A3-3308-01A-01D-0966-08 ENST00000368480 p.R98Q SWT1 chr1 185202710 185202712 In_Frame_Del AAG AAG - TCGA-A3-3308-01A-01D-0966-08 ENST00000367500 p.E529del HMCN1 chr1 186189642 186189642 Missense_Mutation A A G TCGA-A3-3308-01A-01D-0966-08 ENST00000271588 p.T5558A ASPM chr1 197124146 197124146 Missense_Mutation A A T TCGA-A3-3308-01A-01D-0966-08 ENST00000367409 p.D1118E C1orf106 chr1 200911516 200911519 Frame_Shift_Del CACT CACT - TCGA-A3-3308-01A-01D-0966-08 ENST00000367342 p.H428Tfs*3 USH2A chr1 215782062 215782062 Missense_Mutation C C G TCGA-A3-3308-01A-01D-0966-08 ENST00000307340 p.G3574R OR2L2 chr1 248038685 248038685 Missense_Mutation T T C TCGA-A3-3308-01A-01D-0966-08 ENST00000366479 p.C140R PPP1CB chr2 28799364 28799364 3'UTR G G A TCGA-A3-3308-01A-01D-0966-08 ENST00000296122 MAP3K19 chr2 134987148 134987148 Missense_Mutation G G A TCGA-A3-3308-01A-01D-0966-08 ENST00000375845 p.P575L RIF1 chr2 151468027 151468027 Missense_Mutation A A C TCGA-A3-3308-01A-01D-0966-08 ENST00000243326 p.I2210L TTN chr2 178701543 178701543 Missense_Mutation C C G TCGA-A3-3308-01A-01D-0966-08 ENST00000591111 p.A9878P TTN chr2 178719689 178719689 Missense_Mutation G G A TCGA-A3-3308-01A-01D-0966-08 ENST00000591111 p.H7618Y FN1 chr2 215433408 215433408 Missense_Mutation T T G TCGA-A3-3308-01A-01D-0966-08 ENST00000359671 p.T111P PPP1R7 chr2 241163334 241163334 Missense_Mutation G G C TCGA-A3-3308-01A-01D-0966-08 ENST00000234038 p.G216A VHL chr3 10149838 10149841 Frame_Shift_Del CTGA CTGA - TCGA-A3-3308-01A-01D-0966-08 ENST00000256474 p.P172Rfs*29 SETD2 chr3 47084315 47084315 Frame_Shift_Del G G - TCGA-A3-3308-01A-01D-0966-08 ENST00000409792 p.P1822Qfs*16 BAP1 chr3 52402785 52402787 In_Frame_Del CTT CTT - TCGA-A3-3308-01A-01D-0966-08 ENST00000460680 p.K659del IL17RB chr3 53864803 53864803 Missense_Mutation T T A TCGA-A3-3308-01A-01D-0966-08 ENST00000288167 p.L335H OR5H2 chr3 98282893 98282893 Silent G G A TCGA-A3-3308-01A-01D-0966-08 ENST00000355273 p.S2S IMPG2 chr3 101231103 101231103 Silent A A G TCGA-A3-3308-01A-01D-0966-08 ENST00000193391 p.C1092C EFCC1 chr3 129038873 129038873 Silent C C T TCGA-A3-3308-01A-01D-0966-08 ENST00000436022 p.L545L TRAM1L1 chr4 117084349 117084349 Missense_Mutation C C T TCGA-A3-3308-01A-01D-0966-08 ENST00000310754 p.G349R LINC01098 chr4 177990628 177990628 RNA A A G TCGA-A3-3308-01A-01D-0966-08 ENST00000507870 CDH6 chr5 31305192 31305195 Frame_Shift_Del AAGA AAGA - TCGA-A3-3308-01A-01D-0966-08 ENST00000265071 p.K341Cfs*36 ANKRD55 chr5 56111590 56111590 Silent A A G TCGA-A3-3308-01A-01D-0966-08 ENST00000341048 p.D386D HTR1A chr5 63961461 63961461 Missense_Mutation C C G TCGA-A3-3308-01A-01D-0966-08 ENST00000323865 p.V87L SPRY4 chr5 142315036 142315036 Missense_Mutation G G A TCGA-A3-3308-01A-01D-0966-08 ENST00000434127 p.R25W SYCP2L chr6 10955216 10955216 Frame_Shift_Del A A - TCGA-A3-3308-01A-01D-0966-08 ENST00000283141 p.E686Kfs*8 LGSN chr6 63280807 63280807 Nonsense_Mutation A A C TCGA-A3-3308-01A-01D-0966-08 ENST00000370657 p.Y248* PPIL4 chr6 149517374 149517374 Missense_Mutation A A C TCGA-A3-3308-01A-01D-0966-08 ENST00000253329 p.D353E TFB1M chr6 155314381 155314381 Frame_Shift_Del G G - TCGA-A3-3308-01A-01D-0966-08 ENST00000367166 p.T17Rfs*9 KIF25 chr6 168040179 168040179 Silent G G A TCGA-A3-3308-01A-01D-0966-08 ENST00000354419 p.T203T INTS1 chr7 1503917 1503917 Missense_Mutation G G A TCGA-A3-3308-01A-01D-0966-08 ENST00000404767 p.A15V RSPH10B chr7 5966936 5966936 Missense_Mutation G G A TCGA-A3-3308-01A-01D-0966-08 ENST00000337579 p.R61C LRRN3 chr7 111124522 111124522 Missense_Mutation A A G TCGA-A3-3308-01A-01D-0966-08 ENST00000308478 p.N584D PTPRZ1 chr7 122028554 122028554 Missense_Mutation A A T TCGA-A3-3308-01A-01D-0966-08 ENST00000393386 p.K1664I WASL chr7 123692618 123692618 Missense_Mutation G G T TCGA-A3-3308-01A-01D-0966-08 ENST00000223023 p.P359Q ASB10 chr7 151176150 151176150 Missense_Mutation G G A TCGA-A3-3308-01A-01D-0966-08 ENST00000420175 p.R456C NCAPG2 chr7 158654629 158654629 Silent T T C TCGA-A3-3308-01A-01D-0966-08 ENST00000356309 p.Q904Q MSR1 chr8 16110122 16110122 Nonsense_Mutation G G T TCGA-A3-3308-01A-01D-0966-08 ENST00000262101 p.S440* PTK2B chr8 27444245 27444245 Missense_Mutation C C T TCGA-A3-3308-01A-01D-0966-08 ENST00000346049 p.L730F ZBTB10 chr8 80487749 80487749 Silent T T C TCGA-A3-3308-01A-01D-0966-08 ENST00000430430 p.S313S DCAF13 chr8 103415507 103415507 Missense_Mutation T T G TCGA-A3-3308-01A-01D-0966-08 ENST00000612750 p.L21V CSMD3 chr8 112234365 112234365 Missense_Mutation A A C TCGA-A3-3308-01A-01D-0966-08 ENST00000297405 p.F3580L PHF2 chr9 93653356 93653356 Silent C C T TCGA-A3-3308-01A-01D-0966-08 ENST00000359246 p.H260H LRIT1 chr10 84232017 84232017 Silent C C T TCGA-A3-3308-01A-01D-0966-08 ENST00000372105 p.E594E PTEN chr10 87933192 87933192 Frame_Shift_Del T T - TCGA-A3-3308-01A-01D-0966-08 ENST00000371953 p.L146* PTEN chr10 87952260 87952260 Splice_Site G G A TCGA-A3-3308-01A-01D-0966-08 ENST00000371953 p.X212_splice USMG5 chr10 103392240 103392240 Frame_Shift_Del T T - TCGA-A3-3308-01A-01D-0966-08 ENST00000309579 p.Y44Ffs*4 INPP5F chr10 119827588 119827588 Silent T T A TCGA-A3-3308-01A-01D-0966-08 ENST00000361976 p.S1069S PRG3 chr11 57379587 57379587 Silent C C T TCGA-A3-3308-01A-01D-0966-08 ENST00000287143 p.R94R MFAP5 chr12 8649533 8649533 Missense_Mutation C C T TCGA-A3-3308-01A-01D-0966-08 ENST00000359478 p.R126H LRMP chr12 25079646 25079646 Intron C C G TCGA-A3-3308-01A-01D-0966-08 ENST00000354454 KMT2D chr12 49049168 49049168 Missense_Mutation A A T TCGA-A3-3308-01A-01D-0966-08 ENST00000301067 p.H1319Q MAP3K12 chr12 53487177 53487177 Intron G G T TCGA-A3-3308-01A-01D-0966-08 ENST00000267079 SHMT2 chr12 57233826 57233826 Missense_Mutation G G A TCGA-A3-3308-01A-01D-0966-08 ENST00000328923 p.E401K NOS1 chr12 117234569 117234569 Silent A A T TCGA-A3-3308-01A-01D-0966-08 ENST00000317775 p.A1077A CCDC60 chr12 119472160 119472160 Silent T T C TCGA-A3-3308-01A-01D-0966-08 ENST00000327554 p.L113L RNF17 chr13 24779730 24779730 Silent T T C TCGA-A3-3308-01A-01D-0966-08 ENST00000255324 p.L165L TPT1 chr13 45340134 45340134 Silent A A G TCGA-A3-3308-01A-01D-0966-08 ENST00000530705 p.N51N LMO7 chr13 75795425 75795425 5'UTR G G A TCGA-A3-3308-01A-01D-0966-08 ENST00000465261 NYNRIN chr14 24409331 24409331 Missense_Mutation G G A TCGA-A3-3308-01A-01D-0966-08 ENST00000382554 p.A513T ERO1L chr14 52652240 52652240 Missense_Mutation T T G TCGA-A3-3308-01A-01D-0966-08 ENST00000395686 p.K375T WDHD1 chr14 54981656 54981656 Missense_Mutation C C G TCGA-A3-3308-01A-01D-0966-08 ENST00000360586 p.M649I MED6 chr14 70600620 70600620 Silent G G A TCGA-A3-3308-01A-01D-0966-08 ENST00000256379 p.I6I LEO1 chr15 51954511 51954511 Frame_Shift_Del T T - TCGA-A3-3308-01A-01D-0966-08 ENST00000299601 p.N437Mfs*4 ZSCAN2 chr15 84621287 84621288 Frame_Shift_Ins - - A TCGA-A3-3308-01A-01D-0966-08 ENST00000448803 p.E366Rfs*7 IQGAP1 chr15 90482212 90482212 Silent C C T TCGA-A3-3308-01A-01D-0966-08 ENST00000268182 p.F1162F TXNDC11 chr16 11679424 11679424 Missense_Mutation G G T TCGA-A3-3308-01A-01D-0966-08 ENST00000356957 p.A910D MYO1D chr17 32659126 32659126 Silent C C T TCGA-A3-3308-01A-01D-0966-08 ENST00000318217 p.T778T CCDC57 chr17 82198414 82198414 Missense_Mutation T T C TCGA-A3-3308-01A-01D-0966-08 ENST00000389641 p.N139S OR1I1 chr19 15087297 15087297 Missense_Mutation G G A TCGA-A3-3308-01A-01D-0966-08 ENST00000209540 p.V78I SULT2A1 chr19 47882157 47882158 Frame_Shift_Ins - - A TCGA-A3-3308-01A-01D-0966-08 ENST00000222002 p.W134Lfs*8 ZNF347 chr19 53142418 53142418 Frame_Shift_Del T T - TCGA-A3-3308-01A-01D-0966-08 ENST00000334197 p.N137Ifs*21 NLRP7 chr19 54940375 54940375 Silent G G A TCGA-A3-3308-01A-01D-0966-08 ENST00000340844 p.D148D GRIK1 chr21 29588987 29588987 Missense_Mutation C C T TCGA-A3-3308-01A-01D-0966-08 ENST00000399907 p.R474K TMPRSS3 chr21 42384014 42384021 Splice_Site CTAAAGCG CTAAAGCG - TCGA-A3-3308-01A-01D-0966-08 ENST00000291532 p.X191_splice DERL3 chr22 23837152 23837152 Missense_Mutation T T C TCGA-A3-3308-01A-01D-0966-08 ENST00000318109 p.I176V MID1 chrX 10469679 10469679 Intron A A C TCGA-A3-3308-01A-01D-0966-08 ENST00000317552 FAM47B chrX 34943971 34943971 Silent C C T TCGA-A3-3308-01A-01D-0966-08 ENST00000329357 p.Y380Y TAF1 chrX 71423165 71423165 Missense_Mutation G G T TCGA-A3-3308-01A-01D-0966-08 ENST00000373790 p.D1500Y CT47B1 chrX 120875499 120875499 Missense_Mutation C C G TCGA-A3-3308-01A-01D-0966-08 ENST00000371311 p.V58L AFF2 chrX 148501038 148501038 5'UTR G G T TCGA-A3-3308-01A-01D-0966-08 ENST00000370460 GNB1 chr1 1790449 1790449 Missense_Mutation T T G TCGA-AK-3444-01A-01D-0966-08 ENST00000378609 p.E215D EIF3I chr1 32231253 32231253 3'UTR T T G TCGA-AK-3444-01A-01D-0966-08 ENST00000373586 DLGAP3 chr1 34900193 34900198 In_Frame_Del GCTGCC GCTGCC - TCGA-AK-3444-01A-01D-0966-08 ENST00000235180 p.G395_S396del KLF17 chr1 44130730 44130730 Missense_Mutation G G T TCGA-AK-3444-01A-01D-0966-08 ENST00000372299 p.D382Y TMEM61 chr1 54991933 54991933 Missense_Mutation G G T TCGA-AK-3444-01A-01D-0966-08 ENST00000371268 p.A155S ALG6 chr1 63436830 63436835 In_Frame_Del TCTCAG TCTCAG - TCGA-AK-3444-01A-01D-0966-08 ENST00000371108 p.S446_V447del PTPN22 chr1 113852105 113852105 Splice_Site C C A TCGA-AK-3444-01A-01D-0966-08 ENST00000359785 p.X251_splice GPR89B chr1 147992503 147992503 Missense_Mutation T T A TCGA-AK-3444-01A-01D-0966-08 ENST00000314163 p.F366Y PGLYRP4 chr1 153330788 153330788 Silent G G C TCGA-AK-3444-01A-01D-0966-08 ENST00000359650 p.T367T PRRC2C chr1 171539987 171539987 Missense_Mutation G G A TCGA-AK-3444-01A-01D-0966-08 ENST00000338920 p.D839N SOS1 chr2 39054709 39054709 Missense_Mutation T T G TCGA-AK-3444-01A-01D-0966-08 ENST00000402219 p.M209L SRBD1 chr2 45605436 45605436 Silent T T A TCGA-AK-3444-01A-01D-0966-08 ENST00000263736 p.S2S DYSF chr2 71682546 71682546 Missense_Mutation T T A TCGA-AK-3444-01A-01D-0966-08 ENST00000258104 p.F2025I CFAP221 chr2 119630878 119630878 Missense_Mutation G G T TCGA-AK-3444-01A-01D-0966-08 ENST00000413369 p.D651Y SAP130 chr2 128000354 128000354 Missense_Mutation G G A TCGA-AK-3444-01A-01D-0966-08 ENST00000259235 p.H350Y SAP130 chr2 128000355 128000355 Silent A A G TCGA-AK-3444-01A-01D-0966-08 ENST00000259235 p.S349S MAP3K19 chr2 134991504 134991504 Intron T T A TCGA-AK-3444-01A-01D-0966-08 ENST00000375845 NEB chr2 151565739 151565740 Frame_Shift_Ins - - A TCGA-AK-3444-01A-01D-0966-08 ENST00000172853 p.K4379* TTN chr2 178595783 178595783 Missense_Mutation A A G TCGA-AK-3444-01A-01D-0966-08 ENST00000591111 p.F17550L ERBB4 chr2 211665416 211665416 Missense_Mutation C C A TCGA-AK-3444-01A-01D-0966-08 ENST00000342788 p.C593F ANKMY1 chr2 240526285 240526285 Missense_Mutation A A G TCGA-AK-3444-01A-01D-0966-08 ENST00000272972 p.F283L SSUH2 chr3 8632090 8632090 Missense_Mutation C C A TCGA-AK-3444-01A-01D-0966-08 ENST00000317371 p.S98I VHL chr3 10142041 10142041 Nonsense_Mutation C C A TCGA-AK-3444-01A-01D-0966-08 ENST00000256474 p.S65* CX3CR1 chr3 39265676 39265676 Frame_Shift_Del A A - TCGA-AK-3444-01A-01D-0966-08 ENST00000399220 p.E279Rfs*10 KALRN chr3 124492780 124492780 Missense_Mutation T T G TCGA-AK-3444-01A-01D-0966-08 ENST00000240874 p.I1575S PLXND1 chr3 129605961 129605961 Silent G G A TCGA-AK-3444-01A-01D-0966-08 ENST00000324093 p.L227L ERICH6 chr3 150680483 150680483 Missense_Mutation G G T TCGA-AK-3444-01A-01D-0966-08 ENST00000295910 p.H366N B3GNT5 chr3 183269995 183269995 Missense_Mutation A A G TCGA-AK-3444-01A-01D-0966-08 ENST00000326505 p.H66R EHHADH chr3 185204452 185204452 Missense_Mutation C C T TCGA-AK-3444-01A-01D-0966-08 ENST00000231887 p.A292T NAF1 chr4 163166840 163166840 5'UTR C C T TCGA-AK-3444-01A-01D-0966-08 ENST00000274054 DNAH5 chr5 13865846 13865846 Missense_Mutation C C A TCGA-AK-3444-01A-01D-0966-08 ENST00000265104 p.G1393C PCDHGA3 chr5 141344629 141344629 Missense_Mutation C C T TCGA-AK-3444-01A-01D-0966-08 ENST00000253812 p.A199V FGFR4 chr5 177097603 177097603 Missense_Mutation A A C TCGA-AK-3444-01A-01D-0966-08 ENST00000292408 p.D779A CDSN chr6 31117102 31117102 Silent C C G TCGA-AK-3444-01A-01D-0966-08 ENST00000376288 p.G171G FBXO9 chr6 53078857 53078857 Silent T T C TCGA-AK-3444-01A-01D-0966-08 ENST00000244426 p.T132T COL12A1 chr6 75117534 75117534 Missense_Mutation A A T TCGA-AK-3444-01A-01D-0966-08 ENST00000322507 p.F2456Y ARID1B chr6 157201409 157201409 Frame_Shift_Del G G - TCGA-AK-3444-01A-01D-0966-08 ENST00000350026 p.I1593Sfs*8 SYNJ2 chr6 158043344 158043344 Missense_Mutation C C A TCGA-AK-3444-01A-01D-0966-08 ENST00000355585 p.S247Y TAGAP chr6 159036398 159036398 Frame_Shift_Del C C - TCGA-AK-3444-01A-01D-0966-08 ENST00000367066 p.G542Vfs*30 FAM120B chr6 170318002 170318002 Silent C C T TCGA-AK-3444-01A-01D-0966-08 ENST00000476287 p.V204V AP5Z1 chr7 4790588 4790588 Silent C C T TCGA-AK-3444-01A-01D-0966-08 ENST00000348624 p.S645S PMS2 chr7 5989863 5989863 Missense_Mutation C C G TCGA-AK-3444-01A-01D-0966-08 ENST00000265849 p.G361R STAG3 chr7 100204107 100204107 Silent G G A TCGA-AK-3444-01A-01D-0966-08 ENST00000317296 p.L929L STAG3 chr7 100204108 100204108 Silent C C T TCGA-AK-3444-01A-01D-0966-08 ENST00000317296 p.L930L AKR1D1 chr7 138107242 138107242 Intron C C T TCGA-AK-3444-01A-01D-0966-08 ENST00000242375 GIMAP8 chr7 150474521 150474521 Missense_Mutation G G C TCGA-AK-3444-01A-01D-0966-08 ENST00000307271 p.A398P ZBTB10 chr8 80500079 80500079 Missense_Mutation G G A TCGA-AK-3444-01A-01D-0966-08 ENST00000430430 p.G520S KIAA1161 chr9 34371726 34371726 Silent C C T TCGA-AK-3444-01A-01D-0966-08 ENST00000297625 p.V406V FRMPD1 chr9 37708468 37708468 Missense_Mutation A A G TCGA-AK-3444-01A-01D-0966-08 ENST00000377765 p.D110G COL15A1 chr9 99003579 99003579 Missense_Mutation G G A TCGA-AK-3444-01A-01D-0966-08 ENST00000375001 p.V398I PPP3R2 chr9 101594986 101594986 5'UTR G G T TCGA-AK-3444-01A-01D-0966-08 ENST00000374806 RGS3 chr9 113594097 113594097 Intron G G C TCGA-AK-3444-01A-01D-0966-08 ENST00000350696 SARDH chr9 133713115 133713115 Missense_Mutation G G A TCGA-AK-3444-01A-01D-0966-08 ENST00000371872 p.T387M WDR5 chr9 134142418 134142418 Missense_Mutation G G A TCGA-AK-3444-01A-01D-0966-08 ENST00000358625 p.G147E PFKP chr10 3109369 3109369 Silent A A G TCGA-AK-3444-01A-01D-0966-08 ENST00000381125 p.G326G FGFBP3 chr10 91908426 91908426 Missense_Mutation C C T TCGA-AK-3444-01A-01D-0966-08 ENST00000311575 p.G182S NOC3L chr10 94352336 94352336 Frame_Shift_Del A A - TCGA-AK-3444-01A-01D-0966-08 ENST00000371361 p.L309Wfs*16 MGEA5 chr10 101806112 101806112 Silent C C T TCGA-AK-3444-01A-01D-0966-08 ENST00000361464 p.V228V OR51E1 chr11 4653472 4653472 Missense_Mutation T T G TCGA-AK-3444-01A-01D-0966-08 ENST00000396952 p.S316A OR2AG1 chr11 6785754 6785754 Silent C C T TCGA-AK-3444-01A-01D-0966-08 ENST00000307401 p.V239V SLC17A6 chr11 22343283 22343283 Missense_Mutation A A C TCGA-AK-3444-01A-01D-0966-08 ENST00000263160 p.M126L INCENP chr11 62140926 62140926 Missense_Mutation T T C TCGA-AK-3444-01A-01D-0966-08 ENST00000394818 p.L492P HEPHL1 chr11 94045913 94045913 Silent A A C TCGA-AK-3444-01A-01D-0966-08 ENST00000315765 p.S137S CADM1 chr11 115231474 115231474 Silent C C T TCGA-AK-3444-01A-01D-0966-08 ENST00000452722 p.L147L TNFRSF1A chr12 6333753 6333753 Silent G G A TCGA-AK-3444-01A-01D-0966-08 ENST00000162749 p.C102C PZP chr12 9152870 9152870 Missense_Mutation C C G TCGA-AK-3444-01A-01D-0966-08 ENST00000261336 p.D1359H ST8SIA1 chr12 22201720 22201720 Missense_Mutation A A T TCGA-AK-3444-01A-01D-0966-08 ENST00000396037 p.N301K NAV3 chr12 77968543 77968543 Missense_Mutation C C G TCGA-AK-3444-01A-01D-0966-08 ENST00000397909 p.A171G POLR3B chr12 106378314 106378314 Missense_Mutation G G C TCGA-AK-3444-01A-01D-0966-08 ENST00000228347 p.E182Q POLE chr12 132649712 132649712 Frame_Shift_Del T T - TCGA-AK-3444-01A-01D-0966-08 ENST00000320574 p.I1254Sfs*107 CARS2 chr13 110683088 110683088 Frame_Shift_Del T T - TCGA-AK-3444-01A-01D-0966-08 ENST00000257347 p.K206Nfs*71 NID2 chr14 52005761 52005761 Missense_Mutation C C T TCGA-AK-3444-01A-01D-0966-08 ENST00000216286 p.A1365T DYNC1H1 chr14 102050074 102050074 Missense_Mutation T T G TCGA-AK-3444-01A-01D-0966-08 ENST00000360184 p.L4563W HERC2P3 chr15 20437324 20437324 RNA T T C TCGA-AK-3444-01A-01D-0966-08 ENST00000426501 GJD2 chr15 34752822 34752822 Missense_Mutation C C T TCGA-AK-3444-01A-01D-0966-08 ENST00000290374 p.A208T SPINT1 chr15 40844590 40844590 Silent C C T TCGA-AK-3444-01A-01D-0966-08 ENST00000344051 p.L12L TGM5 chr15 43260559 43260559 Missense_Mutation C C A TCGA-AK-3444-01A-01D-0966-08 ENST00000220420 p.D11Y MCTP2 chr15 94458173 94458173 Missense_Mutation A A G TCGA-AK-3444-01A-01D-0966-08 ENST00000357742 p.M763V CES2 chr16 66942167 66942167 Silent C C G TCGA-AK-3444-01A-01D-0966-08 ENST00000317091 p.P464P NQO1 chr16 69710805 69710805 3'UTR T T A TCGA-AK-3444-01A-01D-0966-08 ENST00000320623 WSCD1 chr17 6120483 6120483 Missense_Mutation T T A TCGA-AK-3444-01A-01D-0966-08 ENST00000317744 p.L517Q TTC19 chr17 16027299 16027299 Intron T T G TCGA-AK-3444-01A-01D-0966-08 ENST00000261647 TOP3A chr17 18285152 18285152 Nonsense_Mutation T T A TCGA-AK-3444-01A-01D-0966-08 ENST00000321105 p.K623* DCAKD chr17 45034836 45034836 Missense_Mutation A A G TCGA-AK-3444-01A-01D-0966-08 ENST00000310604 p.V17A SNX11 chr17 48121291 48121291 Missense_Mutation A A C TCGA-AK-3444-01A-01D-0966-08 ENST00000359238 p.E199A HLF chr17 55320724 55320724 Missense_Mutation G G A TCGA-AK-3444-01A-01D-0966-08 ENST00000226067 p.A245T TMC6 chr17 78120696 78120696 Missense_Mutation C C T TCGA-AK-3444-01A-01D-0966-08 ENST00000322914 p.V558I RALBP1 chr18 9516931 9516931 Frame_Shift_Del G G - TCGA-AK-3444-01A-01D-0966-08 ENST00000019317 p.V111Ffs*17 CTAGE1 chr18 22416527 22416528 Frame_Shift_Ins - - T TCGA-AK-3444-01A-01D-0966-08 ENST00000391403 p.A429Sfs*3 TMIGD2 chr19 4298007 4298007 Missense_Mutation T T C TCGA-AK-3444-01A-01D-0966-08 ENST00000301272 p.T129A RNASEH2A chr19 12810356 12810356 Missense_Mutation G G C TCGA-AK-3444-01A-01D-0966-08 ENST00000221486 p.E197Q NUDT19 chr19 32692248 32692248 Missense_Mutation C C A TCGA-AK-3444-01A-01D-0966-08 ENST00000397061 p.F96L MEGF8 chr19 42344474 42344474 Missense_Mutation C C A TCGA-AK-3444-01A-01D-0966-08 ENST00000251268 p.L608I PRR12 chr19 49594891 49594891 5'Flank C C A TCGA-AK-3444-01A-01D-0966-08 ENST00000615927 BACE2 chr21 41226335 41226335 Missense_Mutation A A T TCGA-AK-3444-01A-01D-0966-08 ENST00000330333 p.T128S UMODL1 chr21 42109561 42109561 Splice_Site G G A TCGA-AK-3444-01A-01D-0966-08 ENST00000408910 p.X507_splice RP1-130H16.18 chr22 30286443 30286443 Intron G G T TCGA-AK-3444-01A-01D-0966-08 ENST00000434291 MLC1 chr22 50080353 50080353 Missense_Mutation G G T TCGA-AK-3444-01A-01D-0966-08 ENST00000311597 p.N104K PHKA2 chrX 18943791 18943802 In_Frame_Del AATTGCCTCAAG AATTGCCTCAAG - TCGA-AK-3444-01A-01D-0966-08 ENST00000379942 p.L209_I212del MAGEB3 chrX 30235866 30235866 Splice_Region G G A TCGA-AK-3444-01A-01D-0966-08 ENST00000361644 VSIG4 chrX 66033618 66033618 Missense_Mutation G G A TCGA-AK-3444-01A-01D-0966-08 ENST00000374737 p.H90Y IDS chrX 149505055 149505055 Missense_Mutation G G C TCGA-AK-3444-01A-01D-0966-08 ENST00000340855 p.T28R SPSB1 chr1 9356088 9356088 Missense_Mutation T T C TCGA-BP-5182-01A-01D-1429-08 ENST00000328089 p.F66S UBE4B chr1 10106499 10106499 Missense_Mutation G G A TCGA-BP-5182-01A-01D-1429-08 ENST00000343090 p.R371K SPEN chr1 15873105 15873105 Nonsense_Mutation C C T TCGA-BP-5182-01A-01D-1429-08 ENST00000375759 p.R125* USP48 chr1 21705793 21705793 Missense_Mutation G G A TCGA-BP-5182-01A-01D-1429-08 ENST00000308271 p.A773V STMN1 chr1 25904703 25904703 5'UTR G G T TCGA-BP-5182-01A-01D-1429-08 ENST00000357865 DCDC2B chr1 32212540 32212540 Missense_Mutation C C G TCGA-BP-5182-01A-01D-1429-08 ENST00000409358 p.T193S DENND2D chr1 111192305 111192305 Silent C C T TCGA-BP-5182-01A-01D-1429-08 ENST00000357640 p.Q269Q FLAD1 chr1 154993079 154993079 3'UTR A A G TCGA-BP-5182-01A-01D-1429-08 ENST00000292180 KIF14 chr1 200593723 200593723 Missense_Mutation C C T TCGA-BP-5182-01A-01D-1429-08 ENST00000367350 p.E866K KIF21B chr1 200990044 200990044 Splice_Site C C T TCGA-BP-5182-01A-01D-1429-08 ENST00000422435 p.X1011_splice TRAF5 chr1 211372507 211372507 Silent G G A TCGA-BP-5182-01A-01D-1429-08 ENST00000261464 p.K493K ARHGAP25 chr2 68817954 68817954 Silent C C A TCGA-BP-5182-01A-01D-1429-08 ENST00000409202 p.L321L ARHGAP25 chr2 68819135 68819135 Frame_Shift_Del T T - TCGA-BP-5182-01A-01D-1429-08 ENST00000409202 p.I339Tfs*4 POLR1A chr2 86098664 86098664 Silent G G A TCGA-BP-5182-01A-01D-1429-08 ENST00000263857 p.L127L NEB chr2 151694550 151694550 Missense_Mutation G G T TCGA-BP-5182-01A-01D-1429-08 ENST00000172853 p.A585D CPS1 chr2 210576363 210576363 Missense_Mutation C C G TCGA-BP-5182-01A-01D-1429-08 ENST00000233072 p.T85S ACSL3 chr2 222930737 222930737 Missense_Mutation G G A TCGA-BP-5182-01A-01D-1429-08 ENST00000357430 p.D553N VHL chr3 10146556 10146556 Missense_Mutation T T A TCGA-BP-5182-01A-01D-1429-08 ENST00000256474 p.L128H TRANK1 chr3 36831248 36831248 Missense_Mutation C C A TCGA-BP-5182-01A-01D-1429-08 ENST00000429976 p.G2735C SNRK chr3 43348206 43348206 Silent C C T TCGA-BP-5182-01A-01D-1429-08 ENST00000296088 p.L649L KLHDC8B chr3 49174861 49174861 Missense_Mutation G G A TCGA-BP-5182-01A-01D-1429-08 ENST00000332780 p.E221K BAP1 chr3 52409876 52409876 Translation_Start_Site C C T TCGA-BP-5182-01A-01D-1429-08 ENST00000460680 p.M1? ZBTB20 chr3 114339234 114339234 Missense_Mutation A A G TCGA-BP-5182-01A-01D-1429-08 ENST00000474710 p.I666T EFCC1 chr3 129034194 129034194 Missense_Mutation G G T TCGA-BP-5182-01A-01D-1429-08 ENST00000436022 p.M438I TLR1 chr4 38798244 38798244 Missense_Mutation G G T TCGA-BP-5182-01A-01D-1429-08 ENST00000308979 p.F196L ETNPPL chr4 108760280 108760280 Nonsense_Mutation G G T TCGA-BP-5182-01A-01D-1429-08 ENST00000296486 p.S28* ENPP6 chr4 184217667 184217667 Silent T T C TCGA-BP-5182-01A-01D-1429-08 ENST00000296741 p.K51K DDX46 chr5 134817634 134817634 Nonsense_Mutation G G T TCGA-BP-5182-01A-01D-1429-08 ENST00000354283 p.E917* FOXC1 chr6 1612185 1612185 3'UTR A A - TCGA-BP-5182-01A-01D-1429-08 ENST00000380874 SKIV2L chr6 31962756 31962756 Silent G G A TCGA-BP-5182-01A-01D-1429-08 ENST00000375394 p.E418E DST chr6 56607076 56607076 Intron G G T TCGA-BP-5182-01A-01D-1429-08 ENST00000312431 WBSCR17 chr7 71712168 71712168 3'UTR G G A TCGA-BP-5182-01A-01D-1429-08 ENST00000333538 LRRC4 chr7 128030428 128030428 Silent C C T TCGA-BP-5182-01A-01D-1429-08 ENST00000249363 p.Q71Q FLNC chr7 128842954 128842954 Frame_Shift_Del G G - TCGA-BP-5182-01A-01D-1429-08 ENST00000325888 TNC chr9 115021146 115021146 3'UTR G G A TCGA-BP-5182-01A-01D-1429-08 ENST00000350763 ZMYND11 chr10 252397 252397 Missense_Mutation C C A TCGA-BP-5182-01A-01D-1429-08 ENST00000381591 p.S579Y ADAMTS14 chr10 70738903 70738903 Missense_Mutation G G C TCGA-BP-5182-01A-01D-1429-08 ENST00000373207 p.G554A TLL2 chr10 96422574 96422574 Silent G G T TCGA-BP-5182-01A-01D-1429-08 ENST00000357947 p.T264T SEC31B chr10 100489337 100489337 Missense_Mutation T T A TCGA-BP-5182-01A-01D-1429-08 ENST00000370345 p.E1029V TAF5 chr10 103373516 103373516 Missense_Mutation T T G TCGA-BP-5182-01A-01D-1429-08 ENST00000369839 p.F240V CARS chr11 3018662 3018662 Missense_Mutation T T G TCGA-BP-5182-01A-01D-1429-08 ENST00000397111 p.K412Q ARFGAP2 chr11 47171513 47171513 Missense_Mutation C C A TCGA-BP-5182-01A-01D-1429-08 ENST00000524782 p.R285L BBS1 chr11 66510681 66510681 Missense_Mutation G G A TCGA-BP-5182-01A-01D-1429-08 ENST00000318312 p.D8N EXPH5 chr11 108512789 108512789 Missense_Mutation G G T TCGA-BP-5182-01A-01D-1429-08 ENST00000265843 p.F906L KMT2A chr11 118504563 118504563 Nonsense_Mutation G G T TCGA-BP-5182-01A-01D-1429-08 ENST00000389506 p.E2888* FEZ1 chr11 125454185 125454185 Missense_Mutation T T G TCGA-BP-5182-01A-01D-1429-08 ENST00000278919 p.N322T PRIM1 chr12 56746120 56746120 Nonsense_Mutation C C T TCGA-BP-5182-01A-01D-1429-08 ENST00000338193 p.W168* PTPRB chr12 70576478 70576478 Frame_Shift_Del A A - TCGA-BP-5182-01A-01D-1429-08 ENST00000261266 p.S698Pfs*13 PTPRB chr12 70576479 70576479 Missense_Mutation A A C TCGA-BP-5182-01A-01D-1429-08 ENST00000261266 p.C697W PSMB11 chr14 23042317 23042317 Missense_Mutation G G A TCGA-BP-5182-01A-01D-1429-08 ENST00000408907 p.R31Q FNTB chr14 65015669 65015669 Missense_Mutation C C G TCGA-BP-5182-01A-01D-1429-08 ENST00000246166 p.H109Q IGHG3 chr14 105769982 105769982 Silent A A T TCGA-BP-5182-01A-01D-1429-08 ENST00000616127 p.P306P IGHG1 chr14 106211378 106211378 Intron A A T TCGA-BP-5182-01A-01D-1429-08 ENST00000618756 TMEM87A chr15 42220120 42220120 Silent T T A TCGA-BP-5182-01A-01D-1429-08 ENST00000389834 p.P473P HYPK chr15 43801875 43801875 3'UTR T T - TCGA-BP-5182-01A-01D-1429-08 ENST00000406925 CCDC78 chr16 725560 725560 Silent C C T TCGA-BP-5182-01A-01D-1429-08 ENST00000293889 p.R96R SRCAP chr16 30724499 30724499 Missense_Mutation G G C TCGA-BP-5182-01A-01D-1429-08 ENST00000262518 p.G1692A PYDC1 chr16 31217021 31217021 Missense_Mutation G G C TCGA-BP-5182-01A-01D-1429-08 ENST00000302964 p.T3R C16orf70 chr16 67132645 67132645 Intron G G A TCGA-BP-5182-01A-01D-1429-08 ENST00000219139 HAS3 chr16 69115246 69115246 Silent T T C TCGA-BP-5182-01A-01D-1429-08 ENST00000306560 p.L548L KLHL36 chr16 84657830 84657830 Frame_Shift_Del G G - TCGA-BP-5182-01A-01D-1429-08 ENST00000564996 p.V342Cfs*42 SPG7 chr16 89550468 89550468 Intron C C A TCGA-BP-5182-01A-01D-1429-08 ENST00000268704 DBNDD1 chr16 90010050 90010050 Intron T T C TCGA-BP-5182-01A-01D-1429-08 ENST00000002501 GEMIN4 chr17 747240 747241 Frame_Shift_Ins - - TG TCGA-BP-5182-01A-01D-1429-08 ENST00000319004 p.K268Tfs*6 NUP88 chr17 5419429 5419429 Missense_Mutation T T A TCGA-BP-5182-01A-01D-1429-08 ENST00000573584 p.E74D DHX33 chr17 5444235 5444236 Frame_Shift_Del AA AA - TCGA-BP-5182-01A-01D-1429-08 ENST00000225296 p.F698* ZNF286B chr17 18671245 18671245 Intron C C A TCGA-BP-5182-01A-01D-1429-08 ENST00000545289 GPR179 chr17 38330514 38330514 Missense_Mutation G G T TCGA-BP-5182-01A-01D-1429-08 ENST00000616987 p.H1019N EIF1 chr17 41689890 41689890 Missense_Mutation A A T TCGA-BP-5182-01A-01D-1429-08 ENST00000469257 p.Q48H L3MBTL4 chr18 6311558 6311558 Missense_Mutation C C T TCGA-BP-5182-01A-01D-1429-08 ENST00000284898 p.R23H APC2 chr19 1467882 1467882 Missense_Mutation C C G TCGA-BP-5182-01A-01D-1429-08 ENST00000233607 p.H1527Q DNAJB1 chr19 14516909 14516910 Frame_Shift_Ins - - A TCGA-BP-5182-01A-01D-1429-08 ENST00000254322 p.G117Wfs*12 OR7A10 chr19 14841736 14841736 Missense_Mutation C C T TCGA-BP-5182-01A-01D-1429-08 ENST00000248058 p.A48T JAK3 chr19 17834681 17834681 Missense_Mutation G G T TCGA-BP-5182-01A-01D-1429-08 ENST00000458235 p.P747H TRPM4 chr19 49168612 49168623 In_Frame_Del CCTGGACTACAA CCTGGACTACAA - TCGA-BP-5182-01A-01D-1429-08 ENST00000252826 p.L225_N228del STX16 chr20 58676310 58676310 3'UTR G G T TCGA-BP-5182-01A-01D-1429-08 ENST00000371141 CLTCL1 chr22 19196588 19196588 Missense_Mutation C C A TCGA-BP-5182-01A-01D-1429-08 ENST00000427926 p.M1314I LIMK2 chr22 31278324 31278324 Silent C C A TCGA-BP-5182-01A-01D-1429-08 ENST00000331728 p.S600S H1F0 chr22 37805640 37805640 Silent C C T TCGA-BP-5182-01A-01D-1429-08 ENST00000340857 p.I32I C2orf81 chr2 74416283 74416283 Intron A A T TCGA-B8-A8YJ-01A-13D-A38X-10 ENST00000290390 SGOL2 chr2 200573166 200573166 Missense_Mutation T T G TCGA-B8-A8YJ-01A-13D-A38X-10 ENST00000357799 p.D940E KAZN chr1 15044147 15044147 Silent C C T TCGA-CW-5589-01A-01D-1534-10 ENST00000376030 p.A238A CDC14A chr1 100496018 100496018 Missense_Mutation G G C TCGA-CW-5589-01A-01D-1534-10 ENST00000336454 p.G423R F5 chr1 169560688 169560688 Missense_Mutation T T A TCGA-CW-5589-01A-01D-1534-10 ENST00000367797 p.E151V ALK chr2 29239735 29239735 Frame_Shift_Del T T - TCGA-CW-5589-01A-01D-1534-10 ENST00000389048 p.K767Rfs*23 APLF chr2 68513132 68513132 Missense_Mutation C C A TCGA-CW-5589-01A-01D-1534-10 ENST00000303795 p.P132T PBRM1 chr3 52629036 52629036 Splice_Site C C A TCGA-CW-5589-01A-01D-1534-10 ENST00000296302 p.X434_splice STAG1 chr3 136343945 136343945 Silent G G T TCGA-CW-5589-01A-01D-1534-10 ENST00000383202 p.P1111P ATR chr3 142562367 142562367 Silent A A T TCGA-CW-5589-01A-01D-1534-10 ENST00000350721 p.A345A MUC4 chr3 195782503 195782503 Missense_Mutation T T G TCGA-CW-5589-01A-01D-1534-10 ENST00000463781 p.H3026P BDP1 chr5 71539607 71539607 Missense_Mutation G G A TCGA-CW-5589-01A-01D-1534-10 ENST00000358731 p.D1994N CMYA5 chr5 79735453 79735453 Missense_Mutation G G C TCGA-CW-5589-01A-01D-1534-10 ENST00000446378 p.A2230P LRRC16A chr6 25279694 25279694 5'UTR A A G TCGA-CW-5589-01A-01D-1534-10 ENST00000329474 CRIP3 chr6 43306116 43306117 Frame_Shift_Ins - - C TCGA-CW-5589-01A-01D-1534-10 ENST00000274990 p.V169Sfs*32 POLH chr6 43613687 43613688 In_Frame_Ins - - TGT TCGA-CW-5589-01A-01D-1534-10 ENST00000372236 p.C425dup TMEM63B chr6 44148900 44148908 In_Frame_Del CACCATGGA CACCATGGA - TCGA-CW-5589-01A-01D-1534-10 ENST00000259746 p.T457_D459del FIG4 chr6 109762147 109762147 Missense_Mutation A A C TCGA-CW-5589-01A-01D-1534-10 ENST00000230124 p.K443T TRGC2 chr7 38249347 38249347 Intron G G C TCGA-CW-5589-01A-01D-1534-10 ENST00000610516 BLVRA chr7 43787972 43787973 Frame_Shift_Del GC GC - TCGA-CW-5589-01A-01D-1534-10 ENST00000265523 p.R28Efs*24 KMT2E chr7 105112762 105112762 Missense_Mutation A A G TCGA-CW-5589-01A-01D-1534-10 ENST00000257745 p.H1669R POTEA chr8 43297119 43297119 RNA G G A TCGA-CW-5589-01A-01D-1534-10 ENST00000519951 ARHGAP39 chr8 144534135 144534135 Silent G G A TCGA-CW-5589-01A-01D-1534-10 ENST00000276826 p.A863A PGM5 chr9 68479507 68479507 Missense_Mutation A A T TCGA-CW-5589-01A-01D-1534-10 ENST00000396396 p.I417F SH3GLB2 chr9 129010692 129010692 Missense_Mutation A A C TCGA-CW-5589-01A-01D-1534-10 ENST00000372559 p.L209R CUBN chr10 17068705 17068705 Silent T T G TCGA-CW-5589-01A-01D-1534-10 ENST00000377833 p.S897S DCLRE1A chr10 113849562 113849562 Missense_Mutation C C T TCGA-CW-5589-01A-01D-1534-10 ENST00000361384 p.V515I DEAF1 chr11 687971 687971 Nonsense_Mutation C C A TCGA-CW-5589-01A-01D-1534-10 ENST00000382409 p.E202* OR5AR1 chr11 56664271 56664271 Nonsense_Mutation G G T TCGA-CW-5589-01A-01D-1534-10 ENST00000302969 p.E196* PRKAG1 chr12 49004934 49004934 Intron T T G TCGA-CW-5589-01A-01D-1534-10 ENST00000548065 DTX1 chr12 113094046 113094046 Missense_Mutation C C G TCGA-CW-5589-01A-01D-1534-10 ENST00000257600 p.P392A HIP1R chr12 122860681 122860681 Missense_Mutation A A G TCGA-CW-5589-01A-01D-1534-10 ENST00000253083 p.E888G LATS2 chr13 20987992 20987992 Missense_Mutation G G C TCGA-CW-5589-01A-01D-1534-10 ENST00000382592 p.S596R NEK5 chr13 52087448 52087448 Missense_Mutation G G C TCGA-CW-5589-01A-01D-1534-10 ENST00000355568 p.R428G RAB20 chr13 110523627 110523627 3'UTR C C T TCGA-CW-5589-01A-01D-1534-10 ENST00000267328 PCNX chr14 71057688 71057688 Missense_Mutation C C G TCGA-CW-5589-01A-01D-1534-10 ENST00000304743 p.L1606V GTF2A1 chr14 81216443 81216443 Silent C C T TCGA-CW-5589-01A-01D-1534-10 ENST00000553612 p.V34V UBE3A chr15 25371622 25371622 Missense_Mutation G G C TCGA-CW-5589-01A-01D-1534-10 ENST00000397954 p.D187E NPIPB9 chr16 28752411 28752412 5'UTR - - TT TCGA-CW-5589-01A-01D-1534-10 ENST00000550983 NLGN2 chr17 7415826 7415826 Silent G G C TCGA-CW-5589-01A-01D-1534-10 ENST00000302926 p.L451L SPAG5 chr17 28578518 28578518 Missense_Mutation T T A TCGA-CW-5589-01A-01D-1534-10 ENST00000321765 p.E1070V SGK494 chr17 28612671 28612671 Missense_Mutation G G T TCGA-CW-5589-01A-01D-1534-10 ENST00000301037 p.P165H SUZ12 chr17 31994001 31994001 Missense_Mutation A A C TCGA-CW-5589-01A-01D-1534-10 ENST00000322652 p.N477T ZNF830 chr17 34962785 34962785 3'UTR C C A TCGA-CW-5589-01A-01D-1534-10 ENST00000361952 RARA chr17 40352344 40352344 Missense_Mutation A A G TCGA-CW-5589-01A-01D-1534-10 ENST00000254066 p.E215G NUP85 chr17 75209822 75209823 Frame_Shift_Ins - - A TCGA-CW-5589-01A-01D-1534-10 ENST00000245544 p.S45Ifs*15 ZNF625 chr19 12147745 12147745 Missense_Mutation G G T TCGA-CW-5589-01A-01D-1534-10 ENST00000439556 p.L21M RAB3A chr19 18198826 18198826 Nonsense_Mutation G G C TCGA-CW-5589-01A-01D-1534-10 ENST00000222256 p.S124* TM6SF2 chr19 19269745 19269745 Silent G G C TCGA-CW-5589-01A-01D-1534-10 ENST00000389363 p.L142L PSG9 chr19 43268007 43268007 Frame_Shift_Del T T - TCGA-CW-5589-01A-01D-1534-10 ENST00000270077 p.E71Kfs*2 NLRP9 chr19 55732252 55732252 Missense_Mutation G G A TCGA-CW-5589-01A-01D-1534-10 ENST00000332836 p.L527F RASSF2 chr20 4784203 4784203 3'UTR G G T TCGA-CW-5589-01A-01D-1534-10 ENST00000379376 ZHX3 chr20 41202765 41202765 Missense_Mutation C C T TCGA-CW-5589-01A-01D-1534-10 ENST00000309060 p.A718T C20orf85 chr20 58153600 58153600 Missense_Mutation G G A TCGA-CW-5589-01A-01D-1534-10 ENST00000371168 p.G42E BRWD1 chr21 39196428 39196428 Intron C C A TCGA-CW-5589-01A-01D-1534-10 ENST00000333229 SMPD4P1 chr22 20626103 20626103 RNA A A G TCGA-CW-5589-01A-01D-1534-10 ENST00000416717 RRP7A chr22 42514690 42514690 Missense_Mutation T T C TCGA-CW-5589-01A-01D-1534-10 ENST00000323013 p.I184V POU3F4 chrX 83508415 83508415 Missense_Mutation T T C TCGA-CW-5589-01A-01D-1534-10 ENST00000373200 p.F31L ARMCX3 chrX 101625905 101625905 Missense_Mutation T T A TCGA-CW-5589-01A-01D-1534-10 ENST00000341189 p.F309Y VPS13D chr1 12348928 12348928 Missense_Mutation G G A TCGA-CZ-5986-01A-11D-1669-08 ENST00000620676 p.E3059K PADI3 chr1 17282898 17282898 Missense_Mutation C C G TCGA-CZ-5986-01A-11D-1669-08 ENST00000375460 p.P605R AUNIP chr1 25835535 25835535 Missense_Mutation C C T TCGA-CZ-5986-01A-11D-1669-08 ENST00000374298 p.D178N CSMD2 chr1 33714651 33714651 Silent G G A TCGA-CZ-5986-01A-11D-1669-08 ENST00000241312 p.T1074T SZT2 chr1 43452371 43452371 3'UTR T T G TCGA-CZ-5986-01A-11D-1669-08 ENST00000562955 LRRIQ3 chr1 74041726 74041726 Missense_Mutation C C T TCGA-CZ-5986-01A-11D-1669-08 ENST00000354431 p.R402Q LCE1E chr1 152787295 152787295 5'UTR C C A TCGA-CZ-5986-01A-11D-1669-08 ENST00000368770 HMCN1 chr1 186055623 186055634 In_Frame_Del GCTGTGAATGTA GCTGTGAATGTA - TCGA-CZ-5986-01A-11D-1669-08 ENST00000271588 p.V2366_A2369del NFASC chr1 205002598 205002598 Missense_Mutation A A T TCGA-CZ-5986-01A-11D-1669-08 ENST00000339876 p.N1047Y RAD51AP2 chr2 17515535 17515535 Missense_Mutation C C G TCGA-CZ-5986-01A-11D-1669-08 ENST00000399080 p.D961H YIPF4 chr2 32301410 32301410 Missense_Mutation T T C TCGA-CZ-5986-01A-11D-1669-08 ENST00000238831 p.I171T TTN chr2 178538890 178538890 Intron A A C TCGA-CZ-5986-01A-11D-1669-08 ENST00000591111 TTLL4 chr2 218745185 218745185 Missense_Mutation T T A TCGA-CZ-5986-01A-11D-1669-08 ENST00000258398 p.F580I VHL chr3 10146635 10146660 Splice_Site AGGTACTGACGTTTTACTTTTTAAAA AGGTACTGACGTTTTACTTTTTAAAA - TCGA-CZ-5986-01A-11D-1669-08 ENST00000256474 p.X155_splice SLC22A13 chr3 38265951 38265951 Missense_Mutation C C A TCGA-CZ-5986-01A-11D-1669-08 ENST00000311856 p.L31M PBRM1 chr3 52658220 52658220 Frame_Shift_Del A A - TCGA-CZ-5986-01A-11D-1669-08 ENST00000296302 p.Q209Rfs*15 MUC20 chr3 195726190 195726190 Silent C C A TCGA-CZ-5986-01A-11D-1669-08 ENST00000447234 p.P529P WHSC1 chr4 1978743 1978743 Missense_Mutation C C T TCGA-CZ-5986-01A-11D-1669-08 ENST00000382891 p.T1311I HERC3 chr4 88655916 88655916 Missense_Mutation A A G TCGA-CZ-5986-01A-11D-1669-08 ENST00000264345 p.Y317C SLC10A7 chr4 146517072 146517072 Missense_Mutation A A G TCGA-CZ-5986-01A-11D-1669-08 ENST00000507030 p.I50T FAM169A chr5 74801610 74801610 Missense_Mutation G G A TCGA-CZ-5986-01A-11D-1669-08 ENST00000389156 p.A311V FAM169A chr5 74801611 74801611 Missense_Mutation C C T TCGA-CZ-5986-01A-11D-1669-08 ENST00000389156 p.A311T ANKRD32 chr5 94695083 94695084 Frame_Shift_Ins - - A TCGA-CZ-5986-01A-11D-1669-08 ENST00000265140 p.T984Nfs*5 PDLIM4 chr5 132270999 132270999 Missense_Mutation G G C TCGA-CZ-5986-01A-11D-1669-08 ENST00000253754 p.G138R PCDHGA1 chr5 141332781 141332781 Silent G G A TCGA-CZ-5986-01A-11D-1669-08 ENST00000517417 p.A699A PMS2 chr7 6009056 6009056 5'UTR G G C TCGA-CZ-5986-01A-11D-1669-08 ENST00000265849 ANKRD7 chr7 118224847 118224847 Missense_Mutation G G A TCGA-CZ-5986-01A-11D-1669-08 ENST00000265224 p.S6N WDR91 chr7 135207154 135207154 Missense_Mutation T T A TCGA-CZ-5986-01A-11D-1669-08 ENST00000354475 p.Q187L ADCK2 chr7 140673852 140673852 Silent G G A TCGA-CZ-5986-01A-11D-1669-08 ENST00000072869 p.V174V KMT2C chr7 152139789 152139790 Frame_Shift_Del CC CC - TCGA-CZ-5986-01A-11D-1669-08 ENST00000262189 p.G4782Afs*10 KMT2C chr7 152139791 152139791 Missense_Mutation C C A TCGA-CZ-5986-01A-11D-1669-08 ENST00000262189 p.G4782W NECAB1 chr8 90949839 90949839 Missense_Mutation G G A TCGA-CZ-5986-01A-11D-1669-08 ENST00000417640 p.R298H GOLGA2 chr9 128257105 128257105 Frame_Shift_Del C C - TCGA-CZ-5986-01A-11D-1669-08 ENST00000421699 p.A991Lfs*7 PKD2L1 chr10 100329868 100329868 Splice_Site C C T TCGA-CZ-5986-01A-11D-1669-08 ENST00000318222 p.X79_splice TRIM6 chr11 5603711 5603713 In_Frame_Del GGA GGA - TCGA-CZ-5986-01A-11D-1669-08 ENST00000278302 p.E135del CTR9 chr11 10763492 10763492 Missense_Mutation T T A TCGA-CZ-5986-01A-11D-1669-08 ENST00000361367 p.M304K CAT chr11 34456733 34456733 Silent T T C TCGA-CZ-5986-01A-11D-1669-08 ENST00000241052 p.N324N PRDM11 chr11 45224401 45224401 Silent G G A TCGA-CZ-5986-01A-11D-1669-08 ENST00000530656 p.L343L PRDM11 chr11 45224402 45224402 Missense_Mutation G G A TCGA-CZ-5986-01A-11D-1669-08 ENST00000530656 p.E344K ATM chr11 108256336 108256336 Frame_Shift_Del C C - TCGA-CZ-5986-01A-11D-1669-08 ENST00000278616 p.K750Sfs*3 OR10G4 chr11 124016156 124016156 Missense_Mutation C C A TCGA-CZ-5986-01A-11D-1669-08 ENST00000320891 p.N194K NCAPD3 chr11 134209351 134209351 Missense_Mutation A A T TCGA-CZ-5986-01A-11D-1669-08 ENST00000534548 p.L232M RERG chr12 15109417 15109417 Missense_Mutation A A C TCGA-CZ-5986-01A-11D-1669-08 ENST00000256953 p.L98R SOX5 chr12 23665513 23665513 Missense_Mutation G G A TCGA-CZ-5986-01A-11D-1669-08 ENST00000451604 p.R288W OR6C6 chr12 55294947 55294947 Missense_Mutation C C T TCGA-CZ-5986-01A-11D-1669-08 ENST00000358433 p.A96T ANKRD52 chr12 56253730 56253730 Missense_Mutation A A T TCGA-CZ-5986-01A-11D-1669-08 ENST00000267116 p.I326N BTBD11 chr12 107320016 107320016 Missense_Mutation C C T TCGA-CZ-5986-01A-11D-1669-08 ENST00000280758 p.S359L GOLGA3 chr12 132775229 132775229 Missense_Mutation T T A TCGA-CZ-5986-01A-11D-1669-08 ENST00000204726 p.K1352I SLITRK6 chr13 85793867 85793867 3'UTR G G A TCGA-CZ-5986-01A-11D-1669-08 ENST00000400286 ATP11A chr13 112854405 112854405 Silent G G A TCGA-CZ-5986-01A-11D-1669-08 ENST00000375645 p.R706R AJUBA chr14 22975046 22975051 In_Frame_Del TTGCAA TTGCAA - TCGA-CZ-5986-01A-11D-1669-08 ENST00000262713 p.C432_N433del C14orf79 chr14 104994801 104994801 3'UTR T T A TCGA-CZ-5986-01A-11D-1669-08 ENST00000547315 EIF3J chr15 44537151 44537152 5'UTR - - CT TCGA-CZ-5986-01A-11D-1669-08 ENST00000261868 BBS4 chr15 72736908 72736908 Missense_Mutation T T G TCGA-CZ-5986-01A-11D-1669-08 ENST00000268057 p.N465K IQGAP1 chr15 90492587 90492587 Frame_Shift_Del G G - TCGA-CZ-5986-01A-11D-1669-08 ENST00000268182 p.E1502Nfs*2 AXIN1 chr16 347045 347045 5'UTR G G A TCGA-CZ-5986-01A-11D-1669-08 ENST00000262320 PHLPP2 chr16 71649981 71649981 Missense_Mutation A A C TCGA-CZ-5986-01A-11D-1669-08 ENST00000568954 p.W961G SEZ6 chr17 28957395 28957395 Missense_Mutation C C T TCGA-CZ-5986-01A-11D-1669-08 ENST00000317338 p.R816H MED16 chr19 884992 884992 Missense_Mutation G G A TCGA-CZ-5986-01A-11D-1669-08 ENST00000325464 p.S299F ADGRE4P chr19 6990844 6990844 RNA A A C TCGA-CZ-5986-01A-11D-1669-08 ENST00000600751 IL27RA chr19 14046234 14046234 Silent C C G TCGA-CZ-5986-01A-11D-1669-08 ENST00000263379 p.T283T KIAA1683 chr19 18266199 18266199 Silent C C T TCGA-CZ-5986-01A-11D-1669-08 ENST00000600328 p.G447G CEACAM5 chr19 41709792 41709792 Silent C C A TCGA-CZ-5986-01A-11D-1669-08 ENST00000221992 p.P59P GPR4 chr19 45591687 45591687 Silent G G A TCGA-CZ-5986-01A-11D-1669-08 ENST00000323040 p.S60S NLRP4 chr19 55852239 55852239 Silent A A G TCGA-CZ-5986-01A-11D-1669-08 ENST00000301295 p.E53E GGT7 chr20 34859520 34859520 Missense_Mutation C C T TCGA-CZ-5986-01A-11D-1669-08 ENST00000336431 p.V313M NFS1 chr20 35669424 35669424 3'UTR G G A TCGA-CZ-5986-01A-11D-1669-08 ENST00000374092 SYCP2 chr20 59866328 59866339 In_Frame_Del AATCTTTTTCAA AATCTTTTTCAA - TCGA-CZ-5986-01A-11D-1669-08 ENST00000357552 p.F1425_D1428del C2CD2 chr21 41907814 41907814 Intron C C A TCGA-CZ-5986-01A-11D-1669-08 ENST00000380486 LRRC40 chr1 70152436 70152436 Missense_Mutation A A C TCGA-B0-5693-01A-11D-1534-10 ENST00000370952 p.L479R CCDC18 chr1 93184004 93184004 Missense_Mutation A A G TCGA-B0-5693-01A-11D-1534-10 ENST00000343253 p.Y54C TOR3A chr1 179087985 179087985 Missense_Mutation G G C TCGA-B0-5693-01A-11D-1534-10 ENST00000367627 p.E238D TTN chr2 178533890 178533890 Missense_Mutation T T C TCGA-B0-5693-01A-11D-1534-10 ENST00000591111 p.K32601R VHL chr3 10146610 10146611 Frame_Shift_Ins - - T TCGA-B0-5693-01A-11D-1534-10 ENST00000256474 p.I147Yfs*27 PBRM1 chr3 52615424 52615424 Frame_Shift_Del T T - TCGA-B0-5693-01A-11D-1534-10 ENST00000296302 p.L617Ffs*25 CGGBP1 chr3 88055672 88055672 Missense_Mutation C C G TCGA-B0-5693-01A-11D-1534-10 ENST00000309534 p.S102T CCDC54 chr3 107378521 107378521 Missense_Mutation A A G TCGA-B0-5693-01A-11D-1534-10 ENST00000261058 p.N312D TIMMDC1 chr3 119523628 119523628 Nonsense_Mutation G G T TCGA-B0-5693-01A-11D-1534-10 ENST00000494664 p.E244* FBXL17 chr5 108367905 108367905 Missense_Mutation C C G TCGA-B0-5693-01A-11D-1534-10 ENST00000542267 p.V348L YTHDC2 chr5 113564062 113564062 Silent T T C TCGA-B0-5693-01A-11D-1534-10 ENST00000161863 p.A882A ADCY1 chr7 45686171 45686171 Silent G G A TCGA-B0-5693-01A-11D-1534-10 ENST00000297323 p.T761T FAM91A1 chr8 123779997 123779997 Frame_Shift_Del C C - TCGA-B0-5693-01A-11D-1534-10 ENST00000334705 p.P188Lfs*20 UBQLN1 chr9 83661895 83661895 Silent G G C TCGA-B0-5693-01A-11D-1534-10 ENST00000376395 p.L554L CKS2 chr9 89316385 89316385 Missense_Mutation T T G TCGA-B0-5693-01A-11D-1534-10 ENST00000314355 p.L67R PALM2-AKAP2 chr9 110156453 110156453 Nonsense_Mutation G G T TCGA-B0-5693-01A-11D-1534-10 ENST00000374530 p.E1044* RABGAP1 chr9 122984611 122984624 Frame_Shift_Del GATGGGCCTCTTTC GATGGGCCTCTTTC - TCGA-B0-5693-01A-11D-1534-10 ENST00000373647 p.D93* TRDMT1 chr10 17153592 17153592 Silent T T C TCGA-B0-5693-01A-11D-1534-10 ENST00000377799 p.E330E PCDH15 chr10 53827519 53827519 Missense_Mutation C C T TCGA-B0-5693-01A-11D-1534-10 ENST00000320301 p.R1414Q NHLRC2 chr10 113855008 113855008 Missense_Mutation G G A TCGA-B0-5693-01A-11D-1534-10 ENST00000369301 p.D46N MEN1 chr11 64805762 64805762 Frame_Shift_Del T T - TCGA-B0-5693-01A-11D-1534-10 ENST00000337652 p.Y358Sfs*15 CATSPER1 chr11 66025214 66025214 Missense_Mutation T T G TCGA-B0-5693-01A-11D-1534-10 ENST00000312106 p.K389T HSPA8 chr11 123061267 123061267 Missense_Mutation C C G TCGA-B0-5693-01A-11D-1534-10 ENST00000227378 p.V20L CCDC91 chr12 28484063 28484063 Missense_Mutation G G T TCGA-B0-5693-01A-11D-1534-10 ENST00000381259 p.K371N GJB6 chr13 20223181 20223181 Missense_Mutation G G T TCGA-B0-5693-01A-11D-1534-10 ENST00000241124 p.H100Q ACTN1 chr14 68890249 68890249 Missense_Mutation T T G TCGA-B0-5693-01A-11D-1534-10 ENST00000193403 p.E375A KATNBL1 chr15 34146663 34146663 Intron T T C TCGA-B0-5693-01A-11D-1534-10 ENST00000256544 TGM7 chr15 43276879 43276884 In_Frame_Del ATTGAT ATTGAT - TCGA-B0-5693-01A-11D-1534-10 ENST00000452443 p.I651_N652del TGM7 chr15 43276885 43276885 Silent G G C TCGA-B0-5693-01A-11D-1534-10 ENST00000452443 p.L650L ITGAM chr16 31297828 31297828 Frame_Shift_Del G G - TCGA-B0-5693-01A-11D-1534-10 ENST00000287497 p.D529Tfs*2 EDC4 chr16 67882877 67882877 Intron G G A TCGA-B0-5693-01A-11D-1534-10 ENST00000358933 ZC3H18 chr16 88622273 88622273 Missense_Mutation C C A TCGA-B0-5693-01A-11D-1534-10 ENST00000301011 p.P518T PSMD11 chr17 32479882 32479882 Missense_Mutation C C T TCGA-B0-5693-01A-11D-1534-10 ENST00000261712 p.S357F CDK12 chr17 39524876 39524876 Missense_Mutation G G A TCGA-B0-5693-01A-11D-1534-10 ENST00000447079 p.D1100N KANSL1 chr17 46039041 46039041 Missense_Mutation G G C TCGA-B0-5693-01A-11D-1534-10 ENST00000574590 p.S793C FECH chr18 57566541 57566541 Silent A A G TCGA-B0-5693-01A-11D-1534-10 ENST00000262093 p.P168P SLC7A9 chr19 32868588 32868588 5'UTR G G T TCGA-B0-5693-01A-11D-1534-10 ENST00000023064 RFPL4A chr19 55762729 55762729 Missense_Mutation G G A TCGA-B0-5693-01A-11D-1534-10 ENST00000434937 p.V140I CPXM1 chr20 2798496 2798496 Missense_Mutation T T C TCGA-B0-5693-01A-11D-1534-10 ENST00000380605 p.S128G SCP2D1 chr20 18814322 18814322 3'UTR T T C TCGA-B0-5693-01A-11D-1534-10 ENST00000377428 PCDH19 chrX 100296564 100296564 Frame_Shift_Del C C - TCGA-B0-5693-01A-11D-1534-10 ENST00000373034 p.E1054Rfs*76 XIRP2 chr2 167245407 167245407 Nonsense_Mutation A A T TCGA-BP-4989-01A-01D-1462-08 ENST00000628543 p.K1164* MYO3B chr2 170387238 170387238 Missense_Mutation A A G TCGA-BP-4989-01A-01D-1462-08 ENST00000408978 p.T503A TTN chr2 178619712 178619712 Silent T T C TCGA-BP-4989-01A-01D-1462-08 ENST00000591111 p.R13894R TTN chr2 178640082 178640082 Silent G G A TCGA-BP-4989-01A-01D-1462-08 ENST00000591111 p.L11943L FN1 chr2 215397728 215397728 Missense_Mutation T T C TCGA-BP-4989-01A-01D-1462-08 ENST00000359671 p.R1157G VHL chr3 10146518 10146518 Frame_Shift_Del C C - TCGA-BP-4989-01A-01D-1462-08 ENST00000256474 p.L116Ffs*43 LRRC3B chr3 26710193 26710193 Missense_Mutation C C A TCGA-BP-4989-01A-01D-1462-08 ENST00000396641 p.T174K PLXNB1 chr3 48419626 48419626 Missense_Mutation A A G TCGA-BP-4989-01A-01D-1462-08 ENST00000296440 p.L887P PBRM1 chr3 52576623 52576624 Frame_Shift_Del CT CT - TCGA-BP-4989-01A-01D-1462-08 ENST00000296302 p.E1203Afs*2 WDR5B chr3 122415317 122415317 Missense_Mutation T T C TCGA-BP-4989-01A-01D-1462-08 ENST00000330689 p.Y71C DHX36 chr3 154276889 154276889 Missense_Mutation T T C TCGA-BP-4989-01A-01D-1462-08 ENST00000496811 p.Y900C DGKG chr3 186164914 186164914 Missense_Mutation C C T TCGA-BP-4989-01A-01D-1462-08 ENST00000265022 p.A734T FAM193A chr4 2672305 2672305 Missense_Mutation T T C TCGA-BP-4989-01A-01D-1462-08 ENST00000324666 p.V464A GPR78 chr4 8582577 8582577 Missense_Mutation G G A TCGA-BP-4989-01A-01D-1462-08 ENST00000382487 p.A239T SEC24B chr4 109481679 109481679 Missense_Mutation G G A TCGA-BP-4989-01A-01D-1462-08 ENST00000265175 p.V355M PCDH10 chr4 133150978 133150978 Missense_Mutation G G A TCGA-BP-4989-01A-01D-1462-08 ENST00000264360 p.G280S TENM3 chr4 182792966 182792966 Silent C C G TCGA-BP-4989-01A-01D-1462-08 ENST00000511685 p.L2098L C5orf38 chr5 2755060 2755060 3'UTR C C T TCGA-BP-4989-01A-01D-1462-08 ENST00000334000 EDIL3 chr5 84060409 84060409 Missense_Mutation G G A TCGA-BP-4989-01A-01D-1462-08 ENST00000296591 p.T343M TSLP chr5 111073387 111073388 Intron CT CT - TCGA-BP-4989-01A-01D-1462-08 ENST00000344895 PCDHA3 chr5 140803180 140803180 Silent C C A TCGA-BP-4989-01A-01D-1462-08 ENST00000522353 p.A661A PCDHA7 chr5 140836633 140836633 Missense_Mutation C C A TCGA-BP-4989-01A-01D-1462-08 ENST00000525929 p.F750L MFAP3 chr5 154053113 154053113 Silent C C T TCGA-BP-4989-01A-01D-1462-08 ENST00000322602 p.L163L SLIT3 chr5 168687099 168687099 Missense_Mutation C C T TCGA-BP-4989-01A-01D-1462-08 ENST00000519560 p.G1065D FLT4 chr5 180629415 180629415 Missense_Mutation T T G TCGA-BP-4989-01A-01D-1462-08 ENST00000261937 p.K277Q KIF13A chr6 17898168 17898168 Splice_Region C C T TCGA-BP-4989-01A-01D-1462-08 ENST00000259711 p.K53K FAM135A chr6 70477266 70477266 Missense_Mutation T T G TCGA-BP-4989-01A-01D-1462-08 ENST00000370479 p.F159C GABRR1 chr6 89178961 89178961 Missense_Mutation C C G TCGA-BP-4989-01A-01D-1462-08 ENST00000454853 p.G417R FBXL4 chr6 98917380 98917380 Silent A A C TCGA-BP-4989-01A-01D-1462-08 ENST00000229971 p.P284P LATS1 chr6 149683428 149683428 Missense_Mutation C C T TCGA-BP-4989-01A-01D-1462-08 ENST00000253339 p.G554E CLK2P1 chr7 23585773 23585773 RNA G G - TCGA-BP-4989-01A-01D-1462-08 ENST00000416636 KMT2E chr7 105078964 105078964 Splice_Site G G A TCGA-BP-4989-01A-01D-1462-08 ENST00000257745 p.X416_splice OR2A42 chr7 144232592 144232592 Silent G G T TCGA-BP-4989-01A-01D-1462-08 ENST00000391496 p.L84L DNAJB6 chr7 157385668 157385668 Intron A A - TCGA-BP-4989-01A-01D-1462-08 ENST00000262177 ZNF658 chr9 66920942 66920942 3'UTR A A - TCGA-BP-4989-01A-01D-1462-08 ENST00000612867 PRKACG chr9 69013698 69013698 Missense_Mutation C C T TCGA-BP-4989-01A-01D-1462-08 ENST00000377276 p.R132H PCSK5 chr9 76310843 76310843 Silent G G A TCGA-BP-4989-01A-01D-1462-08 ENST00000545128 p.K1265K RGS3 chr9 113536828 113536828 Missense_Mutation C C G TCGA-BP-4989-01A-01D-1462-08 ENST00000350696 p.H649Q KIAA1217 chr10 24546051 24546051 Silent C C A TCGA-BP-4989-01A-01D-1462-08 ENST00000376454 p.L1853L ZNF438 chr10 30849599 30849599 Missense_Mutation A A G TCGA-BP-4989-01A-01D-1462-08 ENST00000361310 p.M269T PLAU chr10 73913309 73913309 Nonsense_Mutation C C T TCGA-BP-4989-01A-01D-1462-08 ENST00000372764 p.R130* OR51D1 chr11 4640072 4640072 Missense_Mutation G G T TCGA-BP-4989-01A-01D-1462-08 ENST00000357605 p.M94I TCP11L1 chr11 33076150 33076150 3'Flank T T C TCGA-BP-4989-01A-01D-1462-08 ENST00000334274 PAAF1 chr11 73927304 73927304 Missense_Mutation A A T TCGA-BP-4989-01A-01D-1462-08 ENST00000310571 p.Q374L ALG8 chr11 78101024 78101024 Missense_Mutation C C A TCGA-BP-4989-01A-01D-1462-08 ENST00000299626 p.W507C CHD4 chr12 6578875 6578875 Missense_Mutation T T G TCGA-BP-4989-01A-01D-1462-08 ENST00000357008 p.D1651A PLEKHA5 chr12 19257462 19257462 Silent T T C TCGA-BP-4989-01A-01D-1462-08 ENST00000299275 p.N154N OR8S1 chr12 48528080 48528080 Missense_Mutation G G A TCGA-BP-4989-01A-01D-1462-08 ENST00000310194 p.A353T KRT85 chr12 52362857 52362857 Nonsense_Mutation G G T TCGA-BP-4989-01A-01D-1462-08 ENST00000257901 p.C358* ERBB3 chr12 56093789 56093789 Silent A A G TCGA-BP-4989-01A-01D-1462-08 ENST00000267101 p.P502P PCDH9 chr13 66631387 66631387 Missense_Mutation G G A TCGA-BP-4989-01A-01D-1462-08 ENST00000377865 p.L1055F EMC9 chr14 24139048 24139048 Missense_Mutation G G C TCGA-BP-4989-01A-01D-1462-08 ENST00000216799 p.Q197E KLC1 chr14 103662889 103662889 Silent C C T TCGA-BP-4989-01A-01D-1462-08 ENST00000348520 p.D253D AC124312.1 chr15 25089781 25089781 3'Flank C C - TCGA-BP-4989-01A-01D-1462-08 ENST00000623624 MAN2C1 chr15 75358293 75358293 Missense_Mutation C C G TCGA-BP-4989-01A-01D-1462-08 ENST00000267978 p.V819L IL16 chr15 81296933 81296933 Silent G G A TCGA-BP-4989-01A-01D-1462-08 ENST00000302987 p.A636A AXIN1 chr16 346290 346290 Missense_Mutation C C T TCGA-BP-4989-01A-01D-1462-08 ENST00000262320 p.E246K SEC14L5 chr16 5000876 5000876 Missense_Mutation G G A TCGA-BP-4989-01A-01D-1462-08 ENST00000251170 p.G361R ABCC6 chr16 16150735 16150735 Missense_Mutation G G T TCGA-BP-4989-01A-01D-1462-08 ENST00000205557 p.L1416I IGHV3OR16-9 chr16 32066089 32066089 Nonsense_Mutation G G T TCGA-BP-4989-01A-01D-1462-08 ENST00000354689 p.G9* HOXB1 chr17 48530848 48530848 Silent G G T TCGA-BP-4989-01A-01D-1462-08 ENST00000239174 p.P19P KIF2B chr17 53823375 53823375 Missense_Mutation A A C TCGA-BP-4989-01A-01D-1462-08 ENST00000268919 p.K114N TTYH2 chr17 74253791 74253791 Silent C C T TCGA-BP-4989-01A-01D-1462-08 ENST00000269346 p.Y494Y ILF3 chr19 10688593 10688593 Silent C C T TCGA-BP-4989-01A-01D-1462-08 ENST00000590261 p.G822G ZNF260 chr19 36513930 36513930 3'UTR T T C TCGA-BP-4989-01A-01D-1462-08 ENST00000523638 DHX34 chr19 47353305 47353305 Missense_Mutation C C T TCGA-BP-4989-01A-01D-1462-08 ENST00000328771 p.A92V ZFP28 chr19 56554352 56554352 Missense_Mutation C C A TCGA-BP-4989-01A-01D-1462-08 ENST00000301318 p.H523N FLRT3 chr20 14326688 14326688 Silent G G C TCGA-BP-4989-01A-01D-1462-08 ENST00000341420 p.L273L BACH1 chr21 29321408 29321408 Missense_Mutation A A G TCGA-BP-4989-01A-01D-1462-08 ENST00000286800 p.Q43R KRTAP13-2 chr21 30371933 30371933 Missense_Mutation G G A TCGA-BP-4989-01A-01D-1462-08 ENST00000399889 p.T94M BRWD1 chr21 39218222 39218222 Missense_Mutation A A G TCGA-BP-4989-01A-01D-1462-08 ENST00000333229 p.Y1197H COL6A2 chr21 46122116 46122116 Silent C C T TCGA-BP-4989-01A-01D-1462-08 ENST00000300527 p.P510P CCDC116 chr22 21637063 21637063 Missense_Mutation G G T TCGA-BP-4989-01A-01D-1462-08 ENST00000292779 p.G612V MORC4 chrX 106943207 106943207 Splice_Site T T A TCGA-BP-4989-01A-01D-1462-08 ENST00000355610 p.X562_splice LONRF3 chrX 119006198 119006198 Missense_Mutation A A G TCGA-BP-4989-01A-01D-1462-08 ENST00000371628 p.N498S FRMD7 chrX 132078405 132078405 Missense_Mutation T T G TCGA-BP-4989-01A-01D-1462-08 ENST00000298542 p.I538L PTCHD2 chr1 11501842 11501842 Missense_Mutation G G A TCGA-A3-3331-01A-01W-0886-08 ENST00000294484 p.D284N RBBP4 chr1 32672832 32672832 Silent C C T TCGA-A3-3331-01A-01W-0886-08 ENST00000373493 p.S381S CSF3R chr1 36472313 36472313 Missense_Mutation G G C TCGA-A3-3331-01A-01W-0886-08 ENST00000361632 p.R308G OR10J5 chr1 159535735 159535735 Silent A A G TCGA-A3-3331-01A-01W-0886-08 ENST00000334857 p.P91P PPP1R12B chr1 202428879 202428879 Missense_Mutation G G T TCGA-A3-3331-01A-01W-0886-08 ENST00000608999 p.D291Y ZNF670 chr1 247037614 247037614 Silent T T C TCGA-A3-3331-01A-01W-0886-08 ENST00000366503 p.K335K HADHB chr2 26263421 26263421 Missense_Mutation A A T TCGA-A3-3331-01A-01W-0886-08 ENST00000317799 p.I51L SLC5A6 chr2 27206515 27206515 Missense_Mutation A A T TCGA-A3-3331-01A-01W-0886-08 ENST00000310574 p.V160E RTN4 chr2 54987497 54987497 Missense_Mutation G G A TCGA-A3-3331-01A-01W-0886-08 ENST00000337526 p.P1072L ZNF638 chr2 71434803 71434810 Missense_Mutation GGTGATTG GGTGATTG - TCGA-A3-3331-01A-01W-0886-08 ENST00000264447 LRP2 chr2 169279394 169279394 Missense_Mutation T T G TCGA-A3-3331-01A-01W-0886-08 ENST00000263816 p.I515L CASP8 chr2 201272668 201272668 Missense_Mutation A A G TCGA-A3-3331-01A-01W-0886-08 ENST00000432109 p.K148E SLC23A3 chr2 219162015 219162015 Missense_Mutation T T A TCGA-A3-3331-01A-01W-0886-08 ENST00000409878 p.D576V THAP4 chr2 241633342 241633342 Missense_Mutation C C G TCGA-A3-3331-01A-01W-0886-08 ENST00000407315 p.S272T VHL chr3 10146514 10146514 Missense_Mutation G G C TCGA-A3-3331-01A-01W-0886-08 ENST00000256474 p.G114A PBRM1 chr3 52603643 52603643 Missense_Mutation A A C TCGA-A3-3331-01A-01W-0886-08 ENST00000296302 p.L886R PBRM1 chr3 52641953 52641953 Splice_Site C C T TCGA-A3-3331-01A-01W-0886-08 ENST00000296302 p.X363_splice PVRL3 chr3 111134047 111134047 Silent G G A TCGA-A3-3331-01A-01W-0886-08 ENST00000485303 p.Q494Q CNGA1 chr4 47936602 47936602 Missense_Mutation T T A TCGA-A3-3331-01A-01W-0886-08 ENST00000358519 p.E631V TMPRSS11F chr4 68068756 68068756 Missense_Mutation A A G TCGA-A3-3331-01A-01W-0886-08 ENST00000356291 p.I206T ANKRD17 chr4 73177505 73177505 Missense_Mutation T T G TCGA-A3-3331-01A-01W-0886-08 ENST00000358602 p.D141A ERBB2IP chr5 66054894 66054894 Silent T T A TCGA-A3-3331-01A-01W-0886-08 ENST00000284037 p.V1192V PCDHA13 chr5 140882498 140882498 Missense_Mutation T T A TCGA-A3-3331-01A-01W-0886-08 ENST00000289272 p.V77E GPX3 chr5 151027512 151027512 Missense_Mutation A A T TCGA-A3-3331-01A-01W-0886-08 ENST00000388825 p.K147I NKAPL chr6 28259740 28259740 Silent G G A TCGA-A3-3331-01A-01W-0886-08 ENST00000343684 p.K123K TDRD6 chr6 46690669 46690669 Silent C C G TCGA-A3-3331-01A-01W-0886-08 ENST00000316081 p.V847V RWDD2A chr6 83194518 83194518 Frame_Shift_Del T T - TCGA-A3-3331-01A-01W-0886-08 ENST00000369724 p.P24Lfs*6 GPNMB chr7 23266558 23266558 Missense_Mutation G G T TCGA-A3-3331-01A-01W-0886-08 ENST00000381990 p.D366Y DUSP26 chr8 33592185 33592185 Missense_Mutation C C G TCGA-A3-3331-01A-01W-0886-08 ENST00000256261 p.G155A CSMD3 chr8 112682599 112682599 Silent T T A TCGA-A3-3331-01A-01W-0886-08 ENST00000297405 p.P840P CSMD3 chr8 112682600 112682600 Missense_Mutation G G A TCGA-A3-3331-01A-01W-0886-08 ENST00000297405 p.P840L EFR3A chr8 131986228 131986228 Missense_Mutation T T A TCGA-A3-3331-01A-01W-0886-08 ENST00000254624 p.F635Y RPS6 chr9 19379649 19379649 Intron G G T TCGA-A3-3331-01A-01W-0886-08 ENST00000380394 DDX58 chr9 32457092 32457092 3'UTR T T C TCGA-A3-3331-01A-01W-0886-08 ENST00000379883 ZNF79 chr9 127444206 127444206 Missense_Mutation C C T TCGA-A3-3331-01A-01W-0886-08 ENST00000342483 p.P169L NRAP chr10 113662720 113662720 Missense_Mutation A A C TCGA-A3-3331-01A-01W-0886-08 ENST00000359988 p.L72V KIAA1549L chr11 33618598 33618598 Missense_Mutation C C T TCGA-A3-3331-01A-01W-0886-08 ENST00000321505 p.T1485I CKAP5 chr11 46765200 46765200 Missense_Mutation T T A TCGA-A3-3331-01A-01W-0886-08 ENST00000529230 p.K1156N PATL1 chr11 59657619 59657619 Missense_Mutation T T C TCGA-A3-3331-01A-01W-0886-08 ENST00000300146 p.T178A HNRNPUL2 chr11 62723975 62723975 Silent C C A TCGA-A3-3331-01A-01W-0886-08 ENST00000301785 p.L230L CACNA1C chr12 2691116 2691116 Nonsense_Mutation G G T TCGA-A3-3331-01A-01W-0886-08 ENST00000347598 p.E2160* SLCO1C1 chr12 20721986 20721986 Missense_Mutation G G A TCGA-A3-3331-01A-01W-0886-08 ENST00000266509 p.D320N SLCO1C1 chr12 20721987 20721987 Missense_Mutation A A G TCGA-A3-3331-01A-01W-0886-08 ENST00000266509 p.D320G ESPL1 chr12 53289505 53289505 Missense_Mutation G G A TCGA-A3-3331-01A-01W-0886-08 ENST00000257934 p.R1675H CD63 chr12 55726725 55726725 Missense_Mutation G G A TCGA-A3-3331-01A-01W-0886-08 ENST00000257857 p.S134L CCDC63 chr12 110881192 110881192 Missense_Mutation G G A TCGA-A3-3331-01A-01W-0886-08 ENST00000308208 p.R250Q CUX2 chr12 111347996 111347996 Missense_Mutation T T G TCGA-A3-3331-01A-01W-0886-08 ENST00000261726 p.L1378V OGFOD2 chr12 122978567 122978567 Missense_Mutation G G A TCGA-A3-3331-01A-01W-0886-08 ENST00000228922 p.G177R IPO5 chr13 98019681 98019681 Silent C C A TCGA-A3-3331-01A-01W-0886-08 ENST00000357602 p.I979I TMCO3 chr13 113495801 113495801 Missense_Mutation G G A TCGA-A3-3331-01A-01W-0886-08 ENST00000434316 p.A74T RGS6 chr14 72476739 72476739 Splice_Region T T A TCGA-A3-3331-01A-01W-0886-08 ENST00000553530 DYNC1H1 chr14 102044601 102044601 Frame_Shift_Del G G - TCGA-A3-3331-01A-01W-0886-08 ENST00000360184 p.E4304Sfs*36 EIF3J chr15 44561059 44561059 Silent A A T TCGA-A3-3331-01A-01W-0886-08 ENST00000261868 p.G229G DUOX2 chr15 45097254 45097254 Silent C C T TCGA-A3-3331-01A-01W-0886-08 ENST00000603300 p.A1277A ZNF592 chr15 84782657 84782657 5'UTR C C T TCGA-A3-3331-01A-01W-0886-08 ENST00000299927 CHD2 chr15 92944397 92944397 Intron T T A TCGA-A3-3331-01A-01W-0886-08 ENST00000394196 CPPED1 chr16 12704867 12704868 Frame_Shift_Ins - - G TCGA-A3-3331-01A-01W-0886-08 ENST00000381774 p.V158Rfs*140 NFATC3 chr16 68126518 68126518 Missense_Mutation G G A TCGA-A3-3331-01A-01W-0886-08 ENST00000346183 p.V437M ALOXE3 chr17 8096780 8096780 Silent C C T TCGA-A3-3331-01A-01W-0886-08 ENST00000448843 p.E661E NT5C3B chr17 41825635 41825635 Missense_Mutation T T A TCGA-A3-3331-01A-01W-0886-08 ENST00000435506 p.Y264F FZD2 chr17 44559109 44559109 Missense_Mutation C C A TCGA-A3-3331-01A-01W-0886-08 ENST00000315323 p.T474N MAST1 chr19 12851974 12851974 Missense_Mutation C C G TCGA-A3-3331-01A-01W-0886-08 ENST00000251472 p.T272S GMIP chr19 19635455 19635455 Missense_Mutation T T C TCGA-A3-3331-01A-01W-0886-08 ENST00000203556 p.E507G ZNF708 chr19 21309327 21309327 Missense_Mutation T T A TCGA-A3-3331-01A-01W-0886-08 ENST00000356929 p.N49Y ALKBH6 chr19 36010480 36010480 Intron C C T TCGA-A3-3331-01A-01W-0886-08 ENST00000252984 PSG7 chr19 42935731 42935731 Missense_Mutation G G T TCGA-A3-3331-01A-01W-0886-08 ENST00000406070 p.Q35K NLRP8 chr19 55962162 55962162 Missense_Mutation G G C TCGA-A3-3331-01A-01W-0886-08 ENST00000291971 p.S713T SLC23A2 chr20 4883752 4883752 Silent T T G TCGA-A3-3331-01A-01W-0886-08 ENST00000338244 p.L238L MCM8 chr20 5952497 5952497 Silent A A C TCGA-A3-3331-01A-01W-0886-08 ENST00000378896 p.P74P PLCB1 chr20 8722376 8722376 Silent C C T TCGA-A3-3331-01A-01W-0886-08 ENST00000338037 p.D512D DGCR2 chr22 19068226 19068226 Splice_Site C C A TCGA-A3-3331-01A-01W-0886-08 ENST00000263196 p.X68_splice EFCAB6 chr22 43528959 43528959 Missense_Mutation C C A TCGA-A3-3331-01A-01W-0886-08 ENST00000262726 p.S1467I MAGEB6 chrX 26194126 26194126 Missense_Mutation C C A TCGA-A3-3331-01A-01W-0886-08 ENST00000379034 p.P94T DGKK chrX 50386523 50386523 Missense_Mutation T T A TCGA-A3-3331-01A-01W-0886-08 ENST00000611977 p.T728S KIF4A chrX 70404770 70404770 Missense_Mutation A A G TCGA-A3-3331-01A-01W-0886-08 ENST00000374403 p.E949G IDS chrX 149482767 149482767 Silent A A C TCGA-A3-3331-01A-01W-0886-08 ENST00000340855 p.L544L CFAP57 chr1 43181824 43181824 Missense_Mutation G G T TCGA-CZ-5462-01A-01D-1501-10 ENST00000372492 p.D150Y SPTA1 chr1 158648555 158648555 Missense_Mutation C C T TCGA-CZ-5462-01A-01D-1501-10 ENST00000368147 p.R1223Q RGL1 chr1 183922238 183922238 Missense_Mutation A A G TCGA-CZ-5462-01A-01D-1501-10 ENST00000360851 p.K674R HMCN1 chr1 185984299 185984299 Missense_Mutation C C T TCGA-CZ-5462-01A-01D-1501-10 ENST00000271588 p.S974F DISP1 chr1 223005818 223005818 Missense_Mutation G G T TCGA-CZ-5462-01A-01D-1501-10 ENST00000284476 p.R1474M SLC9A4 chr2 102503584 102503584 Missense_Mutation T T A TCGA-CZ-5462-01A-01D-1501-10 ENST00000295269 p.F286Y NCKAP5 chr2 132782740 132782740 Silent G G A TCGA-CZ-5462-01A-01D-1501-10 ENST00000409261 p.S1357S TTN chr2 178541348 178541348 Missense_Mutation T T A TCGA-CZ-5462-01A-01D-1501-10 ENST00000591111 p.I30936F TTN chr2 178651511 178651511 Silent A A T TCGA-CZ-5462-01A-01D-1501-10 ENST00000591111 p.V11656V CXCR6 chr3 45947055 45947055 Missense_Mutation C C T TCGA-CZ-5462-01A-01D-1501-10 ENST00000304552 p.L192F IL20RB chr3 136992007 136992007 Missense_Mutation T T C TCGA-CZ-5462-01A-01D-1501-10 ENST00000329582 p.Y201H AFAP1 chr4 7781481 7781481 Intron C C A TCGA-CZ-5462-01A-01D-1501-10 ENST00000358461 PCDH7 chr4 30723295 30723295 Missense_Mutation G G T TCGA-CZ-5462-01A-01D-1501-10 ENST00000361762 p.V625L EPHA5 chr4 65332090 65332090 Missense_Mutation G G T TCGA-CZ-5462-01A-01D-1501-10 ENST00000273854 p.S964Y TMPRSS11D chr4 67859661 67859661 Missense_Mutation G G A TCGA-CZ-5462-01A-01D-1501-10 ENST00000283916 p.S9L INTU chr4 127710968 127710968 Missense_Mutation C C A TCGA-CZ-5462-01A-01D-1501-10 ENST00000335251 p.Q809K SLC45A2 chr5 33963769 33963772 Frame_Shift_Del AGAA AGAA - TCGA-CZ-5462-01A-01D-1501-10 ENST00000296589 p.I271Rfs*8 ANKRD34B chr5 80559777 80559777 Missense_Mutation G G T TCGA-CZ-5462-01A-01D-1501-10 ENST00000338682 p.D81E RASA1 chr5 87268890 87268890 Missense_Mutation G G A TCGA-CZ-5462-01A-01D-1501-10 ENST00000274376 p.G147R KIF4B chr5 155014813 155014813 Silent C C T TCGA-CZ-5462-01A-01D-1501-10 ENST00000435029 p.S318S UBR2 chr6 42670207 42670207 Missense_Mutation T T A TCGA-CZ-5462-01A-01D-1501-10 ENST00000372899 p.W1333R RNGTT chr6 88612517 88612517 3'UTR C C T TCGA-CZ-5462-01A-01D-1501-10 ENST00000369485 ASCC3 chr6 100662536 100662536 Missense_Mutation C C T TCGA-CZ-5462-01A-01D-1501-10 ENST00000369162 p.V763I HACE1 chr6 104785265 104785265 Nonsense_Mutation C C A TCGA-CZ-5462-01A-01D-1501-10 ENST00000262903 p.E377* FABP7 chr6 122783942 122783943 3'UTR - - GAA TCGA-CZ-5462-01A-01D-1501-10 ENST00000368444 LAMA2 chr6 129098213 129098213 Frame_Shift_Del C C - TCGA-CZ-5462-01A-01D-1501-10 ENST00000421865 p.R148Gfs*24 ETV1 chr7 13935825 13935825 Missense_Mutation G G A TCGA-CZ-5462-01A-01D-1501-10 ENST00000405218 p.S146F AMPH chr7 38391938 38391938 Missense_Mutation G G A TCGA-CZ-5462-01A-01D-1501-10 ENST00000356264 p.A563V ABCA13 chr7 48274446 48274446 Missense_Mutation G G A TCGA-CZ-5462-01A-01D-1501-10 ENST00000435803 p.G1594S ZAN chr7 100789253 100789253 Frame_Shift_Del A A - TCGA-CZ-5462-01A-01D-1501-10 ENST00000613979 p.N2422Mfs*32 PIK3CG chr7 106869208 106869208 Missense_Mutation C C A TCGA-CZ-5462-01A-01D-1501-10 ENST00000359195 p.N549K PLXNA4 chr7 132298144 132298144 Missense_Mutation C C A TCGA-CZ-5462-01A-01D-1501-10 ENST00000321063 p.D484Y CHD7 chr8 60820055 60820055 Missense_Mutation A A T TCGA-CZ-5462-01A-01D-1501-10 ENST00000423902 p.M888L NOV chr8 119422917 119422917 Missense_Mutation T T A TCGA-CZ-5462-01A-01D-1501-10 ENST00000259526 p.Y287N TMEM71 chr8 132751954 132751954 Missense_Mutation C C T TCGA-CZ-5462-01A-01D-1501-10 ENST00000356838 p.G49S DMRT3 chr9 990589 990589 Nonsense_Mutation C C T TCGA-CZ-5462-01A-01D-1501-10 ENST00000190165 p.R335* FAM205BP chr9 34834307 34834307 RNA C C T TCGA-CZ-5462-01A-01D-1501-10 ENST00000399773 SYK chr9 90874254 90874254 Silent G G A TCGA-CZ-5462-01A-01D-1501-10 ENST00000375746 p.P322P AKNA chr9 114377398 114377398 Missense_Mutation C C T TCGA-CZ-5462-01A-01D-1501-10 ENST00000307564 p.A137T SFTPD chr10 79942422 79942422 Silent G G A TCGA-CZ-5462-01A-01D-1501-10 ENST00000372292 p.G133G CPXM2 chr10 123766972 123766972 Splice_Site C C T TCGA-CZ-5462-01A-01D-1501-10 ENST00000241305 p.X493_splice PTPN5 chr11 18728930 18728930 3'UTR G G A TCGA-CZ-5462-01A-01D-1501-10 ENST00000358540 PRPF19 chr11 60903857 60903857 Silent A A T TCGA-CZ-5462-01A-01D-1501-10 ENST00000227524 p.S8S DDB1 chr11 61314159 61314159 Silent T T A TCGA-CZ-5462-01A-01D-1501-10 ENST00000301764 p.G547G DDB1 chr11 61314160 61314160 Missense_Mutation C C T TCGA-CZ-5462-01A-01D-1501-10 ENST00000301764 p.G547E BIRC2 chr11 102350942 102350942 Missense_Mutation A A G TCGA-CZ-5462-01A-01D-1501-10 ENST00000227758 p.R332G TRAPPC4 chr11 119018533 119018533 5'UTR A A G TCGA-CZ-5462-01A-01D-1501-10 ENST00000533632 RILPL1 chr12 123498648 123498653 In_Frame_Del GGTCTG GGTCTG - TCGA-CZ-5462-01A-01D-1501-10 ENST00000376874 p.A231_L233delinsV MYCBP2 chr13 77140155 77140155 Frame_Shift_Del T T - TCGA-CZ-5462-01A-01D-1501-10 ENST00000357337 p.K2432Nfs*23 TMEM255B chr13 113811746 113811746 Missense_Mutation G G A TCGA-CZ-5462-01A-01D-1501-10 ENST00000375353 p.R275H SEC23A chr14 39033263 39033263 Frame_Shift_Del T T - TCGA-CZ-5462-01A-01D-1501-10 ENST00000307712 p.K758Nfs*22 TGM5 chr15 43235493 43235493 Missense_Mutation A A G TCGA-CZ-5462-01A-01D-1501-10 ENST00000220420 p.F564L ADAM10 chr15 58633254 58633254 Missense_Mutation G G T TCGA-CZ-5462-01A-01D-1501-10 ENST00000260408 p.P373H ACSBG1 chr15 78234418 78234418 Silent G G A TCGA-CZ-5462-01A-01D-1501-10 ENST00000258873 p.S28S MYLK3 chr16 46707626 46707626 3'UTR T T G TCGA-CZ-5462-01A-01D-1501-10 ENST00000394809 ANKRD11 chr16 89282635 89282635 Frame_Shift_Del C C - TCGA-CZ-5462-01A-01D-1501-10 ENST00000301030 p.V1303Sfs*15 CTNS chr17 3659945 3659945 Missense_Mutation C C A TCGA-CZ-5462-01A-01D-1501-10 ENST00000046640 p.L314M CA10 chr17 52072363 52072363 Missense_Mutation C C T TCGA-CZ-5462-01A-01D-1501-10 ENST00000285273 p.G31D LGALS3BP chr17 78971658 78971658 Missense_Mutation A A G TCGA-CZ-5462-01A-01D-1501-10 ENST00000262776 p.F559S ZNF24 chr18 35339838 35339838 Missense_Mutation T T A TCGA-CZ-5462-01A-01D-1501-10 ENST00000261332 p.R187W LOXHD1 chr18 46534349 46534349 Missense_Mutation G G T TCGA-CZ-5462-01A-01D-1501-10 ENST00000300591 p.L289I SMAD7 chr18 48942663 48942663 Intron A A T TCGA-CZ-5462-01A-01D-1501-10 ENST00000262158 COL5A3 chr19 10005715 10005715 Splice_Site C C T TCGA-CZ-5462-01A-01D-1501-10 ENST00000264828 p.X146_splice LTBP4 chr19 40623651 40623651 Frame_Shift_Del G G - TCGA-CZ-5462-01A-01D-1501-10 ENST00000308370 p.V1269Cfs*3 KIR3DL2 chr19 54852102 54852102 Missense_Mutation A A T TCGA-CZ-5462-01A-01D-1501-10 ENST00000326321 p.M59L BPIFB1 chr20 33286083 33286083 Missense_Mutation C C A TCGA-CZ-5462-01A-01D-1501-10 ENST00000253354 p.P4T CEP250 chr20 35511430 35511430 Missense_Mutation C C T TCGA-CZ-5462-01A-01D-1501-10 ENST00000397527 p.A2378V PTPRT chr20 42084690 42084690 Silent G G T TCGA-CZ-5462-01A-01D-1501-10 ENST00000373187 p.V1376V ERG chr21 38498402 38498402 Intron C C T TCGA-CZ-5462-01A-01D-1501-10 ENST00000398919 PITPNB chr22 27860211 27860211 Frame_Shift_Del G G - TCGA-CZ-5462-01A-01D-1501-10 ENST00000335272 p.Q189Rfs*8 ACOT9 chrX 23735953 23735953 Silent G G A TCGA-CZ-5462-01A-01D-1501-10 ENST00000336430 p.N28N KLF8 chrX 56265584 56265584 Silent T T C TCGA-CZ-5462-01A-01D-1501-10 ENST00000468660 p.T162T AGO4 chr1 35825740 35825740 Missense_Mutation G G A TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000373210 p.G184R GLMP chr1 156299362 156299363 5'Flank CT CT - TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000362007 MYCN chr2 15945947 15945947 Silent G G A TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000281043 p.E415E KIF5C chr2 148991155 148991155 Missense_Mutation C C T TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000435030 p.A621V TTN chr2 178731532 178731532 Missense_Mutation C C G TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000591111 p.G5428A VHL chr3 10149796 10149796 Missense_Mutation T T G TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000256474 p.L158R CHRD chr3 184388731 184388737 Frame_Shift_Del GCAGATG GCAGATG - TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000204604 p.C900Lfs*153 CHRD chr3 184388738 184388738 Silent T T C TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000204604 p.C902C CLDN16 chr3 190408331 190408331 Missense_Mutation G G A TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000264734 p.G204S OTUD4 chr4 145144399 145144399 Missense_Mutation G G C TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000447906 p.S486R NIPBL chr5 36985683 36985683 Frame_Shift_Del G G - TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000282516 p.D836Ifs*11 RASA1 chr5 87269182 87269182 Intron T T C TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000274376 SLC26A2 chr5 149980310 149980310 Missense_Mutation T T G TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000286298 p.F239L TCOF1 chr5 150399044 150399044 Missense_Mutation T T C TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000377797 p.V1488A KIF13A chr6 17779067 17779067 Silent C C T TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000259711 p.L1324L SNX14 chr6 85572216 85572216 Splice_Site C C G TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000314673 p.X113_splice PDE7B chr6 136173875 136173875 Missense_Mutation C C T TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000308191 p.P264S C6orf118 chr6 165280082 165280082 Missense_Mutation C C A TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000230301 p.C462F CDK13 chr7 40094572 40094572 Missense_Mutation G G T TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000181839 p.L1377F FEZF1 chr7 122303841 122303841 Silent G G A TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000442488 p.A199A ARF5 chr7 127589597 127589597 Splice_Region G G A TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000000233 TMEM65 chr8 124320143 124320144 Frame_Shift_Del AA AA - TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000297632 p.I188Tfs*2 OPLAH chr8 144059691 144059691 Missense_Mutation G G C TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000618853 p.R91G FAM205A chr9 34726367 34726367 Silent C C T TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000378788 p.V291V COMTD1 chr10 75235367 75235367 Silent G G A TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000372538 p.T76T JAKMIP3 chr10 132163367 132163367 Silent C C T TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000298622 p.A791A ANO1 chr11 70087876 70087876 Missense_Mutation C C A TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000355303 p.T78N ADAMTS8 chr11 130411475 130411475 Silent G G A TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000257359 p.Y564Y CD27 chr12 6450680 6450680 Intron G G A TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000266557 ITGB7 chr12 53192474 53192474 Missense_Mutation C C T TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000267082 p.A671T RNA5SP29 chr13 51025435 51025435 3'Flank G G A TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000410988 OR4N2 chr14 19827735 19827735 Missense_Mutation G G A TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000315947 p.G96D TGFB3 chr14 75980853 75980853 Missense_Mutation A A G TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000238682 p.L14P SPATA8 chr15 96784162 96784162 Silent G G A TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000328504 p.S33S IGSF6 chr16 21647213 21647213 Missense_Mutation T T C TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000268389 p.Y116C RBBP6 chr16 24571574 24571574 Missense_Mutation G G A TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000319715 p.R1503Q ITGAD chr16 31426169 31426169 3'UTR C C T TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000389202 NUDT21 chr16 56447891 56447891 Missense_Mutation T T C TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000300291 p.D72G MAP1LC3B chr16 87403317 87403317 3'UTR C C A TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000268607 AC061975.1 chr17 28276768 28276768 5'Flank G G A TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000385109 NEUROD2 chr17 39605458 39605458 Missense_Mutation T T C TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000302584 p.H381R PCTP chr17 55776070 55776070 Missense_Mutation A A T TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000268896 p.R205S PSMD12 chr17 67342213 67342213 Missense_Mutation C C G TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000356126 p.M378I USE1 chr19 17215494 17215494 Missense_Mutation G G T TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000263897 p.W30L SLC2A10 chr20 46726318 46726318 Frame_Shift_Del G G - TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000359271 p.P429Qfs*2 NTSR1 chr20 62709651 62709651 Silent C C T TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000370501 p.R148R LINC01548 chr21 33165650 33165650 RNA G G A TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000451980 MOV10L1 chr22 50113750 50113750 Silent A A C TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000262794 p.L282L TBL1X chrX 9692162 9692162 Frame_Shift_Del G G - TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000217964 p.G268Afs*7 EIF2S3 chrX 24073255 24073255 Missense_Mutation A A T TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000253039 p.K449N MAGEE2 chrX 75784276 75784276 Missense_Mutation C C A TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000373359 p.R259M RGAG1 chrX 110455279 110455279 Silent A A C TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000465301 p.G1375G RP11-1007I13.4 chrX 152115045 152115045 RNA C C T TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000509345 ZNF275 chrX 153350576 153350576 3'UTR G G C TCGA-MW-A4EC-01A-11D-A25V-10 ENST00000370251 SPTA1 chr1 158674356 158674356 Missense_Mutation A A T TCGA-CZ-5458-01A-01D-1501-10 ENST00000368147 p.H441Q VAMP4 chr1 171704370 171704370 3'UTR T T - TCGA-CZ-5458-01A-01D-1501-10 ENST00000236192 CRB1 chr1 197442179 197442179 Missense_Mutation A A C TCGA-CZ-5458-01A-01D-1501-10 ENST00000367400 p.I1298L NUAK2 chr1 205306255 205306255 Missense_Mutation G G T TCGA-CZ-5458-01A-01D-1501-10 ENST00000367157 p.T208K UNC50 chr2 98616450 98616450 Missense_Mutation C C G TCGA-CZ-5458-01A-01D-1501-10 ENST00000357765 p.T187R RNF25 chr2 218668109 218668109 Missense_Mutation G G A TCGA-CZ-5458-01A-01D-1501-10 ENST00000295704 p.P86L VHL chr3 10146556 10146556 Missense_Mutation T T A TCGA-CZ-5458-01A-01D-1501-10 ENST00000256474 p.L128H NBEAL2 chr3 46995834 46995834 Silent C C G TCGA-CZ-5458-01A-01D-1501-10 ENST00000450053 p.A673A SLC35A5 chr3 112581280 112581280 Missense_Mutation A A G TCGA-CZ-5458-01A-01D-1501-10 ENST00000492406 p.E388G TRA2B chr3 185925526 185925526 Missense_Mutation G G C TCGA-CZ-5458-01A-01D-1501-10 ENST00000453386 p.R91G TMED7 chr5 115616039 115616039 3'UTR A A - TCGA-CZ-5458-01A-01D-1501-10 ENST00000456936 ETF1 chr5 138512766 138512766 Nonsense_Mutation G G A TCGA-CZ-5458-01A-01D-1501-10 ENST00000360541 p.Q244* LRRTM2 chr5 138875030 138875030 5'UTR G G T TCGA-CZ-5458-01A-01D-1501-10 ENST00000274711 EYS chr6 63726675 63726675 Missense_Mutation A A G TCGA-CZ-5458-01A-01D-1501-10 ENST00000370616 p.S2714P SCML4 chr6 107772338 107772338 5'UTR G G C TCGA-CZ-5458-01A-01D-1501-10 ENST00000369020 NT5C3A chr7 33015696 33015696 Silent G G A TCGA-CZ-5458-01A-01D-1501-10 ENST00000242210 p.L295L UBE3C chr7 157225456 157225456 Missense_Mutation G G A TCGA-CZ-5458-01A-01D-1501-10 ENST00000348165 p.G717D NKAIN3 chr8 62918502 62918502 Missense_Mutation A A T TCGA-CZ-5458-01A-01D-1501-10 ENST00000523211 p.E174V PKHD1L1 chr8 109459725 109459725 Missense_Mutation T T C TCGA-CZ-5458-01A-01D-1501-10 ENST00000378402 p.F2379L CTSL3P chr9 87772968 87772968 RNA C C A TCGA-CZ-5458-01A-01D-1501-10 ENST00000412179 GPHA2 chr11 64934697 64934697 3'UTR G G - TCGA-CZ-5458-01A-01D-1501-10 ENST00000279168 KAT5 chr11 65713060 65713060 Splice_Site T T G TCGA-CZ-5458-01A-01D-1501-10 ENST00000377046 p.X95_splice CFL1 chr11 65855392 65855392 Frame_Shift_Del G G - TCGA-CZ-5458-01A-01D-1501-10 ENST00000308162 p.L149Wfs*81 GLB1L2 chr11 134375061 134375061 3'UTR G G T TCGA-CZ-5458-01A-01D-1501-10 ENST00000339772 RDH16 chr12 56952197 56952197 Silent C C T TCGA-CZ-5458-01A-01D-1501-10 ENST00000398138 p.S262S P2RX2 chr12 132621268 132621268 Missense_Mutation T T C TCGA-CZ-5458-01A-01D-1501-10 ENST00000389110 p.Y307H MTUS2 chr13 29497298 29497298 Missense_Mutation G G C TCGA-CZ-5458-01A-01D-1501-10 ENST00000612955 p.E1224Q ARPP19 chr15 52552027 52552027 Silent C C T TCGA-CZ-5458-01A-01D-1501-10 ENST00000249822 p.P82P RAB11FIP3 chr16 482561 482561 Missense_Mutation G G A TCGA-CZ-5458-01A-01D-1501-10 ENST00000262305 p.E314K CNOT1 chr16 58530307 58530307 Missense_Mutation T T C TCGA-CZ-5458-01A-01D-1501-10 ENST00000317147 p.K2073R SPATA33 chr16 89658337 89658337 Missense_Mutation G G C TCGA-CZ-5458-01A-01D-1501-10 ENST00000301031 p.D42H KRT23 chr17 40922859 40922859 3'UTR A A - TCGA-CZ-5458-01A-01D-1501-10 ENST00000209718 MARCH10 chr17 62735986 62735986 Nonsense_Mutation T T A TCGA-CZ-5458-01A-01D-1501-10 ENST00000311269 p.K628* GALR1 chr18 77250891 77250891 Missense_Mutation T T C TCGA-CZ-5458-01A-01D-1501-10 ENST00000299727 p.F115L MAGT1 chrX 77895372 77895372 Silent G G T TCGA-CZ-5458-01A-01D-1501-10 ENST00000618282 p.T13T INPP5B chr1 37878241 37878241 Missense_Mutation T T C TCGA-BP-5186-01A-01D-1429-08 ENST00000373023 p.M622V PRG4 chr1 186309841 186309841 Nonsense_Mutation T T A TCGA-BP-5186-01A-01D-1429-08 ENST00000445192 p.L1157* CACNA1S chr1 201048643 201048643 Silent T T A TCGA-BP-5186-01A-01D-1429-08 ENST00000362061 p.T1460T PLEKHH2 chr2 43707543 43707543 Missense_Mutation G G A TCGA-BP-5186-01A-01D-1429-08 ENST00000282406 p.R655Q VHL chr3 10146636 10146640 Splice_Site GGTAC GGTAC - TCGA-BP-5186-01A-01D-1429-08 ENST00000256474 p.X155_splice PBRM1 chr3 52576627 52576627 Missense_Mutation G G T TCGA-BP-5186-01A-01D-1429-08 ENST00000296302 p.T1202K ADAMTS9 chr3 64633772 64633772 Missense_Mutation G G T TCGA-BP-5186-01A-01D-1429-08 ENST00000498707 p.A655D SPARCL1 chr4 87473786 87473786 Missense_Mutation G G C TCGA-BP-5186-01A-01D-1429-08 ENST00000282470 p.L662V GRID2 chr4 93772262 93772262 Missense_Mutation A A T TCGA-BP-5186-01A-01D-1429-08 ENST00000282020 p.T930S COL11A2 chr6 33188378 33188378 Frame_Shift_Del T T - TCGA-BP-5186-01A-01D-1429-08 ENST00000374708 p.D197Vfs*99 SSPO chr7 149789329 149789329 Missense_Mutation C C G TCGA-BP-5186-01A-01D-1429-08 ENST00000378016 p.L1466V PIWIL2 chr8 22309967 22309967 Missense_Mutation G G A TCGA-BP-5186-01A-01D-1429-08 ENST00000356766 p.G565R IKBKAP chr9 108896956 108896956 Nonsense_Mutation G G A TCGA-BP-5186-01A-01D-1429-08 ENST00000374647 p.Q862* ZFP37 chr9 113056595 113056595 Missense_Mutation G G T TCGA-BP-5186-01A-01D-1429-08 ENST00000374227 p.L32M NMT2 chr10 15109771 15109771 Missense_Mutation A A T TCGA-BP-5186-01A-01D-1429-08 ENST00000378165 p.F469L TSPAN32 chr11 2302134 2302134 5'UTR G G C TCGA-BP-5186-01A-01D-1429-08 ENST00000182290 MALAT1 chr11 65498832 65498834 3'Flank TTC TTC - TCGA-BP-5186-01A-01D-1429-08 ENST00000625158 KDM4D chr11 94998821 94998821 Silent T T A TCGA-BP-5186-01A-01D-1429-08 ENST00000335080 p.A483A ST14 chr11 130196682 130196682 Missense_Mutation T T A TCGA-BP-5186-01A-01D-1429-08 ENST00000278742 p.S446T MAP1LC3B2 chr12 116575873 116575873 5'UTR C C T TCGA-BP-5186-01A-01D-1429-08 ENST00000556529 FZD10 chr12 130163601 130163601 Missense_Mutation G G A TCGA-BP-5186-01A-01D-1429-08 ENST00000229030 p.S220N CSNK1A1L chr13 37104510 37104510 Silent A A G TCGA-BP-5186-01A-01D-1429-08 ENST00000379800 p.C249C DACT1 chr14 58646671 58646671 Missense_Mutation C C A TCGA-BP-5186-01A-01D-1429-08 ENST00000335867 p.A683D ACACA chr17 37188460 37188460 Missense_Mutation G G T TCGA-BP-5186-01A-01D-1429-08 ENST00000616317 p.S1531R TBC1D3P2 chr17 62271019 62271025 Splice_Region TTCATGA TTCATGA - TCGA-BP-5186-01A-01D-1429-08 ENST00000581291 ATG4D chr19 10553045 10553045 Missense_Mutation C C A TCGA-BP-5186-01A-01D-1429-08 ENST00000309469 p.S468Y FCGBP chr19 39914246 39914246 Silent G G C TCGA-BP-5186-01A-01D-1429-08 ENST00000616721 p.V947V CLPTM1 chr19 44962063 44962063 Missense_Mutation G G A TCGA-BP-5186-01A-01D-1429-08 ENST00000337392 p.G58D SLC1A5 chr19 46782390 46782390 Missense_Mutation T T C TCGA-BP-5186-01A-01D-1429-08 ENST00000542575 p.I273V CACNG6 chr19 53992853 53992853 5'UTR C C A TCGA-BP-5186-01A-01D-1429-08 ENST00000252729 RIN2 chr20 19974824 19974824 Missense_Mutation G G T TCGA-BP-5186-01A-01D-1429-08 ENST00000255006 p.G316W ZMYND8 chr20 47224443 47224443 Missense_Mutation T T C TCGA-BP-5186-01A-01D-1429-08 ENST00000311275 p.K1024E NUP50 chr22 45178837 45178837 Missense_Mutation T T G TCGA-BP-5186-01A-01D-1429-08 ENST00000347635 p.S314A USP51 chrX 55486805 55486805 Nonstop_Mutation T T A TCGA-BP-5186-01A-01D-1429-08 ENST00000500968 p.*712Lext*7 SLC10A3 chrX 154487674 154487674 Missense_Mutation C C G TCGA-BP-5186-01A-01D-1429-08 ENST00000263512 p.V423L UBE4B chr1 10178698 10178700 In_Frame_Del GGG GGG - TCGA-A3-3319-01A-01D-0966-08 ENST00000343090 p.G1194del YARS chr1 32779495 32779495 Missense_Mutation G G C TCGA-A3-3319-01A-01D-0966-08 ENST00000373477 p.L455V SZT2 chr1 43403180 43403180 Missense_Mutation G G A TCGA-A3-3319-01A-01D-0966-08 ENST00000562955 p.E11K CCDC24 chr1 43995970 43995970 Missense_Mutation T T A TCGA-A3-3319-01A-01D-0966-08 ENST00000372318 p.L245H LRRC42 chr1 53962380 53962380 Missense_Mutation A A G TCGA-A3-3319-01A-01D-0966-08 ENST00000319223 p.N300D DNAJB4 chr1 78005242 78005242 Missense_Mutation A A T TCGA-A3-3319-01A-01D-0966-08 ENST00000370763 p.K44N AP4B1 chr1 113895063 113895064 3'UTR TG TG - TCGA-A3-3319-01A-01D-0966-08 ENST00000256658 TARS2 chr1 150487454 150487454 Missense_Mutation G G A TCGA-A3-3319-01A-01D-0966-08 ENST00000369064 p.A2T ASH1L chr1 155480425 155480425 Silent G G C TCGA-A3-3319-01A-01D-0966-08 ENST00000368346 p.V815V BRINP2 chr1 177280785 177280785 Missense_Mutation C C T TCGA-A3-3319-01A-01D-0966-08 ENST00000361539 p.R537W NFASC chr1 204974281 204974281 Missense_Mutation C C T TCGA-A3-3319-01A-01D-0966-08 ENST00000339876 p.T461I OBSCN chr1 228271972 228271972 Intron C C T TCGA-A3-3319-01A-01D-0966-08 ENST00000422127 ALLC chr2 3679944 3679944 Missense_Mutation C C T TCGA-A3-3319-01A-01D-0966-08 ENST00000252505 p.T83M HS1BP3 chr2 20623953 20623953 Missense_Mutation T T A TCGA-A3-3319-01A-01D-0966-08 ENST00000304031 p.E288V AHSA2 chr2 61186466 61186466 Missense_Mutation C C G TCGA-A3-3319-01A-01D-0966-08 ENST00000394457 p.I71M LRRTM1 chr2 80303816 80303816 Missense_Mutation C C G TCGA-A3-3319-01A-01D-0966-08 ENST00000295057 p.D2H CNNM4 chr2 96809463 96809463 Silent T T G TCGA-A3-3319-01A-01D-0966-08 ENST00000377075 p.L758L CNOT11 chr2 101272947 101272947 3'Flank A A G TCGA-A3-3319-01A-01D-0966-08 ENST00000289382 TMEM182 chr2 102764329 102764329 Missense_Mutation C C T TCGA-A3-3319-01A-01D-0966-08 ENST00000412401 p.T78I RAD54L2 chr3 51633689 51633689 Nonsense_Mutation T T A TCGA-A3-3319-01A-01D-0966-08 ENST00000409535 p.L313* ABHD14B chr3 51969877 51969878 Intron GA GA - TCGA-A3-3319-01A-01D-0966-08 ENST00000361143 PCCB chr3 136327637 136327637 Missense_Mutation T T C TCGA-A3-3319-01A-01D-0966-08 ENST00000251654 p.Y435H ARHGEF26 chr3 154255545 154255545 3'UTR T T C TCGA-A3-3319-01A-01D-0966-08 ENST00000356448 TBL1XR1 chr3 177051566 177051566 Missense_Mutation C C T TCGA-A3-3319-01A-01D-0966-08 ENST00000430069 p.G122E CC2D2A chr4 15555126 15555126 Silent C C T TCGA-A3-3319-01A-01D-0966-08 ENST00000424120 p.D847D PCDH7 chr4 30723001 30723001 Missense_Mutation G G T TCGA-A3-3319-01A-01D-0966-08 ENST00000361762 p.D527Y SEC31A chr4 82866952 82866952 Silent T T C TCGA-A3-3319-01A-01D-0966-08 ENST00000355196 p.S351S ANK2 chr4 113292487 113292487 Silent T T C TCGA-A3-3319-01A-01D-0966-08 ENST00000357077 p.H783H ADGRV1 chr5 90783278 90783278 Silent G G A TCGA-A3-3319-01A-01D-0966-08 ENST00000405460 p.G4462G RIOK2 chr5 97167852 97167852 Missense_Mutation C C T TCGA-A3-3319-01A-01D-0966-08 ENST00000283109 p.D338N CHD1 chr5 98892605 98892605 Silent T T C TCGA-A3-3319-01A-01D-0966-08 ENST00000284049 p.K700K ELMO1 chr7 37222622 37222622 Missense_Mutation C C G TCGA-A3-3319-01A-01D-0966-08 ENST00000310758 p.R258T SGK223 chr8 8376451 8376451 Missense_Mutation C C G TCGA-A3-3319-01A-01D-0966-08 ENST00000622241 p.S653T MTFR1 chr8 65707134 65707134 Silent A A G TCGA-A3-3319-01A-01D-0966-08 ENST00000262146 p.R214R SPAG1 chr8 100240566 100240567 Frame_Shift_Del CT CT - TCGA-A3-3319-01A-01D-0966-08 ENST00000251809 p.L816Qfs*6 ACO1 chr9 32433774 32433774 Missense_Mutation T T A TCGA-A3-3319-01A-01D-0966-08 ENST00000309951 p.L633Q UNC13B chr9 35385808 35385808 Missense_Mutation A A T TCGA-A3-3319-01A-01D-0966-08 ENST00000378495 p.M905L TRDMT1 chr10 17153549 17153549 Missense_Mutation G G C TCGA-A3-3319-01A-01D-0966-08 ENST00000377799 p.P345A NDST2 chr10 73803938 73803938 Missense_Mutation T T C TCGA-A3-3319-01A-01D-0966-08 ENST00000299641 p.E641G TMEM180 chr10 102471395 102471395 Missense_Mutation A A G TCGA-A3-3319-01A-01D-0966-08 ENST00000238936 p.Q276R LRP5 chr11 68426099 68426099 Silent C C G TCGA-A3-3319-01A-01D-0966-08 ENST00000294304 p.T1183T PPP6R3 chr11 68587945 68587945 Missense_Mutation A A G TCGA-A3-3319-01A-01D-0966-08 ENST00000393800 p.M551V SERPINH1 chr11 75568982 75568982 Silent C C T TCGA-A3-3319-01A-01D-0966-08 ENST00000358171 p.I255I ERC1 chr12 1190016 1190016 Missense_Mutation A A G TCGA-A3-3319-01A-01D-0966-08 ENST00000360905 p.K772R C1S chr12 7067049 7067049 Missense_Mutation G G A TCGA-A3-3319-01A-01D-0966-08 ENST00000328916 p.G333D SLCO1B3 chr12 20883570 20883570 Silent A A G TCGA-A3-3319-01A-01D-0966-08 ENST00000261196 p.T550T KIAA1551 chr12 31984845 31984845 Missense_Mutation T T G TCGA-A3-3319-01A-01D-0966-08 ENST00000312561 p.L1297W USP15 chr12 62355458 62355458 Missense_Mutation A A C TCGA-A3-3319-01A-01D-0966-08 ENST00000280377 p.M300L SLC15A4 chr12 128800884 128800885 Frame_Shift_Ins - - A TCGA-A3-3319-01A-01D-0966-08 ENST00000266771 p.G462Wfs*65 B3GALTL chr13 31329633 31329633 Missense_Mutation C C A TCGA-A3-3319-01A-01D-0966-08 ENST00000343307 p.Q488K ATP7B chr13 51944171 51944171 Missense_Mutation C C T TCGA-A3-3319-01A-01D-0966-08 ENST00000242839 p.G1061R KLF12 chr13 73845992 73845992 Missense_Mutation G G T TCGA-A3-3319-01A-01D-0966-08 ENST00000377669 p.P169T DIO2 chr14 80202730 80202730 Missense_Mutation T T A TCGA-A3-3319-01A-01D-0966-08 ENST00000438257 p.N261Y MEX3B chr15 82044240 82044240 Missense_Mutation C C A TCGA-A3-3319-01A-01D-0966-08 ENST00000329713 p.M210I ACSM1 chr16 20637185 20637185 Intron G G A TCGA-A3-3319-01A-01D-0966-08 ENST00000307493 SLC5A11 chr16 24858669 24858669 Missense_Mutation A A G TCGA-A3-3319-01A-01D-0966-08 ENST00000347898 p.Q9R CDH11 chr16 65004750 65004750 Silent C C T TCGA-A3-3319-01A-01D-0966-08 ENST00000268603 p.E40E TUBB3 chr16 89935113 89935113 Missense_Mutation C C T TCGA-A3-3319-01A-01D-0966-08 ENST00000315491 p.T221I MYO15A chr17 18158945 18158945 Missense_Mutation C C T TCGA-A3-3319-01A-01D-0966-08 ENST00000205890 p.S3035F SPECC1 chr17 20096741 20096741 Silent C C T TCGA-A3-3319-01A-01D-0966-08 ENST00000261503 p.S30S KSR1 chr17 27609943 27609943 Intron T T C TCGA-A3-3319-01A-01D-0966-08 ENST00000398988 NSRP1 chr17 30117113 30117113 Intron A A G TCGA-A3-3319-01A-01D-0966-08 ENST00000247026 ATAD5 chr17 30834378 30834378 Silent G G T TCGA-A3-3319-01A-01D-0966-08 ENST00000321990 p.T99T SYNRG chr17 37520592 37520592 Frame_Shift_Del A A - TCGA-A3-3319-01A-01D-0966-08 ENST00000612223 p.N1241Kfs*12 SGCA chr17 50166065 50166066 Frame_Shift_Ins - - AA TCGA-A3-3319-01A-01D-0966-08 ENST00000262018 p.P9Qfs*39 GPRC5C chr17 74446934 74446934 Missense_Mutation A A G TCGA-A3-3319-01A-01D-0966-08 ENST00000392627 p.E456G MPND chr19 4352952 4352952 Missense_Mutation A A G TCGA-A3-3319-01A-01D-0966-08 ENST00000262966 p.D196G SMARCA4 chr19 11033434 11033434 Missense_Mutation G G A TCGA-A3-3319-01A-01D-0966-08 ENST00000344626 p.A1231T KIAA0355 chr19 34300595 34300595 Missense_Mutation T T C TCGA-A3-3319-01A-01D-0966-08 ENST00000299505 p.L41P ZNF233 chr19 44266989 44267004 Intron GCGGGGTACAGCCTAG GCGGGGTACAGCCTAG - TCGA-A3-3319-01A-01D-0966-08 ENST00000391958 PTOV1 chr19 49860286 49860286 3'UTR C C T TCGA-A3-3319-01A-01D-0966-08 ENST00000391842 KLK6 chr19 50963434 50963434 Nonsense_Mutation G G A TCGA-A3-3319-01A-01D-0966-08 ENST00000310157 p.Q105* IGLON5 chr19 51325445 51325445 Missense_Mutation T T C TCGA-A3-3319-01A-01D-0966-08 ENST00000270642 p.V164A ZNF175 chr19 51581395 51581395 Missense_Mutation C C T TCGA-A3-3319-01A-01D-0966-08 ENST00000262259 p.S26L DNTTIP1 chr20 45811278 45811278 3'UTR C C G TCGA-A3-3319-01A-01D-0966-08 ENST00000372622 PREX1 chr20 48650008 48650008 Missense_Mutation C C G TCGA-A3-3319-01A-01D-0966-08 ENST00000371941 p.D1006H MOCS3 chr20 50959879 50959879 Missense_Mutation A A T TCGA-A3-3319-01A-01D-0966-08 ENST00000244051 p.D346V TTC3 chr21 37088211 37088217 Frame_Shift_Del GTATATG GTATATG - TCGA-A3-3319-01A-01D-0966-08 ENST00000354749 p.I69Vfs*17 MICAL3 chr22 17885916 17885916 Nonsense_Mutation C C A TCGA-A3-3319-01A-01D-0966-08 ENST00000441493 p.E735* MEI1 chr22 41776234 41776234 Missense_Mutation C C A TCGA-A3-3319-01A-01D-0966-08 ENST00000401548 p.L893M SMC1B chr22 45349767 45349767 Missense_Mutation A A C TCGA-A3-3319-01A-01D-0966-08 ENST00000357450 p.D1152E KLHL4 chrX 87635606 87635606 Frame_Shift_Del T T - TCGA-A3-3319-01A-01D-0966-08 ENST00000373119 p.S586Qfs*37 UBQLN4 chr1 156051789 156051789 Missense_Mutation C C G TCGA-CZ-4864-01A-01D-1501-10 ENST00000368309 p.K59N RAB25 chr1 156070432 156070432 3'UTR C C A TCGA-CZ-4864-01A-01D-1501-10 ENST00000361084 OR6N1 chr1 158766019 158766019 Missense_Mutation T T A TCGA-CZ-4864-01A-01D-1501-10 ENST00000335094 p.I222F AHCTF1 chr1 246889965 246889965 Splice_Site C C A TCGA-CZ-4864-01A-01D-1501-10 ENST00000326225 p.X724_splice PGBD2 chr1 248913823 248913823 5'UTR G G A TCGA-CZ-4864-01A-01D-1501-10 ENST00000329291 GRHL1 chr2 9961053 9961053 Missense_Mutation A A G TCGA-CZ-4864-01A-01D-1501-10 ENST00000324907 p.I96V ARHGAP25 chr2 68775373 68775374 Frame_Shift_Del GC GC - TCGA-CZ-4864-01A-01D-1501-10 ENST00000409202 p.Q73Afs*8 COL3A1 chr2 189004338 189004338 Missense_Mutation G G A TCGA-CZ-4864-01A-01D-1501-10 ENST00000304636 p.G969R UNC80 chr2 209820371 209820371 Missense_Mutation G G A TCGA-CZ-4864-01A-01D-1501-10 ENST00000439458 p.V675M SNED1 chr2 241067770 241067770 Missense_Mutation G G A TCGA-CZ-4864-01A-01D-1501-10 ENST00000310397 p.R1006H GLYCTK chr3 52290493 52290493 Missense_Mutation C C T TCGA-CZ-4864-01A-01D-1501-10 ENST00000436784 p.P51S BAP1 chr3 52408013 52408013 Missense_Mutation T T A TCGA-CZ-4864-01A-01D-1501-10 ENST00000460680 p.D107V PLXNA1 chr3 127022767 127022767 Silent A A T TCGA-CZ-4864-01A-01D-1501-10 ENST00000393409 p.A1437A ARAP2 chr4 36160337 36160341 Intron AAATA AAATA - TCGA-CZ-4864-01A-01D-1501-10 ENST00000303965 ADGRL3 chr4 61587376 61587376 Missense_Mutation G G C TCGA-CZ-4864-01A-01D-1501-10 ENST00000514591 p.D69H ETFDH chr4 158685145 158685145 Missense_Mutation C C T TCGA-CZ-4864-01A-01D-1501-10 ENST00000511912 p.H178Y UBE2QL1 chr5 6491386 6491387 3'UTR CA CA - TCGA-CZ-4864-01A-01D-1501-10 ENST00000399816 TARS chr5 33461975 33461975 Missense_Mutation T T A TCGA-CZ-4864-01A-01D-1501-10 ENST00000265112 p.L567M HMGCS1 chr5 43292938 43292938 Missense_Mutation C C A TCGA-CZ-4864-01A-01D-1501-10 ENST00000325110 p.D407Y CDC42SE2 chr5 131359299 131359299 5'UTR A A C TCGA-CZ-4864-01A-01D-1501-10 ENST00000360515 PAIP2 chr5 139364634 139364634 Missense_Mutation A A G TCGA-CZ-4864-01A-01D-1501-10 ENST00000265192 p.E70G PCDHGA3 chr5 141345143 141345143 Silent C C T TCGA-CZ-4864-01A-01D-1501-10 ENST00000253812 p.D370D SH3TC2 chr5 149010302 149010302 Missense_Mutation G G T TCGA-CZ-4864-01A-01D-1501-10 ENST00000515425 p.R1099S FAF2 chr5 176507026 176507026 3'UTR A A - TCGA-CZ-4864-01A-01D-1501-10 ENST00000261942 HK3 chr5 176882032 176882032 Missense_Mutation C C T TCGA-CZ-4864-01A-01D-1501-10 ENST00000292432 p.A717T NSD1 chr5 177210040 177210040 Silent C C T TCGA-CZ-4864-01A-01D-1501-10 ENST00000439151 p.A547A DPCR1 chr6 30950939 30950940 Intron - - A TCGA-CZ-4864-01A-01D-1501-10 ENST00000304311 PRICKLE4 chr6 41785504 41785504 Silent A A T TCGA-CZ-4864-01A-01D-1501-10 ENST00000359201 p.A142A DST chr6 56642080 56642080 Missense_Mutation C C T TCGA-CZ-4864-01A-01D-1501-10 ENST00000312431 p.G461R GABRR1 chr6 89178763 89178763 3'UTR C C A TCGA-CZ-4864-01A-01D-1501-10 ENST00000454853 FABP7 chr6 122781238 122781238 Intron C C A TCGA-CZ-4864-01A-01D-1501-10 ENST00000368444 PPIL4 chr6 149505307 149505307 3'UTR A A C TCGA-CZ-4864-01A-01D-1501-10 ENST00000253329 TMEM130 chr7 98855264 98855264 Missense_Mutation G G A TCGA-CZ-4864-01A-01D-1501-10 ENST00000416379 p.T260I ZKSCAN5 chr7 99506040 99506040 5'UTR T T C TCGA-CZ-4864-01A-01D-1501-10 ENST00000326775 SPDYE3 chr7 100321042 100321042 3'UTR G G A TCGA-CZ-4864-01A-01D-1501-10 ENST00000332397 PLXNA4 chr7 132484991 132484991 Intron C C A TCGA-CZ-4864-01A-01D-1501-10 ENST00000321063 WEE2 chr7 141708827 141708827 Missense_Mutation G G C TCGA-CZ-4864-01A-01D-1501-10 ENST00000397541 p.E23D MSRA chr8 10428165 10428165 Silent C C G TCGA-CZ-4864-01A-01D-1501-10 ENST00000317173 p.G187G STMN4 chr8 27241174 27241174 Silent G G A TCGA-CZ-4864-01A-01D-1501-10 ENST00000265770 p.V66V SLA chr8 133038408 133038408 3'UTR G G - TCGA-CZ-4864-01A-01D-1501-10 ENST00000338087 EPPK1 chr8 143868021 143868021 Missense_Mutation G G A TCGA-CZ-4864-01A-01D-1501-10 ENST00000615648 p.R1745C IL33 chr9 6256104 6256104 Missense_Mutation T T C TCGA-CZ-4864-01A-01D-1501-10 ENST00000381434 p.I250T RGS3 chr9 113508550 113508550 Missense_Mutation C C T TCGA-CZ-4864-01A-01D-1501-10 ENST00000350696 p.P483S KCNT1 chr9 135775341 135775341 Missense_Mutation T T C TCGA-CZ-4864-01A-01D-1501-10 ENST00000488444 p.Y740H GDI2 chr10 5765983 5765983 3'UTR T T - TCGA-CZ-4864-01A-01D-1501-10 ENST00000380191 PARG chr10 49869541 49869541 Missense_Mutation C C T TCGA-CZ-4864-01A-01D-1501-10 ENST00000402038 p.R668H CCAR1 chr10 68747536 68747555 Frame_Shift_Del CAGCCCTTATTACAGCAGCC CAGCCCTTATTACAGCAGCC - TCGA-CZ-4864-01A-01D-1501-10 ENST00000265872 p.Q266Sfs*34 CCAR1 chr10 68747556 68747556 Silent T T A TCGA-CZ-4864-01A-01D-1501-10 ENST00000265872 p.P272P LIPF chr10 88675590 88675590 Missense_Mutation G G A TCGA-CZ-4864-01A-01D-1501-10 ENST00000238983 p.R274H HOGA1 chr10 97599605 97599605 Intron G G T TCGA-CZ-4864-01A-01D-1501-10 ENST00000370646 INPP5F chr10 119797483 119797483 Silent A A T TCGA-CZ-4864-01A-01D-1501-10 ENST00000361976 p.G297G TEX36 chr10 125655923 125655923 Frame_Shift_Del C C - TCGA-CZ-4864-01A-01D-1501-10 ENST00000368821 p.V180Lfs*27 CD81 chr11 2397380 2397380 3'UTR G G - TCGA-CZ-4864-01A-01D-1501-10 ENST00000263645 OR52E4 chr11 5884643 5884643 Silent G G A TCGA-CZ-4864-01A-01D-1501-10 ENST00000316987 p.L117L SBF2 chr11 9962012 9962012 Missense_Mutation A A G TCGA-CZ-4864-01A-01D-1501-10 ENST00000256190 p.I602T SLC5A12 chr11 26698403 26698403 Splice_Region T T C TCGA-CZ-4864-01A-01D-1501-10 ENST00000396005 EXT2 chr11 44206872 44206872 Silent T T A TCGA-CZ-4864-01A-01D-1501-10 ENST00000343631 p.P525P PTPRJ chr11 48121225 48121225 Missense_Mutation A A G TCGA-CZ-4864-01A-01D-1501-10 ENST00000418331 p.N192S OR4C11 chr11 55604181 55604181 Missense_Mutation A A C TCGA-CZ-4864-01A-01D-1501-10 ENST00000302231 p.S65A SLC22A8 chr11 62993802 62993802 Silent G G C TCGA-CZ-4864-01A-01D-1501-10 ENST00000336232 p.L431L RTN3 chr11 63720255 63720255 Missense_Mutation G G C TCGA-CZ-4864-01A-01D-1501-10 ENST00000377819 p.V585L FOLH1B chr11 89698636 89698636 RNA G G T TCGA-CZ-4864-01A-01D-1501-10 ENST00000525540 DYNC2H1 chr11 103304614 103304614 Missense_Mutation A A G TCGA-CZ-4864-01A-01D-1501-10 ENST00000375735 p.Q3759R SNX19 chr11 130914814 130914814 Missense_Mutation G G C TCGA-CZ-4864-01A-01D-1501-10 ENST00000265909 p.P376A USP5 chr12 6858536 6858536 Missense_Mutation C C A TCGA-CZ-4864-01A-01D-1501-10 ENST00000229268 p.T326K MTUS2 chr13 29026787 29026787 Missense_Mutation G G A TCGA-CZ-4864-01A-01D-1501-10 ENST00000612955 p.E707K UBAC2 chr13 99244528 99244528 Missense_Mutation G G A TCGA-CZ-4864-01A-01D-1501-10 ENST00000403766 p.G98D THBS1 chr15 39588583 39588583 Missense_Mutation G G T TCGA-CZ-4864-01A-01D-1501-10 ENST00000260356 p.G510V NUSAP1 chr15 41333004 41333004 Missense_Mutation A A C TCGA-CZ-4864-01A-01D-1501-10 ENST00000559596 p.D16A MAP1A chr15 43523557 43523557 Missense_Mutation G G C TCGA-CZ-4864-01A-01D-1501-10 ENST00000300231 p.S695T UNC13C chr15 54533020 54533020 Missense_Mutation G G C TCGA-CZ-4864-01A-01D-1501-10 ENST00000260323 p.D1884H IDH3A chr15 78163701 78163715 Splice_Site ATGTATTCCTTGTAG ATGTATTCCTTGTAG - TCGA-CZ-4864-01A-01D-1501-10 ENST00000299518 p.X239_splice IGSF6 chr16 21641335 21641335 3'UTR G G T TCGA-CZ-4864-01A-01D-1501-10 ENST00000268389 SCNN1B chr16 23352946 23352946 Frame_Shift_Del A A - TCGA-CZ-4864-01A-01D-1501-10 ENST00000343070 p.I153Lfs*22 PRMT7 chr16 68339564 68339564 Splice_Site G G A TCGA-CZ-4864-01A-01D-1501-10 ENST00000339507 p.X249_splice SF3B3 chr16 70541700 70541701 Frame_Shift_Ins - - AT TCGA-CZ-4864-01A-01D-1501-10 ENST00000302516 p.D368Mfs*46 MINK1 chr17 4897247 4897247 Missense_Mutation A A C TCGA-CZ-4864-01A-01D-1501-10 ENST00000355280 p.Y1320S TBX21 chr17 47744316 47744316 Missense_Mutation C C T TCGA-CZ-4864-01A-01D-1501-10 ENST00000177694 p.T297I BCAS3 chr17 61084474 61084474 Missense_Mutation C C G TCGA-CZ-4864-01A-01D-1501-10 ENST00000390652 p.P794A EVPL chr17 76012036 76012036 Silent G G A TCGA-CZ-4864-01A-01D-1501-10 ENST00000301607 p.H809H CBX2 chr17 79784360 79784360 Missense_Mutation G G T TCGA-CZ-4864-01A-01D-1501-10 ENST00000310942 p.S306I GNA11 chr19 3121191 3121191 3'UTR C C A TCGA-CZ-4864-01A-01D-1501-10 ENST00000078429 STAP2 chr19 4333795 4333795 Missense_Mutation C C T TCGA-CZ-4864-01A-01D-1501-10 ENST00000594605 p.G66R CATSPERD chr19 5720781 5720781 Missense_Mutation G G T TCGA-CZ-4864-01A-01D-1501-10 ENST00000381624 p.R15L DDX39A chr19 14411056 14411056 Missense_Mutation C C G TCGA-CZ-4864-01A-01D-1501-10 ENST00000242776 p.R182S PDCD5 chr19 32585839 32585839 Missense_Mutation C C A TCGA-CZ-4864-01A-01D-1501-10 ENST00000590247 p.P64T KLK6 chr19 50963348 50963348 Silent G G A TCGA-CZ-4864-01A-01D-1501-10 ENST00000310157 p.A133A MKKS chr20 10413094 10413094 Missense_Mutation G G T TCGA-CZ-4864-01A-01D-1501-10 ENST00000347364 p.P141T SUN5 chr20 33004304 33004304 Missense_Mutation C C T TCGA-CZ-4864-01A-01D-1501-10 ENST00000356173 p.A13T TPD52L2 chr20 63873734 63873734 Frame_Shift_Del A A - TCGA-CZ-4864-01A-01D-1501-10 ENST00000346249 p.K78Rfs*12 DYRK1A chr21 37505378 37505378 Silent G G A TCGA-CZ-4864-01A-01D-1501-10 ENST00000398960 p.T445T KRTAP10-11 chr21 44646491 44646491 Silent C C T TCGA-CZ-4864-01A-01D-1501-10 ENST00000334670 p.S11S MICAL3 chr22 17864804 17864804 Intron A A C TCGA-CZ-4864-01A-01D-1501-10 ENST00000441493 CSF2RB chr22 36930749 36930749 Missense_Mutation C C T TCGA-CZ-4864-01A-01D-1501-10 ENST00000403662 p.P311S SMC1B chr22 45389875 45389875 Missense_Mutation C C A TCGA-CZ-4864-01A-01D-1501-10 ENST00000357450 p.C523F CUL4B chrX 120536948 120536948 Missense_Mutation C C A TCGA-CZ-4864-01A-01D-1501-10 ENST00000404115 p.M693I C1QB chr1 22659477 22659477 Missense_Mutation G G T TCGA-B8-A54I-01A-21D-A33K-10 ENST00000314933 p.W7C CHI3L2 chr1 111230743 111230743 Splice_Region A A T TCGA-B8-A54I-01A-21D-A33K-10 ENST00000369748 p.G24G TTC24 chr1 156582362 156582362 Missense_Mutation G G A TCGA-B8-A54I-01A-21D-A33K-10 ENST00000368236 p.G280R TIMM17A chr1 201957371 201957371 Missense_Mutation T T G TCGA-B8-A54I-01A-21D-A33K-10 ENST00000367287 p.N39K LBR chr1 225419434 225419434 Missense_Mutation G G T TCGA-B8-A54I-01A-21D-A33K-10 ENST00000272163 p.Q157K HEATR5B chr2 36988693 36988693 Missense_Mutation C C T TCGA-B8-A54I-01A-21D-A33K-10 ENST00000233099 p.G1955E ACOXL chr2 111117713 111117713 Missense_Mutation T T C TCGA-B8-A54I-01A-21D-A33K-10 ENST00000439055 p.I547T KIF5C chr2 148949933 148949933 Missense_Mutation C C T TCGA-B8-A54I-01A-21D-A33K-10 ENST00000435030 p.A270V GPD2 chr2 156579749 156579749 Missense_Mutation G G T TCGA-B8-A54I-01A-21D-A33K-10 ENST00000310454 p.L673F LRP2 chr2 169289052 169289052 Missense_Mutation T T A TCGA-B8-A54I-01A-21D-A33K-10 ENST00000263816 p.N339I LARS2 chr3 45394673 45394673 Missense_Mutation A A T TCGA-B8-A54I-01A-21D-A33K-10 ENST00000265537 p.I74F CD200R1 chr3 112925168 112925168 Frame_Shift_Del T T - TCGA-B8-A54I-01A-21D-A33K-10 ENST00000471858 p.K242Nfs*14 CASR chr3 122262323 122262323 Missense_Mutation G G A TCGA-B8-A54I-01A-21D-A33K-10 ENST00000490131 p.A430T PLXNA1 chr3 126989641 126989641 Nonsense_Mutation A A T TCGA-B8-A54I-01A-21D-A33K-10 ENST00000393409 p.K350* SDHAP1 chr3 195975824 195975824 RNA G G A TCGA-B8-A54I-01A-21D-A33K-10 ENST00000427841 ADGRA3 chr4 22388123 22388123 Missense_Mutation C C A TCGA-B8-A54I-01A-21D-A33K-10 ENST00000334304 p.R1183L NADK2 chr5 36207202 36207202 Silent G G A TCGA-B8-A54I-01A-21D-A33K-10 ENST00000381937 p.L308L RNF180 chr5 64369878 64369878 3'UTR T T G TCGA-B8-A54I-01A-21D-A33K-10 ENST00000389100 MEGF10 chr5 127438518 127438518 Missense_Mutation T T A TCGA-B8-A54I-01A-21D-A33K-10 ENST00000274473 p.D728E PCDHA9 chr5 140848441 140848441 5'UTR T T G TCGA-B8-A54I-01A-21D-A33K-10 ENST00000532602 PCDHGB3 chr5 141371017 141371017 Missense_Mutation A A G TCGA-B8-A54I-01A-21D-A33K-10 ENST00000576222 p.H208R TRA2A chr7 23505501 23505501 3'UTR A A - TCGA-B8-A54I-01A-21D-A33K-10 ENST00000297071 FLNC chr7 128852846 128852846 Missense_Mutation A A G TCGA-B8-A54I-01A-21D-A33K-10 ENST00000325888 p.K2008R CPA2 chr7 130273175 130273175 Missense_Mutation A A C TCGA-B8-A54I-01A-21D-A33K-10 ENST00000222481 p.K162Q RBM33 chr7 155700835 155700835 Missense_Mutation A A T TCGA-B8-A54I-01A-21D-A33K-10 ENST00000401878 p.E210D SLCO5A1 chr8 69832485 69832485 Silent A A G TCGA-B8-A54I-01A-21D-A33K-10 ENST00000260126 p.C63C CHMP5 chr9 33271177 33271177 Missense_Mutation A A C TCGA-B8-A54I-01A-21D-A33K-10 ENST00000223500 p.K114T OLFML2A chr9 124810067 124810067 Silent C C T TCGA-B8-A54I-01A-21D-A33K-10 ENST00000373580 p.D538D PHYH chr10 13288408 13288408 Silent T T C TCGA-B8-A54I-01A-21D-A33K-10 ENST00000263038 p.P210P RP11-38L15.8 chr10 46634989 46634989 RNA A A T TCGA-B8-A54I-01A-21D-A33K-10 ENST00000605984 IGSF22 chr11 18716937 18716937 Missense_Mutation A A T TCGA-B8-A54I-01A-21D-A33K-10 ENST00000319338 p.V346E ANO5 chr11 22276122 22276122 Missense_Mutation G G A TCGA-B8-A54I-01A-21D-A33K-10 ENST00000324559 p.D815N VWCE chr11 61280988 61280988 Silent C C T TCGA-B8-A54I-01A-21D-A33K-10 ENST00000335613 p.V345V SPTBN2 chr11 66690236 66690236 Silent A A T TCGA-B8-A54I-01A-21D-A33K-10 ENST00000309996 p.A1871A VWF chr12 5976151 5976151 Missense_Mutation G G C TCGA-B8-A54I-01A-21D-A33K-10 ENST00000261405 p.A2466G DDX11 chr12 31103938 31103938 Missense_Mutation G G C TCGA-B8-A54I-01A-21D-A33K-10 ENST00000545668 p.V940L SLC8B1 chr12 113316957 113316957 Missense_Mutation T T C TCGA-B8-A54I-01A-21D-A33K-10 ENST00000202831 p.N283D RFC5 chr12 118025766 118025766 Frame_Shift_Del G G - TCGA-B8-A54I-01A-21D-A33K-10 ENST00000454402 p.G201Efs*2 MPHOSPH9 chr12 123221768 123221768 Missense_Mutation C C G TCGA-B8-A54I-01A-21D-A33K-10 ENST00000606320 p.S159T SSTR1 chr14 38210835 38210835 3'UTR T T A TCGA-B8-A54I-01A-21D-A33K-10 ENST00000267377 DDX24 chr14 94079108 94079108 Missense_Mutation A A T TCGA-B8-A54I-01A-21D-A33K-10 ENST00000621632 p.F212Y NPAP1 chr15 24680585 24680586 3'UTR AG AG - TCGA-B8-A54I-01A-21D-A33K-10 ENST00000329468 USP8 chr15 50492897 50492897 Missense_Mutation C C A TCGA-B8-A54I-01A-21D-A33K-10 ENST00000307179 p.Q811K ZNF18 chr17 11992625 11992625 Missense_Mutation A A C TCGA-B8-A54I-01A-21D-A33K-10 ENST00000322748 p.W69G TOM1L2 chr17 17884717 17884717 Frame_Shift_Del T T - TCGA-B8-A54I-01A-21D-A33K-10 ENST00000379504 p.I140Yfs*5 POLDIP2 chr17 28353733 28353736 Frame_Shift_Del AGTA AGTA - TCGA-B8-A54I-01A-21D-A33K-10 ENST00000540200 p.Y133Ifs*4 WNT9B chr17 46876375 46876375 Missense_Mutation C C T TCGA-B8-A54I-01A-21D-A33K-10 ENST00000290015 p.S244L C17orf70 chr17 81547179 81547179 Nonsense_Mutation G G A TCGA-B8-A54I-01A-21D-A33K-10 ENST00000327787 p.Q635* C17orf70 chr17 81547180 81547180 Silent C C T TCGA-B8-A54I-01A-21D-A33K-10 ENST00000327787 p.E634E RTTN chr18 70020645 70020645 Missense_Mutation C C G TCGA-B8-A54I-01A-21D-A33K-10 ENST00000255674 p.L2041F KANK2 chr19 11173012 11173012 Missense_Mutation C C T TCGA-B8-A54I-01A-21D-A33K-10 ENST00000586659 p.R727Q RASAL3 chr19 15461072 15461072 Silent G G A TCGA-B8-A54I-01A-21D-A33K-10 ENST00000343625 p.V198V C19orf44 chr19 16501372 16501372 Missense_Mutation A A T TCGA-B8-A54I-01A-21D-A33K-10 ENST00000221671 p.R194W SUGP1 chr19 19297042 19297042 Missense_Mutation G G A TCGA-B8-A54I-01A-21D-A33K-10 ENST00000247001 p.P397L LILRA4 chr19 54333652 54333652 Missense_Mutation G G C TCGA-B8-A54I-01A-21D-A33K-10 ENST00000291759 p.P474A ZNF343 chr20 2484016 2484016 Missense_Mutation G G C TCGA-B8-A54I-01A-21D-A33K-10 ENST00000278772 p.H315Q RRBP1 chr20 17627543 17627543 Silent C C A TCGA-B8-A54I-01A-21D-A33K-10 ENST00000377807 p.L530L RRBP1 chr20 17627544 17627544 Missense_Mutation A A T TCGA-B8-A54I-01A-21D-A33K-10 ENST00000377807 p.L530Q CHRNA4 chr20 63350347 63350347 Missense_Mutation A A T TCGA-B8-A54I-01A-21D-A33K-10 ENST00000370263 p.L355Q SEPT5 chr22 19719880 19719881 Frame_Shift_Ins - - T TCGA-B8-A54I-01A-21D-A33K-10 ENST00000455784 p.S77Qfs*3 TOM1 chr22 35323110 35323110 Frame_Shift_Del T T - TCGA-B8-A54I-01A-21D-A33K-10 ENST00000449058 p.V100Gfs*35 APOL6 chr22 35658779 35658779 Missense_Mutation A A G TCGA-B8-A54I-01A-21D-A33K-10 ENST00000409652 p.K72R ADGRG4 chrX 136405922 136405922 Missense_Mutation C C T TCGA-B8-A54I-01A-21D-A33K-10 ENST00000370652 p.P2962L CLSTN1 chr1 9744532 9744532 Missense_Mutation T T C TCGA-BP-4795-01A-02D-1421-08 ENST00000377298 p.N366S KCNN3 chr1 154869536 154869536 Silent G G A TCGA-BP-4795-01A-02D-1421-08 ENST00000618040 p.S143S STON1-GTF2A1L chr2 48669943 48669943 Silent T T C TCGA-BP-4795-01A-02D-1421-08 ENST00000394754 p.S1104S TEKT4 chr2 94873576 94873576 Silent A A G TCGA-BP-4795-01A-02D-1421-08 ENST00000295201 p.A185A KCNH7 chr2 162400400 162400400 Silent A A G TCGA-BP-4795-01A-02D-1421-08 ENST00000332142 p.C732C SLC4A7 chr3 27404962 27404962 Missense_Mutation C C T TCGA-BP-4795-01A-02D-1421-08 ENST00000295736 p.S639N BVES chr6 105101088 105101088 3'UTR A A T TCGA-BP-4795-01A-02D-1421-08 ENST00000314641 CREB5 chr7 28809277 28809277 Missense_Mutation G G A TCGA-BP-4795-01A-02D-1421-08 ENST00000357727 p.D373N CCDC129 chr7 31578123 31578123 Missense_Mutation T T C TCGA-BP-4795-01A-02D-1421-08 ENST00000407970 p.F287L GRM8 chr7 126904027 126904027 Missense_Mutation T T A TCGA-BP-4795-01A-02D-1421-08 ENST00000339582 p.Q321H SLC13A4 chr7 135706246 135706246 Silent G G A TCGA-BP-4795-01A-02D-1421-08 ENST00000354042 p.N140N TTI2 chr8 33513571 33513571 5'Flank G G A TCGA-BP-4795-01A-02D-1421-08 ENST00000360742 PDGFD chr11 104163817 104163817 Missense_Mutation G G T TCGA-BP-4795-01A-02D-1421-08 ENST00000393158 p.N37K PPP2R1B chr11 111766404 111766404 5'UTR G G A TCGA-BP-4795-01A-02D-1421-08 ENST00000527614 DCAF11 chr14 24121421 24121421 Missense_Mutation G G A TCGA-BP-4795-01A-02D-1421-08 ENST00000446197 p.G435R AKAP6 chr14 32546486 32546486 Silent A A T TCGA-BP-4795-01A-02D-1421-08 ENST00000280979 p.P611P RP11-407N17.3 chr14 39350175 39350175 Missense_Mutation T T A TCGA-BP-4795-01A-02D-1421-08 ENST00000553728 p.S1311T EML5 chr14 88687232 88687232 Silent C C T TCGA-BP-4795-01A-02D-1421-08 ENST00000380664 p.L946L SNORD108 chr15 24986974 24986974 RNA C C G TCGA-BP-4795-01A-02D-1421-08 ENST00000459332 LRRC49 chr15 70984173 70984173 Missense_Mutation A A C TCGA-BP-4795-01A-02D-1421-08 ENST00000260382 p.N362T TBC1D3B chr17 36171927 36171927 Missense_Mutation A A T TCGA-BP-4795-01A-02D-1421-08 ENST00000611257 p.I142N NAGLU chr17 42538709 42538709 Missense_Mutation C C T TCGA-BP-4795-01A-02D-1421-08 ENST00000225927 p.P240S KIAA1468 chr18 62228512 62228512 Silent A A G TCGA-BP-4795-01A-02D-1421-08 ENST00000398130 p.P454P LMNB2 chr19 2438510 2438510 Silent C C T TCGA-BP-4795-01A-02D-1421-08 ENST00000325327 p.E141E PTPRH chr19 55205463 55205463 Missense_Mutation C C T TCGA-BP-4795-01A-02D-1421-08 ENST00000376350 p.G161D FBXO44 chr1 11658312 11658312 Missense_Mutation G G T TCGA-DV-5573-01A-01D-1534-10 ENST00000251547 p.W104L PTPRF chr1 43617490 43617490 Missense_Mutation G G A TCGA-DV-5573-01A-01D-1534-10 ENST00000359947 p.E1373K ADGRL2 chr1 81970446 81970446 Missense_Mutation T T A TCGA-DV-5573-01A-01D-1534-10 ENST00000370717 p.Y952N ZNF678 chr1 227563706 227563706 5'UTR C C A TCGA-DV-5573-01A-01D-1534-10 ENST00000343776 LYST chr1 235773984 235773984 Missense_Mutation A A T TCGA-DV-5573-01A-01D-1534-10 ENST00000389793 p.L1881H SNX17 chr2 27371358 27371358 Intron C C A TCGA-DV-5573-01A-01D-1534-10 ENST00000233575 XDH chr2 31342227 31342227 Missense_Mutation C C T TCGA-DV-5573-01A-01D-1534-10 ENST00000379416 p.A1159T ZNF638 chr2 71349652 71349652 Missense_Mutation T T C TCGA-DV-5573-01A-01D-1534-10 ENST00000264447 p.I233T BIN1 chr2 127053962 127053962 Silent G G A TCGA-DV-5573-01A-01D-1534-10 ENST00000316724 p.D394D ZEB2 chr2 144517280 144517280 Missense_Mutation T T G TCGA-DV-5573-01A-01D-1534-10 ENST00000409487 p.N24T NEB chr2 151498322 151498322 Intron T T - TCGA-DV-5573-01A-01D-1534-10 ENST00000172853 HPS3 chr3 149157399 149157399 Missense_Mutation A A G TCGA-DV-5573-01A-01D-1534-10 ENST00000296051 p.H520R FAM135A chr6 70482016 70482016 Missense_Mutation A A G TCGA-DV-5573-01A-01D-1534-10 ENST00000370479 p.I229V PILRB chr7 100353615 100353615 Intron C C T TCGA-DV-5573-01A-01D-1534-10 ENST00000452089 CBLL1 chr7 107758800 107758800 Silent C C T TCGA-DV-5573-01A-01D-1534-10 ENST00000440859 p.H366H SLC35G5 chr8 11332187 11332187 3'UTR A A - TCGA-DV-5573-01A-01D-1534-10 ENST00000382435 BNC2 chr9 16436485 16436485 Missense_Mutation G G A TCGA-DV-5573-01A-01D-1534-10 ENST00000380672 p.P570L RALGPS1 chr9 126977733 126977733 Silent T T C TCGA-DV-5573-01A-01D-1534-10 ENST00000259351 p.A68A CD163 chr12 7487404 7487404 Missense_Mutation C C T TCGA-DV-5573-01A-01D-1534-10 ENST00000359156 p.A669T DTX3 chr12 57606958 57606958 Missense_Mutation A A G TCGA-DV-5573-01A-01D-1534-10 ENST00000337737 p.E32G HELB chr12 66309976 66309976 Missense_Mutation T T C TCGA-DV-5573-01A-01D-1534-10 ENST00000247815 p.C350R ZBTB1 chr14 64521596 64521596 Missense_Mutation A A C TCGA-DV-5573-01A-01D-1534-10 ENST00000554015 p.D31A RP11-32B5.8 chr15 21373017 21373017 3'Flank G G A TCGA-DV-5573-01A-01D-1534-10 ENST00000594169 NLGN2 chr17 7415796 7415796 Silent G G A TCGA-DV-5573-01A-01D-1534-10 ENST00000302926 p.R441R RAB27B chr18 54884364 54884364 Missense_Mutation G G A TCGA-DV-5573-01A-01D-1534-10 ENST00000262094 p.D91N INSR chr19 7120654 7120654 Missense_Mutation T T C TCGA-DV-5573-01A-01D-1534-10 ENST00000302850 p.K1209E ZNF730 chr19 23145874 23145874 Missense_Mutation T T A TCGA-DV-5573-01A-01D-1534-10 ENST00000597761 p.I277N PIGU chr20 34645303 34645303 Missense_Mutation A A G TCGA-DV-5573-01A-01D-1534-10 ENST00000217446 p.L76P GRIK1 chr21 29939491 29939491 Missense_Mutation C C T TCGA-DV-5573-01A-01D-1534-10 ENST00000399907 p.G4S LGALS2 chr22 37570310 37570310 Missense_Mutation T T C TCGA-DV-5573-01A-01D-1534-10 ENST00000215886 p.S118G TRIOBP chr22 37725894 37725900 Frame_Shift_Del GTATTGG GTATTGG - TCGA-DV-5573-01A-01D-1534-10 ENST00000406386 p.I1114Tfs*97 ZNF81 chrX 47846301 47846301 Missense_Mutation G G C TCGA-DV-5573-01A-01D-1534-10 ENST00000338637 p.E12Q MACF1 chr1 39315514 39315522 In_Frame_Del ACACCCAGG ACACCCAGG - TCGA-BP-4975-01A-01D-1462-08 ENST00000372915 p.H1096_E1099delinsQ CHIA chr1 111318016 111318016 Silent C C T TCGA-BP-4975-01A-01D-1462-08 ENST00000343320 p.Y212Y COL6A3 chr2 237341035 237341035 Silent A A C TCGA-BP-4975-01A-01D-1462-08 ENST00000295550 p.A2627A PBRM1 chr3 52587417 52587418 Frame_Shift_Del CT CT - TCGA-BP-4975-01A-01D-1462-08 ENST00000296302 p.S1020* ZFYVE28 chr4 2304325 2304325 Missense_Mutation G G A TCGA-BP-4975-01A-01D-1462-08 ENST00000290974 p.S672L ADGRV1 chr5 90729640 90729640 Splice_Site A A C TCGA-BP-4975-01A-01D-1462-08 ENST00000405460 p.X3476_splice FOXC1 chr6 1612185 1612185 3'UTR A A - TCGA-BP-4975-01A-01D-1462-08 ENST00000380874 KIF13A chr6 17828332 17828332 Missense_Mutation G G C TCGA-BP-4975-01A-01D-1462-08 ENST00000259711 p.I480M SKIV2L chr6 31964242 31964242 Missense_Mutation T T C TCGA-BP-4975-01A-01D-1462-08 ENST00000375394 p.M624T NOX3 chr6 155455048 155455048 Nonsense_Mutation G G A TCGA-BP-4975-01A-01D-1462-08 ENST00000159060 p.R44* ODF2 chr9 128494605 128494605 Silent A A G TCGA-BP-4975-01A-01D-1462-08 ENST00000434106 p.Q616Q CKAP5 chr11 46760649 46760649 Missense_Mutation G G A TCGA-BP-4975-01A-01D-1462-08 ENST00000529230 p.R1453C P2RX3 chr11 57350797 57350797 Silent C C T TCGA-BP-4975-01A-01D-1462-08 ENST00000263314 p.C247C DDI1 chr11 104037826 104037826 Missense_Mutation T T C TCGA-BP-4975-01A-01D-1462-08 ENST00000302259 p.L335P VWA5A chr11 124124295 124124295 Missense_Mutation G G A TCGA-BP-4975-01A-01D-1462-08 ENST00000392748 p.R408K H2AFJ chr12 14774857 14774857 Missense_Mutation A A T TCGA-BP-4975-01A-01D-1462-08 ENST00000389078 p.K129N KIAA0226L chr13 46361542 46361542 Missense_Mutation C C G TCGA-BP-4975-01A-01D-1462-08 ENST00000389908 p.E340Q PCSK6 chr15 101393414 101393414 Frame_Shift_Del C C - TCGA-BP-4975-01A-01D-1462-08 ENST00000611716 p.G336Afs*99 HAGH chr16 1816932 1816932 Silent G G A TCGA-BP-4975-01A-01D-1462-08 ENST00000397356 p.P236P MACF1 chr1 39347007 39347015 In_Frame_Del GCTCAGCTG GCTCAGCTG - TCGA-B0-5700-01A-11D-1534-10 ENST00000372915 p.A3543_L3545del SSX2IP chr1 84670811 84670811 Missense_Mutation G G C TCGA-B0-5700-01A-11D-1534-10 ENST00000342203 p.S16R SLC25A24 chr1 108136594 108136594 3'UTR A A G TCGA-B0-5700-01A-11D-1534-10 ENST00000565488 DENND2C chr1 114618391 114618391 Missense_Mutation G G T TCGA-B0-5700-01A-11D-1534-10 ENST00000393274 p.T440K PEAR1 chr1 156913221 156913221 Missense_Mutation A A G TCGA-B0-5700-01A-11D-1534-10 ENST00000292357 p.Y817C FCRL6 chr1 159809235 159809235 Silent C C T TCGA-B0-5700-01A-11D-1534-10 ENST00000368106 p.V198V DCAF6 chr1 168075436 168075437 3'UTR - - A TCGA-B0-5700-01A-11D-1534-10 ENST00000312263 DISC1 chr1 231694171 231694171 Missense_Mutation C C T TCGA-B0-5700-01A-11D-1534-10 ENST00000439617 p.P138L BIRC6 chr2 32509855 32509855 Missense_Mutation G G T TCGA-B0-5700-01A-11D-1534-10 ENST00000421745 p.L3366F ANTXR1 chr2 69245228 69245228 Missense_Mutation C C T TCGA-B0-5700-01A-11D-1534-10 ENST00000303714 p.R480C ZNF638 chr2 71433183 71433183 Missense_Mutation C C G TCGA-B0-5700-01A-11D-1534-10 ENST00000264447 p.P1924R SNRNP200 chr2 96277216 96277216 Missense_Mutation A A G TCGA-B0-5700-01A-11D-1534-10 ENST00000323853 p.M1986T KYNU chr2 142918629 142918629 Missense_Mutation A A G TCGA-B0-5700-01A-11D-1534-10 ENST00000264170 p.K64E PRKRA chr2 178447556 178447556 Missense_Mutation T T A TCGA-B0-5700-01A-11D-1534-10 ENST00000325748 p.H89L TTLL3 chr3 9820728 9820728 Missense_Mutation T T C TCGA-B0-5700-01A-11D-1534-10 ENST00000426895 p.Y381H CXCR6 chr3 45947489 45947489 Silent C C A TCGA-B0-5700-01A-11D-1534-10 ENST00000304552 p.A336A PBRM1 chr3 52609752 52609752 Nonsense_Mutation G G A TCGA-B0-5700-01A-11D-1534-10 ENST00000296302 p.R710* PTPRG chr3 62203659 62203659 Missense_Mutation G G A TCGA-B0-5700-01A-11D-1534-10 ENST00000474889 p.E622K RPN1 chr3 128620307 128620307 3'UTR G G A TCGA-B0-5700-01A-11D-1534-10 ENST00000296255 UBA6 chr4 67635515 67635515 Missense_Mutation T T C TCGA-B0-5700-01A-11D-1534-10 ENST00000322244 p.M594V FRAS1 chr4 78446839 78446839 3'Flank A A G TCGA-B0-5700-01A-11D-1534-10 ENST00000325942 FAT1 chr4 186620926 186620926 Missense_Mutation G G T TCGA-B0-5700-01A-11D-1534-10 ENST00000441802 p.S1887Y MYO10 chr5 16673795 16673795 Missense_Mutation A A T TCGA-B0-5700-01A-11D-1534-10 ENST00000513610 p.S1687T ADAMTS12 chr5 33561122 33561123 Frame_Shift_Del TC TC - TCGA-B0-5700-01A-11D-1534-10 ENST00000504830 p.Q1343Hfs*4 PAIP1 chr5 43547759 43547759 Missense_Mutation A A C TCGA-B0-5700-01A-11D-1534-10 ENST00000306846 p.L197W EFNA5 chr5 107381342 107381342 Silent G G A TCGA-B0-5700-01A-11D-1534-10 ENST00000333274 p.R200R DMXL1 chr5 119170958 119170958 Missense_Mutation G G A TCGA-B0-5700-01A-11D-1534-10 ENST00000311085 p.R2056H MEGF10 chr5 127457223 127457223 Missense_Mutation C C A TCGA-B0-5700-01A-11D-1534-10 ENST00000274473 p.H1110N CATSPER3 chr5 134969963 134969963 Frame_Shift_Del A A - TCGA-B0-5700-01A-11D-1534-10 ENST00000282611 p.F42Lfs*2 CSF1R chr5 150059774 150059774 Silent G G A TCGA-B0-5700-01A-11D-1534-10 ENST00000286301 p.S686S RREB1 chr6 7211694 7211694 Nonsense_Mutation C C A TCGA-B0-5700-01A-11D-1534-10 ENST00000349384 p.S231* ZBTB24 chr6 109481432 109481433 Frame_Shift_Ins - - A TCGA-B0-5700-01A-11D-1534-10 ENST00000230122 p.V199Cfs*3 ROS1 chr6 117342535 117342535 Missense_Mutation C C T TCGA-B0-5700-01A-11D-1534-10 ENST00000368508 p.D1512N ZNF735 chr7 64219799 64219799 Frame_Shift_Del T T - TCGA-B0-5700-01A-11D-1534-10 ENST00000429565 p.F250Lfs*96 ZNF107 chr7 64708840 64708840 3'UTR A A - TCGA-B0-5700-01A-11D-1534-10 ENST00000344930 PEG10 chr7 94663590 94663590 Frame_Shift_Del G G - TCGA-B0-5700-01A-11D-1534-10 ENST00000482108 p.E12Rfs*5 NAPEPLD chr7 103119973 103119975 In_Frame_Del AGG AGG - TCGA-B0-5700-01A-11D-1534-10 ENST00000341533 p.L182del SSPO chr7 149808527 149808527 Missense_Mutation C C A TCGA-B0-5700-01A-11D-1534-10 ENST00000378016 p.S2999R C8orf74 chr8 10700532 10700532 3'UTR C C T TCGA-B0-5700-01A-11D-1534-10 ENST00000304519 DDHD2 chr8 38252795 38252795 Missense_Mutation A A C TCGA-B0-5700-01A-11D-1534-10 ENST00000397166 p.H564P TRPS1 chr8 115623677 115623677 Intron G G A TCGA-B0-5700-01A-11D-1534-10 ENST00000220888 IFNA13 chr9 21367617 21367617 Missense_Mutation C C G TCGA-B0-5700-01A-11D-1534-10 ENST00000610660 p.E132Q IPPK chr9 92649523 92649523 Missense_Mutation A A G TCGA-B0-5700-01A-11D-1534-10 ENST00000287996 p.L115P RC3H2 chr9 122855376 122855376 Missense_Mutation T T G TCGA-B0-5700-01A-11D-1534-10 ENST00000357244 p.K875Q RABEPK chr9 125233882 125233882 Missense_Mutation G G A TCGA-B0-5700-01A-11D-1534-10 ENST00000373538 p.E341K RABEPK chr9 125233883 125233883 Missense_Mutation A A G TCGA-B0-5700-01A-11D-1534-10 ENST00000373538 p.E341G ABO chr9 133257535 133257535 Frame_Shift_Del C C - TCGA-B0-5700-01A-11D-1534-10 ENST00000611156 p.D83Mfs*4 ABO chr9 133257536 133257536 Missense_Mutation C C A TCGA-B0-5700-01A-11D-1534-10 ENST00000611156 p.K82N MCM10 chr10 13172706 13172706 Missense_Mutation A A T TCGA-B0-5700-01A-11D-1534-10 ENST00000484800 p.D179V ANK3 chr10 60075338 60075338 Missense_Mutation G G A TCGA-B0-5700-01A-11D-1534-10 ENST00000280772 p.S1848L ZFYVE27 chr10 97738676 97738676 Splice_Site T T C TCGA-B0-5700-01A-11D-1534-10 ENST00000393677 p.X66_splice R3HCC1L chr10 98209352 98209353 Frame_Shift_Ins - - A TCGA-B0-5700-01A-11D-1534-10 ENST00000612478 p.F415Vfs*15 ADRA2A chr10 111079376 111079376 Missense_Mutation C C G TCGA-B0-5700-01A-11D-1534-10 ENST00000280155 p.D460E CWF19L2 chr11 107439181 107439181 Splice_Region G G C TCGA-B0-5700-01A-11D-1534-10 ENST00000282251 p.S191S BTG4 chr11 111498037 111498047 Frame_Shift_Del TCCTTCGGAAG TCCTTCGGAAG - TCGA-B0-5700-01A-11D-1534-10 ENST00000356018 p.L88Dfs*9 ALG9 chr11 111786233 111786233 3'Flank A A C TCGA-B0-5700-01A-11D-1534-10 ENST00000614444 OR8D1 chr11 124310350 124310350 Missense_Mutation C C A TCGA-B0-5700-01A-11D-1534-10 ENST00000357821 p.W139C TEAD4 chr12 3011064 3011064 Missense_Mutation A A T TCGA-B0-5700-01A-11D-1534-10 ENST00000359864 p.K96M TNFRSF1A chr12 6330853 6330853 Missense_Mutation C C A TCGA-B0-5700-01A-11D-1534-10 ENST00000162749 p.G209C KRT6C chr12 52469771 52469775 Frame_Shift_Del CAGGT CAGGT - TCGA-B0-5700-01A-11D-1534-10 ENST00000252250 p.D440Gfs*163 KRT6C chr12 52469777 52469777 Silent C C T TCGA-B0-5700-01A-11D-1534-10 ENST00000252250 p.Q439Q HPD chr12 121858834 121858834 5'UTR A A T TCGA-B0-5700-01A-11D-1534-10 ENST00000289004 KNTC1 chr12 122579942 122579942 Missense_Mutation T T C TCGA-B0-5700-01A-11D-1534-10 ENST00000333479 p.V960A PRKCH chr14 61529139 61529139 Missense_Mutation A A T TCGA-B0-5700-01A-11D-1534-10 ENST00000332981 p.M500L NEDD4 chr15 55830580 55830580 Missense_Mutation T T A TCGA-B0-5700-01A-11D-1534-10 ENST00000508342 p.N1264I USP3 chr15 63589013 63589013 Splice_Site T T A TCGA-B0-5700-01A-11D-1534-10 ENST00000380324 p.X466_splice TMC7 chr16 19040342 19040342 Silent T T G TCGA-B0-5700-01A-11D-1534-10 ENST00000304381 p.S411S NPIPB15 chr16 74391482 74391482 Missense_Mutation G G A TCGA-B0-5700-01A-11D-1534-10 ENST00000429990 p.R245H GAS8 chr16 90040391 90040391 Frame_Shift_Del A A - TCGA-B0-5700-01A-11D-1534-10 ENST00000268699 p.E368Dfs*7 NUP88 chr17 5419410 5419410 Missense_Mutation C C G TCGA-B0-5700-01A-11D-1534-10 ENST00000573584 p.V81L FLII chr17 18247308 18247308 Missense_Mutation T T G TCGA-B0-5700-01A-11D-1534-10 ENST00000327031 p.Y846S PTPRM chr18 7888282 7888282 Missense_Mutation C C A TCGA-B0-5700-01A-11D-1534-10 ENST00000332175 p.L125M WBP11P1 chr18 32512313 32512313 RNA T T G TCGA-B0-5700-01A-11D-1534-10 ENST00000567636 HMHA1 chr19 1083250 1083250 Missense_Mutation C C G TCGA-B0-5700-01A-11D-1534-10 ENST00000313093 p.S951C ZNF562 chr19 9653061 9653061 Missense_Mutation T T G TCGA-B0-5700-01A-11D-1534-10 ENST00000453372 p.H390P ZNF700 chr19 11947533 11947533 Silent G G A TCGA-B0-5700-01A-11D-1534-10 ENST00000254321 p.Q70Q FAM129C chr19 17553599 17553599 3'UTR C C G TCGA-B0-5700-01A-11D-1534-10 ENST00000335393 SLC7A9 chr19 32859940 32859940 Silent G G T TCGA-B0-5700-01A-11D-1534-10 ENST00000023064 p.I258I ZNF611 chr19 52704935 52704935 3'UTR T T C TCGA-B0-5700-01A-11D-1534-10 ENST00000319783 VAPB chr20 58444275 58444282 3'UTR CACCATAT CACCATAT - TCGA-B0-5700-01A-11D-1534-10 ENST00000475243 BCR chr22 23263716 23263721 Intron CATGAA CATGAA - TCGA-B0-5700-01A-11D-1534-10 ENST00000305877 KIF1B chr1 10361714 10361714 Missense_Mutation C C T TCGA-B0-5085-01A-01D-1462-08 ENST00000377086 p.A1398V RNF186 chr1 19814826 19814826 Silent G G C TCGA-B0-5085-01A-01D-1462-08 ENST00000375121 p.P92P PTPRU chr1 29284863 29284863 Missense_Mutation G G T TCGA-B0-5085-01A-01D-1462-08 ENST00000345512 p.R771L ARTN chr1 43936004 43936004 Intron G G A TCGA-B0-5085-01A-01D-1462-08 ENST00000372354 MCEE chr2 71124208 71124208 Nonsense_Mutation C C A TCGA-B0-5085-01A-01D-1462-08 ENST00000244217 p.E126* CDCA7 chr2 173358749 173358749 Missense_Mutation T T A TCGA-B0-5085-01A-01D-1462-08 ENST00000347703 p.F20Y TTN chr2 178570941 178570941 Missense_Mutation G G C TCGA-B0-5085-01A-01D-1462-08 ENST00000591111 p.T23423S VHL chr3 10142061 10142062 Frame_Shift_Ins - - CC TCGA-B0-5085-01A-01D-1462-08 ENST00000256474 p.Q73Pfs*87 LAMB2 chr3 49131723 49131723 Missense_Mutation T T A TCGA-B0-5085-01A-01D-1462-08 ENST00000305544 p.T154S PBRM1 chr3 52609812 52609812 Nonsense_Mutation T T A TCGA-B0-5085-01A-01D-1462-08 ENST00000296302 p.R690* RAB7A chr3 128798040 128798040 Missense_Mutation A A T TCGA-B0-5085-01A-01D-1462-08 ENST00000265062 p.M51L PXYLP1 chr3 141292978 141292978 Nonsense_Mutation G G T TCGA-B0-5085-01A-01D-1462-08 ENST00000286353 p.E406* TIPARP chr3 156703570 156703570 Missense_Mutation T T A TCGA-B0-5085-01A-01D-1462-08 ENST00000295924 p.V465D NMD3 chr3 161227276 161227276 Frame_Shift_Del A A - TCGA-B0-5085-01A-01D-1462-08 ENST00000351193 p.Q70Rfs*4 GOLIM4 chr3 168010150 168010150 3'UTR A A - TCGA-B0-5085-01A-01D-1462-08 ENST00000470487 FYTTD1 chr3 197749947 197749947 5'UTR C C T TCGA-B0-5085-01A-01D-1462-08 ENST00000241502 IL6ST chr5 55963497 55963497 Missense_Mutation T T C TCGA-B0-5085-01A-01D-1462-08 ENST00000336909 p.N223S MAST4 chr5 67152733 67152733 Missense_Mutation C C G TCGA-B0-5085-01A-01D-1462-08 ENST00000403625 p.S1131C CD180 chr5 67183576 67183576 Missense_Mutation C C T TCGA-B0-5085-01A-01D-1462-08 ENST00000256447 p.E423K APBB3 chr5 140561802 140561802 Intron G G A TCGA-B0-5085-01A-01D-1462-08 ENST00000357560 PCDHB7 chr5 141174345 141174345 Missense_Mutation G G A TCGA-B0-5085-01A-01D-1462-08 ENST00000231137 p.V504I SLC6A7 chr5 150203948 150203948 Missense_Mutation G G C TCGA-B0-5085-01A-01D-1462-08 ENST00000230671 p.E414D GABRG2 chr5 162093976 162093976 Nonsense_Mutation G G T TCGA-B0-5085-01A-01D-1462-08 ENST00000361925 p.G86* SH3PXD2B chr5 172362867 172362867 Missense_Mutation C C T TCGA-B0-5085-01A-01D-1462-08 ENST00000311601 p.G144S JARID2 chr6 15496380 15496380 Missense_Mutation A A T TCGA-B0-5085-01A-01D-1462-08 ENST00000341776 p.K385N AARS2 chr6 44303065 44303065 Splice_Site C C A TCGA-B0-5085-01A-01D-1462-08 ENST00000244571 p.X752_splice SEC63 chr6 107958036 107958036 5'UTR C C A TCGA-B0-5085-01A-01D-1462-08 ENST00000369002 ROS1 chr6 117359911 117359911 Silent T T C TCGA-B0-5085-01A-01D-1462-08 ENST00000368508 p.R1182R THBS2 chr6 169248756 169248756 Silent G G C TCGA-B0-5085-01A-01D-1462-08 ENST00000366787 p.L90L GNAI1 chr7 80135188 80135188 Nonsense_Mutation A A T TCGA-B0-5085-01A-01D-1462-08 ENST00000351004 p.K10* RBM28 chr7 128335541 128335541 Splice_Site A A C TCGA-B0-5085-01A-01D-1462-08 ENST00000223073 p.X316_splice SLC4A2 chr7 151074281 151074282 Frame_Shift_Ins - - T TCGA-B0-5085-01A-01D-1462-08 ENST00000413384 p.P928Sfs*28 CLN8 chr8 1780261 1780261 Silent C C G TCGA-B0-5085-01A-01D-1462-08 ENST00000331222 p.S185S TACC1 chr8 38819873 38819873 Missense_Mutation A A C TCGA-B0-5085-01A-01D-1462-08 ENST00000317827 p.E210A KAT6A chr8 41942698 41942698 Intron T T G TCGA-B0-5085-01A-01D-1462-08 ENST00000265713 HNF4G chr8 75543911 75543911 Silent A A G TCGA-B0-5085-01A-01D-1462-08 ENST00000354370 p.A26A ZFHX4 chr8 76705463 76705463 Missense_Mutation G G A TCGA-B0-5085-01A-01D-1462-08 ENST00000521891 p.E459K GRINA chr8 143992075 143992075 Silent A A T TCGA-B0-5085-01A-01D-1462-08 ENST00000313269 p.A230A AQP3 chr9 33443675 33443675 Intron G G A TCGA-B0-5085-01A-01D-1462-08 ENST00000297991 PNPLA7 chr9 137484725 137484726 Frame_Shift_Ins - - A TCGA-B0-5085-01A-01D-1462-08 ENST00000277531 p.G712Wfs*54 PRKG1 chr10 51907530 51907530 Missense_Mutation C C T TCGA-B0-5085-01A-01D-1462-08 ENST00000373985 p.P226L RUFY2 chr10 68381304 68381304 Silent A A G TCGA-B0-5085-01A-01D-1462-08 ENST00000388768 p.D380D PSTK chr10 122983009 122983009 Nonsense_Mutation C C T TCGA-B0-5085-01A-01D-1462-08 ENST00000368887 p.Q165* OR52J3 chr11 5047315 5047315 Nonsense_Mutation C C T TCGA-B0-5085-01A-01D-1462-08 ENST00000380370 p.R264* RPS13 chr11 17077237 17077237 Missense_Mutation A A C TCGA-B0-5085-01A-01D-1462-08 ENST00000525634 p.L28V KCNC1 chr11 17772348 17772348 Silent T T C TCGA-B0-5085-01A-01D-1462-08 ENST00000379472 p.A418A VSIG2 chr11 124749815 124749815 Missense_Mutation C C T TCGA-B0-5085-01A-01D-1462-08 ENST00000326621 p.G160D LRRC23 chr12 6914020 6914020 3'UTR C C A TCGA-B0-5085-01A-01D-1462-08 ENST00000007969 CLEC2D chr12 9669779 9669779 Missense_Mutation A A C TCGA-B0-5085-01A-01D-1462-08 ENST00000290855 p.E15D PRPF40B chr12 49643745 49643745 Missense_Mutation A A G TCGA-B0-5085-01A-01D-1462-08 ENST00000380281 p.H791R PITPNM2 chr12 123004431 123004431 Silent C C T TCGA-B0-5085-01A-01D-1462-08 ENST00000320201 p.S337S COL4A2 chr13 110450360 110450360 Silent C C A TCGA-B0-5085-01A-01D-1462-08 ENST00000360467 p.P415P MKRN3 chr15 23566605 23566605 Missense_Mutation C C A TCGA-B0-5085-01A-01D-1462-08 ENST00000314520 p.H275N SPRED1 chr15 38324781 38324781 Missense_Mutation A A G TCGA-B0-5085-01A-01D-1462-08 ENST00000299084 p.N132S ZNF174 chr16 3401937 3401937 5'UTR T T C TCGA-B0-5085-01A-01D-1462-08 ENST00000268655 VAC14 chr16 70783081 70783081 Missense_Mutation T T C TCGA-B0-5085-01A-01D-1462-08 ENST00000261776 p.K255E MYO15A chr17 18146028 18146028 Missense_Mutation G G A TCGA-B0-5085-01A-01D-1462-08 ENST00000205890 p.A2144T CDK3 chr17 76002065 76002065 Missense_Mutation T T A TCGA-B0-5085-01A-01D-1462-08 ENST00000425876 p.F80I STARD6 chr18 54337220 54337220 Missense_Mutation G G T TCGA-B0-5085-01A-01D-1462-08 ENST00000307844 p.P58T TMPRSS9 chr19 2422198 2422198 Silent G G A TCGA-B0-5085-01A-01D-1462-08 ENST00000332578 p.Q799Q CRTC1 chr19 18775737 18775737 Missense_Mutation C C A TCGA-B0-5085-01A-01D-1462-08 ENST00000321949 p.L537I SPHK2 chr19 48625968 48625968 Silent G G A TCGA-B0-5085-01A-01D-1462-08 ENST00000245222 p.P39P TGM3 chr20 2332238 2332238 Missense_Mutation A A G TCGA-B0-5085-01A-01D-1462-08 ENST00000381458 p.I524V OSM chr22 30263861 30263861 3'UTR C C G TCGA-B0-5085-01A-01D-1462-08 ENST00000215781 GRAP2 chr22 39947153 39947153 Missense_Mutation A A T TCGA-B0-5085-01A-01D-1462-08 ENST00000344138 p.E16V TTLL1 chr22 43068513 43068513 Missense_Mutation T T G TCGA-B0-5085-01A-01D-1462-08 ENST00000266254 p.T134P SCML1 chrX 17744159 17744159 5'UTR G G A TCGA-B0-5085-01A-01D-1462-08 ENST00000380041 MAP3K15 chrX 19361498 19361499 Frame_Shift_Ins - - A TCGA-B0-5085-01A-01D-1462-08 ENST00000338883 p.E1259* DCAF8L2 chrX 27748316 27748316 Missense_Mutation G G T TCGA-B0-5085-01A-01D-1462-08 ENST00000451261 p.G474V DDX3X chrX 41344243 41344243 Missense_Mutation C C T TCGA-B0-5085-01A-01D-1462-08 ENST00000399959 p.S290L JADE3 chrX 47058571 47058571 Missense_Mutation A A C TCGA-B0-5085-01A-01D-1462-08 ENST00000611250 p.K656Q HUWE1 chrX 53647460 53647460 Missense_Mutation C C G TCGA-B0-5085-01A-01D-1462-08 ENST00000262854 p.E87Q OGT chrX 71564691 71564691 Missense_Mutation G G A TCGA-B0-5085-01A-01D-1462-08 ENST00000373719 p.V843I PHKA1 chrX 72611173 72611173 Missense_Mutation C C A TCGA-B0-5085-01A-01D-1462-08 ENST00000373542 p.W794L LPAR4 chrX 78755634 78755634 Missense_Mutation G G T TCGA-B0-5085-01A-01D-1462-08 ENST00000435339 p.M255I IGSF1 chrX 131282675 131282675 Missense_Mutation C C A TCGA-B0-5085-01A-01D-1462-08 ENST00000361420 p.V339L MMEL1 chr1 2598757 2598757 Missense_Mutation G G C TCGA-A3-3311-01A-01D-0966-08 ENST00000378412 p.L359V C1orf158 chr1 12760816 12760816 Silent G G A TCGA-A3-3311-01A-01D-0966-08 ENST00000614859 p.Q150Q PDE4B chr1 66332441 66332441 Intron G G A TCGA-A3-3311-01A-01D-0966-08 ENST00000329654 FCRL4 chr1 157586419 157586419 Missense_Mutation G G A TCGA-A3-3311-01A-01D-0966-08 ENST00000271532 p.P295L RP11-25K21.6 chr1 161607603 161607603 3'Flank C C T TCGA-A3-3311-01A-01D-0966-08 ENST00000537821 KIF21B chr1 200984964 200984964 Missense_Mutation T T A TCGA-A3-3311-01A-01D-0966-08 ENST00000422435 p.D1233V CYB5R1 chr1 202963132 202963132 Missense_Mutation C C T TCGA-A3-3311-01A-01D-0966-08 ENST00000367249 p.E227K OPTC chr1 203496234 203496234 Missense_Mutation G G A TCGA-A3-3311-01A-01D-0966-08 ENST00000367222 p.E77K PROX1 chr1 213996790 213996790 Missense_Mutation G G A TCGA-A3-3311-01A-01D-0966-08 ENST00000261454 p.M85I CDC42BPA chr1 227026127 227026127 Silent C C T TCGA-A3-3311-01A-01D-0966-08 ENST00000334218 p.V1464V TRAPPC12 chr2 3387845 3387845 Silent C C T TCGA-A3-3311-01A-01D-0966-08 ENST00000324266 p.D74D DHX57 chr2 38848332 38848332 Frame_Shift_Del C C - TCGA-A3-3311-01A-01D-0966-08 ENST00000457308 p.A701Qfs*3 TTN chr2 178534441 178534441 Silent C C T TCGA-A3-3311-01A-01D-0966-08 ENST00000591111 p.R32417R ASIC4 chr2 219532007 219532007 Missense_Mutation C C G TCGA-A3-3311-01A-01D-0966-08 ENST00000347842 p.T372R SETMAR chr3 4313378 4313378 Missense_Mutation A A G TCGA-A3-3311-01A-01D-0966-08 ENST00000358065 p.T213A SETD2 chr3 47017642 47017642 Missense_Mutation C C T TCGA-A3-3311-01A-01D-0966-08 ENST00000409792 p.R2510H NICN1 chr3 49429225 49429225 Silent C C T TCGA-A3-3311-01A-01D-0966-08 ENST00000273598 p.L5L PBRM1 chr3 52564226 52564226 Missense_Mutation A A C TCGA-A3-3311-01A-01D-0966-08 ENST00000296302 p.C1233W SEC22A chr3 123209139 123209139 5'UTR A A C TCGA-A3-3311-01A-01D-0966-08 ENST00000309934 ECT2 chr3 172762736 172762736 Missense_Mutation T T C TCGA-A3-3311-01A-01D-0966-08 ENST00000392692 p.V312A FAM193A chr4 2731883 2731883 3'UTR G G C TCGA-A3-3311-01A-01D-0966-08 ENST00000324666 CCKAR chr4 26482123 26482123 Missense_Mutation C C A TCGA-A3-3311-01A-01D-0966-08 ENST00000295589 p.G268W THAP9 chr4 82918000 82918000 Silent C C T TCGA-A3-3311-01A-01D-0966-08 ENST00000302236 p.V596V FGF2 chr4 122892301 122892301 Frame_Shift_Del G G - TCGA-A3-3311-01A-01D-0966-08 ENST00000614010 p.V258Wfs*3 C4orf51 chr4 145729191 145729191 Missense_Mutation G G C TCGA-A3-3311-01A-01D-0966-08 ENST00000438731 p.G130A GOLPH3 chr5 32126248 32126248 Missense_Mutation C C A TCGA-A3-3311-01A-01D-0966-08 ENST00000265070 p.E287D WDR36 chr5 111092530 111092530 Missense_Mutation A A T TCGA-A3-3311-01A-01D-0966-08 ENST00000506538 p.N81I RREB1 chr6 7181726 7181726 Intron C C T TCGA-A3-3311-01A-01D-0966-08 ENST00000349384 CPNE5 chr6 36762962 36762962 Silent A A G TCGA-A3-3311-01A-01D-0966-08 ENST00000244751 p.S270S MAP3K7 chr6 90518563 90518563 Splice_Site C C A TCGA-A3-3311-01A-01D-0966-08 ENST00000369329 p.X509_splice ADGRG6 chr6 142415926 142415926 Missense_Mutation G G T TCGA-A3-3311-01A-01D-0966-08 ENST00000230173 p.A934S INTS1 chr7 1499604 1499604 Missense_Mutation C C T TCGA-A3-3311-01A-01D-0966-08 ENST00000404767 p.R238Q KDELR2 chr7 6463099 6463099 3'UTR C C G TCGA-A3-3311-01A-01D-0966-08 ENST00000258739 CDK13 chr7 40046009 40046009 Missense_Mutation A A T TCGA-A3-3311-01A-01D-0966-08 ENST00000181839 p.I843F ZMIZ2 chr7 44765540 44765540 Missense_Mutation C C A TCGA-A3-3311-01A-01D-0966-08 ENST00000309315 p.P735T PTPRZ1 chr7 122013757 122013757 Missense_Mutation G G A TCGA-A3-3311-01A-01D-0966-08 ENST00000393386 p.A1571T TRPV5 chr7 142929546 142929546 Silent G G A TCGA-A3-3311-01A-01D-0966-08 ENST00000265310 p.I123I CSMD1 chr8 4637522 4637522 Missense_Mutation C C A TCGA-A3-3311-01A-01D-0966-08 ENST00000520002 p.G41V LZTS1 chr8 20255252 20255252 5'UTR C C T TCGA-A3-3311-01A-01D-0966-08 ENST00000265801 PXDNL chr8 51447032 51447032 Silent C C A TCGA-A3-3311-01A-01D-0966-08 ENST00000356297 p.V499V SULF1 chr8 69603624 69603626 In_Frame_Del AAT AAT - TCGA-A3-3311-01A-01D-0966-08 ENST00000260128 p.K405_I406delinsN ZCCHC6 chr9 86323402 86323402 Missense_Mutation G G A TCGA-A3-3311-01A-01D-0966-08 ENST00000375963 p.S783L SECISBP2 chr9 89350783 89350800 In_Frame_Del AAACACCTGAAGCTCAAA AAACACCTGAAGCTCAAA - TCGA-A3-3311-01A-01D-0966-08 ENST00000375807 p.H683_K688del CARD9 chr9 136371998 136371998 Silent G G C TCGA-A3-3311-01A-01D-0966-08 ENST00000371732 p.P27P CAMK1D chr10 12791178 12791178 Missense_Mutation A A C TCGA-A3-3311-01A-01D-0966-08 ENST00000619168 p.K196Q CCDC7 chr10 32845602 32845602 Missense_Mutation A A C TCGA-A3-3311-01A-01D-0966-08 ENST00000375025 p.T409P ITGB1 chr10 32910325 32910330 In_Frame_Del CAGGAT CAGGAT - TCGA-A3-3311-01A-01D-0966-08 ENST00000302278 p.D686_P687del MALAT1 chr11 65498559 65498559 3'Flank C C G TCGA-A3-3311-01A-01D-0966-08 ENST00000625158 AMICA1 chr11 118198035 118198035 Missense_Mutation T T G TCGA-A3-3311-01A-01D-0966-08 ENST00000356289 p.K323T KLRC1 chr12 10446621 10446621 Missense_Mutation A A C TCGA-A3-3311-01A-01D-0966-08 ENST00000359151 p.L211R SENP1 chr12 48101507 48101507 5'UTR A A T TCGA-A3-3311-01A-01D-0966-08 ENST00000448372 XRCC6BP1 chr12 57947072 57947072 Missense_Mutation C C A TCGA-A3-3311-01A-01D-0966-08 ENST00000300145 p.S104Y EEA1 chr12 92811394 92811394 Frame_Shift_Del G G - TCGA-A3-3311-01A-01D-0966-08 ENST00000322349 p.A695Efs*27 TPTE2 chr13 19465493 19465493 Missense_Mutation C C G TCGA-A3-3311-01A-01D-0966-08 ENST00000400230 p.R195T BRCA2 chr13 32340884 32340884 Missense_Mutation A A G TCGA-A3-3311-01A-01D-0966-08 ENST00000380152 p.I2177V CTDSPL2 chr15 44459078 44459078 Nonsense_Mutation A A T TCGA-A3-3311-01A-01D-0966-08 ENST00000260327 p.R22* FANCI chr15 89293853 89293853 Missense_Mutation T T C TCGA-A3-3311-01A-01D-0966-08 ENST00000310775 p.I771T FBXL16 chr16 695593 695593 Missense_Mutation G G C TCGA-A3-3311-01A-01D-0966-08 ENST00000324361 p.L322V WSCD1 chr17 6118171 6118171 Missense_Mutation G G A TCGA-A3-3311-01A-01D-0966-08 ENST00000317744 p.R453H CEP131 chr17 81194874 81194877 Frame_Shift_Del GACA GACA - TCGA-A3-3311-01A-01D-0966-08 ENST00000269392 p.V708Efs*10 ATP5A1 chr18 46086182 46086182 Missense_Mutation C C T TCGA-A3-3311-01A-01D-0966-08 ENST00000282050 p.D454N PGLYRP2 chr19 15476296 15476296 Missense_Mutation A A T TCGA-A3-3311-01A-01D-0966-08 ENST00000340880 p.L125Q ZNF493 chr19 21424818 21424818 Missense_Mutation A A G TCGA-A3-3311-01A-01D-0966-08 ENST00000355504 p.K592R TLR7 chrX 12888122 12888122 Missense_Mutation C C T TCGA-A3-3311-01A-01D-0966-08 ENST00000380659 p.H872Y ZMYM4 chr1 35370438 35370438 Nonsense_Mutation C C A TCGA-AS-3778-01A-01D-0966-08 ENST00000314607 p.S331* ZMYM4 chr1 35370440 35370440 Missense_Mutation G G T TCGA-AS-3778-01A-01D-0966-08 ENST00000314607 p.V332F THRAP3 chr1 36289500 36289500 Missense_Mutation C C T TCGA-AS-3778-01A-01D-0966-08 ENST00000354618 p.S494F SARS chr1 109229436 109229436 Missense_Mutation A A G TCGA-AS-3778-01A-01D-0966-08 ENST00000234677 p.K104R RUSC1 chr1 155330438 155330438 Missense_Mutation G G T TCGA-AS-3778-01A-01D-0966-08 ENST00000368352 p.R859I ZBTB41 chr1 197199437 197199437 Missense_Mutation T T C TCGA-AS-3778-01A-01D-0966-08 ENST00000367405 p.E346G PPP1R15B chr1 204409792 204409792 Missense_Mutation T T A TCGA-AS-3778-01A-01D-0966-08 ENST00000367188 p.E540D ITPKB chr1 226647268 226647268 Silent G G A TCGA-AS-3778-01A-01D-0966-08 ENST00000272117 p.Y715Y EHD3 chr2 31261623 31261623 Silent G G A TCGA-AS-3778-01A-01D-0966-08 ENST00000322054 p.E330E CTNNA2 chr2 79909711 79909711 Silent C C A TCGA-AS-3778-01A-01D-0966-08 ENST00000402739 p.R324R VHL chr3 10146584 10146585 Frame_Shift_Ins - - C TCGA-AS-3778-01A-01D-0966-08 ENST00000256474 p.S139Ifs*5 XPC chr3 14158507 14158507 Missense_Mutation T T A TCGA-AS-3778-01A-01D-0966-08 ENST00000285021 p.D459V ITGA9 chr3 37629353 37629353 Intron T T G TCGA-AS-3778-01A-01D-0966-08 ENST00000264741 STAG1 chr3 136422536 136422537 Frame_Shift_Del AC AC - TCGA-AS-3778-01A-01D-0966-08 ENST00000383202 p.S637Kfs*4 ERICH6 chr3 150702132 150702140 In_Frame_Del CATTTCAGA CATTTCAGA - TCGA-AS-3778-01A-01D-0966-08 ENST00000295910 p.E149_S151del BCHE chr3 165830121 165830127 Frame_Shift_Del CTTCATT CTTCATT - TCGA-AS-3778-01A-01D-0966-08 ENST00000264381 p.N303Hfs*12 ECE2 chr3 184258744 184258744 Intron T T A TCGA-AS-3778-01A-01D-0966-08 ENST00000402825 PCDHB7 chr5 141174580 141174580 Missense_Mutation C C T TCGA-AS-3778-01A-01D-0966-08 ENST00000231137 p.P582L RANBP17 chr5 171298874 171298874 3'UTR C C G TCGA-AS-3778-01A-01D-0966-08 ENST00000523189 ADGRF4 chr6 47712379 47712379 Frame_Shift_Del T T - TCGA-AS-3778-01A-01D-0966-08 ENST00000283303 p.S109Lfs*2 PKHD1 chr6 52071027 52071027 Missense_Mutation G G T TCGA-AS-3778-01A-01D-0966-08 ENST00000371117 p.H216N TBX18 chr6 84737309 84737309 Missense_Mutation G G T TCGA-AS-3778-01A-01D-0966-08 ENST00000369663 p.F400L RAET1G chr6 149919176 149919176 Missense_Mutation T T A TCGA-AS-3778-01A-01D-0966-08 ENST00000367360 p.R166S SYNE1 chr6 152390383 152390383 Missense_Mutation A A T TCGA-AS-3778-01A-01D-0966-08 ENST00000367255 p.L2692M MIOS chr7 7596391 7596391 Silent C C T TCGA-AS-3778-01A-01D-0966-08 ENST00000340080 p.G777G DPY19L1 chr7 34941778 34941778 Missense_Mutation A A G TCGA-AS-3778-01A-01D-0966-08 ENST00000310974 p.I486T LMOD2 chr7 123662255 123662255 Missense_Mutation C C A TCGA-AS-3778-01A-01D-0966-08 ENST00000458573 p.N223K VPS13B chr8 99875538 99875538 Missense_Mutation G G T TCGA-AS-3778-01A-01D-0966-08 ENST00000358544 p.V3981L CSMD3 chr8 113436707 113436707 Missense_Mutation C C A TCGA-AS-3778-01A-01D-0966-08 ENST00000297405 p.V50F CAAP1 chr9 26842277 26842277 3'UTR A A - TCGA-AS-3778-01A-01D-0966-08 ENST00000333916 AKR1C3 chr10 5097690 5097690 Intron T T C TCGA-AS-3778-01A-01D-0966-08 ENST00000380554 SVIL chr10 29473868 29473876 In_Frame_Del CGTCATCAG CGTCATCAG - TCGA-AS-3778-01A-01D-0966-08 ENST00000355867 p.L1831_T1833del ZFYVE27 chr10 97744735 97744742 Frame_Shift_Del GGTACTCA GGTACTCA - TCGA-AS-3778-01A-01D-0966-08 ENST00000393677 p.W92Cfs*25 SMC3 chr10 110596439 110596439 Missense_Mutation T T G TCGA-AS-3778-01A-01D-0966-08 ENST00000361804 p.Y669D KCNC1 chr11 17772167 17772167 Missense_Mutation T T C TCGA-AS-3778-01A-01D-0966-08 ENST00000379472 p.I358T RASGRP2 chr11 64739660 64739660 Missense_Mutation G G C TCGA-AS-3778-01A-01D-0966-08 ENST00000354024 p.I224M PCNXL3 chr11 65625270 65625270 Missense_Mutation A A T TCGA-AS-3778-01A-01D-0966-08 ENST00000355703 p.T1007S KRT76 chr12 52768714 52768714 Silent C C T TCGA-AS-3778-01A-01D-0966-08 ENST00000332411 p.*639* KRT4 chr12 52813634 52813634 Missense_Mutation T T C TCGA-AS-3778-01A-01D-0966-08 ENST00000551956 p.K142R XPOT chr12 64433525 64433525 Nonsense_Mutation C C T TCGA-AS-3778-01A-01D-0966-08 ENST00000332707 p.Q792* TRHDE chr12 72663107 72663107 Missense_Mutation C C T TCGA-AS-3778-01A-01D-0966-08 ENST00000261180 p.A996V NOS1 chr12 117243322 117243322 Silent C C T TCGA-AS-3778-01A-01D-0966-08 ENST00000317775 p.V979V POLE chr12 132643314 132643314 Missense_Mutation G G C TCGA-AS-3778-01A-01D-0966-08 ENST00000320574 p.I1487M NYNRIN chr14 24416497 24416502 In_Frame_Del GCAGGA GCAGGA - TCGA-AS-3778-01A-01D-0966-08 ENST00000382554 p.R1584_S1585del RPS29 chr14 49586327 49586327 Missense_Mutation T T C TCGA-AS-3778-01A-01D-0966-08 ENST00000245458 p.Y7C DLGAP5 chr14 55158592 55158592 Silent T T C TCGA-AS-3778-01A-01D-0966-08 ENST00000247191 p.P601P L3HYPDH chr14 59473010 59473011 Frame_Shift_Ins - - ATAAA TCGA-AS-3778-01A-01D-0966-08 ENST00000247194 p.I341Lfs*2 DYNC1H1 chr14 102000400 102000400 Splice_Site G G A TCGA-AS-3778-01A-01D-0966-08 ENST00000360184 p.X1358_splice RPUSD2 chr15 40573818 40573818 Missense_Mutation G G C TCGA-AS-3778-01A-01D-0966-08 ENST00000315616 p.G399R MYZAP chr15 57621621 57621621 Missense_Mutation T T C TCGA-AS-3778-01A-01D-0966-08 ENST00000267853 p.L111S ICE2 chr15 60442383 60442383 Intron A A T TCGA-AS-3778-01A-01D-0966-08 ENST00000261520 TLN2 chr15 62738244 62738244 Missense_Mutation A A G TCGA-AS-3778-01A-01D-0966-08 ENST00000306829 p.N1200D RRN3P1 chr16 21806161 21806161 RNA C C T TCGA-AS-3778-01A-01D-0966-08 ENST00000514813 PHLPP2 chr16 71648947 71648947 Silent A A G TCGA-AS-3778-01A-01D-0966-08 ENST00000568954 p.P1305P CHRNE chr17 4901003 4901003 Silent G G A TCGA-AS-3778-01A-01D-0966-08 ENST00000293780 p.F263F GUCY2D chr17 8006467 8006467 Silent T T A TCGA-AS-3778-01A-01D-0966-08 ENST00000254854 p.A377A SRCIN1 chr17 38552035 38552035 Missense_Mutation A A C TCGA-AS-3778-01A-01D-0966-08 ENST00000617146 p.F860V UTP18 chr17 51263371 51263371 Missense_Mutation A A G TCGA-AS-3778-01A-01D-0966-08 ENST00000225298 p.D147G CLTC chr17 59655965 59655966 Frame_Shift_Ins - - T TCGA-AS-3778-01A-01D-0966-08 ENST00000269122 p.V305Cfs*6 GPRC5C chr17 74447153 74447153 3'UTR A A G TCGA-AS-3778-01A-01D-0966-08 ENST00000392627 SLC26A11 chr17 80222762 80222762 Missense_Mutation C C G TCGA-AS-3778-01A-01D-0966-08 ENST00000361193 p.F114L SLC7A10 chr19 33211329 33211329 Splice_Site C C G TCGA-AS-3778-01A-01D-0966-08 ENST00000253188 p.X305_splice RYR1 chr19 38561292 38561292 Silent G G A TCGA-AS-3778-01A-01D-0966-08 ENST00000359596 p.P4154P CYTH2 chr19 48474244 48474244 Missense_Mutation G G A TCGA-AS-3778-01A-01D-0966-08 ENST00000427476 p.V204I KIF3B chr20 32330276 32330276 Missense_Mutation G G A TCGA-AS-3778-01A-01D-0966-08 ENST00000375712 p.A702T RBL1 chr20 37003626 37003626 Intron A A - TCGA-AS-3778-01A-01D-0966-08 ENST00000373664 KCNQ2 chr20 63406762 63406762 Missense_Mutation A A G TCGA-AS-3778-01A-01D-0966-08 ENST00000359125 p.I834T PAX3 chr2 222201939 222201939 Silent C C T TCGA-AK-3453-01A-01D-0966-08 ENST00000350526 p.K475K COL8A1 chr3 99795305 99795305 Silent T T G TCGA-AK-3453-01A-01D-0966-08 ENST00000261037 p.G468G FGD2 chr6 37014986 37014986 Missense_Mutation T T G TCGA-AK-3453-01A-01D-0966-08 ENST00000274963 p.V326G PEX6 chr6 42978482 42978482 Silent C C A TCGA-AK-3453-01A-01D-0966-08 ENST00000304611 p.V223V CYB5R4 chr6 83859843 83859843 Frame_Shift_Del G G - TCGA-AK-3453-01A-01D-0966-08 ENST00000369681 p.R23Vfs*6 CA13 chr8 85250924 85250924 Silent A A T TCGA-AK-3453-01A-01D-0966-08 ENST00000321764 p.T74T MMP3 chr11 102842545 102842545 Missense_Mutation C C T TCGA-AK-3453-01A-01D-0966-08 ENST00000299855 p.A129T MESDC2 chr15 80989779 80989779 Missense_Mutation T T C TCGA-AK-3453-01A-01D-0966-08 ENST00000261758 p.R5G MKL2 chr16 14251988 14251988 Missense_Mutation C C T TCGA-AK-3453-01A-01D-0966-08 ENST00000318282 p.P794S TNFSF9 chr19 6534871 6534871 Silent C C T TCGA-AK-3453-01A-01D-0966-08 ENST00000245817 p.S190S ECSIT chr19 11506242 11506242 Missense_Mutation G G A TCGA-AK-3453-01A-01D-0966-08 ENST00000270517 p.P413L PGLYRP2 chr19 15475608 15475608 Silent C C T TCGA-AK-3453-01A-01D-0966-08 ENST00000340880 p.Q354Q SIGLEC16 chr19 49970174 49970174 RNA T T G TCGA-AK-3453-01A-01D-0966-08 ENST00000602139 NXF5 chrX 101840876 101840876 Missense_Mutation C C A TCGA-AK-3453-01A-01D-0966-08 ENST00000263032 p.C167F IGSF8 chr1 160093842 160093844 In_Frame_Del CTA CTA - TCGA-B8-A54F-01A-11D-A25V-10 ENST00000314485 p.V257del USH2A chr1 215790122 215790122 Silent T T G TCGA-B8-A54F-01A-11D-A25V-10 ENST00000307340 p.G3373G RYR2 chr1 237649987 237649987 Silent C C T TCGA-B8-A54F-01A-11D-A25V-10 ENST00000366574 p.H2541H DPY30 chr2 32039476 32039476 5'UTR A A T TCGA-B8-A54F-01A-11D-A25V-10 ENST00000295066 CACNA1D chr3 53718690 53718690 Intron G G A TCGA-B8-A54F-01A-11D-A25V-10 ENST00000350061 ACTRT3 chr3 169767642 169767642 Missense_Mutation G G T TCGA-B8-A54F-01A-11D-A25V-10 ENST00000330368 p.F303L PRSS12 chr4 118281906 118281906 3'UTR T T A TCGA-B8-A54F-01A-11D-A25V-10 ENST00000296498 LRRC70 chr5 62580412 62580412 Missense_Mutation C C G TCGA-B8-A54F-01A-11D-A25V-10 ENST00000334994 p.A325G ATP10B chr5 160640530 160640530 Missense_Mutation G G A TCGA-B8-A54F-01A-11D-A25V-10 ENST00000327245 p.R311W MTMR7 chr8 17305923 17305930 Frame_Shift_Del AGATTTCT AGATTTCT - TCGA-B8-A54F-01A-11D-A25V-10 ENST00000180173 p.K393Nfs*5 ASH2L chr8 38105738 38105738 Missense_Mutation G G C TCGA-B8-A54F-01A-11D-A25V-10 ENST00000343823 p.G63A PLEKHF2 chr8 95154757 95154757 Missense_Mutation T T C TCGA-B8-A54F-01A-11D-A25V-10 ENST00000315367 p.M238T ZNF79 chr9 127444058 127444058 Missense_Mutation G G A TCGA-B8-A54F-01A-11D-A25V-10 ENST00000342483 p.E120K ARHGAP12 chr10 31817817 31817817 Missense_Mutation T T G TCGA-B8-A54F-01A-11D-A25V-10 ENST00000344936 p.K568Q SLC5A12 chr11 26721576 26721576 Nonsense_Mutation G G A TCGA-B8-A54F-01A-11D-A25V-10 ENST00000396005 p.Q47* MADD chr11 47286534 47286534 Missense_Mutation G G T TCGA-B8-A54F-01A-11D-A25V-10 ENST00000311027 p.V885L GIF chr11 59842528 59842528 Silent C C T TCGA-B8-A54F-01A-11D-A25V-10 ENST00000257248 p.L142L HRASLS2 chr11 63560183 63560183 Missense_Mutation C C A TCGA-B8-A54F-01A-11D-A25V-10 ENST00000255695 p.R7I INPPL1 chr11 72233122 72233122 Missense_Mutation T T G TCGA-B8-A54F-01A-11D-A25V-10 ENST00000298229 p.S667A PRICKLE1 chr12 42468683 42468683 Missense_Mutation A A C TCGA-B8-A54F-01A-11D-A25V-10 ENST00000345127 p.I177M XPOT chr12 64434576 64434576 Missense_Mutation C C T TCGA-B8-A54F-01A-11D-A25V-10 ENST00000332707 p.A841V HCFC2 chr12 104066270 104066270 Frame_Shift_Del A A - TCGA-B8-A54F-01A-11D-A25V-10 ENST00000229330 p.M90Wfs*24 DNAJC15 chr13 43107269 43107269 3'UTR G G - TCGA-B8-A54F-01A-11D-A25V-10 ENST00000379221 DNAJC15 chr13 43107271 43107271 3'UTR A A C TCGA-B8-A54F-01A-11D-A25V-10 ENST00000379221 MIS18BP1 chr14 45218319 45218319 Silent G G A TCGA-B8-A54F-01A-11D-A25V-10 ENST00000310806 p.V935V HERC2P3 chr15 20439333 20439333 Intron G G A TCGA-B8-A54F-01A-11D-A25V-10 ENST00000426501 TGM7 chr15 43293570 43293570 Silent G G A TCGA-B8-A54F-01A-11D-A25V-10 ENST00000452443 p.H24H IREB2 chr15 78487750 78487750 Missense_Mutation A A G TCGA-B8-A54F-01A-11D-A25V-10 ENST00000258886 p.Y576C DERL2 chr17 5480566 5480566 Missense_Mutation A A T TCGA-B8-A54F-01A-11D-A25V-10 ENST00000158771 p.V115E SYMPK chr19 45831352 45831352 Intron T T G TCGA-B8-A54F-01A-11D-A25V-10 ENST00000245934 NPAS1 chr19 47041033 47041033 Silent G G A TCGA-B8-A54F-01A-11D-A25V-10 ENST00000449844 p.G375G VN1R4 chr19 53266787 53266787 Nonsense_Mutation G G T TCGA-B8-A54F-01A-11D-A25V-10 ENST00000311170 p.Y293* MYO18B chr22 26027767 26027767 3'Flank A A T TCGA-B8-A54F-01A-11D-A25V-10 ENST00000536101 BRCC3 chrX 155089352 155089352 Splice_Site G G A TCGA-B8-A54F-01A-11D-A25V-10 ENST00000369462 p.X164_splice SKI chr1 2303383 2303383 Silent G G A TCGA-BP-5001-01A-01D-1462-08 ENST00000378536 p.P398P MTOR chr1 11167473 11167473 Missense_Mutation A A G TCGA-BP-5001-01A-01D-1462-08 ENST00000361445 p.L1433S EIF4G3 chr1 20807392 20807392 Missense_Mutation C C T TCGA-BP-5001-01A-01D-1462-08 ENST00000264211 p.G1562D FCRL5 chr1 157524338 157524338 Missense_Mutation C C T TCGA-BP-5001-01A-01D-1462-08 ENST00000361835 p.C727Y SPTA1 chr1 158612817 158612817 Missense_Mutation C C A TCGA-BP-5001-01A-01D-1462-08 ENST00000368147 p.Q2378H SDCCAG8 chr1 243417985 243417985 Silent T T C TCGA-BP-5001-01A-01D-1462-08 ENST00000366541 p.L588L PLEKHH2 chr2 43745952 43745952 Silent A A T TCGA-BP-5001-01A-01D-1462-08 ENST00000282406 p.T1214T IL1RL1 chr2 102340274 102340274 Splice_Site T T G TCGA-BP-5001-01A-01D-1462-08 ENST00000233954 p.X149_splice KCNH7 chr2 162423388 162423388 Missense_Mutation T T G TCGA-BP-5001-01A-01D-1462-08 ENST00000332142 p.E701A SATB2 chr2 199328908 199328908 Splice_Region T T A TCGA-BP-5001-01A-01D-1462-08 ENST00000260926 p.G392G ATG16L1 chr2 233270020 233270020 Silent G G T TCGA-BP-5001-01A-01D-1462-08 ENST00000392017 p.L220L GPR35 chr2 240616476 240616476 5'Flank G G A TCGA-BP-5001-01A-01D-1462-08 ENST00000430267 ITIH3 chr3 52808613 52808613 Missense_Mutation G G A TCGA-BP-5001-01A-01D-1462-08 ENST00000449956 p.V869I MYNN chr3 169784649 169784649 Missense_Mutation G G T TCGA-BP-5001-01A-01D-1462-08 ENST00000349841 p.C504F SH3BP2 chr4 2831975 2831975 Missense_Mutation A A G TCGA-BP-5001-01A-01D-1462-08 ENST00000356331 p.E468G GUCY1B3 chr4 155802448 155802448 Missense_Mutation G G A TCGA-BP-5001-01A-01D-1462-08 ENST00000264424 p.V428M PCDHGA2 chr5 141339302 141339302 Nonsense_Mutation G G T TCGA-BP-5001-01A-01D-1462-08 ENST00000394576 p.E111* LAMA4 chr6 112191851 112191851 Splice_Site C C G TCGA-BP-5001-01A-01D-1462-08 ENST00000230538 p.X168_splice KIAA0196 chr8 125063600 125063600 Missense_Mutation T T C TCGA-BP-5001-01A-01D-1462-08 ENST00000318410 p.K444E PTCH1 chr9 95447104 95447104 Silent C C G TCGA-BP-5001-01A-01D-1462-08 ENST00000331920 p.P1384P WAC chr10 28589827 28589827 Frame_Shift_Del A A - TCGA-BP-5001-01A-01D-1462-08 ENST00000354911 p.K159Nfs*33 DDX50 chr10 68936039 68936039 Missense_Mutation A A G TCGA-BP-5001-01A-01D-1462-08 ENST00000373585 p.T519A WEE1 chr11 9577300 9577300 Intron A A C TCGA-BP-5001-01A-01D-1462-08 ENST00000450114 C11orf30 chr11 76550078 76550078 Missense_Mutation G G A TCGA-BP-5001-01A-01D-1462-08 ENST00000334736 p.D1301N CHD4 chr12 6592468 6592468 Missense_Mutation A A T TCGA-BP-5001-01A-01D-1462-08 ENST00000357008 p.L958H SLCO1A2 chr12 21301253 21301253 Silent T T A TCGA-BP-5001-01A-01D-1462-08 ENST00000307378 p.G202G PCBP2 chr12 53459335 53459335 Missense_Mutation G G A TCGA-BP-5001-01A-01D-1462-08 ENST00000439930 p.V103M GAS2L3 chr12 100623607 100623607 Missense_Mutation G G A TCGA-BP-5001-01A-01D-1462-08 ENST00000266754 p.D268N GCN1L1 chr12 120184830 120184830 Missense_Mutation C C T TCGA-BP-5001-01A-01D-1462-08 ENST00000300648 p.R60Q ELMSAN1 chr14 73737052 73737060 In_Frame_Del GACTGATGG GACTGATGG - TCGA-BP-5001-01A-01D-1462-08 ENST00000286523 p.P563_V565del ELMSAN1 chr14 73737061 73737061 Missense_Mutation C C A TCGA-BP-5001-01A-01D-1462-08 ENST00000286523 p.K562N FLRT2 chr14 85622498 85622498 Silent C C T TCGA-BP-5001-01A-01D-1462-08 ENST00000330753 p.I328I TRADD chr16 67156602 67156602 Missense_Mutation T T C TCGA-BP-5001-01A-01D-1462-08 ENST00000345057 p.E20G CHAD chr17 50465809 50465809 Missense_Mutation C C T TCGA-BP-5001-01A-01D-1462-08 ENST00000258969 p.R279H PLEKHG2 chr19 39425232 39425232 Missense_Mutation A A G TCGA-BP-5001-01A-01D-1462-08 ENST00000425673 p.T1367A GID8 chr20 62943519 62943519 Missense_Mutation C C T TCGA-BP-5001-01A-01D-1462-08 ENST00000266069 p.R114C RNF113A chrX 119870792 119870792 Silent G G A TCGA-BP-5001-01A-01D-1462-08 ENST00000371442 p.V274V OBSCN chr1 228283536 228283536 Missense_Mutation A A G TCGA-A3-A8OW-01A-11D-A36X-10 ENST00000422127 p.N2924S ASXL2 chr2 25749834 25749834 Missense_Mutation T T A TCGA-A3-A8OW-01A-11D-A36X-10 ENST00000435504 p.Q574H ANKAR chr2 189677011 189677011 Nonsense_Mutation T T A TCGA-A3-A8OW-01A-11D-A36X-10 ENST00000313581 p.L174* CXCR6 chr3 45947135 45947135 Silent G G T TCGA-A3-A8OW-01A-11D-A36X-10 ENST00000304552 p.L218L PBRM1 chr3 52644729 52644730 Frame_Shift_Del TT TT - TCGA-A3-A8OW-01A-11D-A36X-10 ENST00000296302 p.E291Dfs*3 SKIL chr3 170361141 170361142 Frame_Shift_Ins - - A TCGA-A3-A8OW-01A-11D-A36X-10 ENST00000259119 p.C272Mfs*14 TUBB chr6 30723436 30723436 Missense_Mutation A A G TCGA-A3-A8OW-01A-11D-A36X-10 ENST00000327892 p.E125G MUC17 chr7 101040057 101040057 Missense_Mutation G G A TCGA-A3-A8OW-01A-11D-A36X-10 ENST00000306151 p.V2881M GIMAP4 chr7 150572884 150572884 Missense_Mutation C C A TCGA-A3-A8OW-01A-11D-A36X-10 ENST00000255945 p.Q272K ANXA1 chr9 73169078 73169078 Missense_Mutation G G A TCGA-A3-A8OW-01A-11D-A36X-10 ENST00000257497 p.R303H NRAP chr10 113651861 113651861 Missense_Mutation G G A TCGA-A3-A8OW-01A-11D-A36X-10 ENST00000359988 p.T206M PGM2L1 chr11 74398170 74398170 5'UTR G G C TCGA-A3-A8OW-01A-11D-A36X-10 ENST00000298198 KBTBD3 chr11 106053711 106053711 Silent T T C TCGA-A3-A8OW-01A-11D-A36X-10 ENST00000526793 p.Q326Q SLC38A2 chr12 46371337 46371337 5'UTR T T C TCGA-A3-A8OW-01A-11D-A36X-10 ENST00000256689 HSP90AA1 chr14 102084721 102084722 Frame_Shift_Del TT TT - TCGA-A3-A8OW-01A-11D-A36X-10 ENST00000216281 p.K314Efs*5 C16orf58 chr16 31499393 31499393 Missense_Mutation A A G TCGA-A3-A8OW-01A-11D-A36X-10 ENST00000327237 p.I170T RNF135 chr17 30988031 30988031 Missense_Mutation C C T TCGA-A3-A8OW-01A-11D-A36X-10 ENST00000328381 p.H202Y RNMT chr18 13737130 13737130 Missense_Mutation G G A TCGA-A3-A8OW-01A-11D-A36X-10 ENST00000262173 p.C225Y GLTSCR1 chr19 47698645 47698646 Frame_Shift_Ins - - T TCGA-A3-A8OW-01A-11D-A36X-10 ENST00000396720 p.L1088Ffs*21 CLIC6 chr21 34708771 34708771 Missense_Mutation C C T TCGA-A3-A8OW-01A-11D-A36X-10 ENST00000360731 p.A579V POLA1 chrX 24748434 24748434 Missense_Mutation G G C TCGA-A3-A8OW-01A-11D-A36X-10 ENST00000379059 p.D933H MACF1 chr1 39412190 39412190 Intron A A C TCGA-CZ-5988-01A-11D-1669-08 ENST00000372915 DPH2 chr1 43972645 43972645 3'UTR C C G TCGA-CZ-5988-01A-11D-1669-08 ENST00000255108 HPDL chr1 45328338 45328338 3'UTR C C A TCGA-CZ-5988-01A-11D-1669-08 ENST00000334815 BCAR3 chr1 93567350 93567350 Missense_Mutation T T C TCGA-CZ-5988-01A-11D-1669-08 ENST00000260502 p.H743R SEMA6C chr1 151133222 151133222 Silent C C T TCGA-CZ-5988-01A-11D-1669-08 ENST00000341697 p.P685P ADAR chr1 154601716 154601716 Missense_Mutation T T A TCGA-CZ-5988-01A-11D-1669-08 ENST00000368474 p.N309I OR6N1 chr1 158766033 158766033 Missense_Mutation G G A TCGA-CZ-5988-01A-11D-1669-08 ENST00000335094 p.S217F OR2G2 chr1 247589094 247589094 Silent C C T TCGA-CZ-5988-01A-11D-1669-08 ENST00000320065 p.F245F GPR75-ASB3 chr2 53728827 53728827 Missense_Mutation T T G TCGA-CZ-5988-01A-11D-1669-08 ENST00000263634 p.K163N SPTBN1 chr2 54643072 54643072 Silent T T C TCGA-CZ-5988-01A-11D-1669-08 ENST00000356805 p.H1316H CNNM3 chr2 96826839 96826839 Frame_Shift_Del C C - TCGA-CZ-5988-01A-11D-1669-08 ENST00000305510 p.V460Wfs*2 SULT1C3 chr2 108255599 108255599 Missense_Mutation G G A TCGA-CZ-5988-01A-11D-1669-08 ENST00000329106 p.D143N ATF2 chr2 175093246 175093246 Missense_Mutation G G C TCGA-CZ-5988-01A-11D-1669-08 ENST00000264110 p.P334A TTN chr2 178568759 178568759 Silent G G A TCGA-CZ-5988-01A-11D-1669-08 ENST00000591111 p.A24150A CCDC54 chr3 107377764 107377765 Frame_Shift_Ins - - TA TCGA-CZ-5988-01A-11D-1669-08 ENST00000261058 p.D61Mfs*5 COL6A6 chr3 130574277 130574277 Missense_Mutation C C G TCGA-CZ-5988-01A-11D-1669-08 ENST00000358511 p.T1100R NCAPG chr4 17817993 17817993 Silent C C G TCGA-CZ-5988-01A-11D-1669-08 ENST00000251496 p.A341A POLR2B chr4 56994750 56994750 Missense_Mutation A A G TCGA-CZ-5988-01A-11D-1669-08 ENST00000314595 p.I154V EXOSC9 chr4 121801466 121801466 Silent A A G TCGA-CZ-5988-01A-11D-1669-08 ENST00000243498 p.L14L KLHL2 chr4 165317896 165317896 Frame_Shift_Del A A - TCGA-CZ-5988-01A-11D-1669-08 ENST00000226725 p.E561Nfs*17 FBXO4 chr5 41934277 41934277 Silent C C T TCGA-CZ-5988-01A-11D-1669-08 ENST00000281623 p.F289F MAST4 chr5 67142522 67142522 Missense_Mutation A A T TCGA-CZ-5988-01A-11D-1669-08 ENST00000403625 p.R907W KRIT1 chr7 92235695 92235695 Intron G G - TCGA-CZ-5988-01A-11D-1669-08 ENST00000340022 PON3 chr7 95390188 95390188 Missense_Mutation T T A TCGA-CZ-5988-01A-11D-1669-08 ENST00000265627 p.D56V MUC17 chr7 101040829 101040829 Missense_Mutation C C A TCGA-CZ-5988-01A-11D-1669-08 ENST00000306151 p.T3138N SLC26A5 chr7 103407954 103407954 Missense_Mutation A A G TCGA-CZ-5988-01A-11D-1669-08 ENST00000306312 p.L262P PPP1R3A chr7 113918858 113918858 Missense_Mutation C C A TCGA-CZ-5988-01A-11D-1669-08 ENST00000284601 p.D47Y NOM1 chr7 156960034 156960034 Missense_Mutation G G T TCGA-CZ-5988-01A-11D-1669-08 ENST00000275820 p.D498Y TEX15 chr8 30843022 30843022 Missense_Mutation G G A TCGA-CZ-5988-01A-11D-1669-08 ENST00000256246 p.A1999V PCSK5 chr9 76159094 76159094 Silent C C T TCGA-CZ-5988-01A-11D-1669-08 ENST00000545128 p.I514I OR52J3 chr11 5046963 5046963 Silent T T C TCGA-CZ-5988-01A-11D-1669-08 ENST00000380370 p.I146I OR2AG2 chr11 6768558 6768558 Frame_Shift_Del T T - TCGA-CZ-5988-01A-11D-1669-08 ENST00000338569 p.T134Pfs*3 SYTL2 chr11 85717644 85717644 Intron C C T TCGA-CZ-5988-01A-11D-1669-08 ENST00000528231 CEP164 chr11 117392290 117392290 Missense_Mutation C C T TCGA-CZ-5988-01A-11D-1669-08 ENST00000278935 p.A783V NEK5 chr13 52065254 52065254 3'UTR G G C TCGA-CZ-5988-01A-11D-1669-08 ENST00000355568 SLITRK5 chr13 87677569 87677569 Silent A A G TCGA-CZ-5988-01A-11D-1669-08 ENST00000325089 p.P727P TRAV7 chr14 21783015 21783015 Missense_Mutation T T C TCGA-CZ-5988-01A-11D-1669-08 ENST00000390429 p.V8A PTPN21 chr14 88517149 88517149 Missense_Mutation T T C TCGA-CZ-5988-01A-11D-1669-08 ENST00000328736 p.Y98C CHD9 chr16 53324747 53324747 Missense_Mutation T T C TCGA-CZ-5988-01A-11D-1669-08 ENST00000398510 p.I2849T SMTNL2 chr17 4597294 4597294 Missense_Mutation G G C TCGA-CZ-5988-01A-11D-1669-08 ENST00000389313 p.K410N ADORA2B chr17 15945452 15945452 Silent C C T TCGA-CZ-5988-01A-11D-1669-08 ENST00000304222 p.S68S OR1I1 chr19 15087296 15087296 Silent C C T TCGA-CZ-5988-01A-11D-1669-08 ENST00000209540 p.T77T NR2F6 chr19 17235545 17235545 Silent G G A TCGA-CZ-5988-01A-11D-1669-08 ENST00000291442 p.D298D FFAR2 chr19 35450521 35450521 Silent C C T TCGA-CZ-5988-01A-11D-1669-08 ENST00000246549 p.D269D IZUMO1 chr19 48743459 48743459 Missense_Mutation G G T TCGA-CZ-5988-01A-11D-1669-08 ENST00000332955 p.S162Y CD33 chr19 51225545 51225545 Missense_Mutation G G T TCGA-CZ-5988-01A-11D-1669-08 ENST00000262262 p.R122I NOL4L chr20 32447799 32447799 Missense_Mutation T T C TCGA-CZ-5988-01A-11D-1669-08 ENST00000359676 p.M370V ZNFX1 chr20 49257656 49257656 Missense_Mutation C C G TCGA-CZ-5988-01A-11D-1669-08 ENST00000371752 p.E809Q SON chr21 33552460 33552460 Missense_Mutation C C A TCGA-CZ-5988-01A-11D-1669-08 ENST00000356577 p.P1077T SUSD2 chr22 24183642 24183642 Silent G G T TCGA-CZ-5988-01A-11D-1669-08 ENST00000358321 p.L145L MTMR8 chrX 64268944 64268944 Missense_Mutation G G A TCGA-CZ-5988-01A-11D-1669-08 ENST00000374852 p.L570F MTOR chr1 11114354 11114354 Missense_Mutation C C T TCGA-B0-5712-01A-11D-1669-08 ENST00000361445 p.V2422I TRMT13 chr1 100148169 100148169 Nonsense_Mutation C C T TCGA-B0-5712-01A-11D-1669-08 ENST00000370141 p.Q365* BCL9 chr1 147621029 147621029 Silent C C T TCGA-B0-5712-01A-11D-1669-08 ENST00000234739 p.S958S SEMA6C chr1 151136038 151136038 Missense_Mutation T T A TCGA-B0-5712-01A-11D-1669-08 ENST00000341697 p.H411L NPR1 chr1 153680677 153680677 Missense_Mutation G G T TCGA-B0-5712-01A-11D-1669-08 ENST00000368680 p.V300F RUSC1 chr1 155320693 155320693 5'Flank G G C TCGA-B0-5712-01A-11D-1669-08 ENST00000368352 DUSP12 chr1 161752368 161752368 Frame_Shift_Del A A - TCGA-B0-5712-01A-11D-1669-08 ENST00000367943 p.E193Dfs*21 RGS18 chr1 192159285 192159285 Missense_Mutation G G A TCGA-B0-5712-01A-11D-1669-08 ENST00000367460 p.R62H SERTAD4 chr1 210241662 210241662 Silent A A C TCGA-B0-5712-01A-11D-1669-08 ENST00000367012 p.I132I ZNF692 chr1 248857261 248857261 Missense_Mutation C C T TCGA-B0-5712-01A-11D-1669-08 ENST00000306601 p.E150K MTA3 chr2 42697803 42697803 Missense_Mutation A A T TCGA-B0-5712-01A-11D-1669-08 ENST00000405094 p.S332C CNTNAP5 chr2 124798214 124798214 Silent C C G TCGA-B0-5712-01A-11D-1669-08 ENST00000431078 p.S1036S TTN chr2 178602301 178602301 Silent G G T TCGA-B0-5712-01A-11D-1669-08 ENST00000591111 p.I16726I ALS2CR11 chr2 201565795 201565795 Missense_Mutation G G A TCGA-B0-5712-01A-11D-1669-08 ENST00000286195 p.A304V COL6A3 chr2 237379208 237379208 Missense_Mutation A A C TCGA-B0-5712-01A-11D-1669-08 ENST00000295550 p.F642C ASB1 chr2 238444657 238444657 Silent G G A TCGA-B0-5712-01A-11D-1669-08 ENST00000264607 p.S270S KIF1A chr2 240766957 240766957 Nonsense_Mutation C C A TCGA-B0-5712-01A-11D-1669-08 ENST00000320389 p.E539* PBRM1 chr3 52617531 52617532 Frame_Shift_Del TC TC - TCGA-B0-5712-01A-11D-1669-08 ENST00000296302 p.N517Hfs*15 PRICKLE2 chr3 64099049 64099049 3'UTR T T C TCGA-B0-5712-01A-11D-1669-08 ENST00000295902 CLDN16 chr3 190410106 190410106 3'UTR G G A TCGA-B0-5712-01A-11D-1669-08 ENST00000264734 TFRC chr3 196068069 196068070 Nonsense_Mutation - - ATT TCGA-B0-5712-01A-11D-1669-08 ENST00000360110 p.K287_F288ins* SEPSECS chr4 25123907 25123907 3'UTR G G T TCGA-B0-5712-01A-11D-1669-08 ENST00000382103 PDZD2 chr5 32100937 32100937 Intron T T C TCGA-B0-5712-01A-11D-1669-08 ENST00000438447 PTGER4 chr5 40692496 40692496 3'UTR T T G TCGA-B0-5712-01A-11D-1669-08 ENST00000302472 MAP3K1 chr5 56888284 56888284 Missense_Mutation T T G TCGA-B0-5712-01A-11D-1669-08 ENST00000399503 p.I1439S RASGRF2 chr5 81085821 81085821 Frame_Shift_Del C C - TCGA-B0-5712-01A-11D-1669-08 ENST00000265080 p.T394Nfs*26 MCTP1 chr5 94871336 94871336 Frame_Shift_Del T T - TCGA-B0-5712-01A-11D-1669-08 ENST00000515393 p.V707Lfs*18 SLC23A1 chr5 139372080 139372080 Frame_Shift_Del A A - TCGA-B0-5712-01A-11D-1669-08 ENST00000348729 p.S575Qfs*27 DIAPH1 chr5 141517007 141517007 Splice_Region G G T TCGA-B0-5712-01A-11D-1669-08 ENST00000389054 p.A1221A LARS chr5 146130990 146130990 Intron T T C TCGA-B0-5712-01A-11D-1669-08 ENST00000394434 RBM22 chr5 150691881 150691881 Missense_Mutation C C A TCGA-B0-5712-01A-11D-1669-08 ENST00000199814 p.G378V NOP16 chr5 176384207 176384207 3'UTR T T C TCGA-B0-5712-01A-11D-1669-08 ENST00000614830 TBC1D9B chr5 179864015 179864015 Frame_Shift_Del T T - TCGA-B0-5712-01A-11D-1669-08 ENST00000356834 p.E1063Rfs*146 OR2J2 chr6 29173939 29173939 Missense_Mutation C C A TCGA-B0-5712-01A-11D-1669-08 ENST00000377167 p.L102I ZNF318 chr6 43348366 43348366 Silent G G A TCGA-B0-5712-01A-11D-1669-08 ENST00000361428 p.S1010S DST chr6 56609043 56609043 Intron C C G TCGA-B0-5712-01A-11D-1669-08 ENST00000312431 ADGRB3 chr6 69361164 69361164 Silent C C A TCGA-B0-5712-01A-11D-1669-08 ENST00000370598 p.V1297V IL20RA chr6 137001842 137001842 Frame_Shift_Del G G - TCGA-B0-5712-01A-11D-1669-08 ENST00000316649 p.L460Wfs*114 SYNE1 chr6 152236267 152236267 Missense_Mutation A A C TCGA-B0-5712-01A-11D-1669-08 ENST00000367255 p.L6746V COX19 chr7 969392 969392 Missense_Mutation C C T TCGA-B0-5712-01A-11D-1669-08 ENST00000344111 p.E87K COL1A2 chr7 94400194 94400194 Splice_Site A A T TCGA-B0-5712-01A-11D-1669-08 ENST00000297268 p.X45_splice ZAN chr7 100755316 100755316 Frame_Shift_Del A A - TCGA-B0-5712-01A-11D-1669-08 ENST00000613979 p.E1072Gfs*125 MYL10 chr7 101622199 101622199 Splice_Region G G T TCGA-B0-5712-01A-11D-1669-08 ENST00000223167 p.G117G TBXAS1 chr7 139911273 139911273 Missense_Mutation G G A TCGA-B0-5712-01A-11D-1669-08 ENST00000336425 p.M95I FER1L6 chr8 124060726 124060726 Intron C C G TCGA-B0-5712-01A-11D-1669-08 ENST00000399018 WDR5 chr9 134142377 134142377 Missense_Mutation T T G TCGA-B0-5712-01A-11D-1669-08 ENST00000358625 p.F133L CUBN chr10 17123681 17123681 Silent G G A TCGA-B0-5712-01A-11D-1669-08 ENST00000377833 p.D132D ARMC4 chr10 27860737 27860737 Missense_Mutation C C G TCGA-B0-5712-01A-11D-1669-08 ENST00000305242 p.R970P ARID5B chr10 62091612 62091612 Missense_Mutation A A G TCGA-B0-5712-01A-11D-1669-08 ENST00000279873 p.I717V ADAMTS14 chr10 70751631 70751631 Missense_Mutation A A G TCGA-B0-5712-01A-11D-1669-08 ENST00000373207 p.K861E EIF5AL1 chr10 79513029 79513029 Missense_Mutation A A G TCGA-B0-5712-01A-11D-1669-08 ENST00000520547 p.Y127C ZDHHC16 chr10 97453656 97453656 Missense_Mutation C C T TCGA-B0-5712-01A-11D-1669-08 ENST00000370854 p.A228V CALHM1 chr10 103455594 103455594 Nonsense_Mutation C C A TCGA-B0-5712-01A-11D-1669-08 ENST00000329905 p.E237* IRF7 chr11 614335 614335 Missense_Mutation G G T TCGA-B0-5712-01A-11D-1669-08 ENST00000397574 p.P173H CHID1 chr11 870149 870149 Missense_Mutation C C G TCGA-B0-5712-01A-11D-1669-08 ENST00000323578 p.R352T DENND5A chr11 9206711 9206711 Missense_Mutation C C T TCGA-B0-5712-01A-11D-1669-08 ENST00000328194 p.V85I C11orf58 chr11 16752822 16752822 Silent T T A TCGA-B0-5712-01A-11D-1669-08 ENST00000228136 p.S82S HTATIP2 chr11 20382225 20382225 Silent T T C TCGA-B0-5712-01A-11D-1669-08 ENST00000421577 p.S163S DAK chr11 61341874 61341874 Missense_Mutation C C A TCGA-B0-5712-01A-11D-1669-08 ENST00000394900 p.T206N MYRF chr11 61781764 61781764 Nonsense_Mutation C C T TCGA-B0-5712-01A-11D-1669-08 ENST00000278836 p.R986* SLC22A9 chr11 63409851 63409851 Missense_Mutation A A G TCGA-B0-5712-01A-11D-1669-08 ENST00000279178 p.T551A MAP3K11 chr11 65613069 65613069 Missense_Mutation G G A TCGA-B0-5712-01A-11D-1669-08 ENST00000309100 p.H230Y MYO7A chr11 77198518 77198518 Missense_Mutation G G A TCGA-B0-5712-01A-11D-1669-08 ENST00000409709 p.V1489I INTS4 chr11 77960984 77960984 Frame_Shift_Del G G - TCGA-B0-5712-01A-11D-1669-08 ENST00000534064 p.P209Hfs*8 HSPA8 chr11 123060190 123060190 Missense_Mutation T T C TCGA-B0-5712-01A-11D-1669-08 ENST00000227378 p.I164V NECAP1 chr12 8081358 8081358 5'Flank A A C TCGA-B0-5712-01A-11D-1669-08 ENST00000339754 DDX47 chr12 12824712 12824712 Intron A A T TCGA-B0-5712-01A-11D-1669-08 ENST00000358007 LRRK2 chr12 40363478 40363478 Missense_Mutation A A G TCGA-B0-5712-01A-11D-1669-08 ENST00000298910 p.N2369D PDZRN4 chr12 41573836 41573836 Missense_Mutation G G C TCGA-B0-5712-01A-11D-1669-08 ENST00000402685 p.K1019N TUBA1C chr12 49272999 49272999 Silent T T C TCGA-B0-5712-01A-11D-1669-08 ENST00000301072 p.A374A CSRNP2 chr12 51074022 51074022 Missense_Mutation A A T TCGA-B0-5712-01A-11D-1669-08 ENST00000228515 p.V71E TNS2 chr12 53059109 53059109 Frame_Shift_Del C C - TCGA-B0-5712-01A-11D-1669-08 ENST00000314250 p.R491Gfs*29 RARG chr12 53227396 53227396 Silent G G C TCGA-B0-5712-01A-11D-1669-08 ENST00000425354 p.G50G EEA1 chr12 92799053 92799053 Missense_Mutation T T C TCGA-B0-5712-01A-11D-1669-08 ENST00000322349 p.M936V TMED2 chr12 123584763 123584763 Missense_Mutation A A G TCGA-B0-5712-01A-11D-1669-08 ENST00000262225 p.M43V ATP6V0A2 chr12 123733968 123733968 Missense_Mutation G G C TCGA-B0-5712-01A-11D-1669-08 ENST00000330342 p.G231R TUBGCP3 chr13 112526962 112526962 Missense_Mutation G G A TCGA-B0-5712-01A-11D-1669-08 ENST00000261965 p.S512F CPNE6 chr14 24076136 24076136 Intron C C G TCGA-B0-5712-01A-11D-1669-08 ENST00000397016 RTN1 chr14 59603123 59603123 Missense_Mutation C C A TCGA-B0-5712-01A-11D-1669-08 ENST00000267484 p.A744S MAX chr14 65078009 65078009 Frame_Shift_Del C C - TCGA-B0-5712-01A-11D-1669-08 ENST00000358664 p.A67Pfs*103 ADAM20 chr14 70524771 70524771 Missense_Mutation T T G TCGA-B0-5712-01A-11D-1669-08 ENST00000256389 p.N46T YLPM1 chr14 74764243 74764244 Frame_Shift_Ins - - C TCGA-B0-5712-01A-11D-1669-08 ENST00000325680 p.G255Wfs*3 RPAP1 chr15 41531132 41531132 Silent C C T TCGA-B0-5712-01A-11D-1669-08 ENST00000304330 p.E278E MYO9A chr15 72046626 72046626 5'UTR G G A TCGA-B0-5712-01A-11D-1669-08 ENST00000356056 MCTP2 chr15 94398979 94398979 Frame_Shift_Del A A - TCGA-B0-5712-01A-11D-1669-08 ENST00000357742 p.N603Ifs*5 CIITA chr16 10903897 10903897 Splice_Site T T A TCGA-B0-5712-01A-11D-1669-08 ENST00000324288 p.X313_splice SEPHS2 chr16 30444438 30444438 Silent G G T TCGA-B0-5712-01A-11D-1669-08 ENST00000478753 p.A430A NUDT21 chr16 56439740 56439740 Missense_Mutation C C G TCGA-B0-5712-01A-11D-1669-08 ENST00000300291 p.G130R NEURL4 chr17 7325671 7325671 Missense_Mutation G G T TCGA-B0-5712-01A-11D-1669-08 ENST00000399464 p.L446I SUPT6H chr17 28673488 28673488 Missense_Mutation A A C TCGA-B0-5712-01A-11D-1669-08 ENST00000314616 p.K29N SSH2 chr17 29695514 29695515 Frame_Shift_Ins - - G TCGA-B0-5712-01A-11D-1669-08 ENST00000269033 p.Q74Pfs*40 MAPT chr17 46014315 46014315 Missense_Mutation C C T TCGA-B0-5712-01A-11D-1669-08 ENST00000262410 p.H647Y KPNB1 chr17 47669807 47669807 Silent C C T TCGA-B0-5712-01A-11D-1669-08 ENST00000290158 p.L452L RAD51C chr17 58732601 58732602 Intron AG AG - TCGA-B0-5712-01A-11D-1669-08 ENST00000337432 CNDP2 chr18 74513565 74513565 Nonsense_Mutation T T A TCGA-B0-5712-01A-11D-1669-08 ENST00000324262 p.L250* CNDP1 chr18 74580128 74580128 Splice_Site A A G TCGA-B0-5712-01A-11D-1669-08 ENST00000358821 p.X390_splice THOP1 chr19 2794800 2794800 Missense_Mutation C C T TCGA-B0-5712-01A-11D-1669-08 ENST00000307741 p.S89F CATSPERG chr19 38367269 38367269 Silent C C T TCGA-B0-5712-01A-11D-1669-08 ENST00000409235 p.C909C ARHGAP35 chr19 46920777 46920777 Missense_Mutation T T C TCGA-B0-5712-01A-11D-1669-08 ENST00000404338 p.I701T DNMT3B chr20 32795525 32795525 Missense_Mutation C C A TCGA-B0-5712-01A-11D-1669-08 ENST00000328111 p.Q415K TTI1 chr20 38013754 38013754 Silent G G T TCGA-B0-5712-01A-11D-1669-08 ENST00000373447 p.L21L CHRNA4 chr20 63349714 63349714 Missense_Mutation C C T TCGA-B0-5712-01A-11D-1669-08 ENST00000370263 p.R566Q REPS2 chrX 17068413 17068414 Frame_Shift_Ins - - A TCGA-B0-5712-01A-11D-1669-08 ENST00000357277 p.D409Rfs*4 CNKSR2 chrX 21501528 21501528 Silent A A C TCGA-B0-5712-01A-11D-1669-08 ENST00000379510 p.A250A CACNA1F chrX 49233335 49233335 5'UTR C C T TCGA-B0-5712-01A-11D-1669-08 ENST00000376265 EFNB1 chrX 68840403 68840403 Nonsense_Mutation A A T TCGA-B0-5712-01A-11D-1669-08 ENST00000204961 p.K264* ERCC6L chrX 72207735 72207735 Silent T T C TCGA-B0-5712-01A-11D-1669-08 ENST00000334463 p.R344R AMMECR1 chrX 110225034 110225034 Intron C C T TCGA-B0-5712-01A-11D-1669-08 ENST00000262844 KLHL13 chrX 117909379 117909379 Missense_Mutation T T C TCGA-B0-5712-01A-11D-1669-08 ENST00000262820 p.K430E THOC2 chrX 123614155 123614156 Frame_Shift_Ins - - TGGACAGTGG TCGA-B0-5712-01A-11D-1669-08 ENST00000245838 p.K1449Tfs*6 STAG2 chrX 124066420 124066430 Frame_Shift_Del AAAGCAGCTCT AAAGCAGCTCT - TCGA-B0-5712-01A-11D-1669-08 ENST00000371144 p.E750Dfs*31 TENM1 chrX 124383923 124383923 Missense_Mutation G G T TCGA-B0-5712-01A-11D-1669-08 ENST00000371130 p.S2329R CDR1 chrX 140783912 140783912 Missense_Mutation C C T TCGA-B0-5712-01A-11D-1669-08 ENST00000370532 p.R152K HMGCL chr1 23802309 23802309 3'UTR C C T TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000374490 CLCA1 chr1 86499687 86499687 Missense_Mutation T T G TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000234701 p.I796S HDGF chr1 156752137 156752138 5'Flank - - TC TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000357325 CD1D chr1 158182894 158182894 Missense_Mutation G G C TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000368171 p.W208C OR2AK2 chr1 247965678 247965678 Missense_Mutation C C T TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000366480 p.T116M CLHC1 chr2 55209475 55209475 Missense_Mutation C C A TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000401408 p.W248L RGPD8 chr2 112389742 112389742 Missense_Mutation C C G TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000302558 p.R1068T TTL chr2 112494291 112494299 In_Frame_Del GAATTCTTT GAATTCTTT - TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000233336 p.E129_F131del TTL chr2 112494301 112494301 Missense_Mutation T T C TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000233336 p.L132P PROC chr2 127423058 127423058 Missense_Mutation C C T TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000234071 p.P96L UBR3 chr2 169924086 169924086 Splice_Region T T C TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000272793 p.A645A IKZF2 chr2 213013887 213013887 Missense_Mutation T T G TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000434687 p.N254H VHL chr3 10142089 10142090 Frame_Shift_Ins - - A TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000256474 p.R82Afs*50 SETD2 chr3 47042656 47042656 Frame_Shift_Del G G - TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000409792 p.S2382Lfs*29 SETD2 chr3 47042661 47042661 Missense_Mutation G G T TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000409792 p.P2380T PBRM1 chr3 52634678 52634678 Frame_Shift_Del A A - TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000296302 p.Y409Tfs*29 LRRC66 chr4 51995798 51995799 Frame_Shift_Ins - - T TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000343457 p.C409Vfs*20 CDS1 chr4 84604352 84604352 Missense_Mutation T T G TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000295887 p.L76R UNC5C chr4 95216134 95216134 Missense_Mutation C C T TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000453304 p.E575K NR3C2 chr4 148154681 148154681 Missense_Mutation A A C TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000344721 p.I745M SUB1 chr5 32601055 32601055 Missense_Mutation G G A TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000265073 p.D119N PTCD2 chr5 72331330 72331330 Silent C C T TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000308077 p.Y141Y TTC37 chr5 95498513 95498513 Silent C C T TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000358746 p.L1140L PCDHGA10 chr5 141413639 141413639 Missense_Mutation G G A TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000398610 p.R155H RASGEF1C chr5 180118654 180118654 Silent G G A TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000361132 p.R346R DSP chr6 7583785 7583785 Missense_Mutation C C A TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000379802 p.P2175T FUT9 chr6 96208597 96208597 3'UTR G G T TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000302103 STX11 chr6 144186639 144186639 Silent G G A TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000367568 p.R4R PARP12 chr7 140037766 140037766 Missense_Mutation C C A TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000263549 p.A425S EMC2 chr8 108475929 108475929 Missense_Mutation C C A TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000220853 p.P186Q RECK chr9 36117092 36117092 Frame_Shift_Del T T - TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000377966 p.C724Vfs*109 GOLGA1 chr9 124938629 124938629 Missense_Mutation G G C TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000373555 p.S28C PTCHD3 chr10 27398861 27398861 Silent A A T TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000438700 p.T579T BAMBI chr10 28681996 28681997 Frame_Shift_Ins - - T TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000375533 p.Y127Lfs*4 BAMBI chr10 28681998 28681998 Missense_Mutation A A T TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000375533 p.Y127F PCDH15 chr10 53821684 53821684 3'UTR G G C TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000320301 ANKRD1 chr10 90915799 90915799 Missense_Mutation G G A TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000371697 p.L245F CPEB3 chr10 92180962 92180963 Frame_Shift_Ins - - T TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000265997 p.N408Kfs*6 PKD2L1 chr10 100288472 100288472 Missense_Mutation G G A TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000318222 p.P781L SOX5 chr12 23846063 23846063 Missense_Mutation C C T TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000451604 p.R134Q MYL6 chr12 56160838 56160838 3'UTR A A T TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000548293 CAND1 chr12 67297522 67297522 Missense_Mutation G G C TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000545606 p.V203L ANKS1B chr12 99399719 99399719 Nonsense_Mutation G G T TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000547776 p.C556* CMKLR1 chr12 108292661 108292661 Missense_Mutation A A G TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000312143 p.M101T FNDC3A chr13 49146131 49146131 Intron A A - TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000492622 TM9SF2 chr13 99501571 99501571 5'UTR C C A TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000376387 RASA3 chr13 114073719 114073719 Splice_Site C C T TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000334062 p.X58_splice MAX chr14 65078018 65078024 Frame_Shift_Del GGATTTG GGATTTG - TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000358664 p.Q62* MAP3K9 chr14 70732767 70732767 Nonsense_Mutation C C A TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000554752 p.E868* TMEM251 chr14 93185406 93185407 Frame_Shift_Ins - - T TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000415050 p.M7Ifs*12 RTL1 chr14 100882493 100882493 Missense_Mutation C C G TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000534062 p.D766H TLN2 chr15 62707221 62707221 Missense_Mutation C C G TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000306829 p.L714V SLC28A1 chr15 84895423 84895423 Intron T T A TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000286749 RGS11 chr16 274991 274991 Silent C C T TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000397770 p.T101T ITPRIPL2 chr16 19120758 19120758 3'UTR G G A TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000381440 ACSM1 chr16 20691044 20691044 Missense_Mutation A A C TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000307493 p.F49V SLC5A11 chr16 24877362 24877362 Splice_Region T T C TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000347898 p.A194A FOXL1 chr16 86580035 86580035 3'UTR C C T TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000320241 SGK494 chr17 28613491 28613491 Silent G G C TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000301037 p.L91L INTS2 chr17 61927840 61927840 Intron G G C TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000444766 BPTF chr17 67854137 67854137 Missense_Mutation T T C TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000321892 p.C271R ICT1 chr17 75012708 75012708 Missense_Mutation C C T TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000301585 p.R8C SLC25A52 chr18 31759714 31759726 3'UTR TCTTCTTAGAAGG TCTTCTTAGAAGG - TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000269205 MEP1B chr18 32210618 32210618 Missense_Mutation A A G TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000269202 p.Y346C MALT1 chr18 58723073 58723073 Silent A A T TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000348428 p.I348I DOT1L chr19 2227018 2227018 Silent C C T TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000398665 p.S1499S HOOK2 chr19 12763369 12763369 Silent C C G TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000397668 p.L691L ZSCAN5A chr19 56223764 56223764 Missense_Mutation G G C TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000391713 p.S152C VN1R1 chr19 57456450 57456450 Missense_Mutation T T G TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000321039 p.M13L LAMA5 chr20 62327548 62327548 Missense_Mutation G G A TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000252999 p.S1640L LTN1 chr21 28947487 28947487 Missense_Mutation T T G TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000361371 p.K1155T MID1 chrX 10567136 10567136 Nonsense_Mutation C C A TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000317552 p.E138* EBP chrX 48523811 48523811 Nonsense_Mutation C C T TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000495186 p.Q14* HDAC6 chrX 48806311 48806311 Intron G G T TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000334136 AGTR2 chrX 116172709 116172709 Silent C C T TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000371906 p.Y143Y IGSF1 chrX 131277116 131277116 Missense_Mutation A A G TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000361420 p.Y811H PLXNA3 chrX 154467245 154467245 Missense_Mutation T T C TCGA-G6-A8L6-01A-11D-A36X-10 ENST00000369682 p.I1072T HNRNPCL1 chr1 12847503 12847503 Missense_Mutation C C T TCGA-A3-3320-01A-01D-0966-08 ENST00000317869 p.G263R TMCO4 chr1 19683255 19683255 Missense_Mutation C C G TCGA-A3-3320-01A-01D-0966-08 ENST00000294543 p.G564R ARID1A chr1 26773361 26773361 Missense_Mutation C C A TCGA-A3-3320-01A-01D-0966-08 ENST00000324856 p.P1244H TXLNA chr1 32195175 32195175 Missense_Mutation C C T TCGA-A3-3320-01A-01D-0966-08 ENST00000373609 p.P541S TTC22 chr1 54786019 54786019 Silent T T C TCGA-A3-3320-01A-01D-0966-08 ENST00000371276 p.P328P LRRC7 chr1 69678402 69678402 Silent A A G TCGA-A3-3320-01A-01D-0966-08 ENST00000370958 p.G8G FLG chr1 152307462 152307462 Missense_Mutation C C G TCGA-A3-3320-01A-01D-0966-08 ENST00000368799 p.G2475A PGLYRP3 chr1 153302517 153302517 Missense_Mutation A A G TCGA-A3-3320-01A-01D-0966-08 ENST00000290722 p.I207T AFTPH chr2 64552750 64552750 Missense_Mutation G G C TCGA-A3-3320-01A-01D-0966-08 ENST00000238855 p.D426H SLC9A4 chr2 102478954 102478954 Silent C C A TCGA-A3-3320-01A-01D-0966-08 ENST00000295269 p.V124V NFE2L2 chr2 177232371 177232371 Intron A A G TCGA-A3-3320-01A-01D-0966-08 ENST00000397062 PDE11A chr2 177711859 177711859 Missense_Mutation A A T TCGA-A3-3320-01A-01D-0966-08 ENST00000286063 p.I688N TTN chr2 178717596 178717596 Silent G G A TCGA-A3-3320-01A-01D-0966-08 ENST00000591111 p.H8109H COL5A2 chr2 189049387 189049387 Missense_Mutation G G A TCGA-A3-3320-01A-01D-0966-08 ENST00000374866 p.P1036L DLEC1 chr3 38122419 38122419 3'UTR G G A TCGA-A3-3320-01A-01D-0966-08 ENST00000308059 PBRM1 chr3 52615357 52615357 Nonsense_Mutation T T A TCGA-A3-3320-01A-01D-0966-08 ENST00000296302 p.K640* ILDR1 chr3 122005351 122005351 Missense_Mutation T T A TCGA-A3-3320-01A-01D-0966-08 ENST00000344209 p.D91V CNBP chr3 129171180 129171180 Silent G G A TCGA-A3-3320-01A-01D-0966-08 ENST00000422453 p.G105G ATR chr3 142449486 142449486 Frame_Shift_Del T T - TCGA-A3-3320-01A-01D-0966-08 ENST00000350721 p.A2627Lfs*28 P2RY13 chr3 151328074 151328074 Missense_Mutation G G T TCGA-A3-3320-01A-01D-0966-08 ENST00000325602 p.L328I SLC33A1 chr3 155828299 155828299 Nonsense_Mutation C C A TCGA-A3-3320-01A-01D-0966-08 ENST00000359479 p.G521* MCCC1 chr3 183015278 183015278 3'UTR G G A TCGA-A3-3320-01A-01D-0966-08 ENST00000265594 EIF4E chr4 98901962 98901962 Missense_Mutation A A T TCGA-A3-3320-01A-01D-0966-08 ENST00000450253 p.N13K MAST4 chr5 67166528 67166528 Missense_Mutation G G A TCGA-A3-3320-01A-01D-0966-08 ENST00000403625 p.R2450Q NREP chr5 111735499 111735499 Nonsense_Mutation G G T TCGA-A3-3320-01A-01D-0966-08 ENST00000257435 p.Y4* LTC4S chr5 179795878 179795878 Intron G G C TCGA-A3-3320-01A-01D-0966-08 ENST00000292596 GPANK1 chr6 31664330 31664330 Missense_Mutation T T C TCGA-A3-3320-01A-01D-0966-08 ENST00000375906 p.D50G UHRF1BP1 chr6 34821678 34821678 Nonsense_Mutation A A T TCGA-A3-3320-01A-01D-0966-08 ENST00000192788 p.K24* XPO5 chr6 43547703 43547703 Silent G G A TCGA-A3-3320-01A-01D-0966-08 ENST00000265351 p.L689L SIM1 chr6 100393588 100393588 Missense_Mutation C C A TCGA-A3-3320-01A-01D-0966-08 ENST00000262901 p.W490L PHF10 chr6 169714808 169714808 Frame_Shift_Del A A - TCGA-A3-3320-01A-01D-0966-08 ENST00000339209 p.L243Cfs*37 TRIM4 chr7 99901998 99901998 Intron C C G TCGA-A3-3320-01A-01D-0966-08 ENST00000355947 PRKRIP1 chr7 102364330 102364330 5'UTR C C A TCGA-A3-3320-01A-01D-0966-08 ENST00000496391 PTK2 chr8 140717652 140717652 Missense_Mutation T T A TCGA-A3-3320-01A-01D-0966-08 ENST00000521059 p.R696S CPSF1 chr8 144398537 144398537 Missense_Mutation T T A TCGA-A3-3320-01A-01D-0966-08 ENST00000616140 p.E580D ATP8B5P chr9 35449949 35449949 RNA G G C TCGA-A3-3320-01A-01D-0966-08 ENST00000430846 C9orf3 chr9 94760716 94760716 Intron A A G TCGA-A3-3320-01A-01D-0966-08 ENST00000375315 KIAA0368 chr9 111372461 111372461 Nonsense_Mutation A A T TCGA-A3-3320-01A-01D-0966-08 ENST00000338205 p.L1499* LHX2 chr9 124021281 124021281 Missense_Mutation G G T TCGA-A3-3320-01A-01D-0966-08 ENST00000373615 p.G304C CRAT chr9 129110579 129110579 5'UTR G G A TCGA-A3-3320-01A-01D-0966-08 ENST00000318080 SEC16A chr9 136474812 136474812 Missense_Mutation T T C TCGA-A3-3320-01A-01D-0966-08 ENST00000313050 p.E935G PTGDS chr9 136979083 136979083 Missense_Mutation G G A TCGA-A3-3320-01A-01D-0966-08 ENST00000371625 p.V69M FAM166A chr9 137245513 137245513 Missense_Mutation G G A TCGA-A3-3320-01A-01D-0966-08 ENST00000344774 p.P106S OIT3 chr10 72924345 72924345 Nonsense_Mutation C C A TCGA-A3-3320-01A-01D-0966-08 ENST00000334011 p.C356* PCGF5 chr10 91251386 91251387 Frame_Shift_Del TA TA - TCGA-A3-3320-01A-01D-0966-08 ENST00000336126 p.I141Lfs*8 PGAM1 chr10 97426329 97426329 Missense_Mutation C C G TCGA-A3-3320-01A-01D-0966-08 ENST00000334828 p.L8V OR52N2 chr11 5820510 5820510 Silent C C A TCGA-A3-3320-01A-01D-0966-08 ENST00000317037 p.R59R NR1H3 chr11 47267964 47267964 Missense_Mutation A A C TCGA-A3-3320-01A-01D-0966-08 ENST00000441012 p.N347T TNKS1BP1 chr11 57309862 57309862 Frame_Shift_Del T T - TCGA-A3-3320-01A-01D-0966-08 ENST00000358252 p.Q950Rfs*9 TMEM132A chr11 60933592 60933592 Silent C C A TCGA-A3-3320-01A-01D-0966-08 ENST00000453848 p.G469G RCOR2 chr11 63912485 63912485 Silent C C T TCGA-A3-3320-01A-01D-0966-08 ENST00000301459 p.G359G PPFIA1 chr11 70338453 70338453 Missense_Mutation G G A TCGA-A3-3320-01A-01D-0966-08 ENST00000253925 p.G524D CEP295 chr11 93732500 93732500 3'Flank A A C TCGA-A3-3320-01A-01D-0966-08 ENST00000325212 CEP164 chr11 117409866 117409866 Missense_Mutation C C A TCGA-A3-3320-01A-01D-0966-08 ENST00000278935 p.Q1333K SORL1 chr11 121566991 121566991 Missense_Mutation C C A TCGA-A3-3320-01A-01D-0966-08 ENST00000260197 p.A1034D CHPT1 chr12 101714155 101714155 Silent T T A TCGA-A3-3320-01A-01D-0966-08 ENST00000229266 p.I113I TPTE2 chr13 19425003 19425003 Nonsense_Mutation G G C TCGA-A3-3320-01A-01D-0966-08 ENST00000400230 p.Y470* METTL21C chr13 102690875 102690876 Frame_Shift_Ins - - A TCGA-A3-3320-01A-01D-0966-08 ENST00000267273 p.A74Cfs*45 SLC7A8 chr14 23128185 23128185 Silent C C G TCGA-A3-3320-01A-01D-0966-08 ENST00000316902 p.L425L ADAM21 chr14 70458292 70458292 Missense_Mutation A A T TCGA-A3-3320-01A-01D-0966-08 ENST00000603540 p.N265Y FLRT2 chr14 85623297 85623297 Nonsense_Mutation A A T TCGA-A3-3320-01A-01D-0966-08 ENST00000330753 p.K595* TTBK2 chr15 42801129 42801129 Intron C C A TCGA-A3-3320-01A-01D-0966-08 ENST00000267890 GCNT3 chr15 59618367 59618367 Silent G G A TCGA-A3-3320-01A-01D-0966-08 ENST00000396065 p.E43E HERC1 chr15 63623743 63623743 Silent G G T TCGA-A3-3320-01A-01D-0966-08 ENST00000443617 p.T4531T CAPN15 chr16 546909 546909 Missense_Mutation C C A TCGA-A3-3320-01A-01D-0966-08 ENST00000219611 p.S24Y WDR90 chr16 650616 650616 Missense_Mutation C C G TCGA-A3-3320-01A-01D-0966-08 ENST00000293879 p.L156V GRIN2A chr16 9763020 9763021 3'Flank AA AA - TCGA-A3-3320-01A-01D-0966-08 ENST00000330684 PRMT7 chr16 68352302 68352302 Frame_Shift_Del A A - TCGA-A3-3320-01A-01D-0966-08 ENST00000339507 p.N490Tfs*21 BCAR1 chr16 75243003 75243003 Nonsense_Mutation C C A TCGA-A3-3320-01A-01D-0966-08 ENST00000162330 p.E34* BCAR1 chr16 75243004 75243004 Silent C C A TCGA-A3-3320-01A-01D-0966-08 ENST00000162330 p.L33L SPIRE2 chr16 89863577 89863577 Missense_Mutation C C A TCGA-A3-3320-01A-01D-0966-08 ENST00000378247 p.N559K TVP23C chr17 15545901 15545901 Missense_Mutation T T A TCGA-A3-3320-01A-01D-0966-08 ENST00000225576 p.N116Y TCAP chr17 39665365 39665365 Silent T T A TCGA-A3-3320-01A-01D-0966-08 ENST00000309889 p.A2A KANSL1 chr17 46050606 46050615 Frame_Shift_Del GTGAATTTCG GTGAATTTCG - TCGA-A3-3320-01A-01D-0966-08 ENST00000574590 p.E647Mfs*20 CA10 chr17 51649180 51649180 Splice_Site A A G TCGA-A3-3320-01A-01D-0966-08 ENST00000285273 p.X212_splice ITGB4 chr17 75749002 75749002 Silent C C T TCGA-A3-3320-01A-01D-0966-08 ENST00000200181 p.H1091H DNAH17 chr17 78486406 78486406 Missense_Mutation G G T TCGA-A3-3320-01A-01D-0966-08 ENST00000389840 p.R2307S PPAN-P2RY11 chr19 10114548 10114548 Missense_Mutation T T C TCGA-A3-3320-01A-01D-0966-08 ENST00000393796 p.L732P RAB3D chr19 11325576 11325576 Missense_Mutation A A T TCGA-A3-3320-01A-01D-0966-08 ENST00000222120 p.F161Y ZNF714 chr19 21117599 21117599 Missense_Mutation C C A TCGA-A3-3320-01A-01D-0966-08 ENST00000456283 p.S312Y NPAS1 chr19 47036048 47036048 Missense_Mutation C C A TCGA-A3-3320-01A-01D-0966-08 ENST00000449844 p.P203T ZNF749 chr19 57444569 57444569 Missense_Mutation A A G TCGA-A3-3320-01A-01D-0966-08 ENST00000334181 p.K474R RSPO4 chr20 967991 967991 Missense_Mutation C C G TCGA-A3-3320-01A-01D-0966-08 ENST00000217260 p.G76A XKR7 chr20 31968422 31968422 Missense_Mutation C C G TCGA-A3-3320-01A-01D-0966-08 ENST00000562532 p.L83V TST chr22 37018169 37018169 Missense_Mutation G G C TCGA-A3-3320-01A-01D-0966-08 ENST00000249042 p.F188L POLR3H chr22 41530700 41530700 Frame_Shift_Del G G - TCGA-A3-3320-01A-01D-0966-08 ENST00000355209 p.P183Rfs*61 MEI1 chr22 41784383 41784383 Silent T T C TCGA-A3-3320-01A-01D-0966-08 ENST00000401548 p.A1044A ITIH6 chrX 54758867 54758867 Missense_Mutation C C T TCGA-A3-3320-01A-01D-0966-08 ENST00000218436 p.G403S EDA chrX 69616765 69616765 Intron C C G TCGA-A3-3320-01A-01D-0966-08 ENST00000374552 PGK1 chrX 78124899 78124899 Missense_Mutation G G A TCGA-A3-3320-01A-01D-0966-08 ENST00000373316 p.S321N ZCCHC5 chrX 78657554 78657554 Missense_Mutation C C A TCGA-A3-3320-01A-01D-0966-08 ENST00000321110 p.W289C BCORL1 chrX 130014468 130014468 Missense_Mutation C C A TCGA-A3-3320-01A-01D-0966-08 ENST00000218147 p.P566T OVGP1 chr1 111425417 111425417 Silent G G A TCGA-AK-3447-01A-01W-0886-08 ENST00000369732 p.L95L ETV3L chr1 157092664 157092664 Silent G G T TCGA-AK-3447-01A-01W-0886-08 ENST00000454449 p.P357P DISP1 chr1 223003665 223003665 Silent G G A TCGA-AK-3447-01A-01W-0886-08 ENST00000284476 p.R756R ASXL2 chr2 25744003 25744004 Frame_Shift_Ins - - G TCGA-AK-3447-01A-01W-0886-08 ENST00000435504 p.V779Sfs*25 ITIH4 chr3 52825888 52825888 Nonsense_Mutation G G A TCGA-AK-3447-01A-01W-0886-08 ENST00000266041 p.Q253* SLITRK3 chr3 165189510 165189510 Missense_Mutation T T C TCGA-AK-3447-01A-01W-0886-08 ENST00000241274 p.N441D LIAS chr4 39467565 39467565 Missense_Mutation A A C TCGA-AK-3447-01A-01W-0886-08 ENST00000261434 p.D219A NAA15 chr4 139359879 139359879 Missense_Mutation G G T TCGA-AK-3447-01A-01W-0886-08 ENST00000296543 p.C465F ADAMTS2 chr5 179135946 179135946 Missense_Mutation T C C TCGA-AK-3447-01A-01W-0886-08 ENST00000251582 p.K683R DSP chr6 7568587 7568587 Nonsense_Mutation C C T TCGA-AK-3447-01A-01W-0886-08 ENST00000379802 p.Q473* KLHDC10 chr7 130122127 130122127 Missense_Mutation A A T TCGA-AK-3447-01A-01W-0886-08 ENST00000335420 p.H235L FRRS1L chr9 109137615 109137615 Missense_Mutation C C T TCGA-AK-3447-01A-01W-0886-08 ENST00000561981 p.R292Q TRUB2 chr9 128309634 128309634 Silent G G T TCGA-AK-3447-01A-01W-0886-08 ENST00000372890 p.T304T IGHV3-15 chr14 106154137 106154137 5'UTR C C T TCGA-AK-3447-01A-01W-0886-08 ENST00000390603 SNRNP25 chr16 56598 56598 Missense_Mutation G G T TCGA-AK-3447-01A-01W-0886-08 ENST00000383018 p.R109I CACNA1H chr16 1198758 1198758 Missense_Mutation G G T TCGA-AK-3447-01A-01W-0886-08 ENST00000348261 p.D263Y NMRAL1 chr16 4461942 4461942 Silent G G A TCGA-AK-3447-01A-01W-0886-08 ENST00000283429 p.Y246Y RSL1D1 chr16 11841731 11841731 Missense_Mutation T T G TCGA-AK-3447-01A-01W-0886-08 ENST00000571133 p.E273D SLC47A1 chr17 19577434 19577434 Nonsense_Mutation C C T TCGA-AK-3447-01A-01W-0886-08 ENST00000270570 p.Q532* ORMDL3 chr17 39923252 39923252 Silent G G A TCGA-AK-3447-01A-01W-0886-08 ENST00000304046 p.I62I ITGB4 chr17 75743810 75743810 Silent G G A TCGA-AK-3447-01A-01W-0886-08 ENST00000200181 p.G1020G ABCA7 chr19 1062197 1062197 Missense_Mutation C C T TCGA-AK-3447-01A-01W-0886-08 ENST00000263094 p.H1866Y B3GNT3 chr19 17811726 17811726 Silent C C T TCGA-AK-3447-01A-01W-0886-08 ENST00000318683 p.N241N TM9SF4 chr20 32157864 32157864 Missense_Mutation G G T TCGA-AK-3447-01A-01W-0886-08 ENST00000398022 p.G467V NIPAL3 chr1 24440200 24440200 Missense_Mutation T T A TCGA-BP-5180-01A-01D-1429-08 ENST00000374399 p.I41N IPP chr1 45719310 45719310 Missense_Mutation G G C TCGA-BP-5180-01A-01D-1429-08 ENST00000396478 p.T360S IPP chr1 45719311 45719311 Missense_Mutation T T A TCGA-BP-5180-01A-01D-1429-08 ENST00000396478 p.T360S C2orf44 chr2 24038154 24038154 Silent G G C TCGA-BP-5180-01A-01D-1429-08 ENST00000295148 p.T447T SCN1A chr2 166013784 166013784 Missense_Mutation G G T TCGA-BP-5180-01A-01D-1429-08 ENST00000303395 p.T1222N CASP10 chr2 201185898 201185898 Frame_Shift_Del T T - TCGA-BP-5180-01A-01D-1429-08 ENST00000272879 p.L42Sfs*3 PLEKHM3 chr2 208001688 208001688 5'UTR G G A TCGA-BP-5180-01A-01D-1429-08 ENST00000427836 DOCK10 chr2 224845585 224845585 Missense_Mutation A A C TCGA-BP-5180-01A-01D-1429-08 ENST00000258390 p.Y765D VHL chr3 10142063 10142063 Silent C C A TCGA-BP-5180-01A-01D-1429-08 ENST00000256474 p.S72S VHL chr3 10142064 10142064 Nonsense_Mutation C C T TCGA-BP-5180-01A-01D-1429-08 ENST00000256474 p.Q73* PBRM1 chr3 52603695 52603695 Nonsense_Mutation G G A TCGA-BP-5180-01A-01D-1429-08 ENST00000296302 p.Q869* ROBO2 chr3 77617554 77617554 Missense_Mutation C C G TCGA-BP-5180-01A-01D-1429-08 ENST00000461745 p.T1112S LINC01565 chr3 128573216 128573216 RNA C C T TCGA-BP-5180-01A-01D-1429-08 ENST00000356020 DNAJC21 chr5 34935786 34935787 Frame_Shift_Del CG CG - TCGA-BP-5180-01A-01D-1429-08 ENST00000342382 p.R90Lfs*13 KIF2A chr5 62381191 62381191 Missense_Mutation C C T TCGA-BP-5180-01A-01D-1429-08 ENST00000401507 p.S658L PCDHA12 chr5 140876321 140876321 Missense_Mutation G G A TCGA-BP-5180-01A-01D-1429-08 ENST00000398631 p.M283I CLIC1 chr6 31736404 31736404 5'UTR G G C TCGA-BP-5180-01A-01D-1429-08 ENST00000375779 RAB32 chr6 146554553 146554553 Frame_Shift_Del T T - TCGA-BP-5180-01A-01D-1429-08 ENST00000367495 p.K210Sfs*2 ITGB8 chr7 20399020 20399020 Intron T T G TCGA-BP-5180-01A-01D-1429-08 ENST00000222573 PRKDC chr8 47882036 47882036 Missense_Mutation T T C TCGA-BP-5180-01A-01D-1429-08 ENST00000314191 p.H1613R SULF1 chr8 69621041 69621041 Nonsense_Mutation C C T TCGA-BP-5180-01A-01D-1429-08 ENST00000260128 p.Q462* NCOA4 chr10 46013569 46013569 Missense_Mutation C C T TCGA-BP-5180-01A-01D-1429-08 ENST00000581486 p.C184Y TRIM8 chr10 102645122 102645122 Missense_Mutation T T C TCGA-BP-5180-01A-01D-1429-08 ENST00000302424 p.Y169H ADGRA1 chr10 133097058 133097058 Missense_Mutation C C T TCGA-BP-5180-01A-01D-1429-08 ENST00000392607 p.L30F PHRF1 chr11 608267 608267 Silent C C A TCGA-BP-5180-01A-01D-1429-08 ENST00000264555 p.P937P CACNA1C chr12 2601925 2601925 Silent G G T TCGA-BP-5180-01A-01D-1429-08 ENST00000347598 p.L995L PRH1 chr12 10883097 10883097 Splice_Site C C T TCGA-BP-5180-01A-01D-1429-08 ENST00000543626 p.X22_splice ARID2 chr12 45730045 45730045 Missense_Mutation T T A TCGA-BP-5180-01A-01D-1429-08 ENST00000334344 p.S32T UHRF1BP1L chr12 100039602 100039602 Silent C C T TCGA-BP-5180-01A-01D-1429-08 ENST00000279907 p.R1423R VWA8 chr13 41887282 41887292 Frame_Shift_Del GGCAAGCCCAA GGCAAGCCCAA - TCGA-BP-5180-01A-01D-1429-08 ENST00000379310 p.L241Sfs*32 RNY4P30 chr13 49891036 49891045 5'Flank AAAAGGAGTT AAAAGGAGTT - TCGA-BP-5180-01A-01D-1429-08 ENST00000410216 NALCN chr13 101067986 101067986 Missense_Mutation G G C TCGA-BP-5180-01A-01D-1429-08 ENST00000251127 p.Q1460E IPO4 chr14 24186781 24186781 Missense_Mutation T T G TCGA-BP-5180-01A-01D-1429-08 ENST00000354464 p.N256T RASGRF1 chr15 79064509 79064509 Missense_Mutation G G T TCGA-BP-5180-01A-01D-1429-08 ENST00000419573 p.N98K AP3S2 chr15 89888526 89888526 Missense_Mutation T T C TCGA-BP-5180-01A-01D-1429-08 ENST00000336418 p.I90V NATD1 chr17 21243365 21243365 Missense_Mutation T T A TCGA-BP-5180-01A-01D-1429-08 ENST00000611551 p.K97M HOXB3 chr17 48550646 48550646 Silent C C T TCGA-BP-5180-01A-01D-1429-08 ENST00000311626 p.E328E PRKAR1A chr17 68515278 68515278 Intron T T C TCGA-BP-5180-01A-01D-1429-08 ENST00000358598 ZNF77 chr19 2933732 2933732 Missense_Mutation T T A TCGA-BP-5180-01A-01D-1429-08 ENST00000314531 p.E465D TLE6 chr19 2987730 2987730 Missense_Mutation G G A TCGA-BP-5180-01A-01D-1429-08 ENST00000246112 p.E189K RNASEH2A chr19 12806988 12806988 Intron C C G TCGA-BP-5180-01A-01D-1429-08 ENST00000221486 ANO8 chr19 17328211 17328211 Missense_Mutation G G C TCGA-BP-5180-01A-01D-1429-08 ENST00000159087 p.S726W EIF2S2 chr20 34112110 34112110 Translation_Start_Site T T A TCGA-BP-5180-01A-01D-1429-08 ENST00000374980 p.M1? EIF2S2 chr20 34112111 34112111 5'UTR G G T TCGA-BP-5180-01A-01D-1429-08 ENST00000374980 EEF1A2 chr20 63497813 63497813 5'UTR G G A TCGA-BP-5180-01A-01D-1429-08 ENST00000217182 LIPI chr21 14189350 14189350 Missense_Mutation G G A TCGA-BP-5180-01A-01D-1429-08 ENST00000344577 p.P60L CLIC6 chr21 34709441 34709441 Missense_Mutation G G C TCGA-BP-5180-01A-01D-1429-08 ENST00000360731 p.S619T IGLC2 chr22 22901280 22901281 Frame_Shift_Ins - - AC TCGA-BP-5180-01A-01D-1429-08 ENST00000390323 p.E104Qfs*? IGLC2 chr22 22901291 22901292 Frame_Shift_Del CA CA - TCGA-BP-5180-01A-01D-1429-08 ENST00000390323 p.S106Lfs*13 OSBP2 chr22 30870582 30870582 Missense_Mutation A A G TCGA-BP-5180-01A-01D-1429-08 ENST00000332585 p.E336G POLR3GL chr1 145978449 145978449 3'UTR G G A TCGA-B0-5104-01A-01D-1421-08 ENST00000369314 HMCN1 chr1 186087455 186087455 Missense_Mutation T T G TCGA-B0-5104-01A-01D-1421-08 ENST00000271588 p.I3058S NAV1 chr1 201810619 201810619 Missense_Mutation G G A TCGA-B0-5104-01A-01D-1421-08 ENST00000367296 p.R1553H PARP1 chr1 226364045 226364045 Missense_Mutation A A G TCGA-B0-5104-01A-01D-1421-08 ENST00000366794 p.I895T LCLAT1 chr2 30562222 30562222 Missense_Mutation G G A TCGA-B0-5104-01A-01D-1421-08 ENST00000309052 p.M185I BIRC6 chr2 32448891 32448891 Silent C C A TCGA-B0-5104-01A-01D-1421-08 ENST00000421745 p.V1527V LBX2 chr2 74498023 74498023 Silent C C T TCGA-B0-5104-01A-01D-1421-08 ENST00000377566 p.L167L DARS chr2 135920602 135920602 Splice_Site T T C TCGA-B0-5104-01A-01D-1421-08 ENST00000264161 p.X271_splice FSIP2 chr2 185805271 185805271 Missense_Mutation A A T TCGA-B0-5104-01A-01D-1421-08 ENST00000424728 p.E5322V ABCA12 chr2 214954039 214954039 Silent G G A TCGA-B0-5104-01A-01D-1421-08 ENST00000272895 p.Y2154Y IRS1 chr2 226795368 226795368 Missense_Mutation G G A TCGA-B0-5104-01A-01D-1421-08 ENST00000305123 p.A1124V ALPP chr2 232381303 232381303 Nonsense_Mutation C C A TCGA-B0-5104-01A-01D-1421-08 ENST00000392027 p.Y415* PBRM1 chr3 52603676 52603678 In_Frame_Del ATT ATT - TCGA-B0-5104-01A-01D-1421-08 ENST00000296302 p.K874_I875delinsN PDE12 chr3 57557211 57557211 Frame_Shift_Del A A - TCGA-B0-5104-01A-01D-1421-08 ENST00000311180 p.T278Lfs*12 PDE12 chr3 57557213 57557213 Silent T T C TCGA-B0-5104-01A-01D-1421-08 ENST00000311180 p.T278T ROBO1 chr3 79018538 79018538 Intron C C T TCGA-B0-5104-01A-01D-1421-08 ENST00000464233 COX17 chr3 119677201 119677201 Splice_Region G G T TCGA-B0-5104-01A-01D-1421-08 ENST00000261070 STXBP5L chr3 121419166 121419166 3'UTR T T A TCGA-B0-5104-01A-01D-1421-08 ENST00000273666 HSD17B11 chr4 87382267 87382267 Silent G G A TCGA-B0-5104-01A-01D-1421-08 ENST00000358290 p.S102S EXOSC9 chr4 121809996 121809996 Frame_Shift_Del G G - TCGA-B0-5104-01A-01D-1421-08 ENST00000243498 p.R212Qfs*5 EXOSC9 chr4 121809997 121809997 Silent A A C TCGA-B0-5104-01A-01D-1421-08 ENST00000243498 p.R212R RAPGEF2 chr4 159342981 159342981 Missense_Mutation G G C TCGA-B0-5104-01A-01D-1421-08 ENST00000264431 p.G813A CARD6 chr5 40852376 40852376 Silent G G A TCGA-B0-5104-01A-01D-1421-08 ENST00000254691 p.K348K GRIA1 chr5 153698127 153698127 Missense_Mutation C C A TCGA-B0-5104-01A-01D-1421-08 ENST00000285900 p.N406K C6orf10 chr6 32336614 32336614 Splice_Site C C G TCGA-B0-5104-01A-01D-1421-08 ENST00000447241 p.X144_splice SDHAF4 chr6 70579417 70579417 Missense_Mutation C C T TCGA-B0-5104-01A-01D-1421-08 ENST00000370474 p.S23L EIF2AK1 chr7 6054672 6054672 Missense_Mutation T T C TCGA-B0-5104-01A-01D-1421-08 ENST00000199389 p.K51E HDAC9 chr7 18648469 18648469 Missense_Mutation G G T TCGA-B0-5104-01A-01D-1421-08 ENST00000432645 p.G415V ZKSCAN1 chr7 100033959 100033959 Missense_Mutation G G T TCGA-B0-5104-01A-01D-1421-08 ENST00000324306 p.G485V CSGALNACT1 chr8 19439918 19439918 Nonsense_Mutation C C A TCGA-B0-5104-01A-01D-1421-08 ENST00000332246 p.E289* EBAG9 chr8 109564591 109564591 3'UTR G G A TCGA-B0-5104-01A-01D-1421-08 ENST00000337573 CSMD3 chr8 112346176 112346176 Silent C C A TCGA-B0-5104-01A-01D-1421-08 ENST00000297405 p.V2121V ZC3H3 chr8 143538288 143538288 Missense_Mutation T T G TCGA-B0-5104-01A-01D-1421-08 ENST00000262577 p.K360T CUBN chr10 16869672 16869672 Missense_Mutation C C G TCGA-B0-5104-01A-01D-1421-08 ENST00000377833 p.A3140P BMS1 chr10 42797040 42797040 Missense_Mutation C C T TCGA-B0-5104-01A-01D-1421-08 ENST00000374518 p.S599L ERCC6 chr10 49524181 49524181 Frame_Shift_Del C C - TCGA-B0-5104-01A-01D-1421-08 ENST00000355832 p.V417Cfs*23 ERCC6 chr10 49524185 49524185 Silent C C T TCGA-B0-5104-01A-01D-1421-08 ENST00000355832 p.K415K NRAP chr10 113597157 113597157 Missense_Mutation T T G TCGA-B0-5104-01A-01D-1421-08 ENST00000359988 p.I1454L ZNF215 chr11 6956195 6956195 Silent C C A TCGA-B0-5104-01A-01D-1421-08 ENST00000278319 p.P406P C11orf30 chr11 76545905 76545905 Missense_Mutation C C G TCGA-B0-5104-01A-01D-1421-08 ENST00000334736 p.L1128V VWF chr12 6018596 6018596 Missense_Mutation T T C TCGA-B0-5104-01A-01D-1421-08 ENST00000261405 p.T1608A ADAMTS20 chr12 43377472 43377472 Missense_Mutation G G A TCGA-B0-5104-01A-01D-1421-08 ENST00000389420 p.R1630W RND1 chr12 48858145 48858145 Missense_Mutation A A T TCGA-B0-5104-01A-01D-1421-08 ENST00000309739 p.S184T SCYL2 chr12 100311067 100311067 Silent G G A TCGA-B0-5104-01A-01D-1421-08 ENST00000360820 p.L168L SDSL chr12 113428081 113428081 Silent T T A TCGA-B0-5104-01A-01D-1421-08 ENST00000345635 p.P33P RNASE11 chr14 20584011 20584011 Frame_Shift_Del T T - TCGA-B0-5104-01A-01D-1421-08 ENST00000398008 p.N155Ifs*23 DHRS4 chr14 23955083 23955083 Silent G G T TCGA-B0-5104-01A-01D-1421-08 ENST00000313250 p.V59V GMFB chr14 54488947 54488947 5'UTR G G A TCGA-B0-5104-01A-01D-1421-08 ENST00000358056 DACT1 chr14 58646123 58646123 Silent C C T TCGA-B0-5104-01A-01D-1421-08 ENST00000335867 p.N500N PSMC1 chr14 90263760 90263760 Silent T T G TCGA-B0-5104-01A-01D-1421-08 ENST00000261303 p.S126S TGM5 chr15 43233609 43233609 Missense_Mutation C C G TCGA-B0-5104-01A-01D-1421-08 ENST00000220420 p.D652H CGNL1 chr15 57524598 57524598 Missense_Mutation G G T TCGA-B0-5104-01A-01D-1421-08 ENST00000281282 p.E962D CCNB2 chr15 59117322 59117322 Missense_Mutation C C T TCGA-B0-5104-01A-01D-1421-08 ENST00000288207 p.A310V UBN1 chr16 4874864 4874864 Silent G G A TCGA-B0-5104-01A-01D-1421-08 ENST00000262376 p.T818T SH2B1 chr16 28867414 28867414 Missense_Mutation G G T TCGA-B0-5104-01A-01D-1421-08 ENST00000322610 p.E341D CIAPIN1 chr16 57434128 57434129 Frame_Shift_Ins - - TACA TCGA-B0-5104-01A-01D-1421-08 ENST00000394391 p.Q158Cfs*11 MYH13 chr17 10321693 10321693 Nonsense_Mutation C C A TCGA-B0-5104-01A-01D-1421-08 ENST00000252172 p.E984* MMP28 chr17 35766614 35766614 Silent G G A TCGA-B0-5104-01A-01D-1421-08 ENST00000605424 p.D483D G6PC chr17 42900943 42900943 Missense_Mutation T T A TCGA-B0-5104-01A-01D-1421-08 ENST00000253801 p.Y23N PPM1E chr17 58980646 58980646 Missense_Mutation C C T TCGA-B0-5104-01A-01D-1421-08 ENST00000308249 p.T628I RAB37 chr17 74743340 74743340 Missense_Mutation G G T TCGA-B0-5104-01A-01D-1421-08 ENST00000392613 p.R122S DSG3 chr18 31466649 31466649 Missense_Mutation G G T TCGA-B0-5104-01A-01D-1421-08 ENST00000257189 p.V511F GIPC3 chr19 3586522 3586522 Nonsense_Mutation A A T TCGA-B0-5104-01A-01D-1421-08 ENST00000322315 p.K85* ERCC2 chr19 45358793 45358793 Intron A A T TCGA-B0-5104-01A-01D-1421-08 ENST00000391945 ERCC2 chr19 45358794 45358794 Intron T T G TCGA-B0-5104-01A-01D-1421-08 ENST00000391945 XRN2 chr20 21356106 21356106 Missense_Mutation G G C TCGA-B0-5104-01A-01D-1421-08 ENST00000377191 p.V683L SLC17A9 chr20 62963631 62963631 Missense_Mutation T T A TCGA-B0-5104-01A-01D-1421-08 ENST00000370351 p.L258H BAGE2 chr21 10413587 10413587 RNA G G - TCGA-B0-5104-01A-01D-1421-08 ENST00000470054 KCNJ15 chr21 38299601 38299601 Missense_Mutation C C G TCGA-B0-5104-01A-01D-1421-08 ENST00000328656 p.L114V SLC16A8 chr22 38080976 38080976 Silent G G A TCGA-B0-5104-01A-01D-1421-08 ENST00000320521 p.G354G OPHN1 chrX 68053701 68053701 Silent C C T TCGA-B0-5104-01A-01D-1421-08 ENST00000355520 p.K756K PRAMEF1 chr1 12794257 12794257 Silent G G A TCGA-CJ-4899-01A-01D-1462-08 ENST00000332296 p.L210L WNT3A chr1 228059073 228059073 Missense_Mutation G G T TCGA-CJ-4899-01A-01D-1462-08 ENST00000284523 p.D223Y MAT2A chr2 85541852 85541852 Silent T T C TCGA-CJ-4899-01A-01D-1462-08 ENST00000306434 p.T143T COL3A1 chr2 189010330 189010330 Frame_Shift_Del G G - TCGA-CJ-4899-01A-01D-1462-08 ENST00000304636 p.V1326Ffs*61 OBSL1 chr2 219556704 219556709 In_Frame_Del CAGCTT CAGCTT - TCGA-CJ-4899-01A-01D-1462-08 ENST00000404537 p.K1361_L1362del COL7A1 chr3 48572046 48572046 Splice_Site C C T TCGA-CJ-4899-01A-01D-1462-08 ENST00000328333 p.X2342_splice DTWD2 chr5 118944631 118944631 Silent A A G TCGA-CJ-4899-01A-01D-1462-08 ENST00000510708 p.C79C TCOF1 chr5 150364178 150364178 Missense_Mutation G G T TCGA-CJ-4899-01A-01D-1462-08 ENST00000377797 p.R77L IGF2R chr6 160044591 160044591 Missense_Mutation T T G TCGA-CJ-4899-01A-01D-1462-08 ENST00000356956 p.S567A UBN2 chr7 139274000 139274000 Silent T T A TCGA-CJ-4899-01A-01D-1462-08 ENST00000473989 p.S633S CSMD1 chr8 2961181 2961181 Missense_Mutation G G T TCGA-CJ-4899-01A-01D-1462-08 ENST00000520002 p.T3222K TONSL chr8 144440840 144440840 Missense_Mutation C C G TCGA-CJ-4899-01A-01D-1462-08 ENST00000409379 p.G348R RP11-35N6.1 chr9 101185455 101185457 5'UTR ACA ACA - TCGA-CJ-4899-01A-01D-1462-08 ENST00000374874 RP11-35N6.1 chr9 101185458 101185458 5'UTR G G T TCGA-CJ-4899-01A-01D-1462-08 ENST00000374874 BBOX1 chr11 27125752 27125752 Missense_Mutation C C A TCGA-CJ-4899-01A-01D-1462-08 ENST00000263182 p.A312D TSGA10IP chr11 65947490 65947490 Missense_Mutation C C T TCGA-CJ-4899-01A-01D-1462-08 ENST00000532620 p.A222V UBE4A chr11 118392834 118392834 Missense_Mutation G G C TCGA-CJ-4899-01A-01D-1462-08 ENST00000252108 p.V1005L LTBP2 chr14 74506133 74506133 Silent C C T TCGA-CJ-4899-01A-01D-1462-08 ENST00000261978 p.V1364V USP50 chr15 50543601 50543601 Missense_Mutation T T A TCGA-CJ-4899-01A-01D-1462-08 ENST00000532404 p.K147N TRPM7 chr15 50599267 50599267 Missense_Mutation A A C TCGA-CJ-4899-01A-01D-1462-08 ENST00000313478 p.I1006M RNF40 chr16 30766275 30766275 Missense_Mutation G G T TCGA-CJ-4899-01A-01D-1462-08 ENST00000324685 p.R369L ORC6 chr16 46696142 46696142 Intron G G T TCGA-CJ-4899-01A-01D-1462-08 ENST00000219097 SLC47A1 chr17 19567123 19567123 Missense_Mutation A A G TCGA-CJ-4899-01A-01D-1462-08 ENST00000270570 p.S402G SPAG5 chr17 28592266 28592266 Frame_Shift_Del T T - TCGA-CJ-4899-01A-01D-1462-08 ENST00000321765 p.D327Mfs*24 OR4D1 chr17 58155452 58155452 Missense_Mutation A A G TCGA-CJ-4899-01A-01D-1462-08 ENST00000268912 p.Q100R JMJD6 chr17 76725856 76725856 Splice_Site C C T TCGA-CJ-4899-01A-01D-1462-08 ENST00000397625 p.X44_splice ESCO1 chr18 21574367 21574368 Frame_Shift_Ins - - T TCGA-CJ-4899-01A-01D-1462-08 ENST00000269214 p.C160Vfs*2 CDH2 chr18 28003146 28003146 Missense_Mutation C C T TCGA-CJ-4899-01A-01D-1462-08 ENST00000269141 p.A291T PAF1 chr19 39389722 39389722 Missense_Mutation G G C TCGA-CJ-4899-01A-01D-1462-08 ENST00000221265 p.H70Q AKT1S1 chr19 49871679 49871679 Silent G G A TCGA-CJ-4899-01A-01D-1462-08 ENST00000344175 p.P165P BPIFB4 chr20 33102999 33102999 Missense_Mutation C C A TCGA-CJ-4899-01A-01D-1462-08 ENST00000375483 p.N555K CHD6 chr20 41405260 41405260 Missense_Mutation C C T TCGA-CJ-4899-01A-01D-1462-08 ENST00000373233 p.G2494E NHP2L1 chr22 41675037 41675037 Missense_Mutation C C T TCGA-CJ-4899-01A-01D-1462-08 ENST00000215956 p.V95I FGF13 chrX 139204127 139204127 5'UTR A A T TCGA-CJ-4899-01A-01D-1462-08 ENST00000436198 IDS chrX 149496423 149496423 Frame_Shift_Del T T - TCGA-CJ-4899-01A-01D-1462-08 ENST00000340855 p.M268Wfs*12 FAM76A chr1 27734119 27734119 Missense_Mutation C C T TCGA-BP-4974-01A-01D-1462-08 ENST00000373954 p.P97L METTL13 chr1 171784147 171784147 Silent C C T TCGA-BP-4974-01A-01D-1462-08 ENST00000361735 p.A187A METTL13 chr1 171787756 171787756 Missense_Mutation G G A TCGA-BP-4974-01A-01D-1462-08 ENST00000361735 p.G379R MARK1 chr1 220661906 220661906 Missense_Mutation A A G TCGA-BP-4974-01A-01D-1462-08 ENST00000366917 p.S710G HEATR1 chr1 236603191 236603191 Missense_Mutation C C T TCGA-BP-4974-01A-01D-1462-08 ENST00000366582 p.A110T REG3G chr2 79027918 79027918 Missense_Mutation C C A TCGA-BP-4974-01A-01D-1462-08 ENST00000272324 p.L149M SLC11A1 chr2 218390000 218390000 Missense_Mutation C C A TCGA-BP-4974-01A-01D-1462-08 ENST00000233202 p.A309D CRELD1 chr3 9940966 9940966 Missense_Mutation G G A TCGA-BP-4974-01A-01D-1462-08 ENST00000383811 p.G193S ACAP2 chr3 195295884 195295884 Missense_Mutation T T G TCGA-BP-4974-01A-01D-1462-08 ENST00000326793 p.K499T KLHL8 chr4 87185545 87185545 Silent A A G TCGA-BP-4974-01A-01D-1462-08 ENST00000273963 p.C157C UCP1 chr4 140563116 140563116 Missense_Mutation A A T TCGA-BP-4974-01A-01D-1462-08 ENST00000262999 p.L208I SDHA chr5 233652 233652 Splice_Region G G A TCGA-BP-4974-01A-01D-1462-08 ENST00000264932 FNDC9 chr5 157342831 157342831 3'UTR C C T TCGA-BP-4974-01A-01D-1462-08 ENST00000312349 SFXN1 chr5 175516654 175516655 Frame_Shift_Ins - - TT TCGA-BP-4974-01A-01D-1462-08 ENST00000321442 p.L257Ffs*2 GABRR1 chr6 89181982 89181982 Missense_Mutation G G T TCGA-BP-4974-01A-01D-1462-08 ENST00000454853 p.P291H MAP3K5 chr6 136651013 136651013 Missense_Mutation A A C TCGA-BP-4974-01A-01D-1462-08 ENST00000359015 p.S587A PRKDC chr8 47855252 47855252 Missense_Mutation C C T TCGA-BP-4974-01A-01D-1462-08 ENST00000314191 p.C2244Y PKHD1L1 chr8 109400149 109400149 Missense_Mutation T T A TCGA-BP-4974-01A-01D-1462-08 ENST00000378402 p.N362K TPD52L3 chr9 6330058 6330058 3'UTR A A - TCGA-BP-4974-01A-01D-1462-08 ENST00000344545 TPD52L3 chr9 6330060 6330060 3'UTR A A G TCGA-BP-4974-01A-01D-1462-08 ENST00000344545 IKZF5 chr10 122993719 122993719 3'UTR A A G TCGA-BP-4974-01A-01D-1462-08 ENST00000368886 GYLTL1B chr11 45926819 45926821 In_Frame_Del CCA CCA - TCGA-BP-4974-01A-01D-1462-08 ENST00000325468 p.P427del C3AR1 chr12 8058562 8058562 3'UTR T T A TCGA-BP-4974-01A-01D-1462-08 ENST00000307637 ANKS1B chr12 98801077 98801077 Missense_Mutation C C T TCGA-BP-4974-01A-01D-1462-08 ENST00000547776 p.A1039T KIAA1033 chr12 105144763 105144764 Frame_Shift_Del CT CT - TCGA-BP-4974-01A-01D-1462-08 ENST00000332180 p.T742Sfs*5 RYR3 chr15 33581551 33581551 Missense_Mutation T T C TCGA-BP-4974-01A-01D-1462-08 ENST00000389232 p.V494A RHOT1 chr17 32150512 32150512 Intron T T A TCGA-BP-4974-01A-01D-1462-08 ENST00000333942 MED1 chr17 39409626 39409626 Silent G G A TCGA-BP-4974-01A-01D-1462-08 ENST00000300651 p.F865F SUPT4H1 chr17 58351472 58351472 Frame_Shift_Del A A - TCGA-BP-4974-01A-01D-1462-08 ENST00000225504 p.C36Vfs*7 ZNF320 chr19 52881768 52881768 Missense_Mutation T T C TCGA-BP-4974-01A-01D-1462-08 ENST00000391781 p.T120A ZNF320 chr19 52881769 52881769 Missense_Mutation C C A TCGA-BP-4974-01A-01D-1462-08 ENST00000391781 p.L119F KIR2DL1 chr19 54786576 54786576 3'Flank A A - TCGA-BP-4974-01A-01D-1462-08 ENST00000336077 RFPL1 chr22 29438864 29438864 Frame_Shift_Del C C - TCGA-BP-4974-01A-01D-1462-08 ENST00000354373 p.L26Wfs*22 POLA1 chrX 24717367 24717367 Missense_Mutation G G A TCGA-BP-4974-01A-01D-1462-08 ENST00000379059 p.E256K MTOR chr1 11108237 11108237 Silent C C T TCGA-B8-4621-01A-01D-1501-10 ENST00000361445 p.E2526E CLCNKB chr1 16050571 16050572 Frame_Shift_Ins - - A TCGA-B8-4621-01A-01D-1501-10 ENST00000375679 p.P342Hfs*109 CLCNKB chr1 16050572 16050572 Missense_Mutation C C T TCGA-B8-4621-01A-01D-1501-10 ENST00000375679 p.P342L ATP13A2 chr1 16996453 16996453 Missense_Mutation G G T TCGA-B8-4621-01A-01D-1501-10 ENST00000326735 p.H413Q TRIM63 chr1 26058615 26058615 Missense_Mutation A A C TCGA-B8-4621-01A-01D-1501-10 ENST00000374272 p.S202R XDH chr2 31348912 31348912 Missense_Mutation G G T TCGA-B8-4621-01A-01D-1501-10 ENST00000379416 p.P1013H GEMIN6 chr2 38781790 38781790 Silent T T G TCGA-B8-4621-01A-01D-1501-10 ENST00000281950 p.T134T SOS1 chr2 39058748 39058748 Silent G G T TCGA-B8-4621-01A-01D-1501-10 ENST00000402219 p.A90A VRK2 chr2 58123207 58123207 Frame_Shift_Del C C - TCGA-B8-4621-01A-01D-1501-10 ENST00000340157 p.S218Afs*8 VRK2 chr2 58131852 58131852 Silent C C T TCGA-B8-4621-01A-01D-1501-10 ENST00000340157 p.L241L HK2 chr2 74878809 74878809 Silent C C T TCGA-B8-4621-01A-01D-1501-10 ENST00000290573 p.L385L THSD7B chr2 137275930 137275930 Missense_Mutation C C A TCGA-B8-4621-01A-01D-1501-10 ENST00000272643 p.P802T HTR2B chr2 231108577 231108577 Silent A A G TCGA-B8-4621-01A-01D-1501-10 ENST00000258400 p.D462D TATDN2 chr3 10284942 10284942 3'Flank A A C TCGA-B8-4621-01A-01D-1501-10 ENST00000287652 SLC25A36 chr3 140956669 140956669 Frame_Shift_Del C C - TCGA-B8-4621-01A-01D-1501-10 ENST00000324194 p.G63Dfs*6 ST6GAL1 chr3 187043273 187043273 Silent G G A TCGA-B8-4621-01A-01D-1501-10 ENST00000169298 p.A190A ZNF595 chr4 86347 86347 Silent G G A TCGA-B8-4621-01A-01D-1501-10 ENST00000610261 p.E281E HSD17B11 chr4 87372796 87372796 Missense_Mutation G G A TCGA-B8-4621-01A-01D-1501-10 ENST00000358290 p.P157L FAT1 chr4 186628750 186628750 Missense_Mutation A A T TCGA-B8-4621-01A-01D-1501-10 ENST00000441802 p.V1446E ERBB2IP chr5 65992793 65992793 Silent T T C TCGA-B8-4621-01A-01D-1501-10 ENST00000284037 p.T25T ZNF608 chr5 124647187 124647187 Missense_Mutation A A G TCGA-B8-4621-01A-01D-1501-10 ENST00000306315 p.V1066A CDX1 chr5 150182818 150182818 Missense_Mutation C C A TCGA-B8-4621-01A-01D-1501-10 ENST00000231656 p.R166S TNIP1 chr5 151065096 151065096 5'UTR G G A TCGA-B8-4621-01A-01D-1501-10 ENST00000315050 ZNF184 chr6 27452506 27452506 Missense_Mutation T T A TCGA-B8-4621-01A-01D-1501-10 ENST00000211936 p.E351D TFEB chr6 41690723 41690723 Silent G G A TCGA-B8-4621-01A-01D-1501-10 ENST00000230323 p.G136G PKHD1 chr6 52053118 52053118 Missense_Mutation A A G TCGA-B8-4621-01A-01D-1501-10 ENST00000371117 p.F700L NKAIN2 chr6 124658235 124658235 Frame_Shift_Del G G - TCGA-B8-4621-01A-01D-1501-10 ENST00000368417 p.W108* ADAM22 chr7 88165888 88165888 Nonsense_Mutation C C A TCGA-B8-4621-01A-01D-1501-10 ENST00000265727 p.C711* MTERF1 chr7 91874612 91874612 Missense_Mutation T T G TCGA-B8-4621-01A-01D-1501-10 ENST00000351870 p.K61T PNPLA8 chr7 108502633 108502633 Missense_Mutation T T A TCGA-B8-4621-01A-01D-1501-10 ENST00000257694 p.I406F PRSS1 chr7 142750646 142750646 Silent C C A TCGA-B8-4621-01A-01D-1501-10 ENST00000311737 p.G44G CCDC171 chr9 15729741 15729741 Missense_Mutation G G C TCGA-B8-4621-01A-01D-1501-10 ENST00000380701 p.K664N TAF1L chr9 32633476 32633476 Missense_Mutation A A T TCGA-B8-4621-01A-01D-1501-10 ENST00000242310 p.Y702N HNRNPK chr9 83977777 83977777 Missense_Mutation G G T TCGA-B8-4621-01A-01D-1501-10 ENST00000351839 p.P23H PTPDC1 chr9 94101674 94101674 Missense_Mutation G G A TCGA-B8-4621-01A-01D-1501-10 ENST00000375360 p.V654I TSC1 chr9 132901573 132901601 Splice_Site CCTCATTTCTTCTTACCTTTTGGGAAACC CCTCATTTCTTCTTACCTTTTGGGAAACC - TCGA-B8-4621-01A-01D-1501-10 ENST00000298552 p.X830_splice KCNT1 chr9 135771050 135771050 Missense_Mutation G G A TCGA-B8-4621-01A-01D-1501-10 ENST00000488444 p.E636K FAM166A chr9 137245310 137245310 Missense_Mutation G G T TCGA-B8-4621-01A-01D-1501-10 ENST00000344774 p.H173Q ADARB2 chr10 1183364 1183364 Frame_Shift_Del G G - TCGA-B8-4621-01A-01D-1501-10 ENST00000381312 p.S683Rfs*27 PTEN chr10 87961042 87961045 Frame_Shift_Del TACT TACT - TCGA-B8-4621-01A-01D-1501-10 ENST00000371953 p.T319* PPRC1 chr10 102138649 102138649 Missense_Mutation G G A TCGA-B8-4621-01A-01D-1501-10 ENST00000278070 p.V125M BUB3 chr10 123164969 123164969 3'UTR T T C TCGA-B8-4621-01A-01D-1501-10 ENST00000368865 ZNF195 chr11 3359237 3359237 Missense_Mutation A A G TCGA-B8-4621-01A-01D-1501-10 ENST00000399602 p.S591P MUC15 chr11 26559904 26559904 3'UTR A A G TCGA-B8-4621-01A-01D-1501-10 ENST00000455601 CAT chr11 34461300 34461300 Missense_Mutation A A G TCGA-B8-4621-01A-01D-1501-10 ENST00000241052 p.N369S HNRNPKP3 chr11 43262359 43262359 RNA G G A TCGA-B8-4621-01A-01D-1501-10 ENST00000511537 MAPK8IP1 chr11 45904143 45904143 Missense_Mutation G G C TCGA-B8-4621-01A-01D-1501-10 ENST00000241014 p.E550Q MED19 chr11 57704432 57704432 3'UTR C C G TCGA-B8-4621-01A-01D-1501-10 ENST00000337672 EIF1AD chr11 66000430 66000430 5'UTR C C G TCGA-B8-4621-01A-01D-1501-10 ENST00000312234 CLCF1 chr11 67367616 67367618 In_Frame_Del CCA CCA - TCGA-B8-4621-01A-01D-1501-10 ENST00000312438 p.W9del DHCR7 chr11 71442312 71442312 Silent A A G TCGA-B8-4621-01A-01D-1501-10 ENST00000355527 p.F121F ALKBH8 chr11 107504605 107504605 3'UTR T T - TCGA-B8-4621-01A-01D-1501-10 ENST00000389568 PRDM10 chr11 129935208 129935208 Missense_Mutation C C G TCGA-B8-4621-01A-01D-1501-10 ENST00000358825 p.E350D ADAMTS8 chr11 130416251 130416251 Missense_Mutation C C T TCGA-B8-4621-01A-01D-1501-10 ENST00000257359 p.M392I RAD52 chr12 932988 932988 Frame_Shift_Del A A - TCGA-B8-4621-01A-01D-1501-10 ENST00000358495 p.L24Yfs*20 MANSC1 chr12 12330396 12330396 Silent T T A TCGA-B8-4621-01A-01D-1501-10 ENST00000535902 p.A309A SLCO1B3 chr12 20875257 20875257 Missense_Mutation G G C TCGA-B8-4621-01A-01D-1501-10 ENST00000261196 p.K250N HSP90B1 chr12 103947632 103947632 Splice_Site G G A TCGA-B8-4621-01A-01D-1501-10 ENST00000299767 p.X795_splice USP12 chr13 27105927 27105927 Nonsense_Mutation G G T TCGA-B8-4621-01A-01D-1501-10 ENST00000282344 p.Y49* LECT1 chr13 52739098 52739098 Missense_Mutation G G A TCGA-B8-4621-01A-01D-1501-10 ENST00000377962 p.S49L SCEL chr13 77555880 77555880 Missense_Mutation C C G TCGA-B8-4621-01A-01D-1501-10 ENST00000349847 p.S2C SLITRK1 chr13 83880723 83880723 Missense_Mutation G G A TCGA-B8-4621-01A-01D-1501-10 ENST00000377084 p.P262L TINF2 chr14 24239900 24239900 Missense_Mutation A A T TCGA-B8-4621-01A-01D-1501-10 ENST00000267415 p.F418Y MIS18BP1 chr14 45218437 45218437 Missense_Mutation G G A TCGA-B8-4621-01A-01D-1501-10 ENST00000310806 p.P896L PNMA1 chr14 73713580 73713580 Silent A A G TCGA-B8-4621-01A-01D-1501-10 ENST00000316836 p.A20A PACS2 chr14 105376798 105376798 Missense_Mutation C C T TCGA-B8-4621-01A-01D-1501-10 ENST00000325438 p.H278Y UBR1 chr15 43015687 43015687 Splice_Site C C A TCGA-B8-4621-01A-01D-1501-10 ENST00000290650 p.X1070_splice PAQR5 chr15 69379904 69379904 Missense_Mutation C C G TCGA-B8-4621-01A-01D-1501-10 ENST00000340965 p.L25V THSD4 chr15 71660581 71660581 Frame_Shift_Del G G - TCGA-B8-4621-01A-01D-1501-10 ENST00000355327 p.V403Cfs*52 SLC28A1 chr15 84945140 84945140 Missense_Mutation C C A TCGA-B8-4621-01A-01D-1501-10 ENST00000286749 p.F630L TMEM8A chr16 375200 375200 Missense_Mutation T T A TCGA-B8-4621-01A-01D-1501-10 ENST00000431232 p.I458F CRAMP1L chr16 1632304 1632304 Missense_Mutation G G C TCGA-B8-4621-01A-01D-1501-10 ENST00000293925 p.Q211H TRAF7 chr16 2170687 2170687 Missense_Mutation C C G TCGA-B8-4621-01A-01D-1501-10 ENST00000326181 p.S102C SLX4 chr16 3589199 3589199 Missense_Mutation C C T TCGA-B8-4621-01A-01D-1501-10 ENST00000294008 p.G1480E CREBBP chr16 3793625 3793625 Missense_Mutation G G A TCGA-B8-4621-01A-01D-1501-10 ENST00000262367 p.S326F ARHGAP17 chr16 24931034 24931034 Silent G G C TCGA-B8-4621-01A-01D-1501-10 ENST00000289968 p.P755P ZDHHC1 chr16 67406296 67406296 Missense_Mutation C C A TCGA-B8-4621-01A-01D-1501-10 ENST00000348579 p.Q52H DNAH9 chr17 11883681 11883681 Missense_Mutation C C A TCGA-B8-4621-01A-01D-1501-10 ENST00000262442 p.F3634L C17orf75 chr17 32342130 32342130 Missense_Mutation A A G TCGA-B8-4621-01A-01D-1501-10 ENST00000577809 p.S4P KRT35 chr17 41481114 41481114 5'UTR A A T TCGA-B8-4621-01A-01D-1501-10 ENST00000393989 BRIP1 chr17 61808672 61808672 Missense_Mutation G G A TCGA-B8-4621-01A-01D-1501-10 ENST00000259008 p.T238I BPTF chr17 67964366 67964366 Missense_Mutation G G C TCGA-B8-4621-01A-01D-1501-10 ENST00000321892 p.D2932H ABCA5 chr17 69302789 69302789 Missense_Mutation T T G TCGA-B8-4621-01A-01D-1501-10 ENST00000392676 p.S350R GALK1 chr17 75762737 75762737 Frame_Shift_Del T T - TCGA-B8-4621-01A-01D-1501-10 ENST00000225614 p.S254Afs*10 METTL4 chr18 2538953 2538953 3'UTR G G C TCGA-B8-4621-01A-01D-1501-10 ENST00000574538 WDR87 chr19 37892728 37892728 Missense_Mutation T T C TCGA-B8-4621-01A-01D-1501-10 ENST00000303868 p.H953R ZNF816 chr19 52951476 52951476 Frame_Shift_Del T T - TCGA-B8-4621-01A-01D-1501-10 ENST00000357666 p.D100Vfs*7 LILRA6 chr19 54240432 54240432 Missense_Mutation C C T TCGA-B8-4621-01A-01D-1501-10 ENST00000396365 p.R367H ACSS2 chr20 34913395 34913395 Missense_Mutation A A G TCGA-B8-4621-01A-01D-1501-10 ENST00000360596 p.I157V ACTR5 chr20 38767489 38767489 Missense_Mutation C C A TCGA-B8-4621-01A-01D-1501-10 ENST00000243903 p.L487M DHX35 chr20 38994879 38994880 Frame_Shift_Ins - - C TCGA-B8-4621-01A-01D-1501-10 ENST00000252011 p.K215Qfs*7 TCEA2 chr20 64066929 64066929 Silent G G C TCGA-B8-4621-01A-01D-1501-10 ENST00000343484 p.G50G SYNJ1 chr21 32670340 32670340 Missense_Mutation T T C TCGA-B8-4621-01A-01D-1501-10 ENST00000433931 p.I626V PCNT chr21 46363555 46363555 Missense_Mutation G G A TCGA-B8-4621-01A-01D-1501-10 ENST00000359568 p.E744K SMC1B chr22 45344501 45344501 3'UTR G G C TCGA-B8-4621-01A-01D-1501-10 ENST00000357450 HUWE1 chrX 53552687 53552687 Missense_Mutation G G T TCGA-B8-4621-01A-01D-1501-10 ENST00000262854 p.Q2901K MAGEA10 chrX 152134838 152134838 Missense_Mutation G G T TCGA-B8-4621-01A-01D-1501-10 ENST00000244096 p.H261Q RAB1A chr2 65088331 65088331 3'UTR A A - TCGA-B8-5546-01A-01D-1534-10 ENST00000409784 ANKRD36B chr2 97547555 97547556 Frame_Shift_Ins - - T TCGA-B8-5546-01A-01D-1534-10 ENST00000258459 p.D520Efs*6 TGFBRAP1 chr2 105298608 105298608 Silent C C T TCGA-B8-5546-01A-01D-1534-10 ENST00000258449 p.A262A STEAP3 chr2 119254730 119254730 Missense_Mutation G G A TCGA-B8-5546-01A-01D-1534-10 ENST00000393106 p.R356Q CD200R1 chr3 112929004 112929004 Missense_Mutation G G A TCGA-B8-5546-01A-01D-1534-10 ENST00000471858 p.A171V PCOLCE2 chr3 142842921 142842921 Splice_Region C C T TCGA-B8-5546-01A-01D-1534-10 ENST00000295992 CAST chr5 96767939 96767939 Silent T T C TCGA-B8-5546-01A-01D-1534-10 ENST00000341926 p.A653A CAST chr5 96767940 96767940 Missense_Mutation C C T TCGA-B8-5546-01A-01D-1534-10 ENST00000341926 p.L654F PCDHA9 chr5 141011641 141011641 3'UTR A A C TCGA-B8-5546-01A-01D-1534-10 ENST00000532602 DNAH8 chr6 38974422 38974422 Missense_Mutation T T G TCGA-B8-5546-01A-01D-1534-10 ENST00000359357 p.L4026V COL14A1 chr8 120270170 120270170 Missense_Mutation C C A TCGA-B8-5546-01A-01D-1534-10 ENST00000297848 p.T1070N COMMD9 chr11 36276904 36276904 Intron T T C TCGA-B8-5546-01A-01D-1534-10 ENST00000263401 TPTE2P3 chr13 52577140 52577140 RNA C C - TCGA-B8-5546-01A-01D-1534-10 ENST00000441562 NEUROD2 chr17 39606308 39606308 Missense_Mutation C C T TCGA-B8-5546-01A-01D-1534-10 ENST00000302584 p.G98S MFAP2 chr1 16977116 16977116 Missense_Mutation G G C TCGA-BP-5174-01A-01D-1429-08 ENST00000375535 p.D40E GRHL3 chr1 24339717 24339717 Silent C C G TCGA-BP-5174-01A-01D-1429-08 ENST00000350501 p.A334A PIGK chr1 77161643 77161643 Missense_Mutation G G T TCGA-BP-5174-01A-01D-1429-08 ENST00000370812 p.P218H SASS6 chr1 100105837 100105837 Missense_Mutation G G T TCGA-BP-5174-01A-01D-1429-08 ENST00000287482 p.P492H FLG chr1 152314770 152314770 Intron G G T TCGA-BP-5174-01A-01D-1429-08 ENST00000368799 DISC1 chr1 231693925 231693925 Missense_Mutation T T A TCGA-BP-5174-01A-01D-1429-08 ENST00000439617 p.F56Y AC093616.4 chr2 87732487 87732487 RNA C C A TCGA-BP-5174-01A-01D-1429-08 ENST00000427434 TEKT4 chr2 94871697 94871697 Missense_Mutation C C A TCGA-BP-5174-01A-01D-1429-08 ENST00000295201 p.L40M ORC4 chr2 147935696 147935696 Splice_Region A A T TCGA-BP-5174-01A-01D-1429-08 ENST00000264169 p.A375A DNAJC10 chr2 182736286 182736286 Missense_Mutation C C T TCGA-BP-5174-01A-01D-1429-08 ENST00000264065 p.T296I VHL chr3 10146520 10146535 Frame_Shift_Del TTTGGCTCTTCAGAGA TTTGGCTCTTCAGAGA - TCGA-BP-5174-01A-01D-1429-08 ENST00000256474 p.W117Qfs*37 VHL chr3 10146536 10146536 Missense_Mutation T T A TCGA-BP-5174-01A-01D-1429-08 ENST00000256474 p.D121E TRAT1 chr3 108853704 108853704 Missense_Mutation C C A TCGA-BP-5174-01A-01D-1429-08 ENST00000295756 p.H130N DHX36 chr3 154305126 154305126 Silent T T A TCGA-BP-5174-01A-01D-1429-08 ENST00000496811 p.T312T SH3TC1 chr4 8216169 8216169 Missense_Mutation G G T TCGA-BP-5174-01A-01D-1429-08 ENST00000245105 p.L180F STPG2 chr4 97981203 97981203 Missense_Mutation C C T TCGA-BP-5174-01A-01D-1429-08 ENST00000295268 p.S243N TACR3 chr4 103591497 103591497 Missense_Mutation G G T TCGA-BP-5174-01A-01D-1429-08 ENST00000304883 p.L359M FAT4 chr4 125407037 125407037 Missense_Mutation C C T TCGA-BP-5174-01A-01D-1429-08 ENST00000394329 p.S1822F SPATA4 chr4 176195437 176195437 Nonsense_Mutation A A T TCGA-BP-5174-01A-01D-1429-08 ENST00000280191 p.Y42* SPATA4 chr4 176195441 176195441 Frame_Shift_Del A A - TCGA-BP-5174-01A-01D-1429-08 ENST00000280191 p.V41Afs*40 SLC35A4 chr5 140567579 140567579 Missense_Mutation G G T TCGA-BP-5174-01A-01D-1429-08 ENST00000323146 p.R137L RSPH9 chr6 43645270 43645270 Missense_Mutation T T C TCGA-BP-5174-01A-01D-1429-08 ENST00000372163 p.Y58H SNX14 chr6 85548311 85548311 Missense_Mutation A A G TCGA-BP-5174-01A-01D-1429-08 ENST00000314673 p.L286P SLC22A16 chr6 110442274 110442274 Missense_Mutation C C T TCGA-BP-5174-01A-01D-1429-08 ENST00000368919 p.G385S PKD1L1 chr7 47829428 47829428 Missense_Mutation T T G TCGA-BP-5174-01A-01D-1429-08 ENST00000289672 p.E2244D TMEM168 chr7 112772905 112772905 Frame_Shift_Del A A - TCGA-BP-5174-01A-01D-1429-08 ENST00000312814 p.F474Lfs*8 RBM28 chr7 128339760 128339760 Silent G G A TCGA-BP-5174-01A-01D-1429-08 ENST00000223073 p.V50V AKR1B15 chr7 134576992 134576992 Missense_Mutation T T G TCGA-BP-5174-01A-01D-1429-08 ENST00000457545 p.N285K PTPRN2 chr7 157682865 157682865 Missense_Mutation C C G TCGA-BP-5174-01A-01D-1429-08 ENST00000389418 p.V621L DPYS chr8 104444367 104444367 Missense_Mutation A A G TCGA-BP-5174-01A-01D-1429-08 ENST00000351513 p.V225A FAM188A chr10 15837244 15837244 Missense_Mutation A A G TCGA-BP-5174-01A-01D-1429-08 ENST00000277632 p.F179S MICAL2 chr11 12221752 12221752 Missense_Mutation G G A TCGA-BP-5174-01A-01D-1429-08 ENST00000256194 p.A439T KIAA1549L chr11 33545291 33545291 Missense_Mutation C C T TCGA-BP-5174-01A-01D-1429-08 ENST00000321505 p.P803S ELK3 chr12 96246989 96246989 Missense_Mutation C C A TCGA-BP-5174-01A-01D-1429-08 ENST00000228741 p.S86Y MYH7 chr14 23425279 23425279 Splice_Region C C A TCGA-BP-5174-01A-01D-1429-08 ENST00000355349 MYH7 chr14 23425280 23425280 Splice_Site A A T TCGA-BP-5174-01A-01D-1429-08 ENST00000355349 p.X808_splice ACSM2A chr16 20478602 20478603 Frame_Shift_Ins - - C TCGA-BP-5174-01A-01D-1429-08 ENST00000219054 p.G405Rfs*48 ADCY7 chr16 50310847 50310847 Frame_Shift_Del T T - TCGA-BP-5174-01A-01D-1429-08 ENST00000254235 p.L774Rfs*22 MLX chr17 42571604 42571604 3'UTR C C T TCGA-BP-5174-01A-01D-1429-08 ENST00000246912 OR7A17 chr19 14880703 14880709 Frame_Shift_Del TAAGAGC TAAGAGC - TCGA-BP-5174-01A-01D-1429-08 ENST00000327462 p.C216Sfs*4 LILRA2 chr19 54575509 54575509 Silent C C T TCGA-BP-5174-01A-01D-1429-08 ENST00000251377 p.S303S ADIG chr20 38586078 38586078 Missense_Mutation C C A TCGA-BP-5174-01A-01D-1429-08 ENST00000470147 p.S58R FAM210B chr20 56366257 56366258 Frame_Shift_Ins - - T TCGA-BP-5174-01A-01D-1429-08 ENST00000371384 p.K186* DSCAM chr21 40013172 40013172 Silent G G A TCGA-BP-5174-01A-01D-1429-08 ENST00000400454 p.A1967A EIF4G3 chr1 20899908 20899908 Silent T T C TCGA-B2-5641-01A-01D-1534-10 ENST00000264211 p.V540V C8B chr1 56949695 56949695 Missense_Mutation G G A TCGA-B2-5641-01A-01D-1534-10 ENST00000371237 p.R242C SLC44A3 chr1 94820957 94820957 Silent A A G TCGA-B2-5641-01A-01D-1534-10 ENST00000271227 p.A12A ADAR chr1 154584696 154584696 3'UTR A A - TCGA-B2-5641-01A-01D-1534-10 ENST00000368474 CACNA1S chr1 201060741 201060741 Missense_Mutation C C T TCGA-B2-5641-01A-01D-1534-10 ENST00000362061 p.V1111M SPRED2 chr2 65314078 65314078 Missense_Mutation C C T TCGA-B2-5641-01A-01D-1534-10 ENST00000356388 p.G227E FBXO41 chr2 73269572 73269572 Missense_Mutation C C T TCGA-B2-5641-01A-01D-1534-10 ENST00000295133 p.R20Q ANKRD36C chr2 95980672 95980673 Frame_Shift_Ins - - AA TCGA-B2-5641-01A-01D-1534-10 ENST00000456556 p.Y236Ffs*14 MAP3K2 chr2 127308747 127308747 Missense_Mutation C C A TCGA-B2-5641-01A-01D-1534-10 ENST00000344908 p.R491L MMADHC chr2 149587232 149587233 Intron GT GT - TCGA-B2-5641-01A-01D-1534-10 ENST00000303319 SCN7A chr2 166472374 166472374 Missense_Mutation G G A TCGA-B2-5641-01A-01D-1534-10 ENST00000409855 p.S172L TTN chr2 178574441 178574441 Nonsense_Mutation A A C TCGA-B2-5641-01A-01D-1534-10 ENST00000591111 p.Y22256* COL6A3 chr2 237324763 237324763 3'UTR G G A TCGA-B2-5641-01A-01D-1534-10 ENST00000295550 PDE6B chr4 655952 655952 Silent C C G TCGA-B2-5641-01A-01D-1534-10 ENST00000496514 p.A335A PGM2 chr4 37837551 37837551 Missense_Mutation A A G TCGA-B2-5641-01A-01D-1534-10 ENST00000381967 p.T127A CENPC chr4 67492968 67492968 Missense_Mutation G G C TCGA-B2-5641-01A-01D-1534-10 ENST00000273853 p.P774A SLC25A31 chr4 127773660 127773660 3'UTR G G T TCGA-B2-5641-01A-01D-1534-10 ENST00000281154 FNIP2 chr4 158868421 158868421 Silent G G C TCGA-B2-5641-01A-01D-1534-10 ENST00000264433 p.P595P SNX25 chr4 185323792 185323792 Missense_Mutation G G A TCGA-B2-5641-01A-01D-1534-10 ENST00000264694 p.D417N DDX4 chr5 55790581 55790581 Missense_Mutation G G A TCGA-B2-5641-01A-01D-1534-10 ENST00000505374 p.C393Y FBN2 chr5 128311308 128311308 Frame_Shift_Del A A - TCGA-B2-5641-01A-01D-1534-10 ENST00000262464 p.I1689Tfs*47 FAM13B chr5 137943193 137943193 Silent C C T TCGA-B2-5641-01A-01D-1534-10 ENST00000033079 p.R766R KIF20A chr5 138183535 138183535 Missense_Mutation A A G TCGA-B2-5641-01A-01D-1534-10 ENST00000394894 p.N365D BTNL3 chr5 181005814 181005814 Missense_Mutation C C T TCGA-B2-5641-01A-01D-1534-10 ENST00000342868 p.A448V DAXX chr6 33320106 33320106 Missense_Mutation T T A TCGA-B2-5641-01A-01D-1534-10 ENST00000266000 p.E457V NSUN5 chr7 73303578 73303578 3'UTR A A T TCGA-B2-5641-01A-01D-1534-10 ENST00000252594 CLDN12 chr7 90413110 90413110 Missense_Mutation C C G TCGA-B2-5641-01A-01D-1534-10 ENST00000287916 p.T145S PUS7 chr7 105470791 105470791 Missense_Mutation G G A TCGA-B2-5641-01A-01D-1534-10 ENST00000356362 p.T432I CADPS2 chr7 122474493 122474493 Frame_Shift_Del C C - TCGA-B2-5641-01A-01D-1534-10 ENST00000449022 p.G629Vfs*31 DNAJB6 chr7 157367405 157367406 Frame_Shift_Ins - - GA TCGA-B2-5641-01A-01D-1534-10 ENST00000262177 p.F91Afs*78 PSD3 chr8 18804779 18804779 Missense_Mutation G G A TCGA-B2-5641-01A-01D-1534-10 ENST00000440756 p.A585V ADAMDEC1 chr8 24384571 24384571 Missense_Mutation T T C TCGA-B2-5641-01A-01D-1534-10 ENST00000256412 p.W23R XKR4 chr8 55523545 55523545 Missense_Mutation G G T TCGA-B2-5641-01A-01D-1534-10 ENST00000327381 p.C424F TEK chr9 27202842 27202842 Missense_Mutation C C G TCGA-B2-5641-01A-01D-1534-10 ENST00000380036 p.N644K TEX10 chr9 100352479 100352479 Intron C C A TCGA-B2-5641-01A-01D-1534-10 ENST00000374902 YME1L1 chr10 27131921 27131921 Missense_Mutation C C G TCGA-B2-5641-01A-01D-1534-10 ENST00000326799 p.G323R ANKRD30A chr10 37133927 37133927 Missense_Mutation T T G TCGA-B2-5641-01A-01D-1534-10 ENST00000611781 p.M210R IFIT3 chr10 89332599 89332599 5'UTR C C T TCGA-B2-5641-01A-01D-1534-10 ENST00000371811 SLK chr10 103990711 103990711 Missense_Mutation A A G TCGA-B2-5641-01A-01D-1534-10 ENST00000369755 p.K63E OR6A2 chr11 6795009 6795009 Missense_Mutation G G A TCGA-B2-5641-01A-01D-1534-10 ENST00000332601 p.P234S BCL9L chr11 118903423 118903423 Missense_Mutation C C A TCGA-B2-5641-01A-01D-1534-10 ENST00000334801 p.A188S KIAA1551 chr12 31981471 31981471 Silent T T C TCGA-B2-5641-01A-01D-1534-10 ENST00000312561 p.N172N DNAJC14 chr12 55823111 55823111 Silent T T C TCGA-B2-5641-01A-01D-1534-10 ENST00000317269 p.A531A GNPTAB chr12 101764802 101764802 Frame_Shift_Del T T - TCGA-B2-5641-01A-01D-1534-10 ENST00000299314 p.D706Tfs*4 SPPL3 chr12 120767401 120767402 Nonsense_Mutation - - T TCGA-B2-5641-01A-01D-1534-10 ENST00000353487 p.Y322* BRCA2 chr13 32326547 32326547 Missense_Mutation G G C TCGA-B2-5641-01A-01D-1534-10 ENST00000380152 p.D189H VWA8 chr13 41887297 41887297 Missense_Mutation A A G TCGA-B2-5641-01A-01D-1534-10 ENST00000379310 p.I239T TRDC chr14 22463057 22463057 Missense_Mutation G G C TCGA-B2-5641-01A-01D-1534-10 ENST00000617343 p.E183Q SNW1 chr14 77718420 77718421 Frame_Shift_Ins - - T TCGA-B2-5641-01A-01D-1534-10 ENST00000261531 p.N453Kfs*9 MYO5A chr15 52353639 52353639 Missense_Mutation A A C TCGA-B2-5641-01A-01D-1534-10 ENST00000399231 p.I1196S MNS1 chr15 56443445 56443445 Nonsense_Mutation A A C TCGA-B2-5641-01A-01D-1534-10 ENST00000260453 p.Y332* ANKRD34C chr15 79293539 79293539 Silent C C A TCGA-B2-5641-01A-01D-1534-10 ENST00000421388 p.G85G RRN3 chr16 15061723 15061723 3'UTR C C A TCGA-B2-5641-01A-01D-1534-10 ENST00000198767 FUS chr16 31182609 31182609 Silent G G A TCGA-B2-5641-01A-01D-1534-10 ENST00000254108 p.T45T FUS chr16 31182610 31182610 Missense_Mutation G G C TCGA-B2-5641-01A-01D-1534-10 ENST00000254108 p.D46H KATNB1 chr16 57752038 57752038 Silent C C T TCGA-B2-5641-01A-01D-1534-10 ENST00000379661 p.A205A SPNS3 chr17 4486489 4486489 Silent C C T TCGA-B2-5641-01A-01D-1534-10 ENST00000355530 p.C452C TOM1L2 chr17 17907531 17907531 Missense_Mutation T T A TCGA-B2-5641-01A-01D-1534-10 ENST00000379504 p.E18V MED13 chr17 62063159 62063159 Missense_Mutation C C T TCGA-B2-5641-01A-01D-1534-10 ENST00000397786 p.R70Q RTTN chr18 70204173 70204175 In_Frame_Del CAG CAG - TCGA-B2-5641-01A-01D-1534-10 ENST00000255674 p.A103del RTTN chr18 70204177 70204177 Silent C C T TCGA-B2-5641-01A-01D-1534-10 ENST00000255674 p.Q102Q PRR22 chr19 5784416 5784416 Missense_Mutation G G T TCGA-B2-5641-01A-01D-1534-10 ENST00000419421 p.P52T SYDE1 chr19 15112370 15112370 Missense_Mutation C C A TCGA-B2-5641-01A-01D-1534-10 ENST00000342784 p.H535N ZNF714 chr19 21117707 21117707 Missense_Mutation A A G TCGA-B2-5641-01A-01D-1534-10 ENST00000456283 p.K348R ZNF180 chr19 44500218 44500218 Missense_Mutation G G A TCGA-B2-5641-01A-01D-1534-10 ENST00000221327 p.T8M PPFIA3 chr19 49138345 49138345 Missense_Mutation C C T TCGA-B2-5641-01A-01D-1534-10 ENST00000334186 p.A665V MACROD2 chr20 15987065 15987065 Splice_Site G G C TCGA-B2-5641-01A-01D-1534-10 ENST00000217246 p.X354_splice TTI1 chr20 38012889 38012889 Missense_Mutation G G T TCGA-B2-5641-01A-01D-1534-10 ENST00000373447 p.L310M UPB1 chr22 24502357 24502357 Intron G G A TCGA-B2-5641-01A-01D-1534-10 ENST00000326010 KDM5C chrX 53217947 53217953 Frame_Shift_Del CCACCTT CCACCTT - TCGA-B2-5641-01A-01D-1534-10 ENST00000375401 p.E122Vfs*14 KDM5C chrX 53217961 53217961 Silent C C G TCGA-B2-5641-01A-01D-1534-10 ENST00000375401 p.V119V PHF8 chrX 54017687 54017687 Missense_Mutation G G T TCGA-B2-5641-01A-01D-1534-10 ENST00000357988 p.T179N IGSF1 chrX 131276052 131276052 Silent C C T TCGA-B2-5641-01A-01D-1534-10 ENST00000361420 p.E935E RSPO1 chr1 37613870 37613870 Nonsense_Mutation C C T TCGA-B0-5107-01A-01D-1421-08 ENST00000356545 p.W153* BMP8B chr1 39760405 39760405 3'UTR C C T TCGA-B0-5107-01A-01D-1421-08 ENST00000372827 TXNDC12 chr1 52027319 52027319 Nonsense_Mutation C C A TCGA-B0-5107-01A-01D-1421-08 ENST00000371626 p.E81* SPAG17 chr1 118055827 118055827 Missense_Mutation T T A TCGA-B0-5107-01A-01D-1421-08 ENST00000336338 p.K876N ECM1 chr1 150509999 150509999 Missense_Mutation G G A TCGA-B0-5107-01A-01D-1421-08 ENST00000369047 p.E101K FCRLA chr1 161707285 161707285 Silent C C A TCGA-B0-5107-01A-01D-1421-08 ENST00000367959 p.L24L NVL chr1 224303840 224303840 Silent G G A TCGA-B0-5107-01A-01D-1421-08 ENST00000281701 p.L281L OR2T1 chr1 248405995 248405996 Frame_Shift_Ins - - TGTG TCGA-B0-5107-01A-01D-1421-08 ENST00000366474 p.W2Cfs*23 CYP26B1 chr2 72132416 72132416 Missense_Mutation G G T TCGA-B0-5107-01A-01D-1421-08 ENST00000001146 p.F450L RANBP2 chr2 108767687 108767687 Missense_Mutation A A G TCGA-B0-5107-01A-01D-1421-08 ENST00000283195 p.N2383S NEB chr2 151496283 151496283 Missense_Mutation A A G TCGA-B0-5107-01A-01D-1421-08 ENST00000172853 p.I6304T CHL1 chr3 401668 401668 Missense_Mutation C C T TCGA-B0-5107-01A-01D-1421-08 ENST00000397491 p.S1127L VHL chr3 10142110 10142110 Missense_Mutation G G T TCGA-B0-5107-01A-01D-1421-08 ENST00000256474 p.W88L BAP1 chr3 52408496 52408496 Missense_Mutation T T C TCGA-B0-5107-01A-01D-1421-08 ENST00000460680 p.N78S PBRM1 chr3 52642047 52642047 Splice_Site T T A TCGA-B0-5107-01A-01D-1421-08 ENST00000296302 p.X332_splice ATR chr3 142547763 142547763 Frame_Shift_Del A A - TCGA-B0-5107-01A-01D-1421-08 ENST00000350721 p.Y1107Ifs*12 FGFBP1 chr4 15936411 15936411 Missense_Mutation C C A TCGA-B0-5107-01A-01D-1421-08 ENST00000382333 p.E74D JMY chr5 79312454 79312454 Missense_Mutation C C A TCGA-B0-5107-01A-01D-1421-08 ENST00000396137 p.Q674K GPX6 chr6 28515701 28515701 Frame_Shift_Del G G - TCGA-B0-5107-01A-01D-1421-08 ENST00000361902 p.L15Wfs*9 PRRC2A chr6 31631878 31631878 Missense_Mutation G G A TCGA-B0-5107-01A-01D-1421-08 ENST00000376007 p.G1069R TMEM242 chr6 157323434 157323434 Silent A A G TCGA-B0-5107-01A-01D-1421-08 ENST00000400788 p.N22N SUN1 chr7 873255 873255 Missense_Mutation G G A TCGA-B0-5107-01A-01D-1421-08 ENST00000401592 p.R761Q ADAP1 chr7 899436 899436 Missense_Mutation A A C TCGA-B0-5107-01A-01D-1421-08 ENST00000265846 p.Y284D RBAK-RBAKDN chr7 4983769 4983769 5'UTR C C A TCGA-B0-5107-01A-01D-1421-08 ENST00000407184 RBAK-RBAKDN chr7 4983770 4983770 5'UTR A A C TCGA-B0-5107-01A-01D-1421-08 ENST00000407184 CUX1 chr7 102202077 102202078 Frame_Shift_Ins - - C TCGA-B0-5107-01A-01D-1421-08 ENST00000292535 p.L930Afs*24 NRF1 chr7 129657421 129657421 Missense_Mutation G G A TCGA-B0-5107-01A-01D-1421-08 ENST00000223190 p.V24M AKR1B10 chr7 134537658 134537658 Silent C C T TCGA-B0-5107-01A-01D-1421-08 ENST00000359579 p.A246A DPP6 chr7 154588077 154588077 Intron C C A TCGA-B0-5107-01A-01D-1421-08 ENST00000377770 ADAM7 chr8 24508646 24508646 3'UTR T T C TCGA-B0-5107-01A-01D-1421-08 ENST00000175238 PRKDC chr8 47782237 47782237 Nonsense_Mutation C C T TCGA-B0-5107-01A-01D-1421-08 ENST00000314191 p.W3805* ZFPM2 chr8 105801662 105801662 Missense_Mutation G G A TCGA-B0-5107-01A-01D-1421-08 ENST00000407775 p.R527Q NDRG1 chr8 133244401 133244401 Intron G G T TCGA-B0-5107-01A-01D-1421-08 ENST00000323851 SMARCA2 chr9 2116050 2116050 Splice_Site G G A TCGA-B0-5107-01A-01D-1421-08 ENST00000349721 p.X1228_splice AQP7P2 chr9 64622346 64622346 RNA T T C TCGA-B0-5107-01A-01D-1421-08 ENST00000453967 TLR4 chr9 117713112 117713112 Silent T T C TCGA-B0-5107-01A-01D-1421-08 ENST00000355622 p.Y328Y RABGAP1 chr9 123103115 123103115 Missense_Mutation G G A TCGA-B0-5107-01A-01D-1421-08 ENST00000373647 p.A1038T WDR37 chr10 1103835 1103835 Splice_Region A A C TCGA-B0-5107-01A-01D-1421-08 ENST00000263150 p.T320T CUZD1 chr10 122833932 122833932 Missense_Mutation C C T TCGA-B0-5107-01A-01D-1421-08 ENST00000368904 p.R464Q RBM14 chr11 66624307 66624307 Missense_Mutation T T G TCGA-B0-5107-01A-01D-1421-08 ENST00000310137 p.V144G SHANK2 chr11 70486328 70486328 Missense_Mutation G G C TCGA-B0-5107-01A-01D-1421-08 ENST00000423696 p.T943S NLRX1 chr11 119180017 119180017 Missense_Mutation G G A TCGA-B0-5107-01A-01D-1421-08 ENST00000292199 p.G666S CCNT1 chr12 48716675 48716675 Translation_Start_Site T T G TCGA-B0-5107-01A-01D-1421-08 ENST00000261900 p.M1? POC1B chr12 89491949 89491949 Frame_Shift_Del C C - TCGA-B0-5107-01A-01D-1421-08 ENST00000313546 p.V147Yfs*12 NTN4 chr12 95787382 95787383 Frame_Shift_Del AG AG - TCGA-B0-5107-01A-01D-1421-08 ENST00000343702 p.W48Gfs*18 MAB21L1 chr13 35475236 35475236 Silent G G A TCGA-B0-5107-01A-01D-1421-08 ENST00000379919 p.N301N CIDEB chr14 24305767 24305767 Splice_Site T T C TCGA-B0-5107-01A-01D-1421-08 ENST00000258807 p.X176_splice ARHGAP5 chr14 32091369 32091369 Frame_Shift_Del A A - TCGA-B0-5107-01A-01D-1421-08 ENST00000345122 p.N234Tfs*50 FLVCR2 chr14 75622091 75622091 Missense_Mutation A A G TCGA-B0-5107-01A-01D-1421-08 ENST00000238667 p.I228V CAPN3 chr15 42409807 42409807 Missense_Mutation T T G TCGA-B0-5107-01A-01D-1421-08 ENST00000397163 p.D671E CPEB1 chr15 82557959 82557959 Missense_Mutation C C A TCGA-B0-5107-01A-01D-1421-08 ENST00000615198 p.G136V ALPK3 chr15 84862796 84862796 Missense_Mutation G G A TCGA-B0-5107-01A-01D-1421-08 ENST00000258888 p.G1633R CRK chr17 1423621 1423621 Silent A A G TCGA-B0-5107-01A-01D-1421-08 ENST00000300574 p.I269I OR1A1 chr17 3216101 3216101 Missense_Mutation C C A TCGA-B0-5107-01A-01D-1421-08 ENST00000304094 p.L161M AC005863.1 chr17 14770202 14770202 RNA C C G TCGA-B0-5107-01A-01D-1421-08 ENST00000379640 NATD1 chr17 21244190 21244190 Silent G G A TCGA-B0-5107-01A-01D-1421-08 ENST00000611551 p.Y47Y LAMA1 chr18 7026068 7026068 Silent C C T TCGA-B0-5107-01A-01D-1421-08 ENST00000389658 p.Q771Q C3 chr19 6686798 6686798 Missense_Mutation C C G TCGA-B0-5107-01A-01D-1421-08 ENST00000245907 p.Q1198H FBN3 chr19 8100943 8100943 Missense_Mutation C C T TCGA-B0-5107-01A-01D-1421-08 ENST00000270509 p.A1707T RHPN2 chr19 33002855 33002855 Silent A A G TCGA-B0-5107-01A-01D-1421-08 ENST00000254260 p.N302N FCGBP chr19 39892094 39892094 Silent T T A TCGA-B0-5107-01A-01D-1421-08 ENST00000616721 p.S2183S USP29 chr19 57129450 57129450 Nonsense_Mutation G G T TCGA-B0-5107-01A-01D-1421-08 ENST00000254181 p.E259* PTPRT chr20 42315787 42315787 Missense_Mutation T T C TCGA-B0-5107-01A-01D-1421-08 ENST00000373187 p.N692S NPBWR2 chr20 64106030 64106030 Missense_Mutation C C T TCGA-B0-5107-01A-01D-1421-08 ENST00000369768 p.V268M BAGE2 chr21 10473644 10473644 RNA C C A TCGA-B0-5107-01A-01D-1421-08 ENST00000470054 TLR8 chrX 12921426 12921426 Missense_Mutation C C A TCGA-B0-5107-01A-01D-1421-08 ENST00000218032 p.P796T NHS chrX 17727488 17727488 Missense_Mutation C C G TCGA-B0-5107-01A-01D-1421-08 ENST00000380060 p.P1107A PPEF1 chrX 18818094 18818094 Nonsense_Mutation C C T TCGA-B0-5107-01A-01D-1421-08 ENST00000361511 p.R484* PHKA2 chrX 18952526 18952526 Missense_Mutation T T A TCGA-B0-5107-01A-01D-1421-08 ENST00000379942 p.M85L CPXCR1 chrX 88754259 88754259 Missense_Mutation G G A TCGA-B0-5107-01A-01D-1421-08 ENST00000276127 p.G282E HIST2H2BF chr1 149812132 149812132 Silent G G A TCGA-DV-A4VZ-01A-11D-A25V-10 ENST00000369167 p.N64N FLG chr1 152309193 152309193 Missense_Mutation G G A TCGA-DV-A4VZ-01A-11D-A25V-10 ENST00000368799 p.S1898L DCTN1 chr2 74366294 74366294 Missense_Mutation C C T TCGA-DV-A4VZ-01A-11D-A25V-10 ENST00000361874 p.A904T TTN chr2 178566497 178566497 Silent G G A TCGA-DV-A4VZ-01A-11D-A25V-10 ENST00000591111 p.V24904V OTOL1 chr3 161502364 161502364 Missense_Mutation C C T TCGA-DV-A4VZ-01A-11D-A25V-10 ENST00000327928 p.A171V KDR chr4 55098788 55098788 Missense_Mutation G G C TCGA-DV-A4VZ-01A-11D-A25V-10 ENST00000263923 p.T761R CDH10 chr5 24537646 24537646 Missense_Mutation C C T TCGA-DV-A4VZ-01A-11D-A25V-10 ENST00000264463 p.G87E OR2W1 chr6 29044596 29044596 Missense_Mutation T T C TCGA-DV-A4VZ-01A-11D-A25V-10 ENST00000377175 p.T194A COL15A1 chr9 98985620 98985620 Silent C C A TCGA-DV-A4VZ-01A-11D-A25V-10 ENST00000375001 p.P52P DDX31 chr9 132638186 132638186 Intron C C G TCGA-DV-A4VZ-01A-11D-A25V-10 ENST00000372153 ZFPM1 chr16 88532816 88532818 In_Frame_Del CCA CCA - TCGA-DV-A4VZ-01A-11D-A25V-10 ENST00000319555 p.T359del MYH1 chr17 10515980 10515980 Missense_Mutation C C A TCGA-DV-A4VZ-01A-11D-A25V-10 ENST00000226207 p.A151S PYGB chr20 25278393 25278393 Silent C C T TCGA-DV-A4VZ-01A-11D-A25V-10 ENST00000216962 p.R310R LRP8 chr1 53275747 53275747 Missense_Mutation C C T TCGA-BP-4995-01A-01D-1462-08 ENST00000306052 p.G297D PTGFR chr1 78493156 78493156 Missense_Mutation C C G TCGA-BP-4995-01A-01D-1462-08 ENST00000370757 p.T138R NBPF15 chr1 144427898 144427898 Missense_Mutation A A C TCGA-BP-4995-01A-01D-1462-08 ENST00000488031 p.L378R UBE2Q1 chr1 154550465 154550465 Nonsense_Mutation C C T TCGA-BP-4995-01A-01D-1462-08 ENST00000292211 p.W414* LY9 chr1 160799825 160799825 Missense_Mutation C C G TCGA-BP-4995-01A-01D-1462-08 ENST00000263285 p.P66R CACNA1S chr1 201040671 201040671 Missense_Mutation A A T TCGA-BP-4995-01A-01D-1462-08 ENST00000362061 p.L1726Q CDC42BPA chr1 227040134 227040134 Nonsense_Mutation C C A TCGA-BP-4995-01A-01D-1462-08 ENST00000334218 p.E1044* ACTN2 chr1 236761071 236761071 Silent C C A TCGA-BP-4995-01A-01D-1462-08 ENST00000366578 p.T808T CHRM3 chr1 239908592 239908599 Frame_Shift_Del ACCAAGTT ACCAAGTT - TCGA-BP-4995-01A-01D-1462-08 ENST00000255380 p.K382Lfs*9 RSAD2 chr2 6883466 6883466 Missense_Mutation C C T TCGA-BP-4995-01A-01D-1462-08 ENST00000382040 p.R148W UGGT1 chr2 128170315 128170315 Silent G G T TCGA-BP-4995-01A-01D-1462-08 ENST00000259253 p.G983G TTN chr2 178589887 178589887 Missense_Mutation T T A TCGA-BP-4995-01A-01D-1462-08 ENST00000591111 p.Q18972L PIKFYVE chr2 208304918 208304918 Missense_Mutation C C A TCGA-BP-4995-01A-01D-1462-08 ENST00000264380 p.S514Y VHL chr3 10142050 10142050 Nonsense_Mutation C C A TCGA-BP-4995-01A-01D-1462-08 ENST00000256474 p.S68* OXSM chr3 25791222 25791222 Missense_Mutation G G C TCGA-BP-4995-01A-01D-1462-08 ENST00000280701 p.G68R PBRM1 chr3 52586669 52586669 Missense_Mutation G G C TCGA-BP-4995-01A-01D-1462-08 ENST00000296302 p.P1048R COL6A6 chr3 130571113 130571113 Silent C C T TCGA-BP-4995-01A-01D-1462-08 ENST00000358511 p.F899F NCEH1 chr3 172648105 172648105 Missense_Mutation T T A TCGA-BP-4995-01A-01D-1462-08 ENST00000538775 p.I82F TEC chr4 48145506 48145506 Missense_Mutation C C A TCGA-BP-4995-01A-01D-1462-08 ENST00000381501 p.R385S ANK2 chr4 113356797 113356797 Nonsense_Mutation C C T TCGA-BP-4995-01A-01D-1462-08 ENST00000357077 p.Q2727* TLR2 chr4 153705028 153705036 In_Frame_Del TGTGAAGAG TGTGAAGAG - TCGA-BP-4995-01A-01D-1462-08 ENST00000260010 p.V708_S710del DCHS2 chr4 154332839 154332839 Silent C C T TCGA-BP-4995-01A-01D-1462-08 ENST00000623607 p.S624S PCDHB7 chr5 141174410 141174410 Silent G G A TCGA-BP-4995-01A-01D-1462-08 ENST00000231137 p.Q525Q GRK6 chr5 177433404 177433404 Missense_Mutation T T A TCGA-BP-4995-01A-01D-1462-08 ENST00000355472 p.F197L RREB1 chr6 7231033 7231033 Silent T T A TCGA-BP-4995-01A-01D-1462-08 ENST00000349384 p.S978S CYP3A7 chr7 99715860 99715860 Nonsense_Mutation C C A TCGA-BP-4995-01A-01D-1462-08 ENST00000336374 p.G190* SPAM1 chr7 123953803 123953803 Missense_Mutation G G A TCGA-BP-4995-01A-01D-1462-08 ENST00000223028 p.S78N SLC7A2 chr8 17554608 17554608 Silent G G A TCGA-BP-4995-01A-01D-1462-08 ENST00000494857 p.A368A CHMP7 chr8 23260577 23260577 Missense_Mutation A A C TCGA-BP-4995-01A-01D-1462-08 ENST00000313219 p.E447A SVEP1 chr9 110450227 110450227 Missense_Mutation T T C TCGA-BP-4995-01A-01D-1462-08 ENST00000374469 p.Q1312R ZNF438 chr10 30845270 30845270 Silent C C T TCGA-BP-4995-01A-01D-1462-08 ENST00000361310 p.L726L ANK3 chr10 60055762 60055762 Missense_Mutation A A T TCGA-BP-4995-01A-01D-1462-08 ENST00000280772 p.C4321S DLG5 chr10 77794019 77794019 Missense_Mutation C C G TCGA-BP-4995-01A-01D-1462-08 ENST00000372391 p.R1882T FANCF chr11 22625298 22625298 Silent C C T TCGA-BP-4995-01A-01D-1462-08 ENST00000327470 p.L171L MTA2 chr11 62598608 62598608 Silent C C G TCGA-BP-4995-01A-01D-1462-08 ENST00000278823 p.G74G FAT3 chr11 92354369 92354369 Missense_Mutation G G A TCGA-BP-4995-01A-01D-1462-08 ENST00000525166 p.A603T VEZT chr12 95300464 95300464 Missense_Mutation C C T TCGA-BP-4995-01A-01D-1462-08 ENST00000436874 p.P711S VWA8 chr13 41866030 41866030 Missense_Mutation C C T TCGA-BP-4995-01A-01D-1462-08 ENST00000379310 p.A407T SLC8A3 chr14 70168134 70168134 Missense_Mutation G G A TCGA-BP-4995-01A-01D-1462-08 ENST00000381269 p.R97C NEK9 chr14 75106427 75106427 Intron G G - TCGA-BP-4995-01A-01D-1462-08 ENST00000238616 AHNAK2 chr14 104951703 104951703 Nonsense_Mutation G G A TCGA-BP-4995-01A-01D-1462-08 ENST00000333244 p.Q1250* RAD51 chr15 40718818 40718818 Missense_Mutation G G A TCGA-BP-4995-01A-01D-1462-08 ENST00000267868 p.R150Q MAP1A chr15 43529735 43529735 Silent T T A TCGA-BP-4995-01A-01D-1462-08 ENST00000300231 p.A2707A NMRAL1 chr16 4469368 4469368 Silent C C T TCGA-BP-4995-01A-01D-1462-08 ENST00000283429 p.E46E ABCC1 chr16 16014619 16014619 Silent C C T TCGA-BP-4995-01A-01D-1462-08 ENST00000399410 p.A160A DDX5 chr17 64503981 64503984 Splice_Site ACAG ACAG - TCGA-BP-4995-01A-01D-1462-08 ENST00000225792 p.X147_splice ZNF521 chr18 25224593 25224593 Missense_Mutation C C T TCGA-BP-4995-01A-01D-1462-08 ENST00000361524 p.V1109I BOD1L2 chr18 57147655 57147655 Frame_Shift_Del G G - TCGA-BP-4995-01A-01D-1462-08 ENST00000585477 p.G115Efs*14 PRMT1 chr19 49682062 49682062 Silent C C T TCGA-BP-4995-01A-01D-1462-08 ENST00000454376 p.I115I TMCO4 chr1 19755738 19755738 Silent G G A TCGA-B8-5550-01A-01D-1534-10 ENST00000294543 p.L137L ZCCHC17 chr1 31364087 31364087 Missense_Mutation A A C TCGA-B8-5550-01A-01D-1534-10 ENST00000344147 p.D207A HCRTR1 chr1 31621010 31621010 Frame_Shift_Del C C - TCGA-B8-5550-01A-01D-1534-10 ENST00000373706 p.M183Wfs*10 WDR78 chr1 66924743 66924743 Frame_Shift_Del T T - TCGA-B8-5550-01A-01D-1534-10 ENST00000371026 p.K30Rfs*28 WDR78 chr1 66924745 66924745 Missense_Mutation T T A TCGA-B8-5550-01A-01D-1534-10 ENST00000371026 p.K29N COL24A1 chr1 85965006 85965006 Splice_Region T T C TCGA-B8-5550-01A-01D-1534-10 ENST00000370571 ZNF326 chr1 90020831 90020831 Missense_Mutation T T C TCGA-B8-5550-01A-01D-1534-10 ENST00000340281 p.V405A BRDT chr1 91979601 91979601 Silent G G A TCGA-B8-5550-01A-01D-1534-10 ENST00000362005 p.P377P EPS8L3 chr1 109757532 109757532 Silent C C T TCGA-B8-5550-01A-01D-1534-10 ENST00000361965 p.K306K FAM46C chr1 117623705 117623705 Silent G G T TCGA-B8-5550-01A-01D-1534-10 ENST00000369448 p.P279P SPAG17 chr1 118016026 118016026 Missense_Mutation T T A TCGA-B8-5550-01A-01D-1534-10 ENST00000336338 p.E1409V NOTCH2 chr1 119949127 119949127 Splice_Site C C A TCGA-B8-5550-01A-01D-1534-10 ENST00000256646 p.X827_splice TARS2 chr1 150497677 150497681 Frame_Shift_Del CAGAG CAGAG - TCGA-B8-5550-01A-01D-1534-10 ENST00000369064 p.Q390* FLG chr1 152306223 152306223 Missense_Mutation C C T TCGA-B8-5550-01A-01D-1534-10 ENST00000368799 p.G2888E CRB1 chr1 197427760 197427760 Missense_Mutation A A T TCGA-B8-5550-01A-01D-1534-10 ENST00000367400 p.Q812L DNAH14 chr1 225398656 225398656 Nonsense_Mutation T T A TCGA-B8-5550-01A-01D-1534-10 ENST00000445597 p.L3433* FH chr1 241497788 241497788 3'UTR A A T TCGA-B8-5550-01A-01D-1534-10 ENST00000366560 OR13G1 chr1 247672234 247672234 Frame_Shift_Del C C - TCGA-B8-5550-01A-01D-1534-10 ENST00000359688 p.V270Wfs*2 PGBD2 chr1 248918155 248918155 Missense_Mutation A A C TCGA-B8-5550-01A-01D-1534-10 ENST00000329291 p.Y524S ALK chr2 29320750 29320750 Splice_Site C C T TCGA-B8-5550-01A-01D-1534-10 ENST00000389048 p.X516_splice AFTPH chr2 64552611 64552635 Frame_Shift_Del AGTTGGTTCTCCCAAAGAAGAAAGT AGTTGGTTCTCCCAAAGAAGAAAGT - TCGA-B8-5550-01A-01D-1534-10 ENST00000238855 p.V380Efs*23 ANTXR1 chr2 69182496 69182496 Missense_Mutation C C T TCGA-B8-5550-01A-01D-1534-10 ENST00000303714 p.R397C NAT8B chr2 73701204 73701204 RNA C C T TCGA-B8-5550-01A-01D-1534-10 ENST00000624865 INPP4A chr2 98519984 98519984 5'UTR C C T TCGA-B8-5550-01A-01D-1534-10 ENST00000074304 RGPD8 chr2 112388489 112388489 Missense_Mutation A A T TCGA-B8-5550-01A-01D-1534-10 ENST00000302558 p.S1486T RGPD8 chr2 112388490 112388490 Missense_Mutation C C A TCGA-B8-5550-01A-01D-1534-10 ENST00000302558 p.E1485D POLR1B chr2 112559398 112559398 Missense_Mutation C C T TCGA-B8-5550-01A-01D-1534-10 ENST00000263331 p.A479V PIKFYVE chr2 208271623 208271623 Missense_Mutation C C A TCGA-B8-5550-01A-01D-1534-10 ENST00000264380 p.P35H KIF1A chr2 240786509 240786509 Missense_Mutation C C A TCGA-B8-5550-01A-01D-1534-10 ENST00000320389 p.S145I BAP1 chr3 52404486 52404487 Frame_Shift_Ins - - C TCGA-B8-5550-01A-01D-1534-10 ENST00000460680 p.E406Gfs*3 STX19 chr3 94014493 94014493 Silent C C T TCGA-B8-5550-01A-01D-1534-10 ENST00000315099 p.E259E PDGFRA chr4 54264835 54264835 Intron A A T TCGA-B8-5550-01A-01D-1534-10 ENST00000257290 AASDH chr4 56350037 56350037 Missense_Mutation C C A TCGA-B8-5550-01A-01D-1534-10 ENST00000205214 p.D572Y SPP1 chr4 87981728 87981728 Missense_Mutation A A G TCGA-B8-5550-01A-01D-1534-10 ENST00000395080 p.D157G PRSS12 chr4 118281789 118281789 3'UTR C C T TCGA-B8-5550-01A-01D-1534-10 ENST00000296498 PCDH18 chr4 137531431 137531431 Missense_Mutation C C T TCGA-B8-5550-01A-01D-1534-10 ENST00000344876 p.D220N MGARP chr4 139266890 139266890 Missense_Mutation C C A TCGA-B8-5550-01A-01D-1534-10 ENST00000398955 p.E144D ANAPC10 chr4 144995303 144995303 3'UTR G G A TCGA-B8-5550-01A-01D-1534-10 ENST00000309439 CDKN2AIP chr4 183446396 183446396 Frame_Shift_Del A A - TCGA-B8-5550-01A-01D-1534-10 ENST00000504169 p.K238Nfs*11 DNAH5 chr5 13717432 13717432 Missense_Mutation C C A TCGA-B8-5550-01A-01D-1534-10 ENST00000265104 p.Q4196H MTMR12 chr5 32270826 32270826 Silent T T C TCGA-B8-5550-01A-01D-1534-10 ENST00000382142 p.E160E TTC23L chr5 34880209 34880209 Silent T T C TCGA-B8-5550-01A-01D-1534-10 ENST00000505624 p.S326S LVRN chr5 116012402 116012402 Missense_Mutation T T A TCGA-B8-5550-01A-01D-1534-10 ENST00000357872 p.I759K LYRM7 chr5 131170988 131170988 5'UTR G G T TCGA-B8-5550-01A-01D-1534-10 ENST00000379380 PCDHB4 chr5 141123352 141123352 Missense_Mutation C C A TCGA-B8-5550-01A-01D-1534-10 ENST00000194152 p.Q452K ARHGAP26 chr5 143121147 143121147 Missense_Mutation G G C TCGA-B8-5550-01A-01D-1534-10 ENST00000274498 p.K566N SPINK5 chr5 148125726 148125726 Missense_Mutation G G A TCGA-B8-5550-01A-01D-1534-10 ENST00000256084 p.E915K HMGXB3 chr5 150052327 150052327 3'UTR G G C TCGA-B8-5550-01A-01D-1534-10 ENST00000613459 SPARC chr5 151669718 151669718 Frame_Shift_Del C C - TCGA-B8-5550-01A-01D-1534-10 ENST00000231061 p.E133Rfs*28 CYFIP2 chr5 157323955 157323955 Missense_Mutation T T C TCGA-B8-5550-01A-01D-1534-10 ENST00000616178 p.I594T HCP5 chr6 31464133 31464133 RNA G G A TCGA-B8-5550-01A-01D-1534-10 ENST00000414046 DNAH8 chr6 38913891 38913891 Missense_Mutation T T A TCGA-B8-5550-01A-01D-1534-10 ENST00000359357 p.L3084H IL17A chr6 52189268 52189268 Silent C C A TCGA-B8-5550-01A-01D-1534-10 ENST00000340057 p.T148T EYS chr6 63720504 63720504 3'Flank A A T TCGA-B8-5550-01A-01D-1534-10 ENST00000370616 DSE chr6 116436703 116436703 Silent C C T TCGA-B8-5550-01A-01D-1534-10 ENST00000331677 p.N745N ROS1 chr6 117396966 117396966 Missense_Mutation G G T TCGA-B8-5550-01A-01D-1534-10 ENST00000368508 p.T243K SUGCT chr7 40449344 40449344 Missense_Mutation G G C TCGA-B8-5550-01A-01D-1534-10 ENST00000335693 p.A299P AKAP9 chr7 92000898 92000898 Missense_Mutation G G T TCGA-B8-5550-01A-01D-1534-10 ENST00000356239 p.K327N AKAP9 chr7 92095156 92095156 Missense_Mutation G G T TCGA-B8-5550-01A-01D-1534-10 ENST00000356239 p.D3238Y EPHB4 chr7 100807503 100807503 Silent G G C TCGA-B8-5550-01A-01D-1534-10 ENST00000358173 p.A732A IQUB chr7 123502958 123502958 Missense_Mutation A A G TCGA-B8-5550-01A-01D-1534-10 ENST00000324698 p.C285R PSD3 chr8 18808839 18808839 Intron G G A TCGA-B8-5550-01A-01D-1534-10 ENST00000440756 KIF13B chr8 29118956 29118956 Frame_Shift_Del G G - TCGA-B8-5550-01A-01D-1534-10 ENST00000524189 p.P1191Qfs*10 RAB2A chr8 60558888 60558888 Missense_Mutation A A T TCGA-B8-5550-01A-01D-1534-10 ENST00000262646 p.D28V FAM91A1 chr8 123787717 123787717 Missense_Mutation G G C TCGA-B8-5550-01A-01D-1534-10 ENST00000334705 p.E415D KLHL9 chr9 21334023 21334023 Missense_Mutation C C T TCGA-B8-5550-01A-01D-1534-10 ENST00000359039 p.M279I ALDH1A1 chr9 72930927 72930927 Silent T T C TCGA-B8-5550-01A-01D-1534-10 ENST00000297785 p.L88L AKNA chr9 114368545 114368545 Silent T T A TCGA-B8-5550-01A-01D-1534-10 ENST00000307564 p.G489G ADGRD2 chr9 124452649 124452649 Silent T T A TCGA-B8-5550-01A-01D-1534-10 ENST00000334810 p.V70V SKIDA1 chr10 21515145 21515145 Missense_Mutation G G A TCGA-B8-5550-01A-01D-1534-10 ENST00000449193 p.S893F IFIT1 chr10 89403046 89403046 Silent A A T TCGA-B8-5550-01A-01D-1534-10 ENST00000371804 p.A257A MRGPRX3 chr11 18137606 18137606 Missense_Mutation C C T TCGA-B8-5550-01A-01D-1534-10 ENST00000396275 p.P135L USP35 chr11 78210040 78210040 Nonsense_Mutation C C T TCGA-B8-5550-01A-01D-1534-10 ENST00000529308 p.Q729* SCN3B chr11 123642666 123642666 Silent G G A TCGA-B8-5550-01A-01D-1534-10 ENST00000299333 p.Y75Y HEPACAM chr11 124922416 124922416 Missense_Mutation G G A TCGA-B8-5550-01A-01D-1534-10 ENST00000298251 p.P307L C1R chr12 7082082 7082082 Missense_Mutation C C T TCGA-B8-5550-01A-01D-1534-10 ENST00000542285 p.G433D PZP chr12 9165301 9165301 Silent G G A TCGA-B8-5550-01A-01D-1534-10 ENST00000261336 p.A775A MANSC1 chr12 12330247 12330247 Missense_Mutation C C T TCGA-B8-5550-01A-01D-1534-10 ENST00000535902 p.G359D SLC48A1 chr12 47780874 47780874 3'UTR G G C TCGA-B8-5550-01A-01D-1534-10 ENST00000442218 PRIM1 chr12 56744087 56744087 Missense_Mutation C C T TCGA-B8-5550-01A-01D-1534-10 ENST00000338193 p.E206K CAPS2 chr12 75276211 75276211 3'UTR T T G TCGA-B8-5550-01A-01D-1534-10 ENST00000409445 CAPS2 chr12 75323003 75323003 Missense_Mutation G G A TCGA-B8-5550-01A-01D-1534-10 ENST00000409445 p.P107S APPL2 chr12 105188292 105188292 Missense_Mutation C C G TCGA-B8-5550-01A-01D-1534-10 ENST00000258530 p.V539L TMEM132C chr12 128696077 128696077 Silent C C A TCGA-B8-5550-01A-01D-1534-10 ENST00000435159 p.R635R RNY4P30 chr13 49892978 49892978 5'Flank T T A TCGA-B8-5550-01A-01D-1534-10 ENST00000410216 FBXL3 chr13 77021617 77021617 Missense_Mutation C C G TCGA-B8-5550-01A-01D-1534-10 ENST00000355619 p.E82Q LTBP2 chr14 74585853 74585853 Splice_Site C C - TCGA-B8-5550-01A-01D-1534-10 ENST00000261978 p.X277_splice LTBP2 chr14 74585857 74585857 Missense_Mutation G G A TCGA-B8-5550-01A-01D-1534-10 ENST00000261978 p.A276V TTC7B chr14 90689579 90689579 Missense_Mutation T T G TCGA-B8-5550-01A-01D-1534-10 ENST00000328459 p.Y304S STARD9 chr15 42718813 42718824 In_Frame_Del GAAAAATGGTTC GAAAAATGGTTC - TCGA-B8-5550-01A-01D-1534-10 ENST00000290607 p.R4635_R4639delinsS SERINC4 chr15 43795194 43795194 Nonsense_Mutation C C A TCGA-B8-5550-01A-01D-1534-10 ENST00000319327 p.E455* WFIKKN1 chr16 631423 631423 Missense_Mutation A A T TCGA-B8-5550-01A-01D-1534-10 ENST00000319070 p.Q57L CMTM2 chr16 66587976 66587976 Missense_Mutation C C A TCGA-B8-5550-01A-01D-1534-10 ENST00000268595 p.H202N GLG1 chr16 74472402 74472402 Frame_Shift_Del T T - TCGA-B8-5550-01A-01D-1534-10 ENST00000422840 p.I688* ADAD2 chr16 84194234 84194234 Intron T T C TCGA-B8-5550-01A-01D-1534-10 ENST00000315906 TEKT1 chr17 6830248 6830249 Frame_Shift_Ins - - CTCT TCGA-B8-5550-01A-01D-1534-10 ENST00000338694 p.L44Efs*5 HNF1B chr17 37744849 37744849 Silent G G T TCGA-B8-5550-01A-01D-1534-10 ENST00000617811 p.L12L EFCAB13 chr17 47440831 47440831 3'UTR T T G TCGA-B8-5550-01A-01D-1534-10 ENST00000331493 GNA13 chr17 65014624 65014624 Missense_Mutation A A T TCGA-B8-5550-01A-01D-1534-10 ENST00000439174 p.L256H PRPSAP1 chr17 76312877 76312877 Missense_Mutation A A G TCGA-B8-5550-01A-01D-1534-10 ENST00000446526 p.V331A GAREM chr18 32287708 32287708 Missense_Mutation A A T TCGA-B8-5550-01A-01D-1534-10 ENST00000269209 p.F297I CD209 chr19 7740839 7740839 3'UTR A A T TCGA-B8-5550-01A-01D-1534-10 ENST00000315599 COL5A3 chr19 9969395 9969396 Frame_Shift_Ins - - GT TCGA-B8-5550-01A-01D-1534-10 ENST00000264828 p.P1369Hfs*25 ZNF93 chr19 19934485 19934485 Silent A A G TCGA-B8-5550-01A-01D-1534-10 ENST00000343769 p.K510K PLD3 chr19 40370139 40370139 Nonsense_Mutation A A T TCGA-B8-5550-01A-01D-1534-10 ENST00000356508 p.K194* ARHGEF1 chr19 41892073 41892073 Missense_Mutation G G C TCGA-B8-5550-01A-01D-1534-10 ENST00000354532 p.A92P RSPH6A chr19 45810602 45810602 Splice_Site C C G TCGA-B8-5550-01A-01D-1534-10 ENST00000221538 p.X296_splice COX6B2 chr19 55354486 55354486 Frame_Shift_Del C C - TCGA-B8-5550-01A-01D-1534-10 ENST00000326529 p.K13Nfs*114 ZNF324B chr19 58456544 58456544 Missense_Mutation A A C TCGA-B8-5550-01A-01D-1534-10 ENST00000336614 p.K534Q CFAP61 chr20 20263023 20263023 Missense_Mutation A A T TCGA-B8-5550-01A-01D-1534-10 ENST00000245957 p.Q799L HCK chr20 32088568 32088568 Missense_Mutation G G A TCGA-B8-5550-01A-01D-1534-10 ENST00000534862 p.G339E EP300 chr22 41129976 41129985 Frame_Shift_Del AATGCTGGTG AATGCTGGTG - TCGA-B8-5550-01A-01D-1534-10 ENST00000263253 p.N419Ifs*9 SUPT20HL1 chrX 24364527 24364527 RNA C C T TCGA-B8-5550-01A-01D-1534-10 ENST00000436466 BCOR chrX 40072430 40072430 Nonsense_Mutation G G T TCGA-B8-5550-01A-01D-1534-10 ENST00000378444 p.Y972* LAMTOR2 chr1 156058336 156058336 Missense_Mutation C C A TCGA-T7-A92I-01A-11D-A36X-10 ENST00000368305 p.L115M ABCG8 chr2 43839089 43839089 Silent G G A TCGA-T7-A92I-01A-11D-A36X-10 ENST00000272286 p.P12P SMEK2 chr2 55564452 55564452 Silent T T C TCGA-T7-A92I-01A-11D-A36X-10 ENST00000616407 p.K707K TTN chr2 178567622 178567622 Silent A A C TCGA-T7-A92I-01A-11D-A36X-10 ENST00000591111 p.G24529G SEPT2 chr2 241326103 241326103 Silent G G A TCGA-T7-A92I-01A-11D-A36X-10 ENST00000360051 p.L40L COL7A1 chr3 48591931 48591931 Missense_Mutation G G T TCGA-T7-A92I-01A-11D-A36X-10 ENST00000328333 p.R442S CNTN3 chr3 74266580 74266580 Missense_Mutation C C T TCGA-T7-A92I-01A-11D-A36X-10 ENST00000263665 p.V963M NPHP3 chr3 132704274 132704274 Missense_Mutation T T C TCGA-T7-A92I-01A-11D-A36X-10 ENST00000337331 p.D483G SEC62 chr3 169976964 169976964 Missense_Mutation G G T TCGA-T7-A92I-01A-11D-A36X-10 ENST00000337002 p.C55F ANK2 chr4 113358300 113358300 Missense_Mutation G G A TCGA-T7-A92I-01A-11D-A36X-10 ENST00000357077 p.V3228M TMEM174 chr5 73173846 73173846 Silent T T C TCGA-T7-A92I-01A-11D-A36X-10 ENST00000296776 p.S201S SEMA6A chr5 116486890 116486890 Missense_Mutation G G A TCGA-T7-A92I-01A-11D-A36X-10 ENST00000343348 p.T274M PCDHGA1 chr5 141330817 141330817 Missense_Mutation G G T TCGA-T7-A92I-01A-11D-A36X-10 ENST00000517417 p.V45L PTPRZ1 chr7 122010895 122010895 Missense_Mutation A A G TCGA-T7-A92I-01A-11D-A36X-10 ENST00000393386 p.I617V EXOC4 chr7 133997620 133997620 Missense_Mutation C C A TCGA-T7-A92I-01A-11D-A36X-10 ENST00000253861 p.H779N BDNF chr11 27659541 27659541 Intron T T C TCGA-T7-A92I-01A-11D-A36X-10 ENST00000356660 PTPRJ chr11 48167351 48167351 Missense_Mutation T T A TCGA-T7-A92I-01A-11D-A36X-10 ENST00000418331 p.Y1335N CCDC81 chr11 86408256 86408256 Missense_Mutation C C T TCGA-T7-A92I-01A-11D-A36X-10 ENST00000445632 p.L367F TCP11L2 chr12 106323740 106323741 Intron - - AT TCGA-T7-A92I-01A-11D-A36X-10 ENST00000299045 BRCA2 chr13 32398686 32398686 Silent C C T TCGA-T7-A92I-01A-11D-A36X-10 ENST00000380152 p.I3391I OR4K1 chr14 19936078 19936078 Missense_Mutation C C T TCGA-T7-A92I-01A-11D-A36X-10 ENST00000285600 p.R138W BUB1B chr15 40170603 40170625 Frame_Shift_Del AGAAAGAGCTGTAGAAGCACTAC AGAAAGAGCTGTAGAAGCACTAC - TCGA-T7-A92I-01A-11D-A36X-10 ENST00000287598 p.E103Rfs*7 MFAP1 chr15 43805107 43805107 Missense_Mutation C C T TCGA-T7-A92I-01A-11D-A36X-10 ENST00000267812 p.R436Q FAM214A chr15 52611182 52611182 Missense_Mutation T T C TCGA-T7-A92I-01A-11D-A36X-10 ENST00000261844 p.S160G TSC2 chr16 2075856 2075856 Missense_Mutation T T A TCGA-T7-A92I-01A-11D-A36X-10 ENST00000219476 p.V868E TSC2 chr16 2080378 2080378 Splice_Site G G C TCGA-T7-A92I-01A-11D-A36X-10 ENST00000219476 p.X1204_splice ZC3H7A chr16 11752769 11752769 Missense_Mutation T T C TCGA-T7-A92I-01A-11D-A36X-10 ENST00000355758 p.I876V CWC25 chr17 38806890 38806890 Missense_Mutation T T A TCGA-T7-A92I-01A-11D-A36X-10 ENST00000614790 p.R259S GHDC chr17 42193030 42193030 Splice_Region A A G TCGA-T7-A92I-01A-11D-A36X-10 ENST00000301671 ZNF791 chr19 12629156 12629156 Frame_Shift_Del A A - TCGA-T7-A92I-01A-11D-A36X-10 ENST00000343325 p.T543Qfs*25 ZNF528 chr19 52415764 52415764 Missense_Mutation G G T TCGA-T7-A92I-01A-11D-A36X-10 ENST00000360465 p.K304N KIR2DL1 chr19 54783743 54783743 Missense_Mutation C C T TCGA-T7-A92I-01A-11D-A36X-10 ENST00000336077 p.P326L CRNKL1 chr20 20042466 20042466 Missense_Mutation T T A TCGA-T7-A92I-01A-11D-A36X-10 ENST00000377340 p.E502D DGCR2 chr22 19122175 19122176 Frame_Shift_Ins - - G TCGA-T7-A92I-01A-11D-A36X-10 ENST00000263196 p.L11Pfs*42 IGLV4-3 chr22 22871891 22871891 Missense_Mutation G G C TCGA-T7-A92I-01A-11D-A36X-10 ENST00000390318 p.S76T JOSD1 chr22 38687872 38687872 3'UTR C C T TCGA-T7-A92I-01A-11D-A36X-10 ENST00000216039 JOSD1 chr22 38687873 38687873 3'UTR T T C TCGA-T7-A92I-01A-11D-A36X-10 ENST00000216039 ARHGEF9 chrX 63665904 63665904 Missense_Mutation C C G TCGA-T7-A92I-01A-11D-A36X-10 ENST00000253401 p.Q346H CATSPER4 chr1 26198077 26198077 Splice_Region G G A TCGA-CZ-5465-01A-01D-1806-10 ENST00000456354 p.L226L PUM1 chr1 30974716 30974716 Missense_Mutation C C T TCGA-CZ-5465-01A-01D-1806-10 ENST00000257075 p.A481T C1orf122 chr1 37807228 37807228 5'Flank G G A TCGA-CZ-5465-01A-01D-1806-10 ENST00000373042 COL9A2 chr1 40311529 40311529 Frame_Shift_Del G G - TCGA-CZ-5465-01A-01D-1806-10 ENST00000372748 p.Q164Rfs*19 USP24 chr1 55176442 55176442 Splice_Region A A T TCGA-CZ-5465-01A-01D-1806-10 ENST00000294383 p.G164G GBP1P1 chr1 89410357 89410357 RNA C C T TCGA-CZ-5465-01A-01D-1806-10 ENST00000394662 CD101 chr1 117018515 117018515 Missense_Mutation G G T TCGA-CZ-5465-01A-01D-1806-10 ENST00000256652 p.A658S S100A16 chr1 153608019 153608040 Frame_Shift_Del CTTTCTGGAGCATCTCGCGGAA CTTTCTGGAGCATCTCGCGGAA - TCGA-CZ-5465-01A-01D-1806-10 ENST00000368703 p.F38Sfs*2 S100A16 chr1 153608046 153608046 Missense_Mutation T T A TCGA-CZ-5465-01A-01D-1806-10 ENST00000368703 p.S36C FCGR3B chr1 161629935 161629935 Silent C C T TCGA-CZ-5465-01A-01D-1806-10 ENST00000294800 p.E54E CENPL chr1 173811274 173811274 Nonsense_Mutation G G C TCGA-CZ-5465-01A-01D-1806-10 ENST00000345664 p.S9* CFHR3 chr1 196779970 196779970 Missense_Mutation G G T TCGA-CZ-5465-01A-01D-1806-10 ENST00000367425 p.V143F USH2A chr1 215675581 215675581 Nonsense_Mutation G G T TCGA-CZ-5465-01A-01D-1806-10 ENST00000307340 p.Y4110* SPATA17 chr1 217774362 217774362 Missense_Mutation G G T TCGA-CZ-5465-01A-01D-1806-10 ENST00000366933 p.R183I TRIM11 chr1 228394953 228394953 Missense_Mutation A A T TCGA-CZ-5465-01A-01D-1806-10 ENST00000284551 p.Y387N C1orf101 chr1 244552643 244552643 Missense_Mutation T T A TCGA-CZ-5465-01A-01D-1806-10 ENST00000366534 p.S286R OR2L8 chr1 247949059 247949059 Frame_Shift_Del A A - TCGA-CZ-5465-01A-01D-1806-10 ENST00000357191 p.I68Lfs*3 BIRC6 chr2 32380168 32380168 Missense_Mutation T T C TCGA-CZ-5465-01A-01D-1806-10 ENST00000421745 p.S175P EIF2AK2 chr2 37120076 37120076 Missense_Mutation C C G TCGA-CZ-5465-01A-01D-1806-10 ENST00000233057 p.W377C BCL11A chr2 60553259 60553259 Silent G G A TCGA-CZ-5465-01A-01D-1806-10 ENST00000335712 p.R4R ANAPC1P1 chr2 86886638 86886638 RNA T T - TCGA-CZ-5465-01A-01D-1806-10 ENST00000426186 RFX8 chr2 101402584 101402585 Frame_Shift_Ins - - A TCGA-CZ-5465-01A-01D-1806-10 ENST00000428343 p.S366Ffs*50 ANAPC1 chr2 111782394 111782394 Missense_Mutation C C G TCGA-CZ-5465-01A-01D-1806-10 ENST00000341068 p.R1726T CLASP1 chr2 121448955 121448955 Splice_Region T T C TCGA-CZ-5465-01A-01D-1806-10 ENST00000263710 p.L563L C2orf27A chr2 131751566 131751566 RNA C C T TCGA-CZ-5465-01A-01D-1806-10 ENST00000624391 THSD7B chr2 137676606 137676606 3'UTR T T G TCGA-CZ-5465-01A-01D-1806-10 ENST00000272643 TTN chr2 178704674 178704674 Missense_Mutation G G A TCGA-CZ-5465-01A-01D-1806-10 ENST00000591111 p.S9616L ERBB4 chr2 211722398 211722398 Missense_Mutation C C A TCGA-CZ-5465-01A-01D-1806-10 ENST00000342788 p.C293F ABCA12 chr2 215012110 215012110 Frame_Shift_Del T T - TCGA-CZ-5465-01A-01D-1806-10 ENST00000272895 p.K661Sfs*3 VHL chr3 10149796 10149796 Frame_Shift_Del T - - TCGA-CZ-5465-01A-01D-1806-10 ENST00000256474 p.L158Rfs*12 CLASP2 chr3 33498613 33498613 3'UTR T T G TCGA-CZ-5465-01A-01D-1806-10 ENST00000480013 PBRM1 chr3 52662183 52662183 Frame_Shift_Del C C - TCGA-CZ-5465-01A-01D-1806-10 ENST00000296302 p.E160Kfs*14 PROS1 chr3 93924240 93924240 Missense_Mutation C C T TCGA-CZ-5465-01A-01D-1806-10 ENST00000394236 p.V87I DRD3 chr3 114139610 114139610 Missense_Mutation C C G TCGA-CZ-5465-01A-01D-1806-10 ENST00000460779 p.V205L TIMMDC1 chr3 119498797 119498797 Missense_Mutation G G C TCGA-CZ-5465-01A-01D-1806-10 ENST00000494664 p.V22L PARP14 chr3 122718699 122718699 Missense_Mutation G G T TCGA-CZ-5465-01A-01D-1806-10 ENST00000474629 p.K1516N IGSF10 chr3 151443601 151443601 Silent T T A TCGA-CZ-5465-01A-01D-1806-10 ENST00000282466 p.A1782A OCIAD2 chr4 48885561 48885561 Missense_Mutation A A G TCGA-CZ-5465-01A-01D-1806-10 ENST00000508632 p.C130R ADGRL3 chr4 61948159 61948159 Missense_Mutation G G A TCGA-CZ-5465-01A-01D-1806-10 ENST00000514591 p.M828I PCDH10 chr4 133152326 133152326 Missense_Mutation T T G TCGA-CZ-5465-01A-01D-1806-10 ENST00000264360 p.F729C MSMO1 chr4 165333578 165333578 Frame_Shift_Del T T - TCGA-CZ-5465-01A-01D-1806-10 ENST00000261507 p.L71Yfs*8 ICE1 chr5 5463531 5463535 Frame_Shift_Del AACAG AACAG - TCGA-CZ-5465-01A-01D-1806-10 ENST00000296564 p.T1400Dfs*11 PDZD2 chr5 32090697 32090697 Missense_Mutation T T G TCGA-CZ-5465-01A-01D-1806-10 ENST00000438447 p.S2417A TBC1D22B chr6 37282284 37282284 Missense_Mutation G G A TCGA-CZ-5465-01A-01D-1806-10 ENST00000373491 p.G174E ENPP3 chr6 131650108 131650108 Missense_Mutation G G C TCGA-CZ-5465-01A-01D-1806-10 ENST00000357639 p.G79A RMND1 chr6 151405834 151405834 Splice_Region G G T TCGA-CZ-5465-01A-01D-1806-10 ENST00000367303 p.V401V SCRN1 chr7 29940713 29940714 Frame_Shift_Ins - - C TCGA-CZ-5465-01A-01D-1806-10 ENST00000242059 p.A237Cfs*34 GTF2IRD2P1 chr7 73243175 73243175 RNA A A - TCGA-CZ-5465-01A-01D-1806-10 ENST00000618962 FBXO24 chr7 100586625 100586625 5'UTR C C G TCGA-CZ-5465-01A-01D-1806-10 ENST00000241071 MET chr7 116771584 116771584 Silent C C G TCGA-CZ-5465-01A-01D-1806-10 ENST00000397752 p.V939V IQUB chr7 123479894 123479894 Silent A A C TCGA-CZ-5465-01A-01D-1806-10 ENST00000324698 p.L437L ZC3HAV1 chr7 139079479 139079479 Missense_Mutation G G A TCGA-CZ-5465-01A-01D-1806-10 ENST00000242351 p.L488F PDLIM2 chr8 22594559 22594559 3'Flank A A T TCGA-CZ-5465-01A-01D-1806-10 ENST00000397760 PKHD1L1 chr8 109448366 109448366 Silent T T C TCGA-CZ-5465-01A-01D-1806-10 ENST00000378402 p.N2000N FER1L6 chr8 124040003 124040003 Silent A A T TCGA-CZ-5465-01A-01D-1806-10 ENST00000399018 p.T862T MROH5 chr8 141434834 141434834 Silent T T C TCGA-CZ-5465-01A-01D-1806-10 ENST00000621837 p.T1256T RANBP6 chr9 6013478 6013478 Missense_Mutation T T G TCGA-CZ-5465-01A-01D-1806-10 ENST00000259569 p.Q710H ALDOB chr9 101429924 101429925 Frame_Shift_Ins - - TT TCGA-CZ-5465-01A-01D-1806-10 ENST00000374855 p.T52Kfs*27 FSD1L chr9 105461614 105461614 Missense_Mutation A A G TCGA-CZ-5465-01A-01D-1806-10 ENST00000481272 p.Q37R C5 chr9 120957284 120957284 Splice_Site C C T TCGA-CZ-5465-01A-01D-1806-10 ENST00000223642 p.X1588_splice URM1 chr9 128389419 128389419 Intron C C G TCGA-CZ-5465-01A-01D-1806-10 ENST00000372853 PRRC2B chr9 131474690 131474690 Missense_Mutation C C T TCGA-CZ-5465-01A-01D-1806-10 ENST00000357304 p.P854L CCDC183 chr9 136802709 136802709 Missense_Mutation G G A TCGA-CZ-5465-01A-01D-1806-10 ENST00000338005 p.V197M USP6NL chr10 11501103 11501103 Missense_Mutation T T C TCGA-CZ-5465-01A-01D-1806-10 ENST00000609104 p.S128G BMS1 chr10 42823142 42823142 Missense_Mutation G G C TCGA-CZ-5465-01A-01D-1806-10 ENST00000374518 p.V1053L TMEM26 chr10 61452995 61452995 Missense_Mutation C C A TCGA-CZ-5465-01A-01D-1806-10 ENST00000399298 p.E29D CCNJ chr10 96050307 96050307 Missense_Mutation C C T TCGA-CZ-5465-01A-01D-1806-10 ENST00000265992 p.R41W MUC2 chr11 1094157 1094157 RNA G G A TCGA-CZ-5465-01A-01D-1806-10 ENST00000361558 SLC5A12 chr11 26673475 26673475 Frame_Shift_Del A A - TCGA-CZ-5465-01A-01D-1806-10 ENST00000396005 p.L545Yfs*80 SLC15A3 chr11 60943764 60943764 Silent G G A TCGA-CZ-5465-01A-01D-1806-10 ENST00000227880 p.I307I NRXN2 chr11 64685857 64685857 Missense_Mutation A A G TCGA-CZ-5465-01A-01D-1806-10 ENST00000265459 p.I314T EFEMP2 chr11 65868323 65868323 Missense_Mutation C C T TCGA-CZ-5465-01A-01D-1806-10 ENST00000307998 p.V316M PITPNM1 chr11 67498320 67498320 Missense_Mutation A A C TCGA-CZ-5465-01A-01D-1806-10 ENST00000356404 p.L496R KMT2A chr11 118519741 118519741 Missense_Mutation A A G TCGA-CZ-5465-01A-01D-1806-10 ENST00000389506 p.N3754S CCND2 chr12 4276138 4276138 Missense_Mutation C C G TCGA-CZ-5465-01A-01D-1806-10 ENST00000261254 p.S110C VAMP1 chr12 6464662 6464662 Intron A A - TCGA-CZ-5465-01A-01D-1806-10 ENST00000396308 LRRK2 chr12 40295606 40295606 Missense_Mutation C C A TCGA-CZ-5465-01A-01D-1806-10 ENST00000298910 p.Q1020K PRICKLE1 chr12 42460173 42460173 Missense_Mutation T T G TCGA-CZ-5465-01A-01D-1806-10 ENST00000345127 p.K711T LETMD1 chr12 51056187 51056187 Missense_Mutation T T G TCGA-CZ-5465-01A-01D-1806-10 ENST00000262055 p.L235R SP1 chr12 53383048 53383048 Silent T T G TCGA-CZ-5465-01A-01D-1806-10 ENST00000327443 p.A367A TMTC3 chr12 88166341 88166341 Missense_Mutation C C T TCGA-CZ-5465-01A-01D-1806-10 ENST00000266712 p.P270L TMTC3 chr12 88190586 88190586 Frame_Shift_Del G G - TCGA-CZ-5465-01A-01D-1806-10 ENST00000266712 p.S557Tfs*2 UHRF1BP1L chr12 100059143 100059143 Missense_Mutation T T G TCGA-CZ-5465-01A-01D-1806-10 ENST00000279907 p.K712Q RP11-473M10.3 chr13 63746860 63746861 RNA - - GGCTCCAGCTATGGCTGTGGCTAT TCGA-CZ-5465-01A-01D-1806-10 ENST00000611641 NALCN chr13 101065525 101065525 Missense_Mutation G G A TCGA-CZ-5465-01A-01D-1806-10 ENST00000251127 p.R1495W SLC7A8 chr14 23127141 23127141 3'UTR G G T TCGA-CZ-5465-01A-01D-1806-10 ENST00000316902 IL25 chr14 23373256 23373256 Missense_Mutation C C A TCGA-CZ-5465-01A-01D-1806-10 ENST00000329715 p.D46E C14orf39 chr14 60471689 60471689 Missense_Mutation T T A TCGA-CZ-5465-01A-01D-1806-10 ENST00000321731 p.Y125F RHOJ chr14 63269169 63269169 Splice_Site G G C TCGA-CZ-5465-01A-01D-1806-10 ENST00000316754 p.X79_splice MLH3 chr14 75046692 75046693 Frame_Shift_Ins - - AT TCGA-CZ-5465-01A-01D-1806-10 ENST00000355774 p.R989Sfs*8 DUOX2 chr15 45111895 45111899 Frame_Shift_Del AGGAA AGGAA - TCGA-CZ-5465-01A-01D-1806-10 ENST00000603300 p.F128Qfs*171 CCPG1 chr15 55377040 55377040 Missense_Mutation T T G TCGA-CZ-5465-01A-01D-1806-10 ENST00000310958 p.E121D ANKRD34C chr15 79294734 79294743 Frame_Shift_Del TCTTGCTCTC TCTTGCTCTC - TCGA-CZ-5465-01A-01D-1806-10 ENST00000421388 p.S484Lfs*5 AP3B2 chr15 82680949 82680949 Frame_Shift_Del T T - TCGA-CZ-5465-01A-01D-1806-10 ENST00000261722 p.N220Tfs*9 RGMA chr15 93073024 93073024 Missense_Mutation G G C TCGA-CZ-5465-01A-01D-1806-10 ENST00000329082 p.L8V SEC14L5 chr16 4990870 4990870 Missense_Mutation A A G TCGA-CZ-5465-01A-01D-1806-10 ENST00000251170 p.K150R C16orf62 chr16 19629812 19629812 Missense_Mutation C C G TCGA-CZ-5465-01A-01D-1806-10 ENST00000417362 p.H516D ATXN2L chr16 28836179 28836179 Missense_Mutation G G A TCGA-CZ-5465-01A-01D-1806-10 ENST00000336783 p.E1048K DNAH2 chr17 7824173 7824173 Missense_Mutation G G C TCGA-CZ-5465-01A-01D-1806-10 ENST00000389173 p.G3844A MYO15A chr17 18151874 18151874 Missense_Mutation C C T TCGA-CZ-5465-01A-01D-1806-10 ENST00000205890 p.R2606W KRT16P1 chr17 18440281 18440281 RNA G G T TCGA-CZ-5465-01A-01D-1806-10 ENST00000584962 COASY chr17 42563068 42563068 Missense_Mutation C C T TCGA-CZ-5465-01A-01D-1806-10 ENST00000393818 p.S149L ADAM11 chr17 44776751 44776751 Missense_Mutation C C G TCGA-CZ-5465-01A-01D-1806-10 ENST00000200557 p.P525A BRIP1 chr17 61743107 61743107 Missense_Mutation C C T TCGA-CZ-5465-01A-01D-1806-10 ENST00000259008 p.R762H SCN4A chr17 63951799 63951799 Silent G G T TCGA-CZ-5465-01A-01D-1806-10 ENST00000435607 p.I826I C17orf99 chr17 78166059 78166059 3'UTR A A G TCGA-CZ-5465-01A-01D-1806-10 ENST00000340363 PTPRM chr18 7955122 7955122 Missense_Mutation A A T TCGA-CZ-5465-01A-01D-1806-10 ENST00000332175 p.E280D AC034110.1 chr18 76690299 76690299 RNA T T C TCGA-CZ-5465-01A-01D-1806-10 ENST00000611889 ABCA7 chr19 1044700 1044700 Missense_Mutation G G A TCGA-CZ-5465-01A-01D-1806-10 ENST00000263094 p.A391T ZNF507 chr19 32353086 32353086 Missense_Mutation T T A TCGA-CZ-5465-01A-01D-1806-10 ENST00000311921 p.C86S CGB2 chr19 49032267 49032267 Intron C C T TCGA-CZ-5465-01A-01D-1806-10 ENST00000359342 PPP6R1 chr19 55241065 55241068 Frame_Shift_Del ATGG ATGG - TCGA-CZ-5465-01A-01D-1806-10 ENST00000412770 p.H392Mfs*11 ZNF132 chr19 58437204 58437204 Nonsense_Mutation C C T TCGA-CZ-5465-01A-01D-1806-10 ENST00000254166 p.W25* FERMT1 chr20 6089048 6089048 Missense_Mutation A A C TCGA-CZ-5465-01A-01D-1806-10 ENST00000217289 p.F394C LTN1 chr21 28967099 28967100 Frame_Shift_Ins - - A TCGA-CZ-5465-01A-01D-1806-10 ENST00000361371 p.S465Kfs*13 TTC3 chr21 37167558 37167558 Missense_Mutation T T A TCGA-CZ-5465-01A-01D-1806-10 ENST00000354749 p.S1469T KIAA1671 chr22 25039644 25039644 Silent C C T TCGA-CZ-5465-01A-01D-1806-10 ENST00000358431 p.S838S MIOX chr22 50489437 50489438 Frame_Shift_Ins - - C TCGA-CZ-5465-01A-01D-1806-10 ENST00000216075 p.E212* CSF2RA chrX 1294429 1294429 Missense_Mutation G G T TCGA-CZ-5465-01A-01D-1806-10 ENST00000381524 p.D250Y KDM6A chrX 45020631 45020633 In_Frame_Del GGT GGT - TCGA-CZ-5465-01A-01D-1806-10 ENST00000377967 p.V156del PORCN chrX 48520454 48520454 Missense_Mutation T T G TCGA-CZ-5465-01A-01D-1806-10 ENST00000326194 p.I455S OPHN1 chrX 68193909 68193909 Missense_Mutation G G C TCGA-CZ-5465-01A-01D-1806-10 ENST00000355520 p.I394M TRMT2B chrX 101042062 101042062 Silent T T C TCGA-CZ-5465-01A-01D-1806-10 ENST00000372935 p.L76L KIF1B chr1 10282385 10282385 Missense_Mutation G G C TCGA-B0-5690-01A-11D-1534-10 ENST00000377086 p.G429A SERINC2 chr1 31429445 31429445 Missense_Mutation T T C TCGA-B0-5690-01A-11D-1534-10 ENST00000373709 p.V307A SLC16A4 chr1 110381752 110381752 Silent A A G TCGA-B0-5690-01A-11D-1534-10 ENST00000369779 p.T88T DHX9 chr1 182880549 182880549 Silent G G T TCGA-B0-5690-01A-11D-1534-10 ENST00000367549 p.L855L OCLM chr1 186401219 186401219 3'UTR C C T TCGA-B0-5690-01A-11D-1534-10 ENST00000574641 PM20D1 chr1 205841820 205841820 Silent T T C TCGA-B0-5690-01A-11D-1534-10 ENST00000367136 p.A345A TMEM206 chr1 212375249 212375249 Missense_Mutation G G C TCGA-B0-5690-01A-11D-1534-10 ENST00000261455 p.Q279E CENPF chr1 214640128 214640128 Missense_Mutation C C T TCGA-B0-5690-01A-11D-1534-10 ENST00000366955 p.A597V ALK chr2 29227043 29227043 Silent C C T TCGA-B0-5690-01A-11D-1534-10 ENST00000389048 p.K982K POLR1A chr2 86078244 86078244 Missense_Mutation C C T TCGA-B0-5690-01A-11D-1534-10 ENST00000263857 p.S376N IGKV1-16 chr2 89099882 89099882 Missense_Mutation A A C TCGA-B0-5690-01A-11D-1534-10 ENST00000479981 p.C110G LRP2 chr2 169191955 169191955 Missense_Mutation C C A TCGA-B0-5690-01A-11D-1534-10 ENST00000263816 p.W2970L TTN chr2 178749338 178749338 Intron G G - TCGA-B0-5690-01A-11D-1534-10 ENST00000591111 SSFA2 chr2 181918867 181918867 Missense_Mutation T T G TCGA-B0-5690-01A-11D-1534-10 ENST00000431877 p.M993R SETD2 chr3 47019752 47019767 Splice_Site AACCTTACCTCTTTTC AACCTTACCTCTTTTC - TCGA-B0-5690-01A-11D-1534-10 ENST00000409792 p.X2475_splice PBRM1 chr3 52550818 52550818 Splice_Site C C A TCGA-B0-5690-01A-11D-1534-10 ENST00000296302 p.X1537_splice ROBO2 chr3 77550842 77550842 Missense_Mutation C C A TCGA-B0-5690-01A-11D-1534-10 ENST00000461745 p.Q362K TRA2B chr3 185926619 185926619 Missense_Mutation C C T TCGA-B0-5690-01A-11D-1534-10 ENST00000453386 p.R51K WDFY3 chr4 84741920 84741920 Splice_Region C C T TCGA-B0-5690-01A-11D-1534-10 ENST00000295888 p.G2025G TMEM144 chr4 158219315 158219315 Missense_Mutation G G A TCGA-B0-5690-01A-11D-1534-10 ENST00000296529 p.G113D SRFBP1 chr5 122022408 122022408 Splice_Site G G A TCGA-B0-5690-01A-11D-1534-10 ENST00000339397 p.X369_splice MEGF10 chr5 127410516 127410516 Missense_Mutation C C G TCGA-B0-5690-01A-11D-1534-10 ENST00000274473 p.R349G NSD1 chr5 177135157 177135157 Silent T T C TCGA-B0-5690-01A-11D-1534-10 ENST00000439151 p.N18N RP11-798K23.3 chr5 179524447 179524447 RNA C C T TCGA-B0-5690-01A-11D-1534-10 ENST00000505650 IRF4 chr6 405128 405128 Missense_Mutation C C A TCGA-B0-5690-01A-11D-1534-10 ENST00000380956 p.H404N AL645922.1 chr6 32007025 32007025 Intron C C G TCGA-B0-5690-01A-11D-1534-10 ENST00000623068 ZMIZ2 chr7 44759280 44759280 Splice_Site G G A TCGA-B0-5690-01A-11D-1534-10 ENST00000309315 p.X272_splice RFC2 chr7 74240020 74240020 Missense_Mutation T T C TCGA-B0-5690-01A-11D-1534-10 ENST00000055077 p.N204S GTF2IRD2B chr7 75123136 75123136 Missense_Mutation G G T TCGA-B0-5690-01A-11D-1534-10 ENST00000472837 p.G120V LAMB1 chr7 107932321 107932321 Missense_Mutation G G T TCGA-B0-5690-01A-11D-1534-10 ENST00000222399 p.N1415K CHRM2 chr7 137015156 137015156 Missense_Mutation C C G TCGA-B0-5690-01A-11D-1534-10 ENST00000320658 p.D97E XPO7 chr8 21966949 21966949 Missense_Mutation T T A TCGA-B0-5690-01A-11D-1534-10 ENST00000252512 p.F37L ZC3H3 chr8 143536430 143536430 Missense_Mutation C C A TCGA-B0-5690-01A-11D-1534-10 ENST00000262577 p.G463V PRRC2B chr9 131467653 131467653 Missense_Mutation G G A TCGA-B0-5690-01A-11D-1534-10 ENST00000357304 p.S604N GFI1B chr9 132988202 132988202 Missense_Mutation C C T TCGA-B0-5690-01A-11D-1534-10 ENST00000339463 p.P82S KIF11 chr10 92613115 92613115 Silent C C T TCGA-B0-5690-01A-11D-1534-10 ENST00000260731 p.I258I EIF3A chr10 119037165 119037165 Silent G G A TCGA-B0-5690-01A-11D-1534-10 ENST00000369144 p.D1291D MRVI1 chr11 10604435 10604435 Silent T T C TCGA-B0-5690-01A-11D-1534-10 ENST00000423302 p.K571K SAA2 chr11 18245360 18245360 3'UTR C C T TCGA-B0-5690-01A-11D-1534-10 ENST00000256733 PPP2R1B chr11 111766266 111766266 Silent G G T TCGA-B0-5690-01A-11D-1534-10 ENST00000527614 p.L32L DCTN2 chr12 57533964 57533964 Missense_Mutation G G T TCGA-B0-5690-01A-11D-1534-10 ENST00000548249 p.Q220K ARHGEF25 chr12 57615254 57615254 Missense_Mutation G G A TCGA-B0-5690-01A-11D-1534-10 ENST00000286494 p.M326I NIN chr14 50772301 50772301 Splice_Region C C T TCGA-B0-5690-01A-11D-1534-10 ENST00000382041 p.K327K FERMT2 chr14 52859564 52859564 Intron T T C TCGA-B0-5690-01A-11D-1534-10 ENST00000341590 PTPN21 chr14 88485153 88485153 Missense_Mutation G G T TCGA-B0-5690-01A-11D-1534-10 ENST00000328736 p.P334H TICRR chr15 89619768 89619768 Missense_Mutation C C T TCGA-B0-5690-01A-11D-1534-10 ENST00000268138 p.A1027V BRD7 chr16 50323660 50323660 Missense_Mutation T T C TCGA-B0-5690-01A-11D-1534-10 ENST00000394688 p.Y457C P2RX1 chr17 3903630 3903630 Missense_Mutation G G T TCGA-B0-5690-01A-11D-1534-10 ENST00000225538 p.P176T PRPSAP2 chr17 18889836 18889836 Missense_Mutation G G T TCGA-B0-5690-01A-11D-1534-10 ENST00000268835 p.R181S EPN2 chr17 19312071 19312071 Missense_Mutation G G A TCGA-B0-5690-01A-11D-1534-10 ENST00000314728 p.G300D RAB34 chr17 28715480 28715480 Missense_Mutation T T G TCGA-B0-5690-01A-11D-1534-10 ENST00000301043 p.D136A ABCA10 chr17 69149079 69149079 Missense_Mutation G G T TCGA-B0-5690-01A-11D-1534-10 ENST00000269081 p.T1496N NUP85 chr17 75234741 75234741 Missense_Mutation T T C TCGA-B0-5690-01A-11D-1534-10 ENST00000245544 p.W574R ROCK1 chr18 21044134 21044134 Missense_Mutation C C T TCGA-B0-5690-01A-11D-1534-10 ENST00000399799 p.A215T PLIN4 chr19 4512348 4512348 Missense_Mutation C C T TCGA-B0-5690-01A-11D-1534-10 ENST00000301286 p.G524R KCNN1 chr19 17981940 17981940 Missense_Mutation G G A TCGA-B0-5690-01A-11D-1534-10 ENST00000222249 p.V244M PLEKHG2 chr19 39417977 39417977 Missense_Mutation G G A TCGA-B0-5690-01A-11D-1534-10 ENST00000425673 p.A319T LILRA2 chr19 54574444 54574444 Missense_Mutation C C T TCGA-B0-5690-01A-11D-1534-10 ENST00000251377 p.R72W MAFB chr20 40688562 40688562 Missense_Mutation G G A TCGA-B0-5690-01A-11D-1534-10 ENST00000373313 p.P97S PPARA chr22 46219861 46219861 Silent A A T TCGA-B0-5690-01A-11D-1534-10 ENST00000262735 p.A186A ARSF chrX 3110231 3110231 Missense_Mutation C C T TCGA-B0-5690-01A-11D-1534-10 ENST00000359361 p.R457W CDX4 chrX 73447372 73447372 Missense_Mutation C C T TCGA-B0-5690-01A-11D-1534-10 ENST00000373514 p.P40L GNB1 chr1 1825424 1825424 Missense_Mutation C C A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000378609 p.E10D SPATA21 chr1 16421944 16421944 Missense_Mutation G G A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000335496 p.P21L ARID1A chr1 26766324 26766324 Frame_Shift_Del C C - TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000324856 p.P947Hfs*21 THRAP3 chr1 36304113 36304113 3'UTR A A T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000354618 CYP4A22 chr1 47140830 47140830 Frame_Shift_Del C C - TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000371891 p.P83Qfs*23 FGGY chr1 59626210 59626210 Intron A A G TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000303721 EFCAB7 chr1 63534210 63534210 Missense_Mutation A A C TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000371088 p.L266F GLMN chr1 92268002 92268002 Nonsense_Mutation C C A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000370360 p.E337* ADAM30 chr1 119894294 119894294 Silent C C T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000369400 p.A681A NOS1AP chr1 162367122 162367122 Silent G G T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000361897 p.T392T TOR1AIP2 chr1 179851088 179851088 Missense_Mutation G G T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000367612 p.P104T ASPM chr1 197101820 197101820 Silent T T C TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000367409 p.L2477L CENPF chr1 214642354 214642354 Missense_Mutation T T G TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000366955 p.V1339G PCNXL2 chr1 233236850 233236850 Missense_Mutation G G A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000258229 p.P785S HEATR1 chr1 236596929 236596929 Silent C C T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000366582 p.L217L WDR35 chr2 19913645 19913645 Missense_Mutation C C A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000345530 p.W1153C PREPL chr2 44322836 44322836 Missense_Mutation T T C TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000260648 p.I639V INPP4A chr2 98546075 98546075 Splice_Site T T A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000074304 p.X352_splice ZRANB3 chr2 135207449 135207449 Silent C C T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000264159 p.K998K TTN chr2 178563794 178563794 Silent A A G TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000591111 p.A25805A PLCL1 chr2 198088984 198088984 Frame_Shift_Del A A - TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000428675 p.D949Tfs*20 BMPR2 chr2 202377389 202377389 5'UTR A A T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000374580 SCLY chr2 238091284 238091284 Intron T T G TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000254663 C2orf54 chr2 240891707 240891707 Missense_Mutation A A G TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000388934 p.S191P PBRM1 chr3 52617360 52617360 Missense_Mutation T T A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000296302 p.N574Y AMOTL2 chr3 134371333 134371333 Missense_Mutation A A G TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000422605 p.I34T MUC4 chr3 195778910 195778910 Missense_Mutation G G A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000463781 p.P4224S GABRG1 chr4 46123952 46123952 5'UTR C C T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000295452 ALB chr4 73412004 73412004 Missense_Mutation C C G TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000295897 p.A241G G3BP2 chr4 75645461 75645462 Frame_Shift_Ins - - T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000359707 p.M473Nfs*51 SLC9A3 chr5 483404 483404 Silent G G A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000264938 p.Y337Y CCDC125 chr5 69285462 69285462 Missense_Mutation G G A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000396496 p.P369S RP11-848G14.5 chr5 69634335 69634335 RNA G G A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000515156 POC5 chr5 75702628 75702629 Frame_Shift_Ins - - A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000428202 p.D164* PCDHA6 chr5 140828935 140828935 Missense_Mutation A A C TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000529310 p.N282H PCDHB13 chr5 141214558 141214558 Missense_Mutation G G C TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000341948 p.E145D PCDHB15 chr5 141247048 141247048 Silent G G T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000231173 p.L490L PCDHB15 chr5 141247049 141247049 Silent C C T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000231173 p.L491L GCNT2 chr6 10585943 10585963 Intron CTCATTCCCTGAAAAGAAGAG CTCATTCCCTGAAAAGAAGAG - TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000379597 LY6G5C chr6 31677053 31677054 Frame_Shift_Ins - - T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000383237 p.R120Pfs*22 SLC16A10 chr6 111206623 111206623 Frame_Shift_Del A A - TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000368851 p.N327Ifs*30 FAM184A chr6 119020135 119020135 Missense_Mutation G G T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000338891 p.T392N CCDC129 chr7 31643432 31643432 Silent C C T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000407970 p.L688L BAZ1B chr7 73449639 73449639 Missense_Mutation G G T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000339594 p.L1211M LRWD1 chr7 102472490 102472490 Missense_Mutation G G T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000292616 p.W524L WASL chr7 123692474 123692474 Missense_Mutation G G A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000223023 p.A407V ZNF800 chr7 127373702 127373702 Missense_Mutation G G A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000265827 p.S545L GIMAP7 chr7 150520215 150520215 Missense_Mutation A A T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000313543 p.I81F GIMAP7 chr7 150520217 150520221 Frame_Shift_Del CAGCC CAGCC - TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000313543 p.I81Mfs*62 FABP5P3 chr7 152446203 152446203 3'Flank C C G TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000477993 BMP1 chr8 22201894 22201894 Missense_Mutation C C A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000306385 p.F733L PPAPDC1B chr8 38267088 38267088 Intron T T C TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000424479 LETM2 chr8 38404691 38404691 Intron A A - TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000379957 ADCY8 chr8 130780760 130780760 Missense_Mutation C C T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000286355 p.R1129Q EPPK1 chr8 143867540 143867540 Missense_Mutation G G A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000615648 p.P1905L PLEC chr8 143953806 143953806 5'Flank C C A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000322810 CNTNAP3 chr9 39178218 39178218 Frame_Shift_Del T T - TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000297668 p.Q227Hfs*10 GLIDR chr9 39809842 39809842 RNA C C G TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000625350 FAM122A chr9 68783330 68783330 3'UTR T T C TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000394264 GCNT1 chr9 76504914 76504914 3'UTR T T - TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000376730 NAA35 chr9 85975142 85975142 Missense_Mutation G G A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000361671 p.M204I NAA35 chr9 85975143 85975143 Nonsense_Mutation C C T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000361671 p.Q205* ZNF782 chr9 96844930 96844930 Silent T T C TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000481138 p.R34R ZNF618 chr9 114047920 114047929 Frame_Shift_Del ACCAGTCCCG ACCAGTCCCG - TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000374126 p.Q426Rfs*6 PRF1 chr10 70600739 70600739 Missense_Mutation C C T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000373209 p.R55H C10orf54 chr10 71760861 71760861 Splice_Region C C G TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000394957 LGI1 chr10 93793277 93793277 Silent T T G TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000371418 p.P255P C10orf12 chr10 96985673 96985673 3'UTR T T A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000286067 MRPL17 chr11 6682384 6682384 Missense_Mutation T T C TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000288937 p.K88E CYB5R2 chr11 7669301 7669301 Nonsense_Mutation C C A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000299498 p.E98* TRIM44 chr11 35806495 35806495 3'UTR C C T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000299413 OR8J3 chr11 56136842 56136842 Missense_Mutation T T C TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000301529 p.R293G OR4D6 chr11 59457546 59457546 Missense_Mutation G G A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000300127 p.E196K KMT2D chr12 49049833 49049833 Missense_Mutation C C A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000301067 p.R1252L KRT4 chr12 52809426 52809426 Missense_Mutation C C A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000551956 p.S264I ESYT1 chr12 56138032 56138032 Missense_Mutation A A T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000394048 p.K735N SLC5A8 chr12 101209816 101209816 Silent C C G TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000536262 p.V11V STAB2 chr12 103706924 103706924 Missense_Mutation G G C TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000388887 p.G1377R NOS1 chr12 117330966 117330966 Missense_Mutation C C A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000317775 p.R35L SPG20 chr13 36331499 36331499 Missense_Mutation G G A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000355182 p.A303V MRPS31 chr13 40771057 40771057 Missense_Mutation G G A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000323563 p.S27L PCDH17 chr13 57666782 57666782 Missense_Mutation G G A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000377918 p.E916K FITM1 chr14 24132324 24132324 Missense_Mutation G G C TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000267426 p.R127P COCH chr14 30874971 30874971 Splice_Region C C T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000216361 p.L11L TMX1 chr14 51254525 51254525 3'UTR T T - TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000457354 MAP3K9 chr14 70732875 70732875 Silent G G A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000554752 p.L832L BTBD7 chr14 93296092 93296092 5'UTR G G T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000334746 HSP90AA1 chr14 102083579 102083579 Missense_Mutation T T C TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000216281 p.K485E LPCAT4 chr15 34364092 34364092 Intron G G A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000314891 STRC chr15 43608082 43608082 Splice_Region G G A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000450892 p.L1227L DMXL2 chr15 51547313 51547313 Silent A A T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000251076 p.S221S CA12 chr15 63381668 63381668 Frame_Shift_Del T T - TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000178638 p.K18Rfs*10 HCN4 chr15 73324165 73324165 Missense_Mutation G G T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000261917 p.F689L SRRM2 chr16 2767114 2767114 Missense_Mutation C C T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000301740 p.P2196S ACSM3 chr16 20792251 20792251 Silent A A C TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000289416 p.P490P OTOA chr16 21716917 21716917 Missense_Mutation C C T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000286149 p.A514V HYDIN chr16 70920750 70920750 Silent C C T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000393567 p.L2542L PHLPP2 chr16 71649895 71649895 Missense_Mutation T T G TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000568954 p.E989D TAF1C chr16 84181113 84181114 Frame_Shift_Ins - - G TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000567759 p.L439Pfs*114 SLC7A5 chr16 87839716 87839716 Nonsense_Mutation C C A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000261622 p.E309* PIEZO1 chr16 88720173 88720173 Silent G G T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000301015 p.A2020A PHF23 chr17 7236327 7236327 Silent C C G TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000320316 p.R200R DNAH9 chr17 11742289 11742289 Missense_Mutation G G T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000262442 p.L2029F KAT2A chr17 42117070 42117070 Missense_Mutation C C A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000225916 p.V577F TEX14 chr17 58599175 58599175 Nonsense_Mutation C C A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000240361 p.E730* GGA3 chr17 75238672 75238672 Missense_Mutation A A T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000537686 p.L681M VAPA chr18 9954202 9954202 Missense_Mutation C C G TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000400000 p.F247L CEP76 chr18 12674653 12674653 Missense_Mutation C C T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000262127 p.G575D MIB1 chr18 21825608 21825608 Intron A A T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000261537 WDR7 chr18 56776833 56776833 Frame_Shift_Del A A - TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000254442 p.D967Afs*13 MRI1 chr19 13768607 13768607 Missense_Mutation C C A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000040663 p.F198L GRAMD1A chr19 35014198 35014198 Missense_Mutation G G A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000317991 p.D294N CEACAM3 chr19 41811172 41811172 Missense_Mutation G G A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000357396 p.E232K XRCC1 chr19 43553459 43553459 Silent G G A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000262887 p.S181S CEACAM20 chr19 44529467 44529467 Silent G G A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000614924 p.L15L SPHK2 chr19 48628225 48628225 Missense_Mutation C C T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000245222 p.L274F ZNF761 chr19 53455223 53455223 Missense_Mutation C C T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000432094 p.A239V SMTN chr22 31083263 31083263 Missense_Mutation C C T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000347557 p.A2V PISD chr22 31620699 31620700 Frame_Shift_Ins - - A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000439502 p.V287Cfs*16 PISD chr22 31620700 31620700 Silent T T C TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000439502 p.S286S GRAMD4 chr22 46677308 46677308 3'UTR T T C TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000361034 ZXDB chrX 57593248 57593248 Nonsense_Mutation C C A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000374888 p.C400* PJA1 chrX 69162758 69162758 Missense_Mutation A A C TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000361478 p.L161V KIF4A chrX 70343887 70343887 Missense_Mutation G G A TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000374403 p.D446N POU3F4 chrX 83509726 83509726 3'UTR A A T TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000373200 PNCK chrX 153671269 153671269 Intron C C G TCGA-GK-A6C7-01A-11D-A33K-10 ENST00000340888 MIB2 chr1 1616528 1616528 Silent T T C TCGA-A3-A6NI-01A-11D-A33K-10 ENST00000505820 p.A65A SYF2 chr1 25228227 25228227 Silent C C T TCGA-A3-A6NI-01A-11D-A33K-10 ENST00000236273 p.A89A AGO4 chr1 35834168 35834168 Missense_Mutation G G T TCGA-A3-A6NI-01A-11D-A33K-10 ENST00000373210 p.V520L COL11A1 chr1 103074671 103074671 Missense_Mutation T T C TCGA-A3-A6NI-01A-11D-A33K-10 ENST00000370096 p.T200A KCNJ9 chr1 160084288 160084288 Silent C C T TCGA-A3-A6NI-01A-11D-A33K-10 ENST00000368088 p.R86R ADCY10 chr1 167901757 167901758 Frame_Shift_Del TT TT - TCGA-A3-A6NI-01A-11D-A33K-10 ENST00000367851 p.N114Hfs*7 LAMB3 chr1 209629779 209629779 Missense_Mutation G G A TCGA-A3-A6NI-01A-11D-A33K-10 ENST00000356082 p.R364W OBSCN chr1 228272147 228272147 Intron C C T TCGA-A3-A6NI-01A-11D-A33K-10 ENST00000422127 GALNT2 chr1 230262558 230262558 Intron T T G TCGA-A3-A6NI-01A-11D-A33K-10 ENST00000366672 COX20 chr1 244845057 244845059 3'UTR ATT ATT - TCGA-A3-A6NI-01A-11D-A33K-10 ENST00000411948 NOL10 chr2 10689909 10689909 5'UTR G G T TCGA-A3-A6NI-01A-11D-A33K-10 ENST00000381685 NOL10 chr2 10689910 10689910 5'UTR C C G TCGA-A3-A6NI-01A-11D-A33K-10 ENST00000381685 SULT1C4 chr2 108378356 108378356 Missense_Mutation G G A TCGA-A3-A6NI-01A-11D-A33K-10 ENST00000272452 p.E7K AC073869.20 chr2 131443472 131443472 RNA G G A TCGA-A3-A6NI-01A-11D-A33K-10 ENST00000407594 TTN chr2 178784179 178784179 Frame_Shift_Del G G - TCGA-A3-A6NI-01A-11D-A33K-10 ENST00000591111 p.T889Ifs*10 DNAJC10 chr2 182729885 182729885 Missense_Mutation G G C TCGA-A3-A6NI-01A-11D-A33K-10 ENST00000264065 p.S224T VHL chr3 10146512 10146512 Splice_Site A A C TCGA-A3-A6NI-01A-11D-A33K-10 ENST00000256474 p.X114_splice FAM208A chr3 56662453 56662453 Missense_Mutation T T A TCGA-A3-A6NI-01A-11D-A33K-10 ENST00000493960 p.L364F DZIP3 chr3 108688094 108688094 Nonsense_Mutation C C T TCGA-A3-A6NI-01A-11D-A33K-10 ENST00000361582 p.Q1090* RETNLB chr3 108755862 108755862 Silent C C T TCGA-A3-A6NI-01A-11D-A33K-10 ENST00000295755 p.S84S SERPINI2 chr3 167449374 167449374 Silent C C A TCGA-A3-A6NI-01A-11D-A33K-10 ENST00000264677 p.V331V ATP13A3 chr3 194431877 194431878 Frame_Shift_Ins - - TCAA TCGA-A3-A6NI-01A-11D-A33K-10 ENST00000256031 p.T754Ifs*18 DGKQ chr4 962610 962610 Missense_Mutation T T C TCGA-A3-A6NI-01A-11D-A33K-10 ENST00000273814 p.N680S SLC30A9 chr4 42066582 42066582 Missense_Mutation A A G TCGA-A3-A6NI-01A-11D-A33K-10 ENST00000264451 p.R369G DDX60L chr4 168461953 168461953 Frame_Shift_Del C C - TCGA-A3-A6NI-01A-11D-A33K-10 ENST00000260184 p.D118Mfs*26 BASP1 chr5 17276728 17276729 3'UTR - - A TCGA-A3-A6NI-01A-11D-A33K-10 ENST00000322611 BRD8 chr5 138152667 138152667 Frame