Hugo_Symbol Chromosome Start_Position End_Position Variant_Classification Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 Tumor_Sample_Barcode transcript_name amino_acid_change PANK4 chr1 2512909 2512909 Missense_Mutation C C G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000378466 p.W569S AJAP1 chr1 4772433 4772433 Silent T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000378190 p.S357S CHD5 chr1 6136744 6136744 Missense_Mutation T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000262450 p.K853R C1orf158 chr1 12746435 12746435 Missense_Mutation T T G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000614859 p.F2C GPATCH3 chr1 26900361 26900361 Missense_Mutation G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000361720 p.H28Y GPATCH3 chr1 26900363 26900365 In_Frame_Del GCC GCC - TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000361720 p.A27del AZIN2 chr1 33094674 33094674 Silent C C G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000294517 p.G238G ZSCAN20 chr1 33493592 33493592 Missense_Mutation T T G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000361328 p.L617W PIK3R3 chr1 46132863 46132863 5'Flank A A G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000262741 NULL TMED5 chr1 93152247 93152247 3'UTR G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000370282 NULL SPAG17 chr1 118040774 118040774 Missense_Mutation G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000336338 p.S1041F HSD3B2 chr1 119422631 119422631 3'UTR A A T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000369416 NULL HRNR chr1 152214724 152214724 Missense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000368801 p.R2302H HRNR chr1 152220167 152220167 Missense_Mutation A A C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000368801 p.S488A VANGL2 chr1 160428467 160428467 3'UTR T T G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000368061 NULL ASTN1 chr1 177023497 177023497 Missense_Mutation A A C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000361833 p.F449V PRG4 chr1 186308355 186308355 Missense_Mutation A A G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000445192 p.E879G CFHR4 chr1 196918361 196918361 Missense_Mutation A A C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000367416 p.Q563H SYT2 chr1 202605600 202605600 Missense_Mutation A A G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000367267 p.I58T SERTAD4 chr1 210242087 210242087 Missense_Mutation G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000367012 p.G274D KCNH1 chr1 210920002 210920002 Missense_Mutation T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000271751 p.K367R KCNK2 chr1 215086416 215086416 Missense_Mutation A A C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000444842 p.K32T CHRM3 chr1 239907595 239907595 Missense_Mutation T T A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000255380 p.N48K ZNF670 chr1 247037519 247037519 Missense_Mutation C C G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000366503 p.C367S OR11L1 chr1 247841469 247841469 Missense_Mutation C C A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000355784 p.R143M APOB chr2 21006645 21006645 Missense_Mutation C C A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000233242 p.G3408V BIRC6 chr2 32618674 32618674 3'UTR T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000421745 NULL HNRNPLL chr2 38569225 38569225 Missense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000449105 p.G442S DCTN1 chr2 74371602 74371602 Missense_Mutation G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000361874 p.P194A WDR54 chr2 74422269 74422269 Missense_Mutation G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000348227 p.G39E IGKV3D-11 chr2 90173124 90173124 Silent C C A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000390277 p.T19T SEMA4C chr2 96865891 96865891 Silent A A G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000305476 p.C99C AFF3 chr2 100105551 100105551 5'Flank G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000409236 NULL ANKRD30BL chr2 132161836 132161836 5'UTR A A G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000409867 NULL THSD7B chr2 137115151 137115151 Silent A A G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000272643 p.K409K TTN chr2 178593989 178593989 Silent C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000591111 p.R17827R TTN chr2 178681107 178681107 Missense_Mutation T T G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000591111 p.K10787N ITGA4 chr2 181485902 181485902 Missense_Mutation G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000397033 p.E355K PDE1A chr2 182186523 182186523 Missense_Mutation T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000410103 p.I441V CALCRL chr2 187345412 187345412 3'UTR T T G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000392370 NULL METTL21A chr2 207624298 207624298 Silent A A G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000406927 p.F26F SCG2 chr2 223598088 223598088 Missense_Mutation A A C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000305409 p.L399V IRS1 chr2 226796697 226796697 Missense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000305123 p.S681N COPS7B chr2 231807970 231807970 3'UTR C C A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000350033 NULL ATP2B2 chr3 10328780 10328780 3'UTR A A C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000352432 NULL TAMM41 chr3 11846708 11846708 5'UTR A A G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000444133 NULL FBLN2 chr3 13570443 13570443 Missense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000295760 p.R30W TCAIM chr3 44367456 44367456 Missense_Mutation G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000342649 p.G107A ARIH2 chr3 48927719 48927719 Missense_Mutation T T A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000356401 p.F54Y DNAH1 chr3 52382376 52382376 Missense_Mutation G G T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000420323 p.W2621L FAM208A chr3 56627646 56627646 Missense_Mutation T T G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000493960 p.L1322F GOLGB1 chr3 121695018 121695018 Missense_Mutation G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000340645 p.S1830R ROPN1 chr3 123980563 123980563 5'UTR G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000184183 NULL SNORA7B chr3 129393037 129393037 3'Flank A A T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000384360 NULL COMMD2 chr3 149741561 149741561 Missense_Mutation T T G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000473414 p.K187T PLCH1 chr3 155482494 155482494 Missense_Mutation A A C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000340059 p.L1186V IL12A-AS1 chr3 160102604 160102604 Intron C C A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000497452 NULL NLGN1 chr3 174278960 174278960 Missense_Mutation T T G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000457714 p.V320G VWA5B2 chr3 184234552 184234552 Intron T T A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000426955 NULL STIM2 chr4 27008939 27008939 Missense_Mutation C C G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000467087 p.P476A RFC1 chr4 39327591 39327591 Missense_Mutation A A G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000381897 p.L166P DCAF4L1 chr4 41985217 41985217 3'UTR A A - TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000333141 NULL CORIN chr4 47595648 47595648 3'UTR A A G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000273857 NULL EPHA5 chr4 65365081 65365081 Missense_Mutation T T G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000273854 p.E724D CSN1S1 chr4 69932581 69932581 Missense_Mutation T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000246891 p.L9P RUFY3 chr4 70784825 70784825 Silent G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000226328 p.G339G RUFY3 chr4 70784826 70784826 Nonsense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000226328 p.Q340* USP53 chr4 119271360 119271360 Silent A A G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000274030 p.K500K TBC1D9 chr4 140679702 140679702 Missense_Mutation A A T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000442267 p.Y168N FBXW7 chr4 152323086 152323086 Frame_Shift_Del C C - TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000281708 p.S640Tfs*7 FAT1 chr4 186707070 186707070 Missense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000441802 p.V920I ADAMTS16 chr5 5303341 5303341 Missense_Mutation A A G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000274181 p.T955A ANKH chr5 14709806 14709806 3'UTR C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000284268 NULL PTGER4 chr5 40681079 40681079 Missense_Mutation T T G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000302472 p.I29S PTGER4 chr5 40681080 40681080 Silent C C A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000302472 p.I29I C7 chr5 40934420 40934420 Silent A A C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000313164 p.G78G MROH2B chr5 41052568 41052568 Missense_Mutation A A G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000399564 p.L376P RASGRF2 chr5 81070555 81070555 Missense_Mutation G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000265080 p.D203H ADGRV1 chr5 90810576 90810576 Missense_Mutation G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000405460 p.D5106N EPB41L4A chr5 112164845 112164845 3'UTR A A G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000261486 NULL PDLIM4 chr5 132271708 132271708 Intron G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000253754 NULL PCDHAC1 chr5 140928397 140928397 Nonsense_Mutation C C A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000253807 p.S502* PCDHB3 chr5 141101226 141101226 Missense_Mutation G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000231130 p.E193K PCDHB6 chr5 141156373 141156373 3'Flank T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000231136 NULL PCDHGA11 chr5 141422898 141422898 Silent C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000398587 p.N557N FCHSD1 chr5 141644914 141644914 Missense_Mutation G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000435817 p.T490M ARAP3 chr5 141661956 141661964 Intron GGGGCGGAG GGGGCGGAG - TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000239440 NULL PCDH1 chr5 141863423 141863423 Missense_Mutation G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000394536 p.R970G SLU7 chr5 160407506 160407506 Silent T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000297151 p.K365K DRD1 chr5 175442477 175442477 Missense_Mutation G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000393752 p.A208V RUFY1 chr5 179560182 179560182 Silent C C G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000319449 p.L156L ZKSCAN4 chr6 28247006 28247006 Silent A A G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000377294 p.D247D MLN chr6 33799193 33799193 Missense_Mutation T T G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000430124 p.K49T DNAH8 chr6 38737840 38737840 Missense_Mutation G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000359357 p.K111N MEA1 chr6 43012924 43012924 Splice_Site A A T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000244711 p.X136_splice OPN5 chr6 47808176 47808176 Missense_Mutation G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000371211 p.G260A PTCHD4 chr6 47901688 47901688 Intron T T A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000339488 NULL DST chr6 56572225 56572225 Silent T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000312431 p.E2275E EYS chr6 64590630 64590630 Missense_Mutation A A G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000370616 p.F1746S ZNF292 chr6 87257507 87257507 Missense_Mutation A A G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000369577 p.N1293S CNR1 chr6 88142907 88142907 3'UTR T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000369499 NULL MMS22L chr6 97231558 97231558 Missense_Mutation C C G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000275053 p.C466S FYN chr6 111694645 111694645 Missense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000354650 p.V368M DCBLD1 chr6 117519916 117519916 Frame_Shift_Del T T - TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000338728 p.L144Cfs*2 TRDN chr6 123464822 123464822 Intron T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000334268 NULL TAAR2 chr6 132617817 132617846 In_Frame_Del GATGTTATGCTAAGCATCAGGTCAAAACTA GATGTTATGCTAAGCATCAGGTCAAAACTA - TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000367931 p.S121_S130del TNFAIP3 chr6 137871479 137871479 Missense_Mutation C C G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000237289 p.N84K NHSL1 chr6 138473325 138473325 Missense_Mutation T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000427025 p.D155G GRM1 chr6 146399516 146399516 Missense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000282753 p.A826V PPP1R14C chr6 150248772 150248772 Silent G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000361131 p.R150R ARID1B chr6 157200839 157200839 Missense_Mutation C C A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000350026 p.D1402E MLLT4 chr6 167875461 167875461 Missense_Mutation G G T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000447894 p.Q235H MLLT4 chr6 167976659 167976659 3'Flank A A - TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000392112 NULL ZNF853 chr7 6622767 6622767 Silent G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000457543 p.S592S DDX56 chr7 44571556 44571556 Missense_Mutation G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000258772 p.L276V ADCY1 chr7 45722853 45722853 3'UTR C C A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000297323 NULL CDC14C chr7 48925745 48925745 RNA C C A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000428251 NULL MLXIPL chr7 73597705 73597705 Missense_Mutation G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000313375 p.N360K PCLO chr7 82838233 82838233 Missense_Mutation A A C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000333891 p.L4736R PCLO chr7 82952549 82952549 Missense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000333891 p.A2802T KIAA1324L chr7 86880108 86880108 3'UTR C C G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000450689 NULL MUC3A chr7 100963202 100963202 Missense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000379458 p.S3035L KCP chr7 128894226 128894226 Missense_Mutation G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000620378 p.P243L AHCYL2 chr7 129422887 129422887 Silent A A G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000325006 p.Q503Q OR2A2 chr7 144110081 144110081 Missense_Mutation T T G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000408979 p.F167V SSPO chr7 149814497 149814497 Silent G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000378016 p.S3416S ATG9B chr7 151017121 151017121 Missense_Mutation A A C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000469530 p.V735G MSRA chr8 10301578 10301578 Missense_Mutation G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000317173 p.E126K USP17L2 chr8 12137263 12137263 Missense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000333796 p.V500M KIAA1456 chr8 13021459 13021459 Silent T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000524591 p.T260T NAT2 chr8 18400606 18400606 Silent T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000286479 p.D201D PNMA2 chr8 26514378 26514378 5'Flank C C G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000522362 NULL PLAG1 chr8 56162099 56162099 3'UTR T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000316981 NULL SULF1 chr8 69658557 69658557 3'UTR C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000260128 NULL MMP16 chr8 88327184 88327184 Missense_Mutation G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000286614 p.T8S DECR1 chr8 90044902 90044902 Silent C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000220764 p.G264G CSMD3 chr8 112408942 112408942 Missense_Mutation G G T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000297405 p.S1829Y CSMD3 chr8 113314613 113314613 Missense_Mutation G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000297405 p.S120L ZNF572 chr8 124979285 124979285 3'UTR T T - TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000319286 NULL POU5F1B chr8 127416201 127416201 Missense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000465342 p.P112L ADCY8 chr8 130847502 130847502 Missense_Mutation A A C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000286355 p.D808E TG chr8 132923353 132923353 Missense_Mutation A A T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000220616 p.Q1515L KIFC2 chr8 144467298 144467298 Missense_Mutation G G T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000301332 p.Q142H TTC39B chr9 15175079 15175079 Missense_Mutation G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000512701 p.A633V PGM5 chr9 68357296 68357296 Missense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000396396 p.R57C ERCC6L2 chr9 95954819 95954819 Intron C C G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000288985 NULL C9orf84 chr9 111738164 111738164 Intron C C G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000318737 NULL BSPRY chr9 113354278 113354278 Missense_Mutation G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000374183 p.Q80H TNC chr9 115023992 115023992 Missense_Mutation C C A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000350763 p.G2159V CRB2 chr9 123371341 123371341 Missense_Mutation C C A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000373631 p.F733L MAPKAP1 chr9 125585580 125585580 Missense_Mutation T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000265960 p.S216G GARNL3 chr9 127344340 127344340 Splice_Site G G T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000373387 p.X452_splice SET chr9 128693663 128693663 Missense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000372692 p.T186M RALGDS chr9 133100232 133100232 Intron C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000372050 NULL SEC16A chr9 136455677 136455677 Silent C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000313050 p.G1927G SEC16A chr9 136459865 136459865 Missense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000313050 p.D1695N MAN1B1 chr9 137105853 137105853 Intron T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000371589 NULL ITIH5 chr10 7576788 7576788 Missense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000397146 p.R548Q KIAA1217 chr10 24545771 24545771 Intron G G T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000376454 NULL ITGB1 chr10 32901377 32901377 3'UTR C C A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000302278 NULL WDFY4 chr10 48820290 48820290 Silent C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000325239 p.G1854G C10orf107 chr10 61681154 61681154 5'UTR T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000330194 NULL SMNDC1 chr10 110297683 110297683 Silent G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000369592 p.T103T MUC5B chr11 1226277 1226277 Splice_Site G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000529681 p.X67_splice KCNQ1DN chr11 2870814 2870814 RNA C C G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000441418 NULL OR52J3 chr11 5047354 5047354 Missense_Mutation G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000380370 p.V277I UBQLNL chr11 5516371 5516371 Missense_Mutation T T A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000380184 p.K24I TAF10 chr11 6611744 6611744 Frame_Shift_Del C C - TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000299424 p.A103Pfs*5 OVCH2 chr11 7696538 7696538 Missense_Mutation A A C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000533663 p.S356R ABCC8 chr11 17463543 17463553 Frame_Shift_Del CAAGAACTTGA CAAGAACTTGA - TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000389817 p.V155Gfs*113 IGSF22 chr11 18714017 18714017 Missense_Mutation C C A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000319338 p.D644Y KIF18A chr11 28036320 28036320 Missense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000263181 p.D765N WT1 chr11 32388660 32388660 3'UTR C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000332351 NULL QSER1 chr11 32976990 32976990 3'UTR A A G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000399302 NULL PAMR1 chr11 35468034 35468034 Missense_Mutation A A C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000619888 p.L263V OSBP chr11 59581528 59581528 Missense_Mutation T T G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000263847 p.T569P STX3 chr11 59755618 59755618 Silent C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000337979 p.L5L TMEM109 chr11 60920957 60920957 Silent C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000227525 p.A103A NXF1 chr11 62794961 62794961 Silent G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000294172 p.F517F LGALS12 chr11 63506349 63506349 5'UTR G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000394618 NULL VPS51 chr11 65108711 65108711 Missense_Mutation C C G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000279281 p.L414V CD248 chr11 66315101 66315101 Missense_Mutation G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000311330 p.P643S SHANK2 chr11 70603809 70603809 Intron T T A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000423696 NULL P2RY2 chr11 73235874 73235874 3'UTR C C G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000311131 NULL CCDC83 chr11 85882669 85882669 Silent T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000342404 p.L113L KDM4D chr11 94998385 94998385 Missense_Mutation G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000335080 p.R338H CBL chr11 119298490 119298490 Missense_Mutation A A T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000264033 p.N795I AC215219.2 chr12 16040 16040 3'Flank G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000611710 NULL CD27 chr12 6451599 6451599 3'UTR C T T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000266557 NULL PLCZ1 chr12 18719583 18719583 Missense_Mutation A A T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000266505 p.D139E SLCO1A2 chr12 21319378 21319378 Intron C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000307378 NULL LRRK2 chr12 40359350 40359350 Nonsense_Mutation A A T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000298910 p.R2312* SMARCD1 chr12 50094564 50094564 Missense_Mutation G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000394963 p.D421H DIP2B chr12 50748384 50748384 3'UTR G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000301180 NULL TNS2 chr12 53050105 53050105 5'UTR C C A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000314250 NULL AVIL chr12 57807559 57807559 Intron G G T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000257861 NULL CAPS2 chr12 75325266 75325266 Nonsense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000409445 p.W54* UTP20 chr12 101383590 101383590 Silent G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000261637 p.G2659G PLBD2 chr12 113384133 113384133 Missense_Mutation A A C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000280800 p.K329T PITPNM2 chr12 123014005 123014005 Missense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000320201 p.G39D RP5-944M2.3 chr12 126448015 126448015 RNA C C A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000397346 NULL RP5-944M2.3 chr12 126448016 126448016 RNA A A G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000397346 NULL TUBA3C chr13 19177266 19177266 Silent C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000400113 p.T239T TNFRSF19 chr13 23616045 23616045 Missense_Mutation G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000382258 p.G120A EPSTI1 chr13 42895027 42895027 Missense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000398762 p.M310I LMO7 chr13 75849241 75849241 Missense_Mutation G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000465261 p.R1205H GPC6 chr13 94027767 94027767 Missense_Mutation G G T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000377047 p.K250N RAP2A chr13 97464241 97464241 Missense_Mutation A A T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000245304 p.K117N COL4A2 chr13 110512197 110512197 3'UTR C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000360467 NULL CHAMP1 chr13 114325034 114325034 Nonsense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000361283 p.R398* OR6S1 chr14 20641126 20641126 Missense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000320704 p.R189H CHD8 chr14 21385660 21385660 Missense_Mutation G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000399982 p.P2567A RIPK3 chr14 24339012 24339012 Splice_Region G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000216274 NULL FOXG1 chr14 28768663 28768663 Missense_Mutation A A G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000313071 p.S462G SNX6 chr14 34605717 34605717 Missense_Mutation T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000362031 p.I103V WDHD1 chr14 54967363 54967363 Missense_Mutation G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000360586 p.P699S GALNT16 chr14 69352124 69352124 Missense_Mutation G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000337827 p.A545P SMOC1 chr14 70010792 70010792 Silent C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000381280 p.L235L TTLL5 chr14 75707636 75707636 Silent C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000298832 p.D223D PPP2R5C chr14 101912429 101912429 Missense_Mutation G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000334743 p.E428K HERC2P3 chr15 20383257 20383257 Intron T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000426501 NULL FAM189A1 chr15 29136435 29136435 Silent G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000261275 p.P286P GOLGA8A chr15 34380662 34380662 3'UTR A A C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000432566 NULL AQR chr15 34920433 34920433 Missense_Mutation A A C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000156471 p.S374A PAK6 chr15 40266203 40266203 Missense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000260404 p.S189L SPATA5L1 chr15 45421271 45421271 3'UTR G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000305560 NULL TMEM202 chr15 72398748 72398748 Silent C C G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000341689 p.L59L ARID3B chr15 74589945 74589945 Missense_Mutation A A G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000622429 p.T275A CSPG4 chr15 75675929 75675929 Missense_Mutation T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000308508 p.E2197G RP11-24M17.5 chr15 75779434 75779434 RNA C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000566174 NULL PEAK1 chr15 77115146 77115166 In_Frame_Del GTCATCCTCATCCTTTTCAGG GTCATCCTCATCCTTTTCAGG - TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000312493 p.P1411_D1417del SEC11A chr15 84716085 84716085 5'UTR G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000268220 NULL ABHD2 chr15 89200975 89200975 3'UTR G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000352732 NULL NOXO1 chr16 1979800 1979800 Silent T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000397280 p.L235L PKD1 chr16 2114866 2114866 Silent G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000262304 p.H719H ABCA3 chr16 2295650 2295650 Missense_Mutation G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000301732 p.T785M AC092375.1 chr16 21879448 21879448 5'Flank T T A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000617496 NULL C16orf54 chr16 29744378 29744378 Missense_Mutation G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000329410 p.P192A ZNF720 chr16 31754705 31754705 Intron G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000316491 NULL DNAJA2 chr16 46973700 46973700 5'UTR A A C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000317089 NULL FTO chr16 53704051 53704051 5'UTR T T G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000471389 NULL ADGRG1 chr16 57656564 57656564 Missense_Mutation G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000567835 p.E372Q CNOT1 chr16 58543423 58543423 Intron A A C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000317147 NULL DUS2 chr16 68078487 68078487 Missense_Mutation G G T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000358896 p.V405F DUS2 chr16 68079195 68079195 3'UTR A A C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000358896 NULL GAN chr16 81378849 81378849 3'UTR G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000568107 NULL ZDHHC7 chr16 84974751 84974751 3'UTR C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000313732 NULL PITPNM3 chr17 6471346 6471346 Missense_Mutation A A C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000262483 p.L480R TP53 chr17 7675094 7675094 Missense_Mutation A C C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000269305 p.V173G MYH2 chr17 10537747 10537747 Missense_Mutation T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000245503 p.E502G FLOT2 chr17 28882662 28882662 Missense_Mutation C C A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000394908 p.D126Y MYO1D chr17 32775895 32775896 Frame_Shift_Ins - - CATAT TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000318217 p.G178Dfs*11 MYO1D chr17 32775901 32775910 Frame_Shift_Del GGGTCACCCT GGGTCACCCT - TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000318217 p.K173Ifs*11 MYO1D chr17 32775912 32775912 Missense_Mutation G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000318217 p.F172L ARL5C chr17 39161320 39161320 Missense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000269586 p.R96Q BRCA1 chr17 43051097 43051097 Silent G G T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000357654 p.I1766I HOXB2 chr17 48544614 48544614 Nonsense_Mutation C C A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000330070 p.E100* CACNA1G chr17 50568897 50568897 Silent C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000359106 p.V90V CACNA1G chr17 50571957 50571957 Missense_Mutation C C A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000359106 p.F222L COIL chr17 56939003 56939004 3'UTR - - C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000240316 NULL AKAP1 chr17 57105559 57105559 Missense_Mutation A A G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000337714 p.H32R KCNJ16 chr17 70133485 70133485 3'UTR A A - TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000283936 NULL SLC9A3R1 chr17 74768490 74768490 Missense_Mutation C C G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000262613 p.P304R C17orf99 chr17 78164447 78164447 Intron G G T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000340363 NULL ARHGAP28 chr18 6870652 6870652 Missense_Mutation T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000383472 p.Y292H ANKRD30B chr18 14851981 14851981 Missense_Mutation A A G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000358984 p.E1227G ESCO1 chr18 21574051 21574079 Frame_Shift_Del ACTTCTTCATCTCATTCTTTTTCGGGACC ACTTCTTCATCTCATTCTTTTTCGGGACC - TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000269214 p.V256Gfs*8 ADGRE1 chr19 6913778 6913778 Frame_Shift_Del T T - TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000312053 p.W418Gfs*16 CYP4F22 chr19 15540551 15540570 Frame_Shift_Del CGGCGGATGGGCGGAGGTTC CGGCGGATGGGCGGAGGTTC - TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000269703 p.D260Gfs*3 UCA1 chr19 15829288 15829288 RNA A A C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000397381 NULL EPS15L1 chr19 16361970 16361970 Missense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000248070 p.V799I ARRDC2 chr19 18008503 18008503 Missense_Mutation G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000222250 p.A65T HAPLN4 chr19 19258741 19258741 Missense_Mutation G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000291481 p.A200V ZNF738 chr19 21375921 21375921 Missense_Mutation T T A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000311015 p.D92E ZNF100 chr19 21726482 21726490 3'UTR GTTTGAGGT GTTTGAGGT - TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000358296 NULL LRP3 chr19 33205436 33205436 Silent G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000253193 p.A222A PSG2 chr19 43071848 43071848 Silent A A T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000406487 p.S272S ZNF229 chr19 44428870 44428870 Silent G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000614049 p.F637F CABP5 chr19 48043942 48043942 5'UTR C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000293255 NULL CCDC155 chr19 49397672 49397672 Missense_Mutation C C A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000447857 p.P141Q FLT3LG chr19 49480607 49480607 3'UTR A A G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000594009 NULL TSEN34 chr19 54191554 54191554 Missense_Mutation G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000302937 p.G64R USP29 chr19 57131716 57131716 3'UTR A A C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000254181 NULL ZNF837 chr19 58369122 58369122 Missense_Mutation C C G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000427624 p.G71R PAK7 chr20 9580528 9580528 Missense_Mutation A A C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000353224 p.L203V SYNDIG1 chr20 24666349 24666349 3'UTR G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000376862 NULL DNMT3B chr20 32806252 32806252 Missense_Mutation A A T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000328111 p.K782I BPIFB4 chr20 33083575 33083575 Silent C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000375483 p.A126A ZHX3 chr20 41180226 41180226 3'UTR C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000309060 NULL CLDN17 chr21 30166496 30166496 Missense_Mutation A A C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000286808 p.I41S MORC3 chr21 36364210 36364212 In_Frame_Del CTT CTT - TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000400485 p.L525del KCNJ15 chr21 38299550 38299550 Missense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000328656 p.P97S TMPRSS3 chr21 42388954 42388954 Silent T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000291532 p.K99K ADARB1 chr21 45176383 45176396 Frame_Shift_Del TTCCCACCCCCGAG TTCCCACCCCCGAG - TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000360697 p.F228Wfs*18 ADARB1 chr21 45176397 45176397 Silent T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000360697 p.S232S COL6A1 chr21 46001345 46001345 Missense_Mutation G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000361866 p.V639I LSS chr21 46188569 46188569 3'UTR C C A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000356396 NULL ISX chr22 35067117 35067117 Missense_Mutation C C G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000308700 p.C10W ST13 chr22 40827095 40827095 Splice_Site C C G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000216218 p.X327_splice ACO2 chr22 41469174 41469174 Missense_Mutation C C G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000216254 p.R10G GTSE1 chr22 46329227 46329227 Intron C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000454366 NULL C22orf34 chr22 49441029 49441029 RNA G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000414287 NULL MAPK11 chr22 50267003 50267003 Missense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000330651 p.G181S AKAP17A chrX 1593887 1593887 Missense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000313871 p.P142L SH3KBP1 chrX 19695036 19695036 Intron G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000397821 NULL CNKSR2 chrX 21606827 21606827 Missense_Mutation C C T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000379510 p.P698L IL1RAPL1 chrX 29955790 29955790 Silent G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000378993 p.R687R CFAP47 chrX 36298985 36298985 Silent T T G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000378653 p.T2480T RP2 chrX 46854033 46854033 Silent T T A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000218340 p.I220I CFP chrX 47626521 47626521 Splice_Site T T A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000247153 p.X314_splice KIAA2022 chrX 74739217 74739217 3'UTR T T G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000055682 NULL FAM46D chrX 80444238 80444238 3'UTR A A - TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000308293 NULL PCDH11X chrX 91879273 91879273 Splice_Region G G A TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000373094 p.P1011P NAP1L3 chrX 93673463 93673463 5'UTR G G C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000373079 NULL RPL39 chrX 119791603 119791603 5'UTR C C G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000361575 NULL MAGEA10 chrX 152135406 152135406 Missense_Mutation T T C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000244096 p.E72G ATP6AP1 chrX 154431853 154431853 Silent A A G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000369762 p.A104A SPRY3 chrX 155779673 155779673 3'UTR A A C TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000302805 NULL IL9R chrX 155997758 155997758 5'UTR T T G TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000244174 NULL UTY chrY 13470220 13470220 Missense_Mutation A T T TCGA-L5-A8NI-01A-11D-A37C-09 ENST00000331397 p.C76S PRAMEF6 chr1 12938818 12938818 Missense_Mutation T T C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000376189 p.R430G PRAMEF17 chr1 13390654 13390654 Missense_Mutation A A G TCGA-X8-AAAR-01A-11D-A403-09 ENST00000376098 p.R201G FBXO42 chr1 16250475 16250476 3'UTR AT AT - TCGA-X8-AAAR-01A-11D-A403-09 ENST00000375592 NULL RNF186 chr1 19814632 19814632 Missense_Mutation G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000375121 p.A157V YBX1 chr1 42700933 42700933 Missense_Mutation A A T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000321358 p.Q298L HSPB11 chr1 53921686 53921686 Missense_Mutation C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000194214 p.A134T AK4 chr1 65227351 65227351 3'UTR A A G TCGA-X8-AAAR-01A-11D-A403-09 ENST00000327299 NULL SLC44A5 chr1 75234090 75234090 Missense_Mutation G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000370855 p.T250M KCNA2 chr1 110602098 110602098 3'Flank A A G TCGA-X8-AAAR-01A-11D-A403-09 ENST00000316361 NULL SV2A chr1 149913490 149913490 Silent C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000369146 p.A117A ADAR chr1 154601108 154601108 Missense_Mutation C C G TCGA-X8-AAAR-01A-11D-A403-09 ENST00000368474 p.A512P IFI16 chr1 159015955 159015955 Missense_Mutation A A C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000295809 p.T117P SLC26A9 chr1 205921773 205921773 Silent C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000367135 p.P616P ANGEL2 chr1 213005131 213005131 Missense_Mutation T T C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000366962 p.I346V PGBD5 chr1 230337151 230337151 Silent G G T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000525115 p.P275P TARBP1 chr1 234427764 234427764 Splice_Region A A G TCGA-X8-AAAR-01A-11D-A403-09 ENST00000040877 p.I1021I RYR2 chr1 237417116 237417116 Silent A A C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000366574 p.R281R FMN2 chr1 240093408 240093408 Silent G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000319653 p.P433P EHD3 chr2 31244355 31244355 Silent A A G TCGA-X8-AAAR-01A-11D-A403-09 ENST00000322054 p.G103G AAK1 chr2 69458552 69458552 3'UTR C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000606389 NULL LRRTM4 chr2 77519786 77519786 Missense_Mutation G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000409093 p.T28M THSD7B chr2 137657152 137657152 Missense_Mutation A C C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000272643 p.N1458T LY75 chr2 159810529 159810529 Missense_Mutation G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000263636 p.H1566Y SCN7A chr2 166432691 166432691 Missense_Mutation T T C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000409855 p.E740G TTN chr2 178769790 178769790 Missense_Mutation C A A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000591111 p.V2931L PDE1A chr2 182522288 182522288 Missense_Mutation C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000410103 p.R30H PLCL2 chr3 17011473 17011473 Silent G G C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000615277 p.L709L ZNF501 chr3 44736958 44736958 3'UTR T T - TCGA-X8-AAAR-01A-11D-A403-09 ENST00000396048 NULL PBRM1 chr3 52617322 52617322 Missense_Mutation C C A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000296302 p.M586I KLF15 chr3 126343533 126343533 3'UTR C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000296233 NULL KCNMB2 chr3 178842885 178842885 Missense_Mutation T T G TCGA-X8-AAAR-01A-11D-A403-09 ENST00000358316 p.L219R MUC4 chr3 195782111 195782111 Missense_Mutation C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000463781 p.D3157N EVC chr4 5797075 5797075 Missense_Mutation G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000264956 p.R647Q HS3ST1 chr4 11399841 11399841 Silent C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000002596 p.P55P CC2D2A chr4 15479317 15479317 Intron A A G TCGA-X8-AAAR-01A-11D-A403-09 ENST00000424120 NULL PPA2 chr4 105396283 105396283 Missense_Mutation G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000341695 p.L279F SEC24B chr4 109494686 109494686 Missense_Mutation G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000265175 p.A440T NDST4 chr4 114977233 114977233 Silent T T C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000264363 p.A340A FAT4 chr4 125492805 125492805 3'UTR A A T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000394329 NULL ELF2 chr4 139073462 139073462 Missense_Mutation C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000379550 p.R115K GLRB chr4 157152905 157152905 Missense_Mutation A A C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000264428 p.K364N GHR chr5 42629067 42629067 Missense_Mutation T T C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000230882 p.W34R ACTBL2 chr5 57482302 57482302 Missense_Mutation C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000423391 p.A136T ADAMTS19 chr5 129648944 129648944 Missense_Mutation T T G TCGA-X8-AAAR-01A-11D-A403-09 ENST00000274487 p.L711R PCDHA11 chr5 140870941 140870941 Missense_Mutation C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000398640 p.A613V PCDHB6 chr5 141151988 141151988 Silent G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000231136 p.A577A CSNK1A1 chr5 149551030 149551030 5'UTR G G T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000377843 NULL COL23A1 chr5 178270336 178270336 Splice_Site C T T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000390654 p.X156_splice PRICKLE4 chr6 41783868 41783868 5'UTR G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000359201 NULL PTP4A1 chr6 63580706 63580706 3'UTR C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000370651 NULL SOGA3 chr6 127475316 127475316 Missense_Mutation C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000481848 p.E904K SHPRH chr6 145955244 145955244 Missense_Mutation C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000275233 p.E27K SYNE1 chr6 152407183 152407183 Missense_Mutation A A C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000367255 p.L2185R ARID1B chr6 157184526 157184526 Intron A A T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000350026 NULL SDK1 chr7 3642064 3642064 Silent T T G TCGA-X8-AAAR-01A-11D-A403-09 ENST00000404826 p.T224T TNRC18 chr7 5370841 5370841 Silent G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000430969 p.P1251P AMPH chr7 38428479 38428479 Intron T T G TCGA-X8-AAAR-01A-11D-A403-09 ENST00000356264 NULL NRCAM chr7 108150109 108150109 Missense_Mutation C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000379028 p.R1239Q KCND2 chr7 120749612 120749612 3'UTR T T G TCGA-X8-AAAR-01A-11D-A403-09 ENST00000331113 NULL STRIP2 chr7 129483010 129483010 Missense_Mutation C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000249344 p.R740C CALD1 chr7 134968714 134968714 3'UTR G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000361675 NULL CHRM2 chr7 137015908 137015908 Missense_Mutation G G C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000320658 p.G348A AC073310.4 chr7 145010370 145010370 RNA T T C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000423226 NULL MYOM2 chr8 2073424 2073424 Silent C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000262113 p.D348D CSMD1 chr8 3018650 3018650 Missense_Mutation A A C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000520002 p.V2620G FAM150A chr8 52534377 52534377 3'UTR C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000358543 NULL TMEM68 chr8 55740028 55740028 3'UTR T T A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000434581 NULL RIMS2 chr8 103910370 103910370 Silent G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000262231 p.S366S DAB2IP chr9 121567227 121567227 Splice_Region C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000259371 p.Y13Y FIBCD1 chr9 130904151 130904151 Silent G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000372338 p.D433D GTF3C5 chr9 133057948 133057948 Missense_Mutation G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000372097 p.E510K CAMK1D chr10 12829237 12829237 3'UTR A A - TCGA-X8-AAAR-01A-11D-A403-09 ENST00000619168 NULL TMEM236 chr10 17752471 17752471 Missense_Mutation C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000377495 p.A59V RAB18 chr10 27538208 27538208 3'UTR G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000356940 NULL PHYHIPL chr10 59245604 59245604 3'UTR T T G TCGA-X8-AAAR-01A-11D-A403-09 ENST00000373880 NULL DDX50 chr10 68913471 68913471 Missense_Mutation G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000373585 p.D280N HTR7 chr10 90748996 90748996 Missense_Mutation T T A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000336152 p.N380Y SORCS3 chr10 105264947 105264947 3'UTR T T C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000369699 NULL VWA2 chr10 114289140 114289140 Silent G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000392982 p.R591R PNLIPRP3 chr10 116476771 116476771 Missense_Mutation A A C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000369230 p.K431T JAKMIP3 chr10 132135100 132135100 Missense_Mutation T T A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000298622 p.S303R ART5 chr11 3637279 3637279 3'Flank C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000359918 NULL OR51L1 chr11 4999421 4999421 Missense_Mutation G G T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000321543 p.G147C CCKBR chr11 6270721 6270721 Silent C C A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000334619 p.R243R CTR9 chr11 10751455 10751455 Missense_Mutation G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000361367 p.E15K CTR9 chr11 10766402 10766402 Missense_Mutation G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000361367 p.C533Y LUZP2 chr11 25082273 25082273 3'Flank A A C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000336930 NULL HNRNPKP3 chr11 43261874 43261874 RNA C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000511537 NULL OR4C16 chr11 55572423 55572423 Missense_Mutation T T C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000314634 p.V99A PITPNM1 chr11 67497982 67497982 Missense_Mutation C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000356404 p.D573N NAALAD2 chr11 90163341 90163341 Silent C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000534061 p.D369D ARCN1 chr11 118581334 118581334 Missense_Mutation G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000264028 p.G31D GRIK4 chr11 120905488 120905488 Missense_Mutation G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000438375 p.A491T AC215219.2 chr12 14669 14669 3'Flank G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000611710 NULL CRACR2A chr12 3638407 3638407 Missense_Mutation G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000440314 p.S440F IFFO1 chr12 6555808 6555808 Missense_Mutation G G C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000396840 p.I74M CD163 chr12 7487881 7487881 Missense_Mutation C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000359156 p.E543K DDX12P chr12 9429573 9429573 RNA T T C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000432996 NULL KIAA1551 chr12 31992962 31992962 3'UTR A A C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000312561 NULL MUC19 chr12 40545975 40545975 RNA A A C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000454784 NULL ARHGEF25 chr12 57613283 57613283 Missense_Mutation C C A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000286494 p.A111D PTPRQ chr12 80496429 80496429 Missense_Mutation T T G TCGA-X8-AAAR-01A-11D-A403-09 ENST00000614701 p.L724V PXN chr12 120214201 120214201 Missense_Mutation A A T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000228307 p.L432H CDK2AP1 chr12 123261696 123261696 3'UTR C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000261692 NULL PHF2P2 chr13 19051246 19051246 RNA T T G TCGA-X8-AAAR-01A-11D-A403-09 ENST00000444553 NULL CCNA1 chr13 36440146 36440146 Missense_Mutation G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000255465 p.R354Q KIAA0226L chr13 46350333 46350333 Missense_Mutation C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000389908 p.R450Q DACH1 chr13 71439963 71439964 3'UTR - - A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000613252 NULL ZIC5 chr13 99971594 99971594 Missense_Mutation G G T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000267294 p.P28T MYO16 chr13 108666123 108666123 Missense_Mutation C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000356711 p.A67V RGS6 chr14 72470027 72470027 Missense_Mutation G G C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000553530 p.Q160H PTPN21 chr14 88479345 88479345 Missense_Mutation C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000328736 p.G696S CATSPERB chr14 91588004 91588005 Frame_Shift_Ins - - ATTAT TCGA-X8-AAAR-01A-11D-A403-09 ENST00000256343 p.P1011Ifs*8 TCL6 chr14 95672186 95672186 Intron T T C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000497248 NULL IGHV2-26 chr14 106301576 106301576 Silent A A G TCGA-X8-AAAR-01A-11D-A403-09 ENST00000390611 p.R59R ZNF106 chr15 42451583 42451583 Missense_Mutation G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000263805 p.S207F CTDSPL2 chr15 44525692 44525692 3'UTR A A G TCGA-X8-AAAR-01A-11D-A403-09 ENST00000260327 NULL ABCC12 chr16 48091165 48091165 Silent C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000311303 p.T1080T CA7 chr16 66853587 66853587 3'UTR C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000338437 NULL AARS chr16 70267712 70267712 Missense_Mutation C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000261772 p.R390H CLEC3A chr16 78028121 78028121 Missense_Mutation C C A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000299642 p.L53M SPATA2L chr16 89697767 89697767 Missense_Mutation G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000289805 p.P281L TP53 chr17 7670685 7670685 Nonsense_Mutation G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000269305 p.R342* MYO15A chr17 18119392 18119392 Missense_Mutation G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000205890 p.A198T NOS2 chr17 27789610 27789610 Silent C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000313735 p.T63T KRT31 chr17 41394053 41394053 Missense_Mutation C T T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000251645 p.R405H TLK2 chr17 62612541 62612541 Silent G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000326270 p.A765A KIAA1328 chr18 37222092 37222092 Silent C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000280020 p.S533S DSEL chr18 67513032 67513032 Missense_Mutation A A G TCGA-X8-AAAR-01A-11D-A403-09 ENST00000310045 p.L536P ADGRE1 chr19 6901988 6901988 Missense_Mutation T T G TCGA-X8-AAAR-01A-11D-A403-09 ENST00000312053 p.L210V MUC16 chr19 8956947 8956947 Missense_Mutation G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000397910 p.S6608L ZNF491 chr19 11807581 11807581 3'UTR C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000323169 NULL CRTC1 chr19 18771471 18771471 Silent C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000321949 p.S450S MIR1270 chr19 20398926 20398926 3'Flank T T A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000459320 NULL ZNF790 chr19 36819282 36819282 Silent A A G TCGA-X8-AAAR-01A-11D-A403-09 ENST00000356725 p.T354T ZNF607 chr19 37698450 37698450 Missense_Mutation A A G TCGA-X8-AAAR-01A-11D-A403-09 ENST00000355202 p.Y561H CAPN12 chr19 38735496 38735496 Splice_Region C C A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000328867 NULL FBL chr19 39837822 39837822 Nonsense_Mutation C C A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000221801 p.E191* AKT2 chr19 40232178 40232178 3'UTR C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000392038 NULL PSG1 chr19 42867404 42867404 Intron A A C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000436291 NULL ZNF320 chr19 52881773 52881773 Missense_Mutation T T G TCGA-X8-AAAR-01A-11D-A403-09 ENST00000391781 p.K118T GGT7 chr20 34859624 34859624 Missense_Mutation T T C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000336431 p.E278G LPIN3 chr20 41354714 41354714 Missense_Mutation C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000373257 p.R533C APCDD1L chr20 58461397 58461397 Missense_Mutation C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000371149 p.R300Q NRIP1 chr21 14965909 14965909 Missense_Mutation C C A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000318948 p.D762Y ADAMTS5 chr21 26921170 26921170 3'UTR T T - TCGA-X8-AAAR-01A-11D-A403-09 ENST00000284987 NULL ERG chr21 38575661 38575661 Splice_Site C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000398919 p.X13_splice PDXK chr21 43737211 43737211 Intron T T C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000291565 NULL C21orf2 chr21 44331944 44331945 Frame_Shift_Del CT CT - TCGA-X8-AAAR-01A-11D-A403-09 ENST00000339818 p.E148Gfs*21 COL6A2 chr21 46124912 46124912 Missense_Mutation G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000300527 p.G588S PCNT chr21 46366752 46366752 Silent G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000359568 p.A926A AC008132.13 chr22 18858474 18858474 RNA T T A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000412938 NULL DEPDC5 chr22 31874331 31874331 Missense_Mutation G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000400246 p.A1208T TNRC6B chr22 40335766 40335767 3'UTR - - AAAAAAG TCGA-X8-AAAR-01A-11D-A403-09 ENST00000454349 NULL RPL23AP82 chr22 50798748 50798748 RNA C C T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000480246 NULL IL3RA chrX 1382628 1382630 3'UTR GAA GAA - TCGA-X8-AAAR-01A-11D-A403-09 ENST00000331035 NULL MIR1468 chrX 63785190 63785190 3'Flank G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000410600 NULL CYLC1 chrX 83873451 83873451 Missense_Mutation T T A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000329312 p.L248H PABPC5 chrX 91435687 91435687 Missense_Mutation A A C TCGA-X8-AAAR-01A-11D-A403-09 ENST00000312600 p.K37T AMOT chrX 112776868 112776868 3'UTR C T T TCGA-X8-AAAR-01A-11D-A403-09 ENST00000371959 NULL GRIA3 chrX 123403043 123403043 Missense_Mutation G G A TCGA-X8-AAAR-01A-11D-A403-09 ENST00000541091 p.R377H DCAF12L1 chrX 126551302 126551302 Missense_Mutation T T G TCGA-X8-AAAR-01A-11D-A403-09 ENST00000371126 p.Y436S PLAC1 chrX 134566327 134566328 Frame_Shift_Ins - - G TCGA-X8-AAAR-01A-11D-A403-09 ENST00000359237 p.Q119Pfs*26 TMEM257 chrX 145828808 145828808 3'UTR A A - TCGA-X8-AAAR-01A-11D-A403-09 ENST00000408967 NULL CCNL2 chr1 1390792 1390792 Missense_Mutation T T A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000400809 p.I245F ZMYM4 chr1 35392280 35392280 Missense_Mutation A A G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000314607 p.I886V RAVER2 chr1 64745301 64745301 Missense_Mutation C C G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000294428 p.D43E ADGRL2 chr1 81991269 81991270 3'UTR - - A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000370717 NULL PRKACB chr1 84173332 84173332 Intron G G A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000370689 NULL OLFM3 chr1 101804410 101804410 Missense_Mutation G G T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000338858 p.T422N LCE2A chr1 152698948 152698948 Missense_Mutation G G T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000368779 p.C16F DUSP27 chr1 167126836 167126836 Nonsense_Mutation G G T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000271385 p.E569* CRB1 chr1 197328430 197328430 Missense_Mutation T T C TCGA-IG-A50L-01A-11D-A27G-09 ENST00000367400 p.C27R KCNH1 chr1 210683203 210683203 3'UTR G G T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000271751 NULL OBSCN chr1 228299472 228299472 Intron A A G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000422127 NULL RP11-493E12.3 chr2 61134160 61134160 RNA C C A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000462959 NULL SCN2A chr2 165388673 165388673 Missense_Mutation A A T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000283256 p.T1623S NFE2L2 chr2 177234081 177234081 Missense_Mutation T T C TCGA-IG-A50L-01A-11D-A27G-09 ENST00000397062 p.E79G TTN chr2 178568785 178568785 Missense_Mutation G G A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000591111 p.R24142W PTH2R chr2 208481129 208481129 Silent C C T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000272847 p.T347T NYAP2 chr2 225651484 225651484 Silent T T A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000272907 p.P627P KIF1A chr2 240785059 240785059 Missense_Mutation G G A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000320389 p.S217F EMC3 chr3 9974406 9974407 Frame_Shift_Ins - - A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000245046 p.M130Ifs*20 CMC1 chr3 28322622 28322622 3'UTR A A G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000466830 NULL CSRNP1 chr3 39142935 39142935 3'UTR G G T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000273153 NULL ALS2CL chr3 46680443 46680443 Missense_Mutation G G A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000318962 p.A512V DPPA4 chr3 109331735 109331735 Missense_Mutation T T C TCGA-IG-A50L-01A-11D-A27G-09 ENST00000335658 p.K130R ILDR1 chr3 121993262 121993262 Missense_Mutation C C T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000344209 p.R496H ACAP2 chr3 195274800 195274800 3'UTR C C G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000326793 NULL ZNF721 chr4 442827 442827 Missense_Mutation T T G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000338977 p.H535P BOD1L1 chr4 13615368 13615368 Missense_Mutation C C T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000040738 p.G168E GK2 chr4 79407272 79407272 Missense_Mutation C C G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000358842 p.R310T COL25A1 chr4 108859675 108859675 Missense_Mutation T T G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000399132 p.N434T WDR17 chr4 176119935 176119935 Missense_Mutation C C T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000280190 p.P150S PRDM9 chr5 23526859 23526859 Missense_Mutation T T C TCGA-IG-A50L-01A-11D-A27G-09 ENST00000296682 p.W591R CDH10 chr5 24487885 24487885 Silent A A G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000264463 p.N715N OTP chr5 77636823 77636823 Missense_Mutation G G T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000306422 p.Q149K SEC24A chr5 134727718 134727718 3'UTR T T A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000398844 NULL PCDHA7 chr5 140834801 140834801 Missense_Mutation C C G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000525929 p.L140V TNIP1 chr5 151030723 151030723 Missense_Mutation C C G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000315050 p.G634A SNCB chr5 176620522 176620522 3'UTR C C T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000310112 NULL AACSP1 chr5 178772530 178772530 RNA C C T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000503486 NULL WDR46 chr6 33288162 33288162 Missense_Mutation C C T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000374617 p.A183T ANKS1A chr6 35018046 35018046 Missense_Mutation C C T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000360359 p.S666L COL21A1 chr6 56124065 56124065 Missense_Mutation G G T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000244728 p.F585L LGSN chr6 63280346 63280346 Missense_Mutation C C G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000370657 p.G402A IBTK chr6 82211495 82211495 Missense_Mutation C C T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000306270 p.R790K MARCKS chr6 113860737 113860738 3'UTR TG TG - TCGA-IG-A50L-01A-11D-A27G-09 ENST00000612661 NULL ROS1 chr6 117388020 117388020 Missense_Mutation T T C TCGA-IG-A50L-01A-11D-A27G-09 ENST00000368508 p.S592G KIAA0408 chr6 127450199 127450199 Missense_Mutation G G T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000483725 p.H97N MOXD1 chr6 132328485 132328485 Missense_Mutation T T C TCGA-IG-A50L-01A-11D-A27G-09 ENST00000367963 p.Y258C IGF2R chr6 160060648 160060648 Nonsense_Mutation C C T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000356956 p.R1065* DNAAF5 chr7 729780 729780 Missense_Mutation G G C TCGA-IG-A50L-01A-11D-A27G-09 ENST00000297440 p.G238A AMZ1 chr7 2700425 2700425 5'UTR G G A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000312371 NULL DGKB chr7 14621464 14621464 Missense_Mutation T T C TCGA-IG-A50L-01A-11D-A27G-09 ENST00000399322 p.S401G RP11-797H7.5 chr7 64888871 64888871 Intron C C G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000340779 NULL DLX5 chr7 97020607 97020607 3'UTR A A - TCGA-IG-A50L-01A-11D-A27G-09 ENST00000222598 NULL MUC12 chr7 101014019 101014019 Missense_Mutation C C T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000379442 p.L5392F DOCK4 chr7 111727358 111727359 3'Flank - - T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000437633 NULL MKLN1 chr7 131490885 131490885 3'UTR C C G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000352689 NULL TRPV5 chr7 142925607 142925607 Silent G G A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000265310 p.V348V NOS3 chr7 151010735 151010735 Missense_Mutation G G T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000297494 p.V942F NKX2-6 chr8 23702775 23702775 Missense_Mutation C C A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000325017 p.K194N EFCAB1 chr8 48731446 48731446 Missense_Mutation A A G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000262103 p.V39A VCPIP1 chr8 66634829 66634829 Missense_Mutation G G A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000310421 p.S1114F FBXO43 chr8 100133677 100133677 3'UTR A A G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000428847 NULL SMC5 chr9 70300170 70300170 Silent A A G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000361138 p.K478K CTSL3P chr9 87773155 87773155 RNA G G A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000412179 NULL SPATA31C2 chr9 88132564 88132564 RNA A A G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000324915 NULL TMEM246 chr9 101476252 101476252 Missense_Mutation T T C TCGA-IG-A50L-01A-11D-A27G-09 ENST00000374847 p.M281V NOTCH1 chr9 136517365 136517365 Missense_Mutation C C T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000277541 p.E488K PI4K2A chr10 97673838 97673838 3'UTR G T T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000370631 NULL MUC2 chr11 1099937 1099937 RNA G G A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000361558 NULL NUP160 chr11 47815490 47815490 Silent G G A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000378460 p.L559L OR5T1 chr11 56276203 56276203 Missense_Mutation G G C TCGA-IG-A50L-01A-11D-A27G-09 ENST00000313033 p.V189L MS4A10 chr11 60792287 60792287 Missense_Mutation C C T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000308287 p.A109V ESRRA chr11 64314240 64314241 Frame_Shift_Ins - - GTGC TCGA-IG-A50L-01A-11D-A27G-09 ENST00000000442 p.L151Afs*56 FRMD8 chr11 65387064 65387064 Missense_Mutation C C A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000317568 p.Q10K NOX4 chr11 89490495 89490495 Missense_Mutation T T C TCGA-IG-A50L-01A-11D-A27G-09 ENST00000263317 p.Q39R FAT3 chr11 92857295 92857295 Missense_Mutation G G A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000525166 p.S3666N CASP1 chr11 105030455 105030455 Missense_Mutation T T C TCGA-IG-A50L-01A-11D-A27G-09 ENST00000436863 p.I168V PCSK7 chr11 117208977 117208977 Silent T T A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000320934 p.P537P FXYD6 chr11 117820617 117820617 Intron C C A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000614497 NULL TSPAN9 chr12 3281314 3281314 Silent G G A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000011898 p.T183T CREBL2 chr12 12642006 12642006 3'UTR A A G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000228865 NULL CAND1 chr12 67311701 67311701 Silent A A G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000545606 p.T1123T NR1H4 chr12 100503459 100503460 Frame_Shift_Ins - - T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000551379 p.M27Hfs*62 IFT88 chr13 20615828 20615828 Missense_Mutation C C A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000319980 p.A392E SOX1 chr13 112071525 112071525 3'Flank C C T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000330949 NULL OR4Q3 chr14 19748110 19748110 Missense_Mutation C C T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000331723 p.T228I OR4K1 chr14 19935758 19935758 Missense_Mutation T T C TCGA-IG-A50L-01A-11D-A27G-09 ENST00000285600 p.F31S NOVA1 chr14 26446417 26446417 3'UTR G G - TCGA-IG-A50L-01A-11D-A27G-09 ENST00000539517 NULL ARHGAP5 chr14 32154640 32154640 Missense_Mutation A A G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000345122 p.I1401V MAP4K5 chr14 50429243 50429243 Frame_Shift_Del A A - TCGA-IG-A50L-01A-11D-A27G-09 ENST00000013125 p.S728Pfs*4 ZBTB1 chr14 64524637 64524637 3'Flank C C G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000554015 NULL ZNF609 chr15 64675350 64675350 Silent A A T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000326648 p.G832G NPRL3 chr16 89735 89735 Silent G G A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000611875 p.N443N C16orf72 chr16 9117419 9117419 3'UTR A A T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000327827 NULL MIR6511A3 chr16 16371205 16371205 3'Flank G G A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000615389 NULL RPS15A chr16 18784660 18784661 Intron - - A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000322989 NULL KNOP1 chr16 19707008 19707008 Nonsense_Mutation T T A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000219837 p.K427* RLTPR chr16 67654433 67654433 Missense_Mutation G G A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000334583 p.R1108H CNTNAP4 chr16 76489733 76489733 Missense_Mutation G G T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000611870 p.V644F ANKFY1 chr17 4177205 4177205 Nonsense_Mutation G G T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000341657 p.S899* TP53 chr17 7673796 7673796 Missense_Mutation C C A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000269305 p.C275F MYH2 chr17 10527834 10527834 Missense_Mutation A A G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000245503 p.L1262P RAI1 chr17 17792938 17792938 5'UTR C C G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000353383 NULL KRT15 chr17 41514036 41514036 Missense_Mutation T T C TCGA-IG-A50L-01A-11D-A27G-09 ENST00000254043 p.K453R SPAG9 chr17 50995469 50995469 Missense_Mutation A A T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000262013 p.L678Q LPO chr17 58252337 58252337 Silent C C T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000262290 p.S312S PTPN2 chr18 12859248 12859248 Silent G G T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000309660 p.R26R MUC16 chr19 8974174 8974174 Missense_Mutation G G A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000397910 p.A2322V MUC16 chr19 8979810 8979810 Silent A A T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000397910 p.S443S TYK2 chr19 10350931 10350931 Missense_Mutation G G A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000264818 p.A1156V EPOR chr19 11381795 11381795 Missense_Mutation T T A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000222139 p.H161L FARSA chr19 12930612 12930613 Frame_Shift_Ins - - A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000314606 p.M95Ifs*27 MVB12A chr19 17423508 17423508 Missense_Mutation G G A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000317040 p.G142S ZNF90 chr19 20118060 20118061 Frame_Shift_Ins - - A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000418063 p.P172Tfs*21 ZNF676 chr19 22180250 22180250 Missense_Mutation G G T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000397121 p.F489L ZNF676 chr19 22180958 22180958 Nonsense_Mutation G G T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000397121 p.Y253* KRTDAP chr19 35487433 35487433 Missense_Mutation G G T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000338897 p.Q99K ZNF616 chr19 52115856 52115856 Silent A A G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000600228 p.T436T ZNF880 chr19 52384587 52384587 Missense_Mutation G G A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000422689 p.G336D DPRX chr19 53636626 53636626 Missense_Mutation A A G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000376650 p.K72E BRSK1 chr19 55306327 55306327 Missense_Mutation G G A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000309383 p.V656I KIF16B chr20 16507972 16507972 Missense_Mutation T T C TCGA-IG-A50L-01A-11D-A27G-09 ENST00000354981 p.I229V L3MBTL1 chr20 43528715 43528715 Silent C C A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000418998 p.A285A WFDC8 chr20 45558986 45558986 Missense_Mutation G G T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000289953 p.P48Q ZNF335 chr20 45969591 45969591 Missense_Mutation C C G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000322927 p.G101A ANKRD20A11P chr21 13951260 13951260 Splice_Region C C T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000344693 NULL SON chr21 33552425 33552425 Missense_Mutation C C A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000356577 p.S1065Y ERG chr21 38445571 38445571 Silent G G A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000398919 p.Y30Y SLC5A4 chr22 32220998 32220998 Missense_Mutation G G A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000266086 p.R564W ATF4 chr22 39522410 39522410 Missense_Mutation C C G TCGA-IG-A50L-01A-11D-A27G-09 ENST00000337304 p.N288K HDAC10 chr22 50250370 50250370 Intron C C T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000216271 NULL SMS chrX 21994532 21994532 3'UTR T T - TCGA-IG-A50L-01A-11D-A27G-09 ENST00000404933 NULL FOXR2 chrX 55625262 55625262 3'UTR C C A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000339140 NULL ZXDB chrX 57593528 57593528 Missense_Mutation T T C TCGA-IG-A50L-01A-11D-A27G-09 ENST00000374888 p.S494P ASB12 chrX 64224420 64224420 Missense_Mutation G G T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000362002 p.A291D KIAA2022 chrX 74743899 74743899 Missense_Mutation T T C TCGA-IG-A50L-01A-11D-A27G-09 ENST00000055682 p.T220A PLXNB3 chrX 153779288 153779288 3'UTR G G A TCGA-IG-A50L-01A-11D-A27G-09 ENST00000361971 NULL L1CAM chrX 153865332 153865332 Missense_Mutation C C T TCGA-IG-A50L-01A-11D-A27G-09 ENST00000370060 p.A906T TTLL10 chr1 1175507 1175507 Intron C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000379289 NULL NADK chr1 1752811 1752811 3'UTR G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000341426 NULL CEP104 chr1 3839776 3839776 Splice_Region C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000378230 p.R189R RNF207 chr1 6206632 6206632 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000377939 p.E33Q CLSTN1 chr1 9735982 9735982 Missense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000377298 p.S546F KIF1B chr1 10374342 10374342 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000377086 p.S1658C PTCHD2 chr1 11501367 11501367 Silent G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000294484 p.A125A PRAMEF15 chr1 13319720 13319720 Silent G G T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000376152 p.V214V PDPN chr1 13607274 13607274 Missense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000621990 p.E57K SPEN chr1 15937475 15937475 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000375759 p.L3447V MST1P2 chr1 16646491 16646491 RNA G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000457982 NULL PADI2 chr1 17079201 17079201 Intron C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000375486 NULL TAS1R2 chr1 18840154 18840154 Silent G G T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000375371 p.I655I EMC1 chr1 19221028 19221028 Intron C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000477853 NULL LDLRAD2 chr1 21822041 21822041 Intron C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000344642 NULL LAPTM5 chr1 30738958 30738958 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000294507 p.F164L COL16A1 chr1 31660607 31660607 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000373672 p.R1286T ADGRB2 chr1 31756590 31756590 Missense_Mutation A A C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000373658 p.F83V CLSPN chr1 35745518 35745518 Missense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000318121 p.E967K MACF1 chr1 39335034 39335034 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000372915 p.Q2821E EXO5 chr1 40516148 40516148 3'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000296380 NULL CDC20 chr1 43360573 43360573 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000310955 p.W276C SLC6A9 chr1 44008556 44008556 Silent G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000360584 p.I202I BEND5 chr1 48761384 48761384 Nonsense_Mutation C C A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000371833 p.E105* TTC39A chr1 51302232 51302232 Intron C C A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000447632 NULL ANGPTL3 chr1 62602374 62602374 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000371129 p.L309V NEGR1 chr1 71405772 71405772 3'UTR T T G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000357731 NULL FPGT-TNNI3K chr1 74198315 74198315 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000557284 p.R26G FPGT-TNNI3K chr1 74249497 74249497 Missense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000557284 p.R177H SLC44A5 chr1 75339587 75339587 Silent G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000370855 p.A32A PIGK chr1 77210480 77210480 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000370812 p.E35Q USP33 chr1 77697453 77697453 Missense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000357428 p.S898F CCBL2 chr1 88961257 88961257 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000260508 p.A233P GCLM chr1 93904582 93904582 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000370238 p.D45H ARHGAP29 chr1 94173599 94173599 3'UTR G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000260526 NULL LPPR4 chr1 99306010 99306010 Missense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000370185 p.R431K PSMA5 chr1 109413081 109413081 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000271308 p.R93T PKMP1 chr1 114536541 114536541 RNA C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000455804 NULL TBX15 chr1 118924666 118924666 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000369429 p.E225Q NBPF8 chr1 145393083 145393083 Missense_Mutation C C A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000392971 p.D58Y ANKRD34A chr1 145959957 145959957 3'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000606888 NULL CHD1L chr1 147255863 147255863 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000369258 p.R133T PDE4DIP chr1 148992434 148992434 Intron A A C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000369354 NULL RPRD2 chr1 150472347 150472347 Silent A A G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000369068 p.T1133T POGZ chr1 151405152 151405152 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000271715 p.D1295H TCHHL1 chr1 152086327 152086327 Missense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000368806 p.G452E LCE3C chr1 152600921 152600921 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000333881 p.Q64E SPRR2E chr1 153093677 153093677 Silent C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000368750 p.E25E SHC1 chr1 154962832 154962832 3'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000368445 NULL ZBTB7B chr1 155014790 155014790 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000292176 p.E44Q SCAMP3 chr1 155258947 155258947 Missense_Mutation C C A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000302631 p.Q132H CADM3 chr1 159201236 159201236 3'UTR T T A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000368125 NULL ATP1A2 chr1 160143583 160143583 3'UTR A A - TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000361216 NULL KLHDC9 chr1 161098402 161098402 5'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000368011 NULL PRRX1 chr1 170719824 170719824 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000239461 p.E114Q ZBTB37 chr1 173885653 173885653 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000367701 p.M347I ASTN1 chr1 177030885 177030885 Silent C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000361833 p.V311V ABL2 chr1 179104002 179104002 3'UTR T T G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000502732 NULL DHX9 chr1 182860032 182860032 Missense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000367549 p.E394K PRG4 chr1 186306749 186306749 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000445192 p.L344V ZNF281 chr1 200407310 200407310 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000294740 p.S799C CENPF chr1 214641406 214641406 Missense_Mutation T T G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000366955 p.L1023R USH2A chr1 215758605 215758605 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000307340 p.W3793C HHIPL2 chr1 222540021 222540021 Missense_Mutation T T C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000343410 p.N480S ENAH chr1 225496893 225496893 3'UTR C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000366844 NULL CCSAP chr1 229324186 229324186 3'UTR G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000284617 NULL RYR2 chr1 237833815 237833815 3'UTR C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000366574 NULL CHML chr1 241634833 241634833 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000366553 p.D312H WDR64 chr1 241787981 241787981 Missense_Mutation C C A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000366552 p.S936R AHCTF1 chr1 246913320 246913320 Silent T T C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000326225 p.A165A OR1C1 chr1 247757572 247757572 Missense_Mutation A A T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000408896 p.S279T PGBD2 chr1 248917188 248917188 Missense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000329291 p.E202K SOX11 chr2 5693004 5693004 Missense_Mutation A A C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000322002 p.K95Q SOX11 chr2 5694610 5694610 3'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000322002 NULL DNMT3A chr2 25275051 25275051 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000264709 p.E177Q IFT172 chr2 27456594 27456594 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000260570 p.K1096N IFT172 chr2 27461022 27461022 Silent G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000260570 p.F838F HEATR5B chr2 37003604 37003604 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000233099 p.G1663A PLEKHH2 chr2 43697188 43697188 Missense_Mutation T T G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000282406 p.S174A LRPPRC chr2 43963659 43963659 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000260665 p.D473H SLC3A1 chr2 44320592 44320592 Nonsense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000260649 p.R671* PREPL chr2 44359545 44359545 Silent C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000260648 p.K57K BCL11A chr2 60459397 60459397 3'UTR A A G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000335712 NULL WDPCP chr2 63404175 63404175 Missense_Mutation G G T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000272321 p.S436R PLEK chr2 68393162 68393162 Missense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000234313 p.G255R HTRA2 chr2 74529531 74529531 5'UTR G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000258080 NULL KCMF1 chr2 85049423 85049423 Missense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000409785 p.S220F POLR1B chr2 112573561 112573561 Splice_Site G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000263331 p.X758_splice DPP10 chr2 115844254 115844254 3'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000410059 NULL LRP2 chr2 169128361 169128361 3'UTR C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000263816 NULL DCAF17 chr2 171480128 171480128 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000375255 p.D453H HOXD12 chr2 176100546 176100546 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000406506 p.G200A TTC30A chr2 177617459 177617459 Missense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000355689 p.E415K DFNB59 chr2 178454446 178454446 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000375129 p.S109C PLEKHA3 chr2 178478565 178478565 5'Flank G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000234453 NULL UBE2E3 chr2 180982108 180982108 Silent G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000392415 p.A22A PGAP1 chr2 196912984 196912984 Silent A A G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000354764 p.L183L ADAM23 chr2 206481290 206481290 Missense_Mutation T T C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000264377 p.L164P UNC80 chr2 209872777 209872777 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000439458 p.R1218T CCDC108 chr2 219006180 219006180 Missense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000341552 p.A1588V INHA chr2 219572462 219572462 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000243786 p.L30V STK11IP chr2 219611744 219611744 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000295641 p.P760A TRIP12 chr2 229880070 229880070 Missense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000283943 p.R4W COL6A3 chr2 237352552 237352552 Silent C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000295550 p.L2241L CNTN4 chr3 3056236 3056236 3'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000397461 NULL FANCD2 chr3 10090313 10090313 Silent C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000383807 p.F1235F PPARG chr3 12405949 12405949 Silent C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000287820 p.I229I OXSR1 chr3 38198791 38198791 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000311806 p.S121C CCDC13 chr3 42758256 42758256 Missense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000310232 p.M30I RBM6 chr3 50048318 50048318 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000266022 p.R544P RBM6 chr3 50068746 50068746 Silent G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000266022 p.L1000L CCDC66 chr3 56560914 56560914 Intron C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000394672 NULL FAM19A4 chr3 68732661 68732661 3'UTR C C A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000295569 NULL TOMM70A chr3 100368096 100368096 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000284320 p.D541H C3orf30 chr3 119147051 119147051 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000295622 p.E288Q GPR156 chr3 120167313 120167313 Missense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000315843 p.E722K STXBP5L chr3 121238984 121238984 Missense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000273666 p.E400K POLQ chr3 121488961 121488961 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000264233 p.L1324V GOLGB1 chr3 121698520 121698520 Missense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000340645 p.S663L CASR chr3 122284349 122284349 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000490131 p.E799Q SEC61A1 chr3 128055561 128055561 Missense_Mutation A A C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000243253 p.I41L TMCC1 chr3 129650211 129650211 3'UTR C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000393238 NULL ANAPC13 chr3 134482844 134482844 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000354910 p.E21Q A4GNT chr3 138131228 138131228 Nonsense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000236709 p.S10* U2SURP chr3 143053746 143053746 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000473835 p.S909C P2RY1 chr3 152837716 152837716 3'UTR G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000305097 NULL GFM1 chr3 158645702 158645702 Nonsense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000486715 p.S52* SI chr3 164982299 164982299 Silent G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000264382 p.L1787L BCHE chr3 165830682 165830682 Missense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000264381 p.E118K MECOM chr3 169381333 169381333 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000494292 p.P77A PIK3CA chr3 179234286 179234286 Missense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000263967 p.M1043I RTP4 chr3 187371366 187371366 Missense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000259030 p.S245L OPA1 chr3 193692104 193692104 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000392438 p.E954Q XXYLT1 chr3 195175674 195175674 Intron G G T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000310380 NULL PCYT1A chr3 196257824 196257824 Missense_Mutation T T C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000292823 p.R61G FAM184B chr4 17660026 17660026 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000265018 p.E586Q PGM2 chr4 37834689 37834689 Silent C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000381967 p.A107A KLB chr4 39447128 39447128 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000257408 p.S801W PDS5A chr4 39890310 39890310 Nonsense_Mutation C C A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000303538 p.E609* PHOX2B chr4 41745630 41745630 3'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000226382 NULL GABRB1 chr4 47403677 47403677 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000295454 p.I267M FRYL chr4 48575172 48575172 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000358350 p.E931Q LNX1 chr4 53507320 53507320 Missense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000263925 p.E258K PRDM8 chr4 80201990 80201990 Silent C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000339711 p.F176F SEC31A chr4 82900749 82900749 5'Flank C C A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000355196 NULL ANKRD50 chr4 124666496 124666496 3'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000504087 NULL TMEM154 chr4 152643118 152643118 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000304385 p.D150H C4orf46 chr4 158668482 158668482 3'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000379205 NULL TRIM60 chr4 165040702 165040702 Missense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000341062 p.M210I SPOCK3 chr4 166792186 166792186 Silent C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000357154 p.L234L DDX60L chr4 168456060 168456060 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000260184 p.L272F LRP2BP chr4 185370715 185370715 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000328559 p.F301L FRG2 chr4 190027033 190027033 Silent T T G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000378763 p.R58R NKD2 chr5 1033424 1033424 Silent C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000296849 p.L85L SLC6A19 chr5 1213552 1213552 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000304460 p.I251M CLPTM1L chr5 1318322 1318322 3'UTR C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000320895 NULL TRIO chr5 14369505 14369505 Silent G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000344204 p.Q1066Q ZNF622 chr5 16463611 16463611 Missense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000308683 p.D253N PRDM9 chr5 23527548 23527548 Silent C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000296682 p.L820L RAI14 chr5 34821846 34821846 Missense_Mutation T T C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000265109 p.L370S C5orf42 chr5 37201691 37201691 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000425232 p.S1136C CENPH chr5 69189684 69189684 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000283006 p.G17A MRPS36 chr5 69228316 69228316 Missense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000256441 p.E75K RP11-136K7.2 chr5 71445779 71445779 RNA C C - TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000502659 NULL BDP1 chr5 71544503 71544503 Missense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000358731 p.E2187K JMY chr5 79324897 79324897 3'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000396137 NULL PAPD4 chr5 79645143 79645143 Missense_Mutation C C A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000296783 p.Q258K ADGRV1 chr5 90653352 90653352 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000405460 p.E1260Q SLCO6A1 chr5 102458426 102458426 Silent G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000379807 p.L363L PRRC1 chr5 127551847 127551847 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000296666 p.Q423H SEC24A chr5 134671862 134671862 Missense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000398844 p.E265K CD14 chr5 140631798 140631798 3'UTR G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000302014 NULL PCDHGA1 chr5 141330955 141330955 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000517417 p.D91H PCDHGA9 chr5 141403949 141403949 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000573521 p.V333L PCDHGB7 chr5 141418540 141418540 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000398594 p.Q227H PPP2R2B chr5 146593026 146593026 Missense_Mutation A A G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000394409 p.Y333H CYFIP2 chr5 157325507 157325507 Silent C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000616178 p.L642L MIR3142 chr5 160474443 160474443 RNA C C A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000582487 NULL MXD3 chr5 177307639 177307639 Silent G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000439742 p.F190F RMND5B chr5 178146127 178146127 Missense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000313386 p.M236I HNRNPH1 chr5 179620894 179620894 Nonsense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000356731 p.S132* HNRNPH1 chr5 179621042 179621042 Splice_Region G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000356731 NULL KDM1B chr6 18222586 18222586 3'UTR C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000297792 NULL E2F3 chr6 20401969 20401969 5'Flank C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000346618 NULL BTN3A2 chr6 26376650 26376650 3'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000356386 NULL ZSCAN12 chr6 28392931 28392931 Missense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000361028 p.S173F HLA-B chr6 31356686 31356686 Splice_Site A A G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000412585 p.X115_splice HLA-B chr6 31356687 31356687 Splice_Site C C A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000412585 p.X115_splice BAG6 chr6 31647782 31647782 Silent C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000375964 p.Q205Q PPARD chr6 35424673 35424673 Silent C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000311565 p.F324F RUNX2 chr6 45549888 45549888 3'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000371438 NULL ADGRB3 chr6 69372433 69372433 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000370598 p.D1423H CD109 chr6 73828020 73828020 3'UTR C C - TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000287097 NULL COL12A1 chr6 75184044 75184044 Silent G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000322507 p.V366V SYNCRIP chr6 85615211 85615211 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000369622 p.D473H CNR1 chr6 88145266 88145266 Silent C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000369499 p.S3S SRSF12 chr6 89098712 89098712 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000452027 p.D218H SIM1 chr6 100390757 100390757 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000262901 p.Q635H PRDM1 chr6 106105140 106105140 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000369096 p.S327C PTPRK chr6 128067708 128067708 Silent G G T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000368215 p.V656V CTAGE9 chr6 131709496 131709496 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000314099 p.D508H ENPP1 chr6 131869411 131869411 Missense_Mutation G G T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000360971 p.D443Y RADIL chr7 4834907 4834907 Silent G G T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000399583 p.L372L GRID2IP chr7 6502019 6502019 Missense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000457091 p.D1084N AGR3 chr7 16861392 16861392 Missense_Mutation A A C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000310398 p.M120R TWIST1 chr7 19115697 19115697 3'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000242261 NULL SP8 chr7 20782471 20782471 3'Flank G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000361443 NULL TRIL chr7 28957623 28957623 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000539664 p.E142Q LSM5 chr7 32490468 32490468 5'Flank G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000450169 NULL CAMK2B chr7 44219359 44219359 3'UTR T T G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000395749 NULL OGDH chr7 44624446 44624446 Nonsense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000222673 p.Q35* SEPT7P2 chr7 45748643 45748644 RNA - - T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000429741 NULL SEPT14 chr7 55819187 55819187 Missense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000388975 p.E253K ZNF679 chr7 64266160 64266160 Missense_Mutation C C A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000255746 p.T176K GTF2IRD1 chr7 74555478 74555478 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000265755 p.K684N SEMA3A chr7 84005430 84005430 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000265362 p.I423M AKAP9 chr7 92001268 92001268 Nonsense_Mutation G G T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000356239 p.E451* AKAP9 chr7 92002183 92002183 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000356239 p.E756Q DYNC1I1 chr7 96076182 96076182 Silent C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000324972 p.L562L TECPR1 chr7 98233588 98233588 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000447648 p.S502W MUC17 chr7 101041909 101041909 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000306151 p.S3498C MUC17 chr7 101042011 101042011 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000306151 p.S3532C SLC35G5 chr8 11332111 11332111 Missense_Mutation G G T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000382435 p.K335N PDLIM2 chr8 22593761 22593761 Missense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000397760 p.R304W PURG chr8 31031597 31031597 3'UTR G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000475541 NULL LETM2 chr8 38394140 38394140 Missense_Mutation A A G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000379957 p.M182V TGS1 chr8 55782753 55782753 Missense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000260129 p.R36Q LYN chr8 55999481 55999481 Missense_Mutation A A C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000519728 p.K423T ASPH chr8 61646810 61646810 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000379454 p.L187V PREX2 chr8 68191737 68191737 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000288368 p.D1454E CDH17 chr8 94176667 94176667 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000027335 p.D100H RAD54B chr8 94432002 94432002 Intron C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000336148 NULL UBR5 chr8 102261972 102261972 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000520539 p.F2595L SLC30A8 chr8 117174725 117174725 3'Flank T T G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000456015 NULL COL14A1 chr8 120280740 120280740 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000297848 p.D1226H MRPL13 chr8 120443228 120443228 Silent A A G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000306185 p.S36S OPLAH chr8 144058805 144058805 Silent G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000618853 p.R185R SMARCA2 chr9 2058298 2058298 Missense_Mutation T T C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000349721 p.L452P CNTNAP3 chr9 39073068 39073068 3'UTR G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000297668 NULL ZFAND5 chr9 72355104 72355104 3'UTR C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000237937 NULL TMC1 chr9 72648604 72648604 5'UTR C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000297784 NULL GADD45G chr9 89605394 89605394 Intron C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000252506 NULL BICD2 chr9 92764591 92764591 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000375512 p.E52Q FGD3 chr9 93011239 93011239 Silent C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000337352 p.A334A PTPDC1 chr9 94107900 94107900 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000375360 p.E741Q NANS chr9 98076944 98076944 Silent G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000210444 p.L125L ABCA1 chr9 104817391 104817391 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000374736 p.S1159C SNX30 chr9 112817809 112817809 Silent C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000374232 p.L151L TRIM32 chr9 116701236 116701236 3'UTR T T A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000373983 NULL RBM18 chr9 122241494 122241494 3'UTR C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000417201 NULL LRSAM1 chr9 127502796 127502796 Missense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000300417 p.C690Y STXBP1 chr9 127692511 127692511 3'UTR C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000373299 NULL URM1 chr9 128371413 128371413 Splice_Region C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000372853 p.F11F SPTAN1 chr9 128609248 128609248 Silent G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000372731 p.A1574A PMPCA chr9 136416296 136416296 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000371717 p.E180Q ANAPC2 chr9 137187911 137187911 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000323927 p.E104Q NSMF chr9 137449609 137449609 Silent G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000371475 p.L495L EHMT1 chr9 137777879 137777879 Splice_Region A A C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000460843 NULL USP6NL chr10 11461123 11461123 3'UTR G G T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000609104 NULL RNA5SP311 chr10 46809223 46809223 5'Flank T T - TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000411290 NULL ANXA8 chr10 47461620 47461620 3'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000583448 NULL ARID5B chr10 62092439 62092439 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000279873 p.M992I MYPN chr10 68106745 68106745 5'Flank G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000358913 NULL COL13A1 chr10 69802715 69802715 Missense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000398978 p.E98K DLG5 chr10 77809684 77809684 Missense_Mutation A A T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000372391 p.F1504I ZCCHC24 chr10 79394425 79394425 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000372336 p.E155Q BTAF1 chr10 92009061 92009061 Nonsense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000265990 p.S1319* HOGA1 chr10 97601972 97601972 Silent C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000370646 p.L272L NDUFB8 chr10 100523893 100523893 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000299166 p.E169Q FAM178A chr10 100944102 100944102 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000238961 p.E911Q MRPL43 chr10 100978485 100978485 3'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000318325 NULL PNLIPRP2 chr10 116624031 116624031 Missense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000611850 p.P46S EMX2 chr10 117549394 117549394 3'UTR A A G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000553456 NULL C10orf88 chr10 122937705 122937705 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000481909 p.G368A RP11-108K14.8 chr10 133396217 133396217 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000468317 p.H83D OR52L1 chr11 5985936 5985936 3'UTR T T G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000332249 NULL TUB chr11 8100855 8100855 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000299506 p.Q415H CSNK2A3 chr11 11353048 11353048 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000528848 p.W24C SPON1 chr11 14255749 14255749 Nonsense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000576479 p.Q399* KIAA1549L chr11 33645950 33645950 Missense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000321505 p.P1595S KIAA1549L chr11 33645951 33645951 Missense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000321505 p.P1595L SLC35C1 chr11 45811513 45811513 3'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000314134 NULL OR5I1 chr11 55936056 55936056 Silent G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000301532 p.F115F OR8K3 chr11 56318372 56318372 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000312711 p.E22D LRRC55 chr11 57187265 57187265 Missense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000497933 p.R271W MED19 chr11 57705024 57705024 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000337672 p.F141L C11orf31 chr11 57741539 57741539 5'Flank G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000388857 NULL RAB3IL1 chr11 61906551 61906551 Missense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000394836 p.R191H AHNAK chr11 62529904 62529904 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000378024 p.D1505H AHNAK chr11 62530567 62530567 Missense_Mutation C C A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000378024 p.D1284Y AHNAK chr11 62531278 62531278 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000378024 p.E1047Q C11orf85 chr11 64939696 64939696 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000301896 p.R206S SLC25A45 chr11 65377047 65377047 Silent G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000398802 p.I123I CNIH2 chr11 66278518 66278520 In_Frame_Del TCT TCT - TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000311445 p.F23del C11orf80 chr11 66788208 66788208 Nonsense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000525908 p.S191* PPFIA1 chr11 70383108 70383108 3'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000253925 NULL KRTAP5-7 chr11 71527701 71527701 Nonsense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000398536 p.S134* DEFB108B chr11 71837536 71837536 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000328698 p.E66Q ARHGEF17 chr11 73365513 73365513 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000263674 p.E1892Q C2CD3 chr11 74034162 74034162 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000334126 p.R2000G LRRC32 chr11 76659915 76659915 Missense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000260061 p.E560K NOX4 chr11 89402528 89402528 Missense_Mutation T T A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000263317 p.Y215F NOX4 chr11 89488936 89488936 Intron G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000263317 NULL TRPC6 chr11 101471258 101471258 Silent C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000344327 p.L778L MMP3 chr11 102836450 102836450 Intron G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000299855 NULL DYNC2H1 chr11 103170989 103170989 Missense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000375735 p.S1752L ATM chr11 108315862 108315862 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000278616 p.D2016H FEZ1 chr11 125495602 125495602 Intron G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000278919 NULL PRDM10 chr11 129924989 129924989 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000358825 p.E595Q B3GAT1 chr11 134382825 134382825 Missense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000312527 p.R268Q KDM5A chr12 284268 284268 3'UTR C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000399788 NULL CACNA1C chr12 2674549 2674549 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000347598 p.E1627Q ANO2 chr12 5563458 5563458 Silent C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000356134 p.L947L C1R chr12 7081192 7081192 Silent G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000542285 p.R486R PLEKHA5 chr12 19376298 19376298 3'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000299275 NULL PLEKHA8P1 chr12 45173640 45173640 RNA C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000256692 NULL KMT2D chr12 49034135 49034135 Nonsense_Mutation C C A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000301067 p.E3558* NCKAP5L chr12 49792693 49792693 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000335999 p.E1212Q ATF1 chr12 50820003 50820003 3'UTR C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000262053 NULL CSRNP2 chr12 51063800 51063800 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000228515 p.Q526H RP11-923I11.6 chr12 51820079 51820079 RNA G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000562343 NULL ACVR1B chr12 51986882 51986882 Missense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000257963 p.A401T KRT78 chr12 52848779 52848779 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000304620 p.S51C NCKAP1L chr12 54511982 54511982 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000293373 p.S273C TIMELESS chr12 56432476 56432476 Missense_Mutation G G T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000553532 p.H194N HELB chr12 66306460 66306460 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000247815 p.L241F KRR1 chr12 75499790 75499790 3'UTR T T G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000229214 NULL CCDC59 chr12 82358267 82358267 Missense_Mutation C C A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000256151 p.W37L C12orf29 chr12 88048344 88048347 Frame_Shift_Del TAAG TAAG - TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000356891 p.K301Vfs*7 ATP2B1 chr12 89609941 89609941 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000428670 p.A813G ANKS1B chr12 99053291 99053291 Missense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000547776 p.D882N MYBPC1 chr12 101667800 101667800 Missense_Mutation A A G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000550270 p.T802A TCTN1 chr12 110649317 110649317 3'UTR C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000551590 NULL ACAD10 chr12 111705927 111705927 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000313698 p.D176H COX6A1 chr12 120438100 120438100 5'UTR C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000229379 NULL EP400 chr12 131982458 131982458 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000389562 p.Q637E TPTE2 chr13 19465520 19465520 Missense_Mutation C C A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000400230 p.R186I DCLK1 chr13 35836134 35836134 Silent C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000360631 p.S376S ELF1 chr13 40941204 40941204 Nonsense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000239882 p.Q325* FBXL3 chr13 77005445 77005445 3'UTR T T G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000355619 NULL MYCBP2 chr13 77097629 77097629 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000357337 p.I3137M GPR180 chr13 94619495 94619495 Silent A A C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000376958 p.P238P ABCC4 chr13 95206581 95206581 Nonsense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000376887 p.S371* TMTC4 chr13 100614421 100614421 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000376234 p.L597V EFNB2 chr13 106534903 106534903 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000245323 p.R21T SUPT16H chr14 21384165 21384165 5'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000216297 NULL TRAV8-4 chr14 21894901 21894901 Nonsense_Mutation C C A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000390438 p.S71* RPL10L chr14 46651455 46651455 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000298283 p.F94L TMX1 chr14 51254610 51254610 3'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000457354 NULL KCNH5 chr14 62949984 62949984 Intron T T G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000322893 NULL ATP6V1D chr14 67338191 67338191 3'UTR G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000216442 NULL NRXN3 chr14 79863003 79863003 3'Flank G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000557594 NULL KCNK13 chr14 90184414 90184414 Nonsense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000282146 p.S213* DDX24 chr14 94079487 94079487 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000621632 p.E86Q BCL11B chr14 99169828 99169828 3'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000357195 NULL PPP2R5C chr14 101925955 101925955 3'UTR G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000334743 NULL INF2 chr14 104706096 104706096 Missense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000392634 p.D255N JAG2 chr14 105151378 105151378 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000331782 p.S391W NPAP1 chr15 24676518 24676518 Silent A A T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000329468 p.S217S MEIS2 chr15 36891506 36891506 3'UTR C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000561208 NULL C15orf54 chr15 39253102 39253102 RNA G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000625107 NULL RPUSD2 chr15 40571852 40571852 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000315616 p.K285N DLL4 chr15 40938891 40938891 3'UTR C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000249749 NULL MYO5C chr15 52235719 52235719 Silent C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000261839 p.Q971Q RFX7 chr15 56102174 56102174 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000559447 p.D103H HCN4 chr15 73322628 73322628 Missense_Mutation C C A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000261917 p.K1155N RPP25 chr15 74957211 74957211 5'UTR C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000322177 NULL HMG20A chr15 77485442 77485442 3'UTR G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000336216 NULL CHRNA5 chr15 78580817 78580817 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000299565 p.S38C AKAP13 chr15 85575260 85575260 Silent A A G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000394518 p.E264E DNM1P47 chr15 101757364 101757364 RNA C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000561463 NULL WDR90 chr16 667619 667619 3'UTR C C A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000293879 NULL TBC1D24 chr16 2502627 2502627 3'UTR C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000293970 NULL PPL chr16 4899115 4899115 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000345988 p.F258L PKD1P6 chr16 15131700 15131700 5'Flank G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000605794 NULL SMG1 chr16 18926090 18926090 5'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000446231 NULL C16orf62 chr16 19616722 19616722 Nonsense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000417362 p.Q380* SPN chr16 29668845 29668845 3'UTR A A - TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000360121 NULL SEZ6L2 chr16 29888592 29888592 Silent G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000308713 p.I329I SEPT1 chr16 30381418 30381418 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000321367 p.E168Q STX1B chr16 30993416 30993416 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000215095 p.I202M ZNF267 chr16 31914811 31914811 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000300870 p.H188D RP11-1166P10.6 chr16 32052230 32052230 Intron C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000566806 NULL PHKB chr16 47649111 47649111 Missense_Mutation T T G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000323584 p.I568M MMP2 chr16 55493220 55493220 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000219070 p.E467Q DPEP3 chr16 67975754 67975754 3'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000268793 NULL FAM92B chr16 85107911 85107911 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000539556 p.E121Q SGSM2 chr17 2375561 2375561 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000426855 p.E679Q MNT chr17 2386994 2386994 Silent C C A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000174618 p.V552V OR3A3 chr17 3421527 3421527 Silent G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000291231 p.L320L ASPA chr17 3481706 3481706 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000263080 p.D114H PFN1 chr17 4945677 4945678 3'UTR - - A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000225655 NULL DNAH2 chr17 7770821 7770821 Missense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000389173 p.R1417H SREBF1 chr17 17818326 17818326 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000261646 p.L373V MYO1D chr17 32654603 32654603 Silent G G T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000318217 p.L788L TAF15 chr17 35844849 35844849 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000605844 p.G517A SRCIN1 chr17 38563468 38563468 Missense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000617146 p.E199K KRTAP9-9 chr17 41255982 41255982 3'UTR G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000394008 NULL SLC25A39 chr17 44320105 44320105 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000377095 p.R326G CRHR1 chr17 45830497 45830497 Nonsense_Mutation C C A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000398285 p.Y241* CRHR1 chr17 45835057 45835057 3'UTR C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000398285 NULL SP6 chr17 47845596 47845596 3'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000342234 NULL VEZF1 chr17 57971646 57971646 3'Flank G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000581208 NULL SMG8 chr17 59211134 59211134 Silent G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000300917 p.V361V VMP1 chr17 59841287 59841287 3'Flank G G T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000262291 NULL APPBP2 chr17 60494528 60494528 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000083182 p.S106C DDX5 chr17 64500311 64500311 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000225792 p.R486T BPTF chr17 67984345 67984345 3'UTR C C A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000321892 NULL CDC42EP4 chr17 73286066 73286066 Silent C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000335793 p.K145K KIAA0195 chr17 75498321 75498321 Splice_Region C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000314256 p.P1212P CHMP6 chr17 80995747 80995747 Missense_Mutation A A G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000325167 p.K113E ACTG1 chr17 81510201 81510201 3'UTR C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000331925 NULL COLEC12 chr18 346689 346689 Silent C C A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000400256 p.L311L RALBP1 chr18 9537336 9537336 3'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000019317 NULL ANKRD29 chr18 23638887 23638887 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000592179 p.L98V ZNF521 chr18 25227552 25227552 Missense_Mutation G G T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000361524 p.F122L DSG4 chr18 31413248 31413248 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000308128 p.D926H MC4R chr18 60371711 60371711 Silent G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000299766 p.V213V CDH7 chr18 65763004 65763004 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000323011 p.F54L CYB5A chr18 74253479 74253479 3'UTR C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000340533 NULL CYB5A chr18 74253585 74253585 Nonstop_Mutation C C A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000340533 p.*135Lext*73 SBNO2 chr19 1107646 1107646 3'UTR A A T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000361757 NULL MYO1F chr19 8536350 8536350 Missense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000338257 p.E649K EPOR chr19 11378259 11378259 Missense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000222139 p.G418R HOOK2 chr19 12771306 12771306 Nonsense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000397668 p.S205* CTB-55O6.8 chr19 14073072 14073072 Silent C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000269720 p.L63L OR7C2 chr19 14941766 14941766 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000248072 p.T93S BRD4 chr19 15256163 15256163 Missense_Mutation T T C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000263377 p.H551R CTC-448F2.3 chr19 29923740 29923740 3'Flank C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000585753 NULL ZNF829 chr19 36891832 36891832 Missense_Mutation C C A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000391711 p.G320V ZNF568 chr19 36973559 36973559 5'UTR C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000586353 NULL ZNF420 chr19 37128979 37128979 Missense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000337995 p.R663K LYPD4 chr19 41838979 41838979 Missense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000609812 p.R38K ZNF233 chr19 44259994 44259994 5'UTR G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000391958 NULL LILRB4 chr19 54664247 54664247 Silent C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000391736 p.S139S ZNF773 chr19 57507266 57507266 Missense_Mutation G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000282292 p.E391K ZNF446 chr19 58480124 58480124 Intron G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000594369 NULL TBC1D20 chr20 437768 437768 3'UTR T T C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000354200 NULL TMC2 chr20 2617179 2617179 Missense_Mutation A A G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000358864 p.E683G ITPA chr20 3209456 3209456 5'UTR G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000380113 NULL JAG1 chr20 10638632 10638632 3'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000254958 NULL CRNKL1 chr20 20043542 20043542 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000377340 p.E469Q TPX2 chr20 31770367 31770367 Silent G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000300403 p.Q127Q NOL4L chr20 32527799 32527799 Missense_Mutation T T C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000621426 p.K146E DSN1 chr20 36771312 36771312 Intron C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000373750 NULL RPN2 chr20 37241347 37241347 3'UTR G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000237530 NULL RBPJL chr20 45314056 45314056 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000343694 p.G260A CSE1L chr20 49088067 49088067 Silent C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000262982 p.L594L SUMO1P1 chr20 53875302 53875302 RNA C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000497904 NULL RAB22A chr20 58366910 58366910 3'UTR G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000244040 NULL SLCO4A1 chr20 62668955 62668955 Silent C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000217159 p.F634F DNAJC28 chr21 33488457 33488457 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000314399 p.D313H SLC5A3 chr21 34095990 34095990 Missense_Mutation C C A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000381151 p.F264L TPTEP1 chr22 16638619 16638619 RNA G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000426585 NULL GAB4 chr22 17008097 17008097 Silent G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000400588 p.P6P POM121L7 chr22 21126811 21126811 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000329949 p.P276A MN1 chr22 27797055 27797055 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000302326 p.Q1163H SF3A1 chr22 30334606 30334606 Silent C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000215793 p.G790G RNF185 chr22 31206339 31206339 3'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000326132 NULL POLDIP3 chr22 42596249 42596249 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000252115 p.L250F SHROOM2 chrX 9946683 9946683 Missense_Mutation G C C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000380913 p.E1533Q RBBP7 chrX 16870401 16870401 5'UTR C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000380087 NULL NHS chrX 17727731 17727731 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000380060 p.E1188Q ZFX chrX 24213664 24213664 3'Flank G G T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000304543 NULL SUPT20HL1 chrX 24363449 24363449 RNA T T G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000436466 NULL MAOB chrX 43802243 43802243 Nonsense_Mutation C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000378069 p.W135* PIM2 chrX 48913437 48913437 3'UTR C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000376509 NULL VSIG4 chrX 66021870 66021870 3'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000374737 NULL EDA chrX 70039320 70039320 3'UTR G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000374552 NULL NAP1L6 chrX 73127676 73127676 Silent C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000373518 p.L69L TSIX chrX 73829074 73829074 RNA C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000604411 NULL UPRT chrX 75303584 75303584 3'UTR C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000373383 NULL CYLC1 chrX 83873283 83873283 Nonsense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000329312 p.S192* CYLC1 chrX 83874453 83874453 Nonsense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000329312 p.S582* KLHL4 chrX 87625713 87625713 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000373119 p.S414C SYTL4 chrX 100685892 100685892 Intron A A G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000263033 NULL ACSL4 chrX 109668194 109668194 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000340800 p.Q449E ZCCHC16 chrX 112456369 112456369 3'UTR T T C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000340433 NULL HTR2C chrX 114651557 114651557 Intron T T C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000276198 NULL GRIA3 chrX 123480138 123480138 Intron C C T TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000541091 NULL FMR1 chrX 147950302 147950302 3'UTR G G A TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000370475 NULL FATE1 chrX 151716196 151716196 Missense_Mutation G G C TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000370350 p.G26A MECP2 chrX 154030411 154030411 Missense_Mutation C C G TCGA-Z6-AAPN-01A-11D-A403-09 ENST00000303391 p.E473Q ATAD3A chr1 1523966 1523966 Splice_Site T T G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000378755 p.X411_splice UBR4 chr1 19179108 19179108 Missense_Mutation T T C TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000375254 p.H766R ADGRL2 chr1 81950373 81950373 Missense_Mutation T T G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000370717 p.I461M CDC7 chr1 91501752 91501752 Silent A A G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000234626 p.P12P INTS3 chr1 153751212 153751212 Missense_Mutation C C A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000318967 p.D234E PAQR6 chr1 156243887 156243888 3'UTR CT CT - TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000292291 NULL ASTN1 chr1 176934282 176934282 Silent C C T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000361833 p.A847A ASTN1 chr1 176949246 176949246 Missense_Mutation G G T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000361833 p.L665I ADORA1 chr1 203165790 203165790 Missense_Mutation C C T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000309502 p.R291C OBSCN chr1 228288316 228288316 Missense_Mutation C C T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000422127 p.T3356I NID1 chr1 235981656 235981656 Missense_Mutation G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000264187 p.T1061I FAM179A chr2 28999197 28999197 Missense_Mutation G G T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000379558 p.E52D SMEK2 chr2 55548959 55548959 3'UTR T T G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000616407 NULL TET3 chr2 74100454 74100454 Silent G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000409262 p.P1222P EVA1A chr2 75493331 75493331 Missense_Mutation G G T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000233712 p.Q122K RGPD4 chr2 107870738 107870738 Nonsense_Mutation G G T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000408999 p.E912* RGPD4 chr2 107871772 107871772 Missense_Mutation A A C TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000408999 p.E1256D FAM138B chr2 113577628 113577628 RNA G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000432583 NULL LRP1B chr2 140232547 140232547 3'UTR A A C TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000389484 NULL ZEB2 chr2 144388369 144388369 3'UTR G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000409487 NULL SCN7A chr2 166477606 166477606 Nonsense_Mutation C C A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000409855 p.E31* LRP2 chr2 169238162 169238162 Missense_Mutation G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000263816 p.R1479C DNAH7 chr2 195900285 195900285 Silent C C A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000312428 p.L1515L MARS2 chr2 197707181 197707181 Silent G G T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000282276 p.R592R CFLAR chr2 201138277 201138277 Intron C C A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000309955 NULL ATG9A chr2 219223971 219223971 Silent G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000361242 p.R439R SLC4A3 chr2 219636789 219636789 Missense_Mutation G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000317151 p.R817H FARP2 chr2 241373291 241373291 Splice_Site G G T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000264042 p.X61_splice KAT2B chr3 20111629 20111629 Silent C C T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000263754 p.C295C WNT5A chr3 55468651 55468652 3'UTR TA TA - TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000264634 NULL ERC2 chr3 56296112 56296112 Silent C C T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000288221 p.E327E CNTN3 chr3 74362004 74362004 Missense_Mutation T T G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000263665 p.K417T VGLL3 chr3 86940833 86940833 3'UTR A A C TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000398399 NULL OR5K4 chr3 98354042 98354042 Silent G G T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000354924 p.L63L OSBPL11 chr3 125567493 125567493 Missense_Mutation G G C TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000296220 p.L257V TSC22D2 chr3 150458883 150458883 3'UTR A A G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000361875 NULL P2RY1 chr3 152837896 152837896 3'UTR C C T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000305097 NULL KLHL6 chr3 183555435 183555435 Missense_Mutation A A T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000341319 p.D73E WFS1 chr4 6291349 6291349 Missense_Mutation G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000226760 p.G205S BOD1L1 chr4 13604865 13604865 Nonsense_Mutation G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000040738 p.Q679* EPHA5 chr4 65414423 65414423 Silent C C T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000273854 p.T516T AFP chr4 73455689 73455689 3'UTR C C T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000395792 NULL TRAM1L1 chr4 117084272 117084272 3'UTR C C A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000310754 NULL GPM6A chr4 175634301 175634301 3'UTR T T - TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000280187 NULL CDH9 chr5 26988233 26988233 Missense_Mutation C C A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000231021 p.S34I FCHO2 chr5 73081953 73081953 Silent G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000430046 p.T717T PRR16 chr5 120686503 120686503 Missense_Mutation C C A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000407149 p.P237T NME5 chr5 138118850 138118850 Missense_Mutation C C T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000265191 p.E175K PCDHB8 chr5 141178937 141178937 Missense_Mutation A A C TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000239444 p.E301D PCDHGA3 chr5 141345803 141345803 Silent G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000253812 p.K590K FAT2 chr5 151521309 151521309 Missense_Mutation G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000261800 p.R3762W CREBRF chr5 173136228 173136228 3'UTR A A - TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000296953 NULL RREB1 chr6 7230047 7230047 Nonsense_Mutation C C T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000349384 p.Q650* XXbac-BPG170G13.32 chr6 29748934 29748934 3'Flank G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000606834 NULL SLC35B2 chr6 44256824 44256824 Missense_Mutation C C G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000393812 p.E22D PKHD1 chr6 51659770 51659770 Silent A A C TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000371117 p.T3452T Unknown chr6 60499441 60499441 IGR A A C TCGA-2H-A9GM-01A-11D-A37C-09 NULL FAXC chr6 99281317 99281317 Silent C C A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000389677 p.L359L WASF1 chr6 110108649 110108649 Missense_Mutation A A C TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000359451 p.F101V PDE10A chr6 165413544 165413544 Missense_Mutation T T A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000366882 p.K402I ABCA13 chr7 48219463 48219463 Missense_Mutation A A G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000435803 p.K133E RP13-580B18.4 chr7 56810860 56810860 RNA G G T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000624628 NULL SEMA3D chr7 84999399 84999399 3'UTR T T G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000284136 NULL GRM3 chr7 86786865 86786865 Missense_Mutation A A T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000361669 p.K358M MDFIC chr7 114979580 114979580 Missense_Mutation A A G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000393486 p.N98D STRIP2 chr7 129485789 129485789 Missense_Mutation C C T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000249344 p.S822L PTN chr7 137227665 137227666 3'UTR AA AA - TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000348225 NULL C7orf55-LUC7L2 chr7 139375945 139375945 Intron G G C TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000354926 NULL DEFB105A chr8 7823399 7823400 Frame_Shift_Ins - - A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000334773 p.S32Ffs*8 ZFHX4 chr8 76705830 76705830 Missense_Mutation A A G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000521891 p.D581G SLC7A13 chr8 86229836 86229836 Missense_Mutation G G T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000297524 p.L148M DCAF4L2 chr8 87873974 87873974 5'UTR C C T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000319675 NULL OTUD6B chr8 91078412 91078412 Silent T T C TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000404789 p.I124I SPATA31A7 chr9 61192503 61192503 Missense_Mutation T T G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000619167 p.H139Q CDK2AP2P2 chr9 62844985 62844985 RNA C C A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000478512 NULL SPATA31A3 chr9 66990117 66990117 Silent G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000428649 p.G127G SPATA31D1 chr9 81993668 81993668 Silent A G G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000344803 p.R1066R DAPK1 chr9 87706266 87706266 Silent C C T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000358077 p.T1065T TGFBR1 chr9 99150727 99150727 3'UTR T T G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000374994 NULL SH2D3C chr9 127747177 127747177 Missense_Mutation C C T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000314830 p.E412K UBAC1 chr9 135938263 135938263 Missense_Mutation G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000371756 p.P354L GATA3 chr10 8074309 8074309 3'UTR T T G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000346208 NULL C1QL3 chr10 16520540 16520540 Missense_Mutation G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000298943 p.H176Y NEBL chr10 20782993 20782993 3'UTR G G C TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000377122 NULL NDST2 chr10 73807640 73807640 Missense_Mutation G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000299641 p.P250L PYROXD2 chr10 98400128 98400128 Missense_Mutation C C T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000370575 p.A149T RBM20 chr10 110812382 110812382 Missense_Mutation C C T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000369519 p.P662L GFRA1 chr10 116093720 116093720 Missense_Mutation T T C TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000355422 p.K333E CFAP46 chr10 132924852 132924852 Missense_Mutation G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000368586 p.A367V MUC6 chr11 1017612 1017612 Missense_Mutation G G C TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000421673 p.T1730S MUC5B chr11 1235205 1235205 Silent C C T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000529681 p.C917C OR52A1 chr11 5151959 5151959 Silent G G T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000328942 p.I137I MPPED2 chr11 30410701 30410701 3'UTR A A - TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000358117 NULL OR5M9 chr11 56462722 56462722 Missense_Mutation C C T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000279791 p.R227H FAT3 chr11 92798022 92798022 Missense_Mutation A A C TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000525166 p.K1520T FAT3 chr11 92801709 92801709 Missense_Mutation G G T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000525166 p.G2749V SLC37A2 chr11 125076811 125076811 Missense_Mutation G G T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000403796 p.M38I ATN1 chr12 6936697 6936697 Missense_Mutation C C T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000356654 p.S477L SLCO1C1 chr12 20721975 20721975 Missense_Mutation A A G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000266509 p.K316R OR8S1 chr12 48526441 48526441 Missense_Mutation G G C TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000310194 p.L270F TNS2 chr12 53058496 53058496 Intron G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000314250 NULL IL22 chr12 68248717 68248717 3'UTR A A - TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000328087 NULL TMEM132C chr12 128697302 128697302 Missense_Mutation T T G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000435159 p.L670V LATS2 chr13 20983707 20983707 Missense_Mutation T T C TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000382592 p.M667V CCDC169 chr13 36231158 36231158 3'Flank A A C TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000239859 NULL SPG20 chr13 36335086 36335086 Nonsense_Mutation G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000355182 p.R249* VWA8 chr13 41689409 41689409 Missense_Mutation A A T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000379310 p.I1359N HTR2A chr13 46835629 46835629 Missense_Mutation C C A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000378688 p.M208I UTP14C chr13 52032686 52032686 3'UTR A A G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000521776 NULL PCDH20 chr13 61412325 61412325 Missense_Mutation T T C TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000409186 p.T592A ZIC5 chr13 99963665 99963666 3'UTR - - T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000267294 NULL TRAV23DV6 chr14 22086767 22086767 Missense_Mutation C T T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000390451 p.A57V GNPNAT1 chr14 52778086 52778086 3'UTR T T C TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000216410 NULL ACOT2 chr14 73569185 73569185 5'UTR G G T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000238651 NULL TDP1 chr14 89963261 89963261 Silent C C T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000335725 p.S49S HERC2P3 chr15 20439605 20439605 RNA G G T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000426501 NULL NPAP1 chr15 24680784 24680784 3'UTR A A G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000329468 NULL AC124312.1 chr15 25087893 25087893 3'Flank T T A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000623624 NULL GABRB3 chr15 26547950 26547950 Missense_Mutation G G T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000311550 p.P422Q TLN2 chr15 62796283 62796283 Missense_Mutation G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000306829 p.A2014T AKAP13 chr15 85579165 85579165 Missense_Mutation A A G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000394518 p.D366G DNM1P47 chr15 101754130 101754130 RNA G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000561463 NULL SSTR5 chr16 1079612 1079612 Silent C C T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000293897 p.R248R CDH11 chr16 64948708 64948708 Intron A A C TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000268603 NULL CMTM4 chr16 66621995 66621995 Intron G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000330687 NULL TP53 chr17 7675083 7675084 In_Frame_Ins - - GCA TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000269305 p.C176dup GUCY2D chr17 8004142 8004142 Missense_Mutation C T T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000254854 p.L338F SP2 chr17 47928203 47928203 3'UTR C C T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000376741 NULL ACSF2 chr17 50463232 50463232 Missense_Mutation G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000300441 p.R290H EPB41L3 chr18 5433927 5433927 Missense_Mutation A A G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000341928 p.V267A CDH2 chr18 27988628 27988628 Frame_Shift_Del A A - TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000269141 p.I546Kfs*4 CDH2 chr18 27988634 27988634 Missense_Mutation A A T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000269141 p.L544Q NOL4 chr18 33852425 33852425 3'UTR T T - TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000261592 NULL PIK3C3 chr18 41990461 41990461 Missense_Mutation T G G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000262039 p.S207R RNF165 chr18 46460374 46460375 3'UTR - - A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000269439 NULL C3 chr19 6694461 6694461 Missense_Mutation G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000245907 p.R1042W ELAVL1 chr19 7959111 7959112 3'Flank - - T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000351593 NULL MUC16 chr19 8956286 8956286 Silent A A G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000397910 p.P6828P LLNLR-249E10.1 chr19 15772046 15772046 3'Flank G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000595525 NULL TPM4 chr19 16101533 16101534 3'UTR - - T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000300933 NULL ZNF43 chr19 21809706 21809706 Missense_Mutation T T G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000354959 p.N111H ZNF681 chr19 23745191 23745191 Missense_Mutation C C A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000402377 p.C120F ZNF790 chr19 36823360 36823360 Nonsense_Mutation C C A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000356725 p.E52* PRX chr19 40398470 40398470 Intron C C A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000324001 NULL ZNF223 chr19 44066411 44066411 Missense_Mutation C C A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000434772 p.Q195K LILRA1 chr19 54595402 54595402 Missense_Mutation G G T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000251372 p.G221C LILRB1 chr19 54636000 54636000 Intron C C T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000324602 NULL ZNF784 chr19 55620971 55620971 3'UTR G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000325351 NULL PEG3 chr19 56814259 56814259 Missense_Mutation C C A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000326441 p.A1395S MANBAL chr20 37301240 37301240 5'UTR G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000373605 NULL BMP7 chr20 57228419 57228419 Missense_Mutation C C G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000395863 p.E141Q COL20A1 chr20 63312540 63312540 Missense_Mutation G G T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000358894 p.V642L DYRK1A chr21 37514838 37514838 3'Flank T T - TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000398960 NULL CHEK2 chr22 28724569 28724570 Intron - - T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000328354 NULL CSNK1E chr22 38290801 38290802 3'UTR - - T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000359867 NULL PPEF1 chrX 18749817 18749817 Silent C C T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000361511 p.S87S EIF1AX chrX 20141648 20141648 5'UTR G G A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000379607 NULL DMD chrX 32454822 32454822 Missense_Mutation C T T TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000357033 p.R1148K CFAP47 chrX 36104573 36104573 Silent A A G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000378653 p.K1649K SHROOM4 chrX 50634488 50634488 Missense_Mutation C C A TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000289292 p.A529S ZCCHC5 chrX 78657213 78657213 Missense_Mutation T T G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000321110 p.K403T TBC1D8B chrX 106802848 106802848 5'UTR T T G TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000357242 NULL GABRE chrX 151959660 151959660 Intron A A C TCGA-2H-A9GM-01A-11D-A37C-09 ENST00000370328 NULL NOL9 chr1 6550438 6550438 Missense_Mutation T T C TCGA-IG-A3YC-01A-11D-A247-09 ENST00000377705 p.K192E HSPB7 chr1 16015707 16015707 Missense_Mutation G G A TCGA-IG-A3YC-01A-11D-A247-09 ENST00000311890 p.P129L UHMK1 chr1 162522916 162522916 3'UTR G G C TCGA-IG-A3YC-01A-11D-A247-09 ENST00000489294 NULL MGST3 chr1 165651042 165651042 Missense_Mutation A A T TCGA-IG-A3YC-01A-11D-A247-09 ENST00000367884 p.E49V CFHR3 chr1 196789736 196789736 Intron G G C TCGA-IG-A3YC-01A-11D-A247-09 ENST00000367425 NULL PTPN14 chr1 214383787 214383788 Frame_Shift_Ins - - A TCGA-IG-A3YC-01A-11D-A247-09 ENST00000366956 p.P690Sfs*11 CHRM3 chr1 239909104 239909104 Silent C C T TCGA-IG-A3YC-01A-11D-A247-09 ENST00000255380 p.F551F CEP170 chr1 243200654 243200654 Silent C C T TCGA-IG-A3YC-01A-11D-A247-09 ENST00000366542 p.Q120Q HNRNPU chr1 244862499 244862501 In_Frame_Del TCT TCT - TCGA-IG-A3YC-01A-11D-A247-09 ENST00000283179 p.E279del OR2M2 chr1 248180863 248180863 Missense_Mutation G G A TCGA-IG-A3YC-01A-11D-A247-09 ENST00000359682 p.R293H MSH6 chr2 47783138 47783138 5'UTR T T A TCGA-IG-A3YC-01A-11D-A247-09 ENST00000234420 NULL ANKRD36 chr2 97167583 97167583 Missense_Mutation C C G TCGA-IG-A3YC-01A-11D-A247-09 ENST00000420699 p.S513C OSBPL6 chr2 178382427 178382427 Missense_Mutation A A T TCGA-IG-A3YC-01A-11D-A247-09 ENST00000190611 p.D514V DYTN chr2 206651718 206651718 3'UTR T T C TCGA-IG-A3YC-01A-11D-A247-09 ENST00000452335 NULL PHC3 chr3 170171300 170171300 Intron T T C TCGA-IG-A3YC-01A-11D-A247-09 ENST00000494943 NULL NKD2 chr5 1034836 1034836 Silent C C T TCGA-IG-A3YC-01A-11D-A247-09 ENST00000296849 p.L169L SLC6A3 chr5 1443137 1443137 Missense_Mutation G G A TCGA-IG-A3YC-01A-11D-A247-09 ENST00000270349 p.P21S ADCY2 chr5 7827161 7827161 3'UTR C C A TCGA-IG-A3YC-01A-11D-A247-09 ENST00000338316 NULL IL7R chr5 35876471 35876471 Missense_Mutation C C G TCGA-IG-A3YC-01A-11D-A247-09 ENST00000303115 p.F455L PTGER4 chr5 40681842 40681842 Missense_Mutation C C G TCGA-IG-A3YC-01A-11D-A247-09 ENST00000302472 p.I283M AP3B1 chr5 78216123 78216123 Missense_Mutation C C G TCGA-IG-A3YC-01A-11D-A247-09 ENST00000255194 p.G240R JADE2 chr5 134579915 134579915 3'UTR G G A TCGA-IG-A3YC-01A-11D-A247-09 ENST00000395003 NULL TRIM27 chr6 28907238 28907238 Missense_Mutation G G A TCGA-IG-A3YC-01A-11D-A247-09 ENST00000377199 p.S315L HLA-J chr6 30006992 30006992 RNA T T A TCGA-IG-A3YC-01A-11D-A247-09 ENST00000462773 NULL EYS chr6 64436210 64436210 Missense_Mutation C C T TCGA-IG-A3YC-01A-11D-A247-09 ENST00000370616 p.R1964K EYS chr6 65490689 65490689 Missense_Mutation A A T TCGA-IG-A3YC-01A-11D-A247-09 ENST00000370616 p.I256K C6orf118 chr6 165301860 165301860 Missense_Mutation C C G TCGA-IG-A3YC-01A-11D-A247-09 ENST00000230301 p.E154D RNF216P1 chr7 4976428 4976428 RNA G G A TCGA-IG-A3YC-01A-11D-A247-09 ENST00000404006 NULL FAM183B chr7 38685545 38685545 3'UTR G G A TCGA-IG-A3YC-01A-11D-A247-09 ENST00000409072 NULL ERV3-1 chr7 64992098 64992098 Missense_Mutation T T A TCGA-IG-A3YC-01A-11D-A247-09 ENST00000394323 p.E310V CACNA2D1 chr7 82335153 82335153 Silent G G A TCGA-IG-A3YC-01A-11D-A247-09 ENST00000356253 p.N92N SAMD9L chr7 93135969 93135969 Translation_Start_Site C C G TCGA-IG-A3YC-01A-11D-A247-09 ENST00000318238 p.M1? TFPI2 chr7 93890645 93890645 Missense_Mutation G G T TCGA-IG-A3YC-01A-11D-A247-09 ENST00000222543 p.L12M ZFPM2 chr8 105419254 105419254 Missense_Mutation G G C TCGA-IG-A3YC-01A-11D-A247-09 ENST00000407775 p.G51R TRPS1 chr8 115412180 115412180 3'Flank A A - TCGA-IG-A3YC-01A-11D-A247-09 ENST00000220888 NULL ARL5B chr10 18675387 18675387 3'UTR T T - TCGA-IG-A3YC-01A-11D-A247-09 ENST00000377275 NULL ARMC3 chr10 23003286 23003286 Missense_Mutation C C T TCGA-IG-A3YC-01A-11D-A247-09 ENST00000298032 p.R535W ZNF488 chr10 47368393 47368393 Missense_Mutation T T C TCGA-IG-A3YC-01A-11D-A247-09 ENST00000585316 p.K146R LRRC56 chr11 550123 550123 Missense_Mutation C C A TCGA-IG-A3YC-01A-11D-A247-09 ENST00000270115 p.L159M PC chr11 66848602 66848602 3'UTR A A T TCGA-IG-A3YC-01A-11D-A247-09 ENST00000393955 NULL GRAMD1B chr11 123609828 123609828 Missense_Mutation A A T TCGA-IG-A3YC-01A-11D-A247-09 ENST00000529750 p.N421I OR8G5 chr11 124265207 124265209 In_Frame_Del CTC CTC - TCGA-IG-A3YC-01A-11D-A247-09 ENST00000524943 p.S128del GDF3 chr12 7690049 7690049 Silent G G A TCGA-IG-A3YC-01A-11D-A247-09 ENST00000329913 p.S308S SOX5 chr12 23846070 23846070 Missense_Mutation G G A TCGA-IG-A3YC-01A-11D-A247-09 ENST00000451604 p.P132S PCBP2 chr12 53454836 53454836 Silent C C A TCGA-IG-A3YC-01A-11D-A247-09 ENST00000439930 p.V12V KIAA1033 chr12 105168474 105168474 3'UTR A A G TCGA-IG-A3YC-01A-11D-A247-09 ENST00000332180 NULL ACACB chr12 109265175 109265175 Missense_Mutation G G C TCGA-IG-A3YC-01A-11D-A247-09 ENST00000338432 p.E2336D ALDH2 chr12 111803973 111803974 Splice_Site TG TG - TCGA-IG-A3YC-01A-11D-A247-09 ENST00000261733 p.X507_splice HEATR5A chr14 31304915 31304915 Missense_Mutation G G C TCGA-IG-A3YC-01A-11D-A247-09 ENST00000543095 p.C1743W MPP5 chr14 67332850 67332850 Missense_Mutation C C T TCGA-IG-A3YC-01A-11D-A247-09 ENST00000261681 p.T641M NRXN3 chr14 79863149 79863149 3'Flank C C T TCGA-IG-A3YC-01A-11D-A247-09 ENST00000557594 NULL FMN1 chr15 32774342 32774342 Missense_Mutation G G A TCGA-IG-A3YC-01A-11D-A247-09 ENST00000559047 p.R1410C THSD4 chr15 71748580 71748580 Frame_Shift_Del G G - TCGA-IG-A3YC-01A-11D-A247-09 ENST00000355327 p.E801Sfs*22 RPUSD1 chr16 786115 786115 Silent G G A TCGA-IG-A3YC-01A-11D-A247-09 ENST00000007264 p.P258P TP53 chr17 7675175 7675175 Nonsense_Mutation C C T TCGA-IG-A3YC-01A-11D-A247-09 ENST00000269305 p.W146* GUCY2D chr17 8016232 8016232 Missense_Mutation C C A TCGA-IG-A3YC-01A-11D-A247-09 ENST00000254854 p.L1056I CLTC chr17 59620036 59620036 5'UTR C C T TCGA-IG-A3YC-01A-11D-A247-09 ENST00000269122 NULL CHST9 chr18 26915882 26915882 3'UTR C C G TCGA-IG-A3YC-01A-11D-A247-09 ENST00000581714 NULL B4GALT6 chr18 31631015 31631015 Nonsense_Mutation G G T TCGA-IG-A3YC-01A-11D-A247-09 ENST00000306851 p.Y240* COL5A3 chr19 9972940 9972940 Silent C C T TCGA-IG-A3YC-01A-11D-A247-09 ENST00000264828 p.E1251E SCN1B chr19 35033969 35033969 Intron C C T TCGA-IG-A3YC-01A-11D-A247-09 ENST00000262631 NULL FAM83E chr19 48609988 48609988 Missense_Mutation G G A TCGA-IG-A3YC-01A-11D-A247-09 ENST00000263266 p.R216C ZNF432 chr19 52046895 52046895 5'UTR C C T TCGA-IG-A3YC-01A-11D-A247-09 ENST00000221315 NULL ZNF671 chr19 57720924 57720924 Missense_Mutation G G T TCGA-IG-A3YC-01A-11D-A247-09 ENST00000317398 p.Q388K AC016629.3 chr19 58599081 58599081 Intron A A G TCGA-IG-A3YC-01A-11D-A247-09 ENST00000596427 NULL SEL1L2 chr20 13870189 13870189 Silent G G A TCGA-IG-A3YC-01A-11D-A247-09 ENST00000284951 p.G373G SEL1L2 chr20 13870193 13870194 Frame_Shift_Ins - - T TCGA-IG-A3YC-01A-11D-A247-09 ENST00000284951 p.I372Nfs*25 ZHX3 chr20 41202666 41202666 Missense_Mutation G G T TCGA-IG-A3YC-01A-11D-A247-09 ENST00000309060 p.P751T HEG1 chr3 125010546 125010546 Missense_Mutation C C G TCGA-KH-A6WC-01A-11D-A33E-09 ENST00000311127 p.C989S MARCH3 chr5 126870476 126870476 3'UTR C C T TCGA-KH-A6WC-01A-11D-A33E-09 ENST00000308660 NULL F13A1 chr6 6174609 6174609 Missense_Mutation G G A TCGA-KH-A6WC-01A-11D-A33E-09 ENST00000264870 p.T573M C6orf48 chr6 31834951 31834951 5'Flank A A C TCGA-KH-A6WC-01A-11D-A33E-09 ENST00000375633 NULL TMEM63B chr6 44154939 44154939 3'UTR G G C TCGA-KH-A6WC-01A-11D-A33E-09 ENST00000259746 NULL NOTCH1 chr9 136503180 136503180 Splice_Site A A G TCGA-KH-A6WC-01A-11D-A33E-09 ENST00000277541 p.X1723_splice MUC2 chr11 1097284 1097284 RNA A A C TCGA-KH-A6WC-01A-11D-A33E-09 ENST00000361558 NULL KMT2D chr12 49033481 49033481 Nonsense_Mutation G G A TCGA-KH-A6WC-01A-11D-A33E-09 ENST00000301067 p.Q3742* DNM1P47 chr15 101752950 101752952 RNA CTC CTC - TCGA-KH-A6WC-01A-11D-A33E-09 ENST00000561463 NULL MED13 chr17 61943847 61943847 3'UTR A A - TCGA-KH-A6WC-01A-11D-A33E-09 ENST00000397786 NULL DLG3 chrX 70503144 70503144 3'UTR C C T TCGA-KH-A6WC-01A-11D-A33E-09 ENST00000374360 NULL GPRASP1 chrX 102658408 102658408 3'UTR T T A TCGA-KH-A6WC-01A-11D-A33E-09 ENST00000361600 NULL PLEKHG5 chr1 6467883 6467883 Missense_Mutation G G C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000400915 p.L1041V PRAMEF11 chr1 12825275 12825275 Silent T T C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000619922 p.Q368Q PRAMEF17 chr1 13389635 13389635 5'UTR T T C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000376098 NULL WDTC1 chr1 27306631 27306631 3'UTR C C - TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000319394 NULL SYTL1 chr1 27351160 27351160 Intron C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000543823 NULL GRIK3 chr1 36891029 36891029 Silent T T G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000373091 p.R61R MAGOH chr1 53227005 53227005 3'UTR C C A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000371470 NULL PTGFR chr1 78539569 78539569 3'UTR T T G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000370757 NULL DENND4B chr1 153944143 153944143 Missense_Mutation C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000361217 p.E78K MSTO1 chr1 155614515 155614515 3'UTR G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000245564 NULL SPTA1 chr1 158661409 158661409 Missense_Mutation C C G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000368147 p.G822A SPTA1 chr1 158676195 158676195 Missense_Mutation T T C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000368147 p.E353G KCNT2 chr1 196280873 196280873 Missense_Mutation A A C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000294725 p.L966R PCNXL2 chr1 233139764 233139764 Silent G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000258229 p.A1203A OR14K1 chr1 247739108 247739108 Missense_Mutation A A C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000283225 p.N165T PXDN chr2 1654481 1654481 Missense_Mutation G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000252804 p.P622L KCNF1 chr2 10913042 10913042 Missense_Mutation G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000295082 p.E206K ITSN2 chr2 24220963 24220963 Missense_Mutation G G T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000355123 p.D1227E ANKRD36C chr2 95912255 95912255 Missense_Mutation G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000456556 p.T881I LIMS1 chr2 108655006 108655006 Intron G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000332345 NULL SH3RF3 chr2 109449452 109449452 Missense_Mutation A A C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000309415 p.N704T THSD7B chr2 137676882 137676882 3'UTR A A G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000272643 NULL LRP1B chr2 140850221 140850221 Missense_Mutation T T A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000389484 p.D1607V MBD5 chr2 148483826 148483826 Intron G G T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000407073 NULL BAZ2B chr2 159433294 159433294 Missense_Mutation T T G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000392783 p.I455L TTN chr2 178604880 178604880 Missense_Mutation C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000591111 p.R16429K FSIP2 chr2 185808665 185808665 Silent A A G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000424728 p.K6453K DNAH7 chr2 195858496 195858496 Missense_Mutation G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000312428 p.A2682V ABCA12 chr2 214983680 214983680 Nonsense_Mutation C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000272895 p.W1450* ARPC4 chr3 9806786 9806786 3'UTR A A G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000397261 NULL FANCD2 chr3 10067306 10067306 Missense_Mutation A A C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000383807 p.K828T ATG7 chr3 11554859 11554859 3'UTR G G C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000354449 NULL KIF9 chr3 47243075 47243075 Missense_Mutation G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000265529 p.P562L COL7A1 chr3 48586213 48586213 Missense_Mutation G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000328333 p.A1195V IL17RD chr3 57091281 57091281 3'UTR C C G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000296318 NULL OR5H15 chr3 98169138 98169138 Missense_Mutation T T G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000356526 p.L147V PARP14 chr3 122730584 122730585 3'UTR AG AG - TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000474629 NULL PLSCR5 chr3 146591832 146591832 Missense_Mutation T T G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000443512 p.K168T MBNL1 chr3 152415043 152415043 Missense_Mutation A A C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000282486 p.M93L SI chr3 165041073 165041074 Frame_Shift_Ins - - A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000264382 p.G676Wfs*8 ZBBX chr3 167305943 167305943 Silent A A G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000392766 p.T475T NCEH1 chr3 172711063 172711063 Silent C C A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000538775 p.G6G MUC4 chr3 195781299 195781299 Silent G G T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000463781 p.V3427V CPEB2 chr4 15068148 15068148 3'Flank T T G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000507071 NULL SLIT2 chr4 20542627 20542627 Splice_Site G G T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000504154 p.X759_splice EPHA5 chr4 65324036 65324036 3'UTR T T A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000273854 NULL EPHA5 chr4 65602157 65602157 Missense_Mutation A A C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000273854 p.F132V NPFFR2 chr4 72128844 72128844 Missense_Mutation T T G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000308744 p.L187V TET2 chr4 105236023 105236023 Missense_Mutation T T G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000380013 p.L694R PCDH18 chr4 137530328 137530328 Missense_Mutation T T G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000344876 p.E587D ADAMTS16 chr5 5242068 5242068 Silent A A C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000274181 p.R847R DNAH5 chr5 13776510 13776510 Missense_Mutation T T C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000265104 p.K3101R NPR3 chr5 32789459 32789459 3'UTR T T C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000265074 NULL MROH2B chr5 41042181 41042181 Missense_Mutation T T G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000399564 p.T622P VCAN chr5 83512333 83512333 Missense_Mutation C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000265077 p.R327C COX7C chr5 86618097 86618097 Silent C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000247655 p.V14V FBN2 chr5 128278698 128278698 Missense_Mutation G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000262464 p.P2428S PCDHA8 chr5 140841586 140841586 Missense_Mutation C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000531613 p.R89W PCDHA12 chr5 140875760 140875760 Silent C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000398631 p.C96C PCDHB16 chr5 141182994 141182994 Silent C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000609684 p.N145N FGF1 chr5 142595426 142595426 Missense_Mutation G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000337706 p.T111I MFAP3 chr5 154054972 154054972 3'UTR G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000322602 NULL GABRA1 chr5 161898369 161898369 3'Flank T T G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000023897 NULL FLT4 chr5 180631729 180631729 Silent C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000261937 p.E36E F13A1 chr6 6320657 6320657 5'UTR G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000264870 NULL HIST1H1D chr6 26234533 26234533 Missense_Mutation C C G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000244534 p.G134A BTN3A1 chr6 26413469 26413469 Missense_Mutation A A C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000289361 p.K440T DAAM2 chr6 39878488 39878488 Missense_Mutation C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000274867 p.T482M MEA1 chr6 43012993 43012993 Silent C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000244711 p.E113E RUNX2 chr6 45547903 45547903 3'UTR T T G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000371438 NULL EYS chr6 65384420 65384420 Missense_Mutation T T G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000370616 p.E422A RIMS1 chr6 72399006 72399006 Missense_Mutation A A G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000521978 p.K1591R SYNE1 chr6 152381322 152381322 Missense_Mutation C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000367255 p.S2898N SYNJ2 chr6 158017250 158017250 Silent G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000355585 p.T58T RBAK chr7 5064108 5064108 Missense_Mutation G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000353796 p.A218T PPP1R17 chr7 31692497 31692497 Missense_Mutation A A T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000342032 p.K19M SFRP4 chr7 37916430 37916430 Silent G G T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000436072 p.P36P ZNF716 chr7 57469679 57469679 Missense_Mutation A A C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000420713 p.K406N YWHAG chr7 76327224 76327224 3'UTR A A - TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000307630 NULL ZNF804B chr7 89333773 89333773 Missense_Mutation A T T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000333190 p.K264M CDK14 chr7 91207844 91207844 3'UTR A A C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000380050 NULL RP11-1220K2.2 chr7 142183281 142183281 Missense_Mutation G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000477922 p.G1278S TRBC2 chr7 142715692 142715692 Intron G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000610566 NULL ZNF425 chr7 149104600 149104600 Missense_Mutation C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000378061 p.R424H ZNF212 chr7 149253767 149253767 Missense_Mutation C C A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000335870 p.S280R MCPH1 chr8 6499900 6499900 Missense_Mutation G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000344683 p.E729K WHSC1L1 chr8 38278365 38278365 Nonsense_Mutation T T A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000317025 p.R1270* KAT6A chr8 41930847 41930847 3'UTR G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000265713 NULL PRKDC chr8 47839171 47839172 Frame_Shift_Ins - - A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000314191 p.L2510Ffs*4 PXDNL chr8 51408174 51408174 Missense_Mutation G G C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000356297 p.I1150M XKR4 chr8 55449840 55449840 Intron T T C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000327381 NULL SULF1 chr8 69604864 69604864 Missense_Mutation A A G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000260128 p.K437E PRDM14 chr8 70068523 70068523 Missense_Mutation G G T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000276594 p.S237Y PRDM14 chr8 70069561 70069561 Silent C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000276594 p.P100P TG chr8 132919501 132919501 Missense_Mutation G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000220616 p.A1502T TG chr8 133017924 133017924 Frame_Shift_Del C C - TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000220616 p.L2238Wfs*12 ADAMTSL1 chr9 18777701 18777701 Nonsense_Mutation C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000380548 p.R1158* SMC5 chr9 70348038 70348038 Splice_Region G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000361138 p.E963E GDA chr9 72227958 72227958 Missense_Mutation G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000358399 p.G280S TGFBR1 chr9 99146594 99146594 Missense_Mutation C C G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000374994 p.R414G TLR4 chr9 117714392 117714392 Missense_Mutation A A C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000355622 p.Q755P OR1L3 chr9 122675382 122675382 Missense_Mutation T T G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000304820 p.F85V GOLGA2 chr9 128268161 128268161 Splice_Site C C G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000421699 p.X105_splice ADAMTS13 chr9 133433651 133433651 Missense_Mutation G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000371929 p.G419R OLFM1 chr9 135120119 135120119 Missense_Mutation G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000371793 p.G467S RABL6 chr9 136837321 136837321 Intron T T G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000311502 NULL CELF2 chr10 11330428 11330428 3'UTR T T G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000416382 NULL FAM107B chr10 14530366 14530366 Missense_Mutation C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000378458 p.D32N CUBN chr10 16938996 16938996 Missense_Mutation T T G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000377833 p.E1900D MRC1 chr10 17910658 17910658 3'UTR A A C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000569591 NULL APBB1IP chr10 26536082 26536082 Missense_Mutation C C A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000376236 p.F303L ZFAND4 chr10 45618206 45618206 Missense_Mutation T T G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000344646 p.K661T ASAH2 chr10 50233225 50233225 Silent C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000395526 p.L284L SLC16A9 chr10 59684297 59684297 5'UTR G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000395347 NULL ZNF365 chr10 62643853 62643853 Intron C C G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000410046 NULL C10orf12 chr10 96981537 96981537 Missense_Mutation C C G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000286067 p.N49K SYT9 chr11 7313860 7313860 Silent A A G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000318881 p.Q321Q MRGPRX3 chr11 18137412 18137412 Silent G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000396275 p.A70A RAG1 chr11 36577578 36577578 3'UTR T T G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000299440 NULL MYBPC3 chr11 47343086 47343086 Missense_Mutation G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000545968 p.A429V KDM2A chr11 67256351 67256352 3'UTR - - A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000529006 NULL CNTN5 chr11 99845177 99845177 Missense_Mutation A A C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000524871 p.E164D SORL1 chr11 121605558 121605558 Silent G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000260197 p.R1645R OR10G8 chr11 124029836 124029836 Missense_Mutation T T C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000431524 p.S72P ARHGAP32 chr11 128974236 128974236 Missense_Mutation T T G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000310343 p.E973D TAS2R10 chr12 10825435 10825435 Silent G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000240619 p.L279L MUC19 chr12 40528264 40528264 RNA T T G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000454784 NULL MUC19 chr12 40531255 40531255 RNA A A G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000454784 NULL MUC19 chr12 40547145 40547145 RNA T T C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000454784 NULL PDZRN4 chr12 41574383 41574383 3'Flank T T G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000402685 NULL AMIGO2 chr12 47077496 47077496 Missense_Mutation T T C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000266581 p.K503E KRT6B chr12 52451876 52451876 Missense_Mutation T T C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000252252 p.K68R CSAD chr12 53173440 53173440 Missense_Mutation C C A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000444623 p.A11S SYT1 chr12 79217656 79217656 Missense_Mutation A A C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000261205 p.K46T OTOGL chr12 80336122 80336122 Missense_Mutation C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000547103 p.P1507S PPFIA2 chr12 81277319 81277319 Missense_Mutation T T C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000549396 p.K1103R DUSP6 chr12 89348216 89348217 3'UTR CA CA - TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000279488 NULL PLBD2 chr12 113369179 113369179 Silent C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000280800 p.A118A TMEM132B chr12 125654110 125654110 Silent G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000299308 p.P879P ADGRD1 chr12 131004225 131004225 Missense_Mutation C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000261654 p.S395F TSC22D1 chr13 44575516 44575516 Missense_Mutation C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000458659 p.G187R ARL11 chr13 49633395 49633395 3'UTR A A G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000282026 NULL PCDH9 chr13 67228333 67228333 Missense_Mutation T T G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000377865 p.E36D MIR622 chr13 90231187 90231187 RNA A A C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000385123 NULL ING1 chr13 110719678 110719678 Nonsense_Mutation C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000375774 p.R339* C14orf37 chr14 58116334 58116334 Intron C C A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000267485 NULL ZFP36L1 chr14 68787931 68787931 3'Flank T T - TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000336440 NULL FLRT2 chr14 85625879 85625879 3'UTR T T C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000330753 NULL IGHM chr14 105854675 105854675 Missense_Mutation G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000610838 p.R490W SNORD116-8 chr15 25070473 25070473 RNA G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000384365 NULL SNORD115-43 chr15 25250770 25250770 3'Flank A A G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000365503 NULL RYR3 chr15 33635703 33635703 Missense_Mutation T T C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000389232 p.F1089L GOLGA6L17P chr15 82523985 82523985 RNA T T C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000614358 NULL GOLGA6L17P chr15 82524495 82524495 RNA A A T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000614358 NULL TICRR chr15 89582686 89582686 Missense_Mutation T T G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000268138 p.L219V OR4F15 chr15 101819047 101819047 Nonsense_Mutation C C G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000332238 p.Y287* ZNF598 chr16 2002578 2002578 Missense_Mutation C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000563630 p.R152H UMOD chr16 20349094 20349094 Nonsense_Mutation G G T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000302509 p.C69* RP11-249C24.12 chr16 56677741 56677741 3'UTR G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000379816 NULL USP6 chr17 5173351 5173351 3'UTR A A C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000250066 NULL TP53 chr17 7676032 7676032 Missense_Mutation A A C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000269305 p.F113V DNAH2 chr17 7818035 7818035 Silent C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000389173 p.N3442N GLP2R chr17 9842524 9842524 Missense_Mutation T T G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000262441 p.L138V MAP2K4 chr17 12141592 12141592 3'UTR A A T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000353533 NULL NCOR1 chr17 16040446 16040446 Missense_Mutation G G T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000268712 p.T2243K USP32P3 chr17 20427037 20427037 RNA A A C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000413270 NULL KRTAP4-7 chr17 41084463 41084463 Missense_Mutation G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000391417 p.R86H HDAC5 chr17 44086649 44086649 Missense_Mutation C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000586802 p.R658H PRCD chr17 76544640 76544641 3'Flank TC TC - TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000586148 NULL BAIAP2 chr17 81103594 81103594 Silent G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000321300 p.Q245Q CDH2 chr18 27951802 27951802 3'UTR T T C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000269141 NULL C18orf63 chr18 74353355 74353355 Missense_Mutation C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000579455 p.S363L AP3D1 chr19 2111748 2111748 Silent C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000345016 p.Q894Q LDLR chr19 11120374 11120374 Silent G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000558518 p.V664V KLHL26 chr19 18669146 18669146 Silent G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000300976 p.T583T ZNF493 chr19 21423578 21423578 Missense_Mutation A A C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000355504 p.T179P ZNF99 chr19 22769977 22769977 Intron A A G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000596209 NULL ZNF345 chr19 36878156 36878156 Silent T T G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000420450 p.T442T RASGRP4 chr19 38411161 38411161 Silent G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000587738 p.P602P CYP2G1P chr19 40893916 40893916 RNA G G T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000252909 NULL GYS1 chr19 48987260 48987260 Silent C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000323798 p.P142P NLRP13 chr19 55913128 55913128 Missense_Mutation G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000342929 p.T230M ZNF583 chr19 56423746 56423746 Missense_Mutation A A G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000291598 p.H363R ZFP28 chr19 56555053 56555053 Silent T T G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000301318 p.P756P CFAP61 chr20 20098771 20098771 Silent C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000245957 p.D272D ITCH chr20 34412563 34412563 Missense_Mutation G G C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000262650 p.Q87H C20orf173 chr20 35528882 35528882 Missense_Mutation G G C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000246199 p.Q50E CHD6 chr20 41404806 41404806 Silent C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000373233 p.S2645S KRTAP26-1 chr21 30319877 30319877 Silent T T C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000360542 p.T53T TMPRSS6 chr22 37084371 37084371 Missense_Mutation A A C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000346753 p.F383V SLC25A6 chrX 1389263 1389263 Silent G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000381401 p.F192F KLHL15 chrX 23987993 23987993 Missense_Mutation C C G TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000328046 p.K581N MAGEB3 chrX 30236251 30236251 Silent C C T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000361644 p.D109D CXorf67 chrX 51407185 51407185 Missense_Mutation G A A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000342995 p.G57S KIAA2022 chrX 74738858 74738859 3'UTR AC AC - TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000055682 NULL RPS6KA6 chrX 84107674 84107674 Missense_Mutation G G A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000262752 p.P354S COL4A6 chrX 108169989 108169989 Missense_Mutation C C A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000372216 p.G1175V HTR2C chrX 114652654 114652654 Intron C C A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000276198 NULL NKRF chrX 119590483 119590483 Silent T T C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000304449 p.P314P HTATSF1 chrX 136509169 136509171 In_Frame_Del CTT CTT - TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000218364 p.L306del SOX3 chrX 140504836 140504836 Silent T T A TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000370536 p.A75A SLITRK4 chrX 143628223 143628223 3'UTR A A C TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000338017 NULL SPANXN2 chrX 143720714 143720714 5'UTR G G T TCGA-2H-A9GO-01A-11D-A37C-09 ENST00000598475 NULL PRAMEF6 chr1 12939008 12939008 Silent T T C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000376189 p.Q366Q STPG1 chr1 24360956 24360956 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000337248 p.V275M CSMD2 chr1 33571535 33571535 Nonsense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000241312 p.R2654* COL9A2 chr1 40311131 40311131 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000372748 p.R198C RP11-342M1.7 chr1 42888009 42888009 RNA G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000448759 NULL MIER1 chr1 66958917 66958917 Nonsense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000355356 p.Q137* PTGER3 chr1 71012138 71012138 Intron G G T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000306666 NULL NEGR1 chr1 71404165 71404165 3'UTR T T - TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000357731 NULL FAM102B chr1 108606228 108606228 Frame_Shift_Del A A - TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000370035 p.G90Vfs*13 IVL chr1 152910315 152910315 Missense_Mutation T T C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000368764 p.L173P ADAMTS4 chr1 161190808 161190808 3'UTR T T C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000367996 NULL RXRG chr1 165417189 165417189 Silent G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000359842 p.G158G NPHS2 chr1 179557227 179557227 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000367615 p.V180M CEP350 chr1 179996981 179996981 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000367607 p.R275Q ZNF648 chr1 182057484 182057484 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000339948 p.A176V BRINP3 chr1 190281701 190281701 Missense_Mutation A A G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000367462 p.F96L PTPRC chr1 198755997 198755997 Missense_Mutation T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000442510 p.I1246S PTPN14 chr1 214384328 214384328 Missense_Mutation T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000366956 p.K509N MARK1 chr1 220652136 220652136 Silent A A G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000366917 p.E574E MARK1 chr1 220661994 220661994 Missense_Mutation T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000366917 p.L739W RYR2 chr1 237784842 237784842 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000366574 p.S4377L OR6F1 chr1 247712722 247712722 Missense_Mutation A C C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000302084 p.F12V OR2W3 chr1 247896115 247896115 Missense_Mutation T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000360358 p.F177V OR2M3 chr1 248203514 248203514 Missense_Mutation G G T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000456743 p.W149C OR2T10 chr1 248593168 248593168 Silent A A G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000330500 p.L201L OR2T10 chr1 248593633 248593633 Missense_Mutation T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000330500 p.I46L MYT1L chr2 1887499 1887500 Frame_Shift_Ins - - T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000399161 p.D878Gfs*34 APOB chr2 21010349 21010349 Missense_Mutation T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000233242 p.Q2173H NRXN1 chr2 50623562 50623562 Silent A A G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000406316 p.L296L CCDC85A chr2 56385053 56385053 3'UTR T T - TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000407595 NULL CYP26B1 chr2 72129439 72129439 3'UTR G G T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000001146 NULL IGKV3D-11 chr2 90173370 90173370 Missense_Mutation A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000390277 p.E101D DPP10 chr2 115689894 115689894 Silent G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000410059 p.A183A MARCO chr2 118970256 118970256 Missense_Mutation A A T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000327097 p.Q114H SCN1A chr2 165992356 165992356 Missense_Mutation A A G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000303395 p.L1640P SCN1A chr2 166041233 166041233 Missense_Mutation A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000303395 p.L805V SCN9A chr2 166278225 166278225 Missense_Mutation A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000303354 p.F811C SCN7A chr2 166477585 166477585 Missense_Mutation A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000409855 p.L38V ZNF804A chr2 184939198 184939198 3'UTR A A G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000302277 NULL DNAH7 chr2 195969979 195969979 Missense_Mutation A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000312428 p.L725R PLCL1 chr2 198103865 198103865 Missense_Mutation A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000428675 p.K1012Q SATB2 chr2 199269694 199269695 3'UTR - - CA TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000260926 NULL ALS2CR11 chr2 201619135 201619135 5'UTR C C G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000286195 NULL PLEKHM3 chr2 208001507 208001507 Missense_Mutation G G T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000427836 p.L45M SPAG16 chr2 214149233 214149233 Missense_Mutation A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000331683 p.S563R ABCA12 chr2 215001631 215001631 Silent A A G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000272895 p.I930I ABCA12 chr2 215025776 215025776 Frame_Shift_Del T T - TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000272895 p.N395Ifs*2 MARCH4 chr2 216283691 216283691 Silent G G C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000273067 p.V185V CCDC108 chr2 219024223 219024223 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000341552 p.R796H DOCK10 chr2 224800178 224800178 Silent C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000258390 p.L1493L PSMD1 chr2 231153628 231153628 Missense_Mutation A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000308696 p.K727T GRM7 chr3 7146486 7146486 Missense_Mutation A A G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000357716 p.E185G NR2C2 chr3 15023235 15023235 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000393102 p.R198W TRANK1 chr3 36856367 36856367 Missense_Mutation A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000429976 p.L1075V CACNA1D chr3 53775916 53775916 Missense_Mutation C C G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000350061 p.I1411M LRIG1 chr3 66410183 66410183 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000273261 p.S294F FAM19A4 chr3 68732505 68732505 3'UTR T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000295569 NULL CNTN3 chr3 74297964 74297964 Silent T T C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000263665 p.A798A PROS1 chr3 93898552 93898552 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000394236 p.E249K ARL13B chr3 93980304 93980304 5'UTR T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000394222 NULL CCDC54 chr3 107377919 107377919 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000261058 p.R111K KIAA2018 chr3 113659785 113659785 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000316407 p.L633F GOLGB1 chr3 121664973 121664973 Nonsense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000340645 p.Q3200* CLSTN2 chr3 140564009 140564009 Missense_Mutation T T C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000458420 p.L844P IGSF10 chr3 151458542 151458542 Silent C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000282466 p.P56P VEPH1 chr3 157470445 157470445 Missense_Mutation T T A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000362010 p.I75F CHRD chr3 184388633 184388633 Silent T T C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000204604 p.D867D RTP1 chr3 187200160 187200160 3'UTR T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000312295 NULL LINC00969 chr3 195683826 195683826 RNA G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000445430 NULL LDB2 chr4 16898477 16898477 Missense_Mutation G G T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000304523 p.S3R TBC1D19 chr4 26672187 26672187 Missense_Mutation G G T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000264866 p.V235F ARAP2 chr4 36128578 36128580 In_Frame_Del CAT CAT - TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000303965 p.D1198del EPHA5 chr4 65336032 65336032 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000273854 p.E918K SEC24B chr4 109512019 109512019 Frame_Shift_Del C C - TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000265175 p.F615Lfs*18 KIAA1109 chr4 122343419 122343419 Missense_Mutation G G T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000264501 p.G4121V FAT4 chr4 125415020 125415020 Silent A A G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000394329 p.Q2019Q HSPA4L chr4 127805168 127805168 Missense_Mutation G G C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000296464 p.D361H DCHS2 chr4 154490089 154490089 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000339452 p.V423I NPY2R chr4 155216817 155216817 3'UTR C C A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000329476 NULL WDR17 chr4 176125264 176125264 Silent T T C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000280190 p.S257S WDR17 chr4 176131695 176131695 Missense_Mutation T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000280190 p.L376R ADAMTS16 chr5 5239847 5239847 Silent T T C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000274181 p.T815T ADAMTS12 chr5 33614316 33614316 Missense_Mutation G G T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000504830 p.L817I RANBP3L chr5 36271257 36271257 Missense_Mutation A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000296604 p.F49C PLCXD3 chr5 41381853 41381853 Missense_Mutation C C A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000328457 p.S262I NNT chr5 43659209 43659209 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000264663 p.M831I HCN1 chr5 45645358 45645358 Missense_Mutation A A G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000303230 p.F226L FAM174A chr5 100586184 100586184 Silent A A G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000312637 p.*191* ST8SIA4 chr5 100856230 100856230 Frame_Shift_Del A A - TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000231461 p.W224Gfs*20 SNCAIP chr5 122425490 122425490 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000261368 p.R381C ADAMTS19 chr5 129704303 129704303 Missense_Mutation A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000274487 p.K1069T NEUROG1 chr5 135534416 135534416 3'UTR C C G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000314744 NULL ARSI chr5 150297917 150297917 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000328668 p.R336Q GRK6 chr5 177436097 177436097 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000355472 p.R361Q ADAMTS2 chr5 179125065 179125065 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000251582 p.A956T KIAA0319 chr6 24582246 24582246 Splice_Region T T C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000378214 NULL MDC1 chr6 30705893 30705898 In_Frame_Del TCTGAG TCTGAG - TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000376406 p.S1096_E1097del CDSN chr6 31116835 31116835 Silent G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000376288 p.H260H VWA7 chr6 31773407 31773407 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000375688 p.R251Q TNXB chr6 32097181 32097181 Silent G G C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000375244 p.G224G MOCS1 chr6 39912372 39912372 Splice_Region G G T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000340692 p.A291A TFAP2B chr6 50844475 50844475 3'UTR G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000393655 NULL LRRC1 chr6 53795384 53795384 Missense_Mutation T T A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000370888 p.L43Q ZNF451 chr6 57102032 57102032 Intron G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000370706 NULL SLC25A51P1 chr6 65789055 65789055 RNA T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000468432 NULL OGFRL1 chr6 71301713 71301713 Silent T T C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000370435 p.T340T TBX18 chr6 84763454 84763454 Intron G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000369663 NULL FUT9 chr6 96210097 96210097 3'UTR T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000302103 NULL FHL5 chr6 96615731 96615731 Missense_Mutation T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000326771 p.F272V MMS22L chr6 97149871 97149871 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000275053 p.G1211D THEMIS chr6 127813611 127813611 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000368248 p.R344W MYB chr6 135187870 135187870 Missense_Mutation A A G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000367814 p.T60A GRM1 chr6 146029599 146029599 Missense_Mutation T T A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000282753 p.L28M SYNE1 chr6 152231480 152231480 Missense_Mutation T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000367255 p.S6984R C6orf118 chr6 165302269 165302269 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000230301 p.T18M HDAC9 chr7 18767121 18767121 Missense_Mutation A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000432645 p.K724T SNX10 chr7 26361023 26361023 Missense_Mutation T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000338523 p.F25V INHBA chr7 41690408 41690408 Frame_Shift_Del G G - TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000242208 p.L175Sfs*23 CACNA2D1 chr7 81994910 81994910 Silent A A G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000356253 p.S583S PCLO chr7 83135246 83135246 Silent A A G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000333891 p.S768S ABCB4 chr7 87402093 87402093 3'UTR A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000265723 NULL TAS2R16 chr7 122995078 122995078 Missense_Mutation A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000249284 p.V186G KCNH2 chr7 150951119 150951119 Splice_Region G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000262186 p.S649S CSMD1 chr8 3108664 3108664 Missense_Mutation T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000520002 p.Q2232H MSR1 chr8 16168795 16168795 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000262101 p.T98M ZNF703 chr8 37698632 37698632 Nonsense_Mutation T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000331569 p.Y577* EFCAB1 chr8 48731490 48731490 Missense_Mutation T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000262103 p.E24D FAM110B chr8 58148068 58148068 3'UTR G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000361488 NULL CYP7B1 chr8 64615120 64615120 Missense_Mutation T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000310193 p.E321D ZFHX4 chr8 76778323 76778323 Missense_Mutation A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000521891 p.K1070T CNGB3 chr8 86629030 86629030 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000320005 p.A457T CNBD1 chr8 87353670 87353670 Missense_Mutation T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000518476 p.L396R OSGIN2 chr8 89925236 89925236 Missense_Mutation G G T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000297438 p.A408S RIMS2 chr8 104249514 104249514 Missense_Mutation A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000262231 p.K1045T EXT1 chr8 117812952 117812952 Frame_Shift_Del T T - TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000378204 p.S548Afs*73 NDUFB9 chr8 124543205 124543205 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000276689 p.R74C SPATA31A6 chr9 42188768 42188768 Missense_Mutation A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000332857 p.Q1022H TLE4 chr9 79706754 79706754 Missense_Mutation C C A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000376552 p.S264Y TLR4 chr9 117713304 117713304 Silent T T C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000355622 p.S392S PRRC2B chr9 131482708 131482708 Splice_Site A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000357304 p.X1726_splice FAM69B chr9 136721791 136721792 Intron TG TG - TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000371692 NULL ZMYND11 chr10 237626 237626 Silent G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000381591 p.P186P VIM chr10 17237530 17237530 3'UTR T T - TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000224237 NULL KIF5B chr10 32018555 32018555 Missense_Mutation G G T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000302418 p.Q772K MARCH8 chr10 45463309 45463309 Intron G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000319836 NULL ZFAND4 chr10 45648301 45648301 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000344646 p.R188C CISD1 chr10 58269272 58269272 5'UTR C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000333926 NULL BICC1 chr10 58814083 58814083 Intron A A G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000373886 NULL PHYHIPL chr10 59234397 59234397 Missense_Mutation A A G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000373880 p.K67R POLR3A chr10 78002250 78002250 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000372371 p.R769Q TSPAN14 chr10 80519802 80519802 3'Flank T T - TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000372156 NULL PLCE1 chr10 94298620 94298620 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000260766 p.M1803I NOC3L chr10 94356562 94356562 Missense_Mutation G G C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000371361 p.Q180E EIF3A chr10 119070998 119070998 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000369144 p.R210H OR52H1 chr11 5544621 5544621 Silent T T C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000322653 p.G301G SYT9 chr11 7467311 7467311 3'UTR A A G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000318881 NULL TSG101 chr11 18516122 18516122 Missense_Mutation C C G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000251968 p.G57A IGSF22 chr11 18712243 18712243 Intron T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000319338 NULL LRRC4C chr11 40114554 40114554 Missense_Mutation G G C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000278198 p.P580R LRRC4C chr11 40114872 40114872 Missense_Mutation T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000278198 p.N474T OR4C46 chr11 54603909 54603909 Silent A A G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000328188 p.F30F OR4C11 chr11 55604080 55604080 Silent T T C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000302231 p.Q98Q OR5D14 chr11 55795726 55795726 Silent T T C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000335605 p.F57F OR8K1 chr11 56346532 56346532 Missense_Mutation T T C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000279783 p.L165P RIN1 chr11 66334093 66334093 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000311320 p.R473W FCHSD2 chr11 72843419 72843419 Intron A A T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000409418 NULL SLCO2B1 chr11 75165885 75165885 Silent G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000289575 p.A128A KDM4D chr11 94999005 94999005 3'UTR A A G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000335080 NULL GUCY1A2 chr11 106810246 106810246 Frame_Shift_Del T T - TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000526355 p.H480Pfs*23 CWF19L2 chr11 107455732 107455732 Missense_Mutation C C A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000282251 p.K50N ANKK1 chr11 113393531 113393531 Missense_Mutation A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000303941 p.K79T TMPRSS5 chr11 113697398 113697398 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000299882 p.E117K DSCAML1 chr11 117505594 117505594 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000321322 p.S701L HMBS chr11 119090000 119090000 Missense_Mutation C C A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000278715 p.P119T TECTA chr11 121127790 121127790 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000264037 p.V605M OR10G4 chr11 124015941 124015941 Silent T T C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000320891 p.L123L TSPAN9 chr12 3283639 3283639 3'UTR T T C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000011898 NULL KCNA1 chr12 4911892 4911892 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000382545 p.V172I CHD4 chr12 6600557 6600557 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000357008 p.R347Q KLRG1 chr12 8992272 8992272 Missense_Mutation T T C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000266551 p.L50P RP11-22B23.1 chr12 9313205 9313205 RNA G G T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000539757 NULL CLEC12B chr12 10013050 10013050 Intron A A G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000338896 NULL RP11-545J16.1 chr12 21054549 21054549 Intron G G T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000540229 NULL RP11-545J16.1 chr12 21090068 21090068 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000540229 p.D737N KRT84 chr12 52382450 52382450 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000257951 p.T300M TMEM5 chr12 63781138 63781138 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000261234 p.D97N PPFIA2 chr12 81281341 81281341 Missense_Mutation T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000549396 p.E1043A DCN chr12 91158421 91158421 Missense_Mutation T T C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000052754 p.K138R UBE2N chr12 93411149 93411149 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000318066 p.E61K FAM71C chr12 99649288 99649288 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000324341 p.G206R UBE3B chr12 109499671 109499671 Missense_Mutation T T A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000342494 p.L327I MTUS2 chr13 29100836 29100836 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000612955 p.R847H FRY chr13 32296537 32296537 3'UTR T T C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000542859 NULL STARD13 chr13 33103467 33103467 3'UTR G G C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000336934 NULL SPG20 chr13 36335390 36335390 Silent A A G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000355182 p.T147T LHFP chr13 39343455 39343455 3'UTR T T A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000379589 NULL PCDH17 chr13 57634171 57634171 Missense_Mutation T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000377918 p.F542C SLITRK5 chr13 87676428 87676428 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000325089 p.R347Q DNAJC3 chr13 95757740 95757740 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000602402 p.A164T ITGBL1 chr13 101452757 101452757 5'UTR T T C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000376180 NULL CHMP4A chr14 24213509 24213509 5'Flank A A G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000609024 NULL PRKD1 chr14 29576570 29576570 3'UTR A A G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000331968 NULL SLC39A9 chr14 69460039 69460040 3'UTR - - G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000336643 NULL PCNX chr14 71110889 71110889 3'UTR G G T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000304743 NULL PCNX chr14 71110890 71110890 3'UTR A A T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000304743 NULL STON2 chr14 81277027 81277027 Missense_Mutation T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000267540 p.S762R THBS1 chr15 39593423 39593423 Missense_Mutation T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000260356 p.F1008V MAP1A chr15 43523321 43523322 Frame_Shift_Del AG AG - TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000300231 p.E617Gfs*28 NEO1 chr15 73303128 73303128 3'UTR A A T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000261908 NULL ACSBG1 chr15 78182567 78182567 Missense_Mutation C C A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000258873 p.D265Y KIAA1024 chr15 79463223 79463223 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000305428 p.E819K GOLGA6L17P chr15 82523900 82523900 RNA A A G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000614358 NULL BNC1 chr15 83267045 83267046 Frame_Shift_Ins - - G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000345382 p.M76Hfs*17 NTRK3 chr15 87876774 87876774 3'UTR T T - TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000360948 NULL RGMA chr15 93045193 93045193 Silent G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000329082 p.G386G EARS2 chr16 23544555 23544555 Missense_Mutation C C A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000449606 p.E148D KIF22 chr16 29799138 29799138 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000160827 p.R238Q ZNF646 chr16 31083195 31083197 3'UTR CTC CTC - TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000394979 NULL VPS35 chr16 46676647 46676647 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000299138 p.R284W SLC12A4 chr16 67951030 67951030 Missense_Mutation T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000316341 p.D443A ZNF469 chr16 88430076 88430076 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000437464 p.A869V SCARF1 chr17 1645675 1645675 Missense_Mutation G A A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000263071 p.P8L TP53 chr17 7674894 7674894 Nonsense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000269305 p.R213* DNAH2 chr17 7734632 7734632 Missense_Mutation A A T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000389173 p.K301M MYH2 chr17 10527765 10527765 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000245503 p.R1285H MYOCD chr17 12752712 12752712 Missense_Mutation T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000343344 p.F475C SLC5A10 chr17 19019565 19019565 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000395645 p.V462I PLEKHM1 chr17 45468347 45468347 Silent T T C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000430334 p.V390V TBKBP1 chr17 47711349 47711349 3'UTR G G T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000361722 NULL ABCA6 chr17 69100933 69100933 Missense_Mutation T T C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000284425 p.D959G OTOP2 chr17 74930728 74930728 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000331427 p.R365C QRICH2 chr17 76278002 76278002 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000262765 p.P1536S SRSF2 chr17 76734582 76734583 3'UTR AA AA - TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000359995 NULL SLC38A10 chr17 81282260 81282260 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000374759 p.R144W ARHGDIA chr17 81868168 81868168 3'UTR G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000269321 NULL L3MBTL4 chr18 6171917 6171917 Missense_Mutation T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000284898 p.K336T PTPRM chr18 8253279 8253279 Silent T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000332175 p.T860T DSG1 chr18 31355076 31355076 Silent C T T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000257192 p.G960G ELP2 chr18 36170074 36170074 Nonsense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000358232 p.W696* CDH19 chr18 66505291 66505291 Missense_Mutation A C C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000262150 p.L614V DSEL chr18 67510656 67510656 3'UTR T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000310045 NULL NETO1 chr18 72867287 72867287 Missense_Mutation A A T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000327305 p.I2N ABCA7 chr19 1062172 1062172 Splice_Region C T T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000263094 p.S1857S ZNF561 chr19 9610439 9610439 Missense_Mutation G A A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000302851 p.R408C QTRT1 chr19 10701471 10701471 Missense_Mutation C T T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000250237 p.A4V ZNF208 chr19 21973060 21973060 Silent A G G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000397126 p.I658I HPN chr19 35066321 35066321 3'UTR C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000262626 NULL TYROBP chr19 35904443 35904443 3'UTR C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000262629 NULL ZNF585B chr19 37190117 37190117 Missense_Mutation A A T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000532828 p.F36I HNRNPUL1 chr19 41301623 41301623 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000392006 p.E536K ATP5SL chr19 41433370 41433370 Silent G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000221943 p.L166L ZNF112 chr19 44328302 44328302 Nonsense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000337401 p.Q625* SLC6A16 chr19 49290586 49290586 Intron G G T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000335875 NULL ZNF577 chr19 51880374 51880375 Frame_Shift_Ins - - T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000301399 p.N3Kfs*99 LILRA4 chr19 54338212 54338212 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000291759 p.A127T ZNF582 chr19 56393269 56393269 Intron G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000301310 NULL ZNF329 chr19 58129189 58129189 Silent G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000358067 p.P105P ADRA1D chr20 4221912 4221912 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000379453 p.G444S SPTLC3 chr20 13074380 13074380 Missense_Mutation A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000399002 p.N164H SPTLC3 chr20 13117687 13117687 Missense_Mutation A A G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000399002 p.S372G MACROD2 chr20 16041236 16041236 Missense_Mutation A A G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000217246 p.S397G PAX1 chr20 21706874 21706874 Silent G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000398485 p.P241P HCK chr20 32071693 32071693 Missense_Mutation G G T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000534862 p.V32F MMP24 chr20 35276733 35276733 3'UTR C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000246186 NULL KIAA1755 chr20 38241836 38241836 Missense_Mutation A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000279024 p.L99V ZMYND8 chr20 47209860 47209860 3'UTR G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000311275 NULL GNAS chr20 58855144 58855144 Nonsense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000371100 p.Q627* ZNF512B chr20 63967407 63967407 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000217130 p.E80K bP-2189O9.2 chr21 8880133 8880133 RNA A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000624291 NULL AL078471.5 chr21 10491568 10491568 RNA G G T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000612267 NULL LIPI chr21 14163523 14163523 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000344577 p.G322D CHODL chr21 18262806 18262806 Missense_Mutation T C C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000299295 p.L217P ERG chr21 38382211 38382211 3'Flank A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000398919 NULL LZTR1 chr22 20994152 20994152 Missense_Mutation G G T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000215739 p.A500S ZNRF3 chr22 29061896 29061896 3'Flank T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000544604 NULL SLC5A4 chr22 32225769 32225769 Missense_Mutation T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000266086 p.Q445H XRCC6 chr22 41661345 41661345 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000359308 p.A513T DMD chrX 32362892 32362892 Missense_Mutation A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000357033 p.L1741V XAGE2 chrX 52372588 52372588 Missense_Mutation A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000286049 p.T78P FAM155B chrX 69531724 69531724 3'UTR A A G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000252338 NULL EDA chrX 70036258 70036258 3'UTR A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000374552 NULL ZCCHC5 chrX 78657654 78657654 Missense_Mutation A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000321110 p.V256G FAM133A chrX 93710994 93710994 3'UTR T T - TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000322139 NULL GPRASP2 chrX 102716395 102716395 Missense_Mutation G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000332262 p.R509Q NRK chrX 105912748 105912748 Missense_Mutation A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000243300 p.K781T AGTR2 chrX 116172634 116172634 Missense_Mutation A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000371906 p.K118N KLHL13 chrX 117899274 117899274 Silent T T C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000262820 p.G534G DOCK11 chrX 118686025 118686025 3'UTR A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000276202 NULL KIAA1210 chrX 119087302 119087302 Missense_Mutation C C G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000402510 p.V1310L TENM1 chrX 124385931 124385931 Missense_Mutation C C T TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000371130 p.R1934Q SMIM10 chrX 134992014 134992014 3'UTR T T C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000330288 NULL SPANXN1 chrX 145255730 145255730 Silent G G A TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000370493 p.T45T RP11-1007I13.4 chrX 152115686 152115686 RNA T T G TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000509345 NULL MAGEA12 chrX 152736529 152736529 Missense_Mutation A A C TCGA-IG-A4QS-01A-11D-A27G-09 ENST00000357916 p.K123T VPS13D chr1 12318106 12318106 Missense_Mutation C C A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000620676 p.L2395I CLCNKA chr1 16022690 16022690 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000331433 p.P24L NR0B2 chr1 26913808 26913808 Missense_Mutation G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000254227 p.R45W KHDRBS1 chr1 32042758 32042758 3'UTR C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000327300 NULL KHDRBS1 chr1 32042967 32042967 3'UTR C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000327300 NULL SH3D21 chr1 36320118 36320118 Silent C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000505871 p.V374V PTCH2 chr1 44826748 44826748 Missense_Mutation C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000372192 p.E906Q PRPF38A chr1 52405814 52405814 Missense_Mutation G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000257181 p.E89Q ACADM chr1 75762854 75762854 3'UTR A A G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000370841 NULL ST6GALNAC3 chr1 76628712 76628712 Missense_Mutation G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000328299 p.G275E GTF2B chr1 88853029 88853029 3'UTR A A C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000370500 NULL GPR88 chr1 100541550 100541550 3'UTR C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000315033 NULL SNX27 chr1 151698802 151698802 3'UTR C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000458013 NULL UBAP2L chr1 154243265 154243265 Missense_Mutation C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000361546 p.L269V FCRL5 chr1 157542947 157542947 Silent C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000361835 p.L345L GPR52 chr1 174448476 174448476 Nonsense_Mutation C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000367685 p.S122* CRB1 chr1 197435034 197435034 Silent C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000367400 p.N1057N SIPA1L2 chr1 232514693 232514693 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000262861 p.R216Q FMN2 chr1 240207562 240207562 Missense_Mutation G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000319653 p.G917E FMN2 chr1 240474487 240474487 3'UTR G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000319653 NULL RGS7 chr1 240775736 240775736 3'UTR C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000366565 NULL SOX11 chr2 5697252 5697252 3'UTR C A A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000322002 NULL PLB1 chr2 28566833 28566848 Splice_Site CTGGCGAGTGAGTACG CTGGCGAGTGAGTACG - TCGA-VR-AA7B-01A-31D-A403-09 ENST00000327757 p.X440_splice PLB1 chr2 28566850 28566850 Intron G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000327757 NULL TMEM163 chr2 134458157 134458157 Silent C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000281924 p.V228V ABCB11 chr2 168935297 168935297 Silent G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000263817 p.Y981Y pk chr2 173209743 173209743 Missense_Mutation C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000375213 p.F253L HECW2 chr2 196201386 196201386 Missense_Mutation G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000260983 p.A1537V ZDBF2 chr2 206307294 206307294 Silent C C A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000374423 p.I922I ZDBF2 chr2 206310199 206310199 Missense_Mutation C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000374423 p.Q1891E MAP2 chr2 209731099 209731099 3'UTR G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000360351 NULL PID1 chr2 229024760 229024760 3'Flank G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000354069 NULL DLEC1 chr3 38121683 38121683 Missense_Mutation G T T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000308059 p.W1641L FAM208A chr3 56628610 56628610 Missense_Mutation T T C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000493960 p.Y1251C MYH15 chr3 108444700 108444700 Silent C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000273353 p.L885L KIAA2018 chr3 113648633 113648633 3'UTR G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000316407 NULL POGLUT1 chr3 119485363 119485363 Missense_Mutation C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000295588 p.S205C POLQ chr3 121511922 121511922 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000264233 p.E526K PLXND1 chr3 129560424 129560424 Missense_Mutation G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000324093 p.T1680M ATP2C1 chr3 130940647 130940647 Silent A A G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000428331 p.K126K ATP2C1 chr3 131001834 131001834 3'UTR C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000428331 NULL LRRIQ4 chr3 169821964 169821964 Missense_Mutation C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000340806 p.H15D MCF2L2 chr3 183216060 183216060 Nonsense_Mutation G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000328913 p.S802* THPO chr3 184373466 184373466 Silent A A G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000204615 p.S115S MUC4 chr3 195782627 195782627 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000463781 p.A2985T IQCG chr3 197912713 197912713 Missense_Mutation G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000265239 p.H309D BEND4 chr4 42143527 42143527 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000502486 p.E319K SCFD2 chr4 53365785 53365785 Missense_Mutation C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000401642 p.D53H EGF chr4 109994755 109994755 Silent C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000265171 p.L960L FAT4 chr4 125451715 125451715 Missense_Mutation A A G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000394329 p.S3567G RAPGEF2 chr4 159346960 159346960 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000264431 p.S1064L SPOCK3 chr4 166734655 166734655 3'UTR A A C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000357154 NULL AADAT chr4 170061917 170061917 Missense_Mutation G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000337664 p.S404L PPIC chr5 123023773 123023773 3'UTR A A - TCGA-VR-AA7B-01A-31D-A403-09 ENST00000306442 NULL PCDHGA6 chr5 141376018 141376018 Silent C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000517434 p.A645A PCDHGA6 chr5 141376281 141376281 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000517434 p.A733V PCDH1 chr5 141864209 141864209 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000394536 p.E708K FAT2 chr5 151521468 151521468 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000261800 p.E3709K FAT2 chr5 151549501 151549501 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000261800 p.R1528Q FAT2 chr5 151568736 151568736 Nonsense_Mutation G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000261800 p.Q66* FAM114A2 chr5 154002327 154002327 Missense_Mutation G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000351797 p.H394Y LMAN2 chr5 177331912 177331912 3'UTR C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000303127 NULL DSP chr6 7579814 7579815 Frame_Shift_Ins - - AAGT TCGA-VR-AA7B-01A-31D-A403-09 ENST00000379802 p.Y1210* ADGRF5 chr6 46858961 46858961 Frame_Shift_Del T T - TCGA-VR-AA7B-01A-31D-A403-09 ENST00000265417 p.D981Afs*10 MCM3 chr6 52277654 52277672 Frame_Shift_Del GGGGCCAATGACTTGGCCA GGGGCCAATGACTTGGCCA - TCGA-VR-AA7B-01A-31D-A403-09 ENST00000229854 p.L299Qfs*25 COL19A1 chr6 70140973 70140973 Missense_Mutation G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000620364 p.G489E SENP6 chr6 75697476 75697499 In_Frame_Del TATTTTTGAGAAGGATTTTATTTT TATTTTTGAGAAGGATTTTATTTT - TCGA-VR-AA7B-01A-31D-A403-09 ENST00000447266 p.I750_F757del NT5E chr6 85491057 85491057 Intron C C A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000257770 NULL ZNF292 chr6 87256159 87256159 Missense_Mutation C C A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000369577 p.Q844K PNRC1 chr6 89084428 89084428 3'UTR G G T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000336032 NULL ATG5 chr6 106308389 106308389 Missense_Mutation C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000343245 p.E71Q TSPYL4 chr6 116258572 116258572 5'Flank T T A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000420283 NULL SLC18B1 chr6 132770266 132770266 3'UTR C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000275227 NULL BRAT1 chr7 2543355 2543355 Intron C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000340611 NULL DAGLB chr7 6416574 6416574 Intron G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000297056 NULL HOXA7 chr7 27152749 27152749 3'Flank G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000242159 NULL HOXA10 chr7 27170735 27170735 3'UTR G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000283921 NULL CALN1 chr7 71787152 71787152 3'UTR C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000329008 NULL DBF4 chr7 87907690 87907690 Missense_Mutation C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000265728 p.L518V ZNF804B chr7 89218278 89218278 Missense_Mutation G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000333190 p.D78H TES chr7 116258595 116258595 3'UTR G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000358204 NULL POT1 chr7 124841033 124841033 Missense_Mutation G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000357628 p.H437D CUL1 chr7 148800553 148800553 Missense_Mutation G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000325222 p.E768K FASTK chr7 151079862 151079862 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000297532 p.R48Q SLC7A2 chr8 17554980 17554980 Intron C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000494857 NULL PRKDC chr8 47953655 47953655 Nonsense_Mutation G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000314191 p.S229* NCOA2 chr8 70138324 70138324 Missense_Mutation C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000452400 p.E1013Q TMEM70 chr8 73981448 73981448 Missense_Mutation G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000312184 p.D204H PKHD1L1 chr8 109396063 109396063 Missense_Mutation G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000378402 p.R283Q ATAD2 chr8 123356435 123356435 Missense_Mutation C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000287394 p.D534H FAM135B chr8 138132119 138132119 3'UTR C C A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000395297 NULL FAM135B chr8 138132734 138132734 Silent A A C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000395297 p.T1360T FAM135B chr8 138242946 138242946 Nonsense_Mutation G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000395297 p.S222* UBAP2 chr9 33953309 33953309 Silent G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000360802 p.V344V PRUNE2 chr9 76707650 76707650 Missense_Mutation G G T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000376718 p.H1542N CYLC2 chr9 103005571 103005571 Missense_Mutation G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000374798 p.D314H CDC26 chr9 113267367 113267367 Missense_Mutation T T C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000374206 p.S52G ZNF79 chr9 127444677 127444677 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000342483 p.T326I POMT1 chr9 131504216 131504227 Missense_Mutation AAGATGTGGGGA AAGATGTGGGGA - TCGA-VR-AA7B-01A-31D-A403-09 ENST00000372228 NULL ITIH2 chr10 7744278 7744278 Missense_Mutation G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000358415 p.Q802H USP6NL chr10 11463039 11463039 Missense_Mutation G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000609104 p.P630L MLLT10 chr10 21726286 21726286 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000307729 p.H641Y WAC chr10 28532798 28532798 5'Flank C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000354911 NULL TM9SF3 chr10 96521959 96521959 3'UTR C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000371142 NULL WBP1L chr10 102814731 102814731 3'UTR G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000369889 NULL RAB11FIP2 chr10 118005278 118005278 3'UTR G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000355624 NULL BAG3 chr10 119677353 119677353 3'UTR G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000369085 NULL SIGIRR chr11 406070 406070 Intron G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000332725 NULL OR52N1 chr11 5788179 5788179 Missense_Mutation A A G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000317078 p.I213T OR52E6 chr11 5840966 5840966 Missense_Mutation G G T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000329322 p.T311K OR10A2 chr11 6870013 6870013 Nonsense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000307322 p.Q87* USH1C chr11 17544390 17544390 5'UTR G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000318024 NULL ACCS chr11 44067654 44067654 Silent C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000263776 p.F9F OR5D16 chr11 55838887 55838887 Missense_Mutation G G T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000378396 p.G46W OR5B21 chr11 58507748 58507748 Missense_Mutation G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000360374 p.R120C ZFP91 chr11 58617400 58617400 Silent C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000316059 p.L469L GLYAT chr11 58710679 58710679 Silent G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000344743 p.L133L MALAT1 chr11 65498989 65498989 3'Flank T T A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000625158 NULL SUV420H1 chr11 68189954 68189954 Missense_Mutation C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000304363 p.K41N NOX4 chr11 89488924 89488924 Intron A A C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000263317 NULL ZPR1 chr11 116782191 116782191 Missense_Mutation C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000227322 p.E382D GLB1L3 chr11 134283785 134283785 Silent C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000431683 p.S192S IQSEC3 chr12 138469 138469 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000538872 p.A369V TAS2R30 chr12 11134003 11134003 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000539585 p.R81K DERA chr12 15956983 15956983 Missense_Mutation A A T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000428559 p.R27W FGD4 chr12 32619799 32619799 Silent G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000427716 p.E480E KIF21A chr12 39309640 39309640 Missense_Mutation G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000361418 p.S1408C KIF21A chr12 39366354 39366354 Missense_Mutation C C A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000361418 p.G300V LRRK2 chr12 40295488 40295488 Silent G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000298910 p.E980E EIF4B chr12 53040228 53040229 3'UTR - - TA TCGA-VR-AA7B-01A-31D-A403-09 ENST00000262056 NULL METAP2 chr12 95512825 95512825 Missense_Mutation A A G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000323666 p.T365A WSCD2 chr12 108224772 108224772 Missense_Mutation G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000332082 p.R239K NOS1 chr12 117218071 117218071 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000317775 p.E1422K CCDC60 chr12 119516695 119516695 Missense_Mutation G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000327554 p.R319T CAMKK2 chr12 121240524 121240526 3'UTR CTT CTT - TCGA-VR-AA7B-01A-31D-A403-09 ENST00000324774 NULL MPHOSPH9 chr12 123176762 123176762 Silent G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000606320 p.V794V GLT1D1 chr12 128947398 128947398 Silent G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000442111 p.K240K FLT3 chr13 28048288 28048288 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000241453 p.D398N COG6 chr13 39665117 39665117 Missense_Mutation G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000455146 p.D131N ZC3H13 chr13 45963872 45963875 Frame_Shift_Del TTTC TTTC - TCGA-VR-AA7B-01A-31D-A403-09 ENST00000242848 p.E1547Hfs*6 SLAIN1 chr13 77763970 77763970 3'UTR C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000466548 NULL JPH4 chr14 23571852 23571852 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000356300 p.R407Q RP11-407N17.3 chr14 39294004 39294004 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000553728 p.A702V AKAP5 chr14 64468785 64468785 Missense_Mutation A A G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000320636 p.K131E ACOT6 chr14 73616906 73616906 5'UTR C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000381139 NULL SYNDIG1L chr14 74409414 74409414 Missense_Mutation C C A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000331628 p.A111S NRDE2 chr14 90290412 90290412 Missense_Mutation A A T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000354366 p.F680I RPS6KA5 chr14 90871977 90871977 3'UTR G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000614987 NULL SETD3 chr14 99404245 99404245 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000331768 p.R386Q IGHV5-51 chr14 106578879 106578879 Silent A A T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000390626 p.P72P SNORD115-41 chr15 25245542 25245542 RNA A A C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000363608 NULL STARD9 chr15 42693369 42693369 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000290607 p.H3931Y CTDSPL2 chr15 44525985 44525985 3'UTR A A C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000260327 NULL DMXL2 chr15 51565098 51565098 Missense_Mutation C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000251076 p.W118C UNC13C chr15 54015299 54015299 Missense_Mutation C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000260323 p.S799C UNC13C chr15 54250307 54250307 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000260323 p.T1104M UNC13C chr15 54322072 54322072 Missense_Mutation C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000260323 p.R1468G HACD3 chr15 65562877 65562877 Missense_Mutation G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000261875 p.L175F HACD3 chr15 65564214 65564214 Splice_Site G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000261875 p.X178_splice TMED3 chr15 79322065 79322065 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000299705 p.R169W ADAMTSL3 chr15 84039393 84039393 3'UTR G G T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000286744 NULL ASB7 chr15 100630026 100630026 Silent C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000332783 p.F267F HS3ST6 chr16 1911955 1911955 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000454677 p.A239T SLC9A3R2 chr16 2036464 2036464 Silent C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000424542 p.A185A SLC9A3R2 chr16 2038286 2038286 3'UTR G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000424542 NULL SEPT12 chr16 4788398 4788398 5'UTR C C A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000268231 NULL LITAF chr16 11549644 11549644 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000339430 p.R160H DCUN1D3 chr16 20858306 20858306 3'UTR G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000324344 NULL RBBP6 chr16 24569885 24569885 Silent G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000319715 p.E1065E PRSS36 chr16 31140375 31140375 Missense_Mutation G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000268281 p.I736M RBL2 chr16 53465549 53465549 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000262133 p.P604S DDX19A chr16 70370328 70370328 Nonsense_Mutation G G T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000302243 p.E376* HYDIN chr16 70985231 70985231 Missense_Mutation G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000393567 p.S1429C PHLPP2 chr16 71645188 71645188 3'UTR G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000568954 NULL TERF2IP chr16 75656480 75656480 Missense_Mutation G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000300086 p.D357H AFG3L1P chr16 89990988 89990988 RNA C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000437774 NULL TP53 chr17 7673334 7673334 Intron C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000269305 NULL TP53 chr17 7675124 7675124 Missense_Mutation T T C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000269305 p.Y163C MYO15A chr17 18119759 18119759 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000205890 p.S320L ITGA2B chr17 44385039 44385039 Silent C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000262407 p.S236S EFTUD2 chr17 44854303 44854303 Missense_Mutation C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000426333 p.Q771H GALK1 chr17 75763348 75763348 Silent C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000225614 p.T149T MC2R chr18 13884646 13884646 Silent G G T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000327606 p.I291I ANKRD30B chr18 14779986 14779986 Nonsense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000358984 p.R483* GREB1L chr18 21500550 21500550 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000424526 p.T1327M ABHD3 chr18 21704540 21704540 Silent G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000289119 p.V42V SYT4 chr18 43270405 43270405 Nonsense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000255224 p.W405* KATNAL2 chr18 47058327 47058327 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000356157 p.S142L TCF4 chr18 55228987 55228987 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000356073 p.R576Q MC4R chr18 60372578 60372578 5'UTR C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000299766 NULL TXNL4A chr18 79973717 79973717 Missense_Mutation G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000269601 p.P133S MUC16 chr19 8892912 8892912 Missense_Mutation G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000397910 p.T13351M JAK3 chr19 17826800 17826800 Missense_Mutation C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000458235 p.E1106D PDE4C chr19 18211828 18211828 Silent G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000355502 p.R574R ZNF91 chr19 23362108 23362108 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000300619 p.E291K APLP1 chr19 35879367 35879367 Missense_Mutation G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000221891 p.E628K ZNF180 chr19 44476837 44476837 Silent C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000221327 p.P548P CKM chr19 45317886 45317886 Missense_Mutation C C A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000221476 p.R96L ACPT chr19 50791694 50791694 Silent G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000270593 p.E114E NLRP12 chr19 53805396 53805396 Silent G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000324134 p.L766L NLRP7 chr19 54939279 54939279 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000340844 p.D514N ANGPT4 chr20 878271 878271 Silent G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000381922 p.L370L PRNP chr20 4700743 4700743 3'UTR T T - TCGA-VR-AA7B-01A-31D-A403-09 ENST00000379440 NULL NOL4L chr20 32453734 32453734 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000359676 p.D139N PLCG1 chr20 41166518 41166518 Missense_Mutation G G T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000373271 p.M681I CDH26 chr20 59958680 59958680 5'UTR G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000348616 NULL EVA1C chr21 32515236 32515236 3'UTR G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000300255 NULL ZNF280B chr22 22486546 22486546 Intron G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000613655 NULL SGSM1 chr22 24884161 24884161 Missense_Mutation C C A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000400359 p.T590K LRP5L chr22 25354750 25354750 Missense_Mutation G G T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000402785 p.F167L ZNRF3 chr22 29050756 29050756 Nonsense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000544604 p.R859* KREMEN1 chr22 29146166 29146166 3'Flank G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000407188 NULL TCN2 chr22 30623056 30623056 Nonsense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000215838 p.R399* PRR14L chr22 31716613 31716613 Missense_Mutation C C G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000327423 p.R409T RFPL2 chr22 32191283 32191283 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000248983 p.R209Q ELFN2 chr22 37373140 37373140 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000402918 p.A799T VCX3A chrX 6533906 6533906 Missense_Mutation G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000381089 p.L134V MOSPD2 chrX 14902983 14902983 Missense_Mutation G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000380492 p.D186H ACE2 chrX 15600803 15600803 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000252519 p.E37K CXorf23 chrX 19916652 19916652 3'UTR G G C TCGA-VR-AA7B-01A-31D-A403-09 ENST00000379682 NULL MAGEB6 chrX 26194426 26194426 Missense_Mutation G G T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000379034 p.A194S GNL3L chrX 54558512 54558512 Missense_Mutation G G T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000336470 p.R508L TAF1 chrX 71392660 71392660 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000373790 p.T957M XIST chrX 73850909 73850909 RNA G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000429829 NULL ARMCX6 chrX 101616268 101616268 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000361910 p.C118Y PAK3 chrX 111163625 111163625 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000262836 p.P237S KIAA1210 chrX 119087058 119087058 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000402510 p.S1391N DCAF12L2 chrX 126165603 126165603 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000360028 p.A108T DCAF12L1 chrX 126551548 126551548 Missense_Mutation C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000371126 p.R354Q ARHGAP36 chrX 131083801 131083801 Silent G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000276211 p.K129K ARHGEF6 chrX 136665673 136665673 3'UTR A A G TCGA-VR-AA7B-01A-31D-A403-09 ENST00000250617 NULL MAGEA4 chrX 151924723 151924723 3'UTR C C T TCGA-VR-AA7B-01A-31D-A403-09 ENST00000276344 NULL IDH3G chrX 153786873 153786873 Silent G G A TCGA-VR-AA7B-01A-31D-A403-09 ENST00000217901 p.C284C PLCH2 chr1 2497575 2497575 Silent C C T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000378486 p.C730C MACF1 chr1 39387783 39387783 Missense_Mutation C C T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000372915 p.R4986W ZFYVE9 chr1 52332877 52332877 Missense_Mutation A A G TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000287727 p.Y1183C PHTF1 chr1 113710405 113710405 Missense_Mutation C C A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000369604 p.R373L FLG chr1 152304837 152304837 Nonsense_Mutation G G C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000368799 p.S3350* FAM189B chr1 155251536 155251536 Missense_Mutation T T A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000361361 p.Y287F FAM189B chr1 155251537 155251537 Missense_Mutation A A T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000361361 p.Y287N FMO2 chr1 171185752 171185752 Silent T T C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000209929 p.S13S CACNA1E chr1 181755293 181755293 Silent G G A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000367573 p.V1295V LAMC2 chr1 183243774 183243774 3'UTR T T - TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000264144 NULL BRINP3 chr1 190160806 190160806 Missense_Mutation G G A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000367462 p.S349F PTPN14 chr1 214386893 214386893 Silent G G A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000366956 p.P339P PXDN chr2 1632134 1632134 3'UTR C C T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000252804 NULL GRHL1 chr2 9958822 9958822 Frame_Shift_Del G G - TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000324907 p.E82Rfs*18 NLRC4 chr2 32235455 32235455 Missense_Mutation C C G TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000360906 p.V910L VPS54 chr2 63914265 63914265 Missense_Mutation T T A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000272322 p.I751F POLR1A chr2 86099987 86099987 Missense_Mutation T T A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000263857 p.Y88F RMND5A chr2 86773395 86773395 Missense_Mutation A A G TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000283632 p.K387R IL1RL2 chr2 102191991 102191991 Silent T T C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000264257 p.T120T AMER3 chr2 130764560 130764560 Missense_Mutation C C T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000321420 p.P830S RIF1 chr2 151468640 151468640 Splice_Site G G C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000243326 p.X2276_splice TTN chr2 178591419 178591419 Missense_Mutation T T C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000591111 p.I18461M SSFA2 chr2 181930174 181930174 3'UTR T T C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000431877 NULL IRS1 chr2 226735837 226735837 3'UTR G G A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000305123 NULL OXSR1 chr3 38253538 38253538 3'UTR G G A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000311806 NULL ZBTB11 chr3 101671112 101671112 Intron G G C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000312938 NULL STXBP5L chr3 121381439 121381439 Missense_Mutation G G C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000273666 p.G856R MBNL1 chr3 152462874 152462874 3'UTR A G G TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000282486 NULL MUC4 chr3 195783079 195783079 Missense_Mutation G G A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000463781 p.P2834L FYTTD1 chr3 197783416 197783416 3'UTR A A T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000241502 NULL ZNF732 chr4 271922 271922 Missense_Mutation C C A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000419098 p.G312V CTBP1 chr4 1241502 1241502 Intron G G A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000290921 NULL SLC2A9 chr4 9980697 9980697 Silent G G T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000264784 p.I192I WDR19 chr4 39274870 39274870 Missense_Mutation G G A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000399820 p.A1210T NSUN7 chr4 40775017 40775017 Intron A A C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000381782 NULL COX18 chr4 73064801 73064801 Missense_Mutation C C T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000295890 p.V233I CNOT6L chr4 77756870 77756870 Missense_Mutation T T C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000504123 p.N161S UNC5C chr4 95206714 95206714 Missense_Mutation C C T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000453304 p.V606I TBC1D9 chr4 140669637 140669637 Silent T T C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000442267 p.K478K SEMA5A chr5 9063009 9063009 Missense_Mutation T T G TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000382496 p.D799A PRDM9 chr5 23522825 23522825 Silent C C T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000296682 p.G274G PRDM9 chr5 23526936 23526936 Silent C C A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000296682 p.G616G KIF2A chr5 62385907 62385907 3'Flank T T - TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000401507 NULL DMXL1 chr5 119149921 119149921 Missense_Mutation C C G TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000311085 p.S1365C CH17-140K24.8 chr5 141236153 141236153 Intron C C T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000624396 NULL SLC25A2 chr5 141303700 141303700 Missense_Mutation C C A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000239451 p.A56S PCDHGB3 chr5 141372754 141372754 Missense_Mutation G G T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000576222 p.W787L PCDHGB7 chr5 141418051 141418051 Silent C C T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000398594 p.R64R CCDC69 chr5 151184406 151184406 Silent C C T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000355417 p.T217T FAT2 chr5 151543452 151543452 Missense_Mutation C C A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000261800 p.A2559S LSM11 chr5 157751525 157751525 Missense_Mutation A A G TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000286307 p.N195S CPEB4 chr5 173959938 173959939 3'UTR - - T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000265085 NULL FAM153B chr5 176103245 176103245 Frame_Shift_Del T T - TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000253490 p.Q229Rfs*16 TAPBP chr6 33300280 33300280 3'Flank T T A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000426633 NULL MOCS1 chr6 39925765 39925765 Missense_Mutation C C T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000340692 p.A111T COL12A1 chr6 75130869 75130869 Missense_Mutation G G C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000322507 p.P2017R MCHR2 chr6 99943134 99943134 Silent G G A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000281806 p.A134A HDDC2 chr6 125292907 125292907 Missense_Mutation T T A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000398153 p.E104D SGK1 chr6 134170852 134170852 Missense_Mutation T T C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000237305 p.I368V UTRN chr6 144479859 144479859 Silent G G T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000367545 p.A1128A AKAP12 chr6 151356167 151356167 3'UTR G G A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000253332 NULL CCDC129 chr7 31642888 31642888 Missense_Mutation T T A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000407970 p.F506L AEBP1 chr7 44112864 44112864 Missense_Mutation G G C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000223357 p.G842R SNORA15 chr7 65069676 65069676 5'Flank T T C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000384334 NULL POR chr7 75981125 75981125 Silent C C T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000394893 p.L198L NDUFA5 chr7 123556546 123556546 Intron G G C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000355749 NULL ADCK2 chr7 140681066 140681066 Nonsense_Mutation C C T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000072869 p.Q412* NOBOX chr7 144401278 144401278 Frame_Shift_Del C C - TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000467773 p.K205Sfs*63 PAXIP1 chr7 154946457 154946457 Intron G G A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000397192 NULL WDR60 chr7 158871335 158871335 Missense_Mutation G G A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000407559 p.R88K DLC1 chr8 13499055 13499055 Missense_Mutation C C A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000276297 p.K339N PPP3CC chr8 22511175 22511175 Missense_Mutation C C G TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000240139 p.L192V CNGB3 chr8 86739703 86739703 Missense_Mutation T T C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000320005 p.T55A PHF20L1 chr8 132846848 132846848 3'UTR G G A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000395386 NULL C9orf131 chr9 35042301 35042301 Missense_Mutation G G A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000312292 p.G16E SPAG8 chr9 35811392 35811392 Missense_Mutation T T A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000475644 p.R218S SPAG8 chr9 35811393 35811393 Missense_Mutation C C G TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000475644 p.R218T PRUNE2 chr9 76706901 76706901 Missense_Mutation T T G TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000376718 p.E1791D ZNF484 chr9 92848212 92848212 Missense_Mutation T C C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000375495 p.Y192C PTCH1 chr9 95480079 95480080 Frame_Shift_Ins - - A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000331920 p.M319Ifs*118 FAM208B chr10 5712914 5712914 5'UTR A A G TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000328090 NULL TAF3 chr10 7977313 7977313 Missense_Mutation C C A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000344293 p.Q769K FAM25C chr10 47995404 47995404 Missense_Mutation C C T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000617224 p.E82K RGR chr10 84258520 84258520 Missense_Mutation A A G TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000359452 p.I257V NUTM2D chr10 87366794 87366794 Missense_Mutation C C G TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000381697 p.P764R ZNF518A chr10 96161948 96161948 3'UTR A A G TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000316045 NULL MUC5B chr11 1248751 1248751 Silent C C T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000529681 p.T3957T EIF4G2 chr11 10807334 10807334 5'UTR T T C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000526148 NULL KBTBD4 chr11 47572370 47572370 3'UTR A A C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000395288 NULL OR4S2 chr11 55650999 55650999 Missense_Mutation C C G TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000312422 p.F32L PELI3 chr11 66472403 66472403 Missense_Mutation A A C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000320740 p.Y130S CACNA1C chr12 2692759 2692759 3'Flank G G A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000347598 NULL CLEC7A chr12 10118467 10118467 Missense_Mutation A A C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000304084 p.F245L AEBP2 chr12 19473317 19473317 Missense_Mutation A A G TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000398864 p.R317G TM7SF3 chr12 26980604 26980604 Missense_Mutation T T A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000343028 p.Y333F TRIAP1 chr12 120444734 120444734 3'UTR A A C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000546954 NULL PGAM5 chr12 132715018 132715018 Missense_Mutation C C T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000498926 p.R118C AMER2 chr13 25169487 25169487 3'UTR G G T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000515384 NULL ATP8A2 chr13 25372130 25372130 5'UTR C A A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000381655 NULL LINC01551 chr14 28792185 28792185 RNA G G A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000399387 NULL PCNX chr14 70978600 70978600 Missense_Mutation A A C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000304743 p.N755H FLRT2 chr14 85623020 85623020 Silent C C T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000330753 p.R502R AC100757.1 chr15 22427350 22427350 3'Flank T T - TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000408073 NULL HERC2 chr15 28206266 28206266 Missense_Mutation C C T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000261609 p.A2396T PPIP5K1 chr15 43535002 43535002 Missense_Mutation C C A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000396923 p.C1325F WDR72 chr15 53615960 53615960 Missense_Mutation C C G TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000360509 p.S749T PML chr15 73998389 73998389 Missense_Mutation A A T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000268058 p.Q172L ALPK3 chr15 84868438 84868438 Missense_Mutation G G C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000258888 p.K1902N RGMA chr15 93073801 93073801 Intron C C G TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000329082 NULL USP31 chr16 23082526 23082526 Missense_Mutation T T C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000219689 p.H621R UBFD1 chr16 23571034 23571035 3'UTR - - T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000395878 NULL MT1M chr16 56633790 56633790 Missense_Mutation C C T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000379818 p.A45V SLC9A5 chr16 67264460 67264460 Missense_Mutation A A T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000299798 p.T651S RP11-303E16.5 chr16 81053904 81053904 5'Flank G G T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000562450 NULL ANKRD11 chr16 89274844 89274844 Silent G G A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000301030 p.S2561S CXCL16 chr17 4734566 4734566 Intron A A - TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000293778 NULL TP53 chr17 7676051 7676051 Missense_Mutation G G C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000269305 p.S106R GAS7 chr17 9915388 9915388 3'UTR T T C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000432992 NULL SYNRG chr17 37553170 37553171 Frame_Shift_Ins - - A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000612223 p.M851Ifs*3 WBP11P1 chr18 32511976 32511976 RNA G G A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000567636 NULL CDH20 chr18 61527998 61527998 Missense_Mutation C C A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000262717 p.T350N FBXO15 chr18 74147735 74147735 Missense_Mutation C C G TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000419743 p.Q17H TRIP10 chr19 6750377 6750377 Missense_Mutation C C T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000313244 p.A494V MUC16 chr19 8960429 8960429 Silent C C T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000397910 p.S5447S RPSAP58 chr19 23827762 23827766 Frame_Shift_Del CTGTA CTGTA - TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000496398 p.Y202Lfs*5 ARHGAP33 chr19 35792402 35792402 3'Flank G G A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000314737 NULL ZNF260 chr19 36514679 36514679 Missense_Mutation G G T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000523638 p.T187N ZNF461 chr19 36639846 36639846 Frame_Shift_Del T T - TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000588268 p.I167Lfs*98 PSG1 chr19 42869003 42869003 Silent G G A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000436291 p.N247N ZNF347 chr19 53149340 53149340 Missense_Mutation T T C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000334197 p.I15V ZNF71 chr19 56622613 56622613 Missense_Mutation G G T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000328070 p.Q442H SNX5 chr20 17942293 17942293 3'UTR T T A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000377759 NULL DHX35 chr20 38962368 38962369 Frame_Shift_Ins - - T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000252011 p.M1? STK4 chr20 45000497 45000497 Missense_Mutation G G T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000372806 p.D313Y SS18L1 chr20 62161462 62161462 Silent C C T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000331758 p.G86G TFIP11 chr22 26510128 26510128 Missense_Mutation C C A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000405938 p.A49S EWSR1 chr22 29268114 29268114 5'UTR T T - TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000397938 NULL ATF4 chr22 39521505 39521505 Silent C C T TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000337304 p.F20F MOV10L1 chr22 50160731 50160731 Missense_Mutation T T G TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000262794 p.L1123W TLR8 chrX 12920169 12920169 Missense_Mutation T T C TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000218032 p.Y377H SLC25A5 chrX 119470489 119470489 Missense_Mutation A A G TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000317881 p.M239V FAM127A chrX 135033483 135033483 3'UTR A A G TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000257013 NULL TMEM257 chrX 145827800 145827800 Missense_Mutation C A A TCGA-XP-A8T8-01A-11D-A36J-09 ENST00000408967 p.F41L MEGF6 chr1 3509232 3509232 Silent C C T TCGA-JY-A93D-01A-11D-A387-09 ENST00000356575 p.P457P PRAMEF19 chr1 13370870 13370870 Missense_Mutation C C G TCGA-JY-A93D-01A-11D-A387-09 ENST00000376101 p.M146I TIE1 chr1 43312587 43312587 Missense_Mutation T T G TCGA-JY-A93D-01A-11D-A387-09 ENST00000372476 p.L638R CCBL2 chr1 88988287 88988287 Missense_Mutation A A G TCGA-JY-A93D-01A-11D-A387-09 ENST00000260508 p.S22P FNBP1L chr1 93552559 93552559 3'UTR T T G TCGA-JY-A93D-01A-11D-A387-09 ENST00000271234 NULL PHGDH chr1 119735340 119735340 Missense_Mutation G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000369409 p.R230H BCL9 chr1 147624062 147624062 Silent G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000234739 p.P1128P CD1E chr1 158354548 158354548 Missense_Mutation T T G TCGA-JY-A93D-01A-11D-A387-09 ENST00000368167 p.L77R OR6Y1 chr1 158547286 158547286 Missense_Mutation T T A TCGA-JY-A93D-01A-11D-A387-09 ENST00000302617 p.N274Y OR10X1 chr1 158579423 158579423 Missense_Mutation T T G TCGA-JY-A93D-01A-11D-A387-09 ENST00000368150 p.Q159H VANGL2 chr1 160415812 160415812 5'UTR G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000368061 NULL KCNT2 chr1 196428232 196428232 Missense_Mutation T T C TCGA-JY-A93D-01A-11D-A387-09 ENST00000294725 p.K286R F13B chr1 197052715 197052715 Missense_Mutation A A C TCGA-JY-A93D-01A-11D-A387-09 ENST00000367412 p.L492V CRB1 chr1 197427576 197427576 Missense_Mutation T T G TCGA-JY-A93D-01A-11D-A387-09 ENST00000367400 p.L751V PROX1 chr1 213997302 213997302 Missense_Mutation A A C TCGA-JY-A93D-01A-11D-A387-09 ENST00000261454 p.K256T OR2M4 chr1 248239816 248239816 Missense_Mutation A A C TCGA-JY-A93D-01A-11D-A387-09 ENST00000306687 p.E296D OR2T6 chr1 248388462 248388462 Nonsense_Mutation T T G TCGA-JY-A93D-01A-11D-A387-09 ENST00000355728 p.L285* TPO chr2 1456152 1456152 Missense_Mutation T T G TCGA-JY-A93D-01A-11D-A387-09 ENST00000329066 p.L230R PXDN chr2 1665043 1665043 Missense_Mutation G G T TCGA-JY-A93D-01A-11D-A387-09 ENST00000252804 p.D441E MYT1L chr2 1922549 1922549 Missense_Mutation T T C TCGA-JY-A93D-01A-11D-A387-09 ENST00000399161 p.E407G BIRC6 chr2 32415069 32415069 Missense_Mutation G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000421745 p.G593D FSHR chr2 48962920 48962920 Missense_Mutation C C T TCGA-JY-A93D-01A-11D-A387-09 ENST00000406846 p.R634H DPP10 chr2 115844064 115844064 3'UTR A A C TCGA-JY-A93D-01A-11D-A387-09 ENST00000410059 NULL LRP1B chr2 140352977 140352977 Silent T T G TCGA-JY-A93D-01A-11D-A387-09 ENST00000389484 p.R3876R SCN2A chr2 165389189 165389189 Missense_Mutation T T A TCGA-JY-A93D-01A-11D-A387-09 ENST00000283256 p.F1795I AGPS chr2 177461971 177461971 Missense_Mutation C C T TCGA-JY-A93D-01A-11D-A387-09 ENST00000264167 p.R317C DNAH7 chr2 195865000 195865000 Missense_Mutation G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000312428 p.R2219C SH3BP4 chr2 235041763 235041763 Missense_Mutation C C T TCGA-JY-A93D-01A-11D-A387-09 ENST00000344528 p.L332F HDLBP chr2 241268503 241268503 5'UTR T T C TCGA-JY-A93D-01A-11D-A387-09 ENST00000391975 NULL EPHA3 chr3 89479692 89479692 3'UTR G G C TCGA-JY-A93D-01A-11D-A387-09 ENST00000336596 NULL KY chr3 134629638 134629638 Missense_Mutation T T G TCGA-JY-A93D-01A-11D-A387-09 ENST00000423778 p.K107T TP63 chr3 189896976 189896977 3'UTR - - T TCGA-JY-A93D-01A-11D-A387-09 ENST00000264731 NULL NAA15 chr4 139370353 139370353 Missense_Mutation T T G TCGA-JY-A93D-01A-11D-A387-09 ENST00000296543 p.D632E DCHS2 chr4 154236998 154236998 Missense_Mutation T T G TCGA-JY-A93D-01A-11D-A387-09 ENST00000623607 p.K2097Q DCHS2 chr4 154489849 154489849 Missense_Mutation C C T TCGA-JY-A93D-01A-11D-A387-09 ENST00000339452 p.D503N FGA chr4 154586310 154586310 Nonsense_Mutation C C T TCGA-JY-A93D-01A-11D-A387-09 ENST00000302053 p.W373* VEGFC chr4 176683620 176683620 3'UTR T T G TCGA-JY-A93D-01A-11D-A387-09 ENST00000618562 NULL SEMA5A chr5 9337728 9337728 Missense_Mutation A A G TCGA-JY-A93D-01A-11D-A387-09 ENST00000382496 p.L70P MARCH6 chr5 10433725 10433726 3'UTR - - T TCGA-JY-A93D-01A-11D-A387-09 ENST00000274140 NULL DNAH5 chr5 13717421 13717421 Missense_Mutation T T G TCGA-JY-A93D-01A-11D-A387-09 ENST00000265104 p.K4200T PDZD2 chr5 32074284 32074284 Missense_Mutation A A G TCGA-JY-A93D-01A-11D-A387-09 ENST00000438447 p.T1060A UGT3A1 chr5 35957333 35957333 Silent C C T TCGA-JY-A93D-01A-11D-A387-09 ENST00000274278 p.Q310Q RASA1 chr5 87389331 87389332 Intron - - A TCGA-JY-A93D-01A-11D-A387-09 ENST00000274376 NULL PCDHB7 chr5 141173089 141173089 Missense_Mutation T T G TCGA-JY-A93D-01A-11D-A387-09 ENST00000231137 p.L85R BTNL3 chr5 180997394 180997394 Silent C C A TCGA-JY-A93D-01A-11D-A387-09 ENST00000342868 p.I193I ZNF292 chr6 87255041 87255041 Missense_Mutation A A G TCGA-JY-A93D-01A-11D-A387-09 ENST00000369577 p.D471G POU3F2 chr6 98838376 98838376 3'UTR C C G TCGA-JY-A93D-01A-11D-A387-09 ENST00000328345 NULL SOBP chr6 107634410 107634410 Silent C C T TCGA-JY-A93D-01A-11D-A387-09 ENST00000317357 p.T522T GPR6 chr6 109980637 109980637 3'Flank G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000275169 NULL MARCKS chr6 113861089 113861089 3'UTR A A - TCGA-JY-A93D-01A-11D-A387-09 ENST00000612661 NULL HBS1L chr6 134965049 134965049 3'UTR T T C TCGA-JY-A93D-01A-11D-A387-09 ENST00000367837 NULL LRP11 chr6 149837395 149837395 Missense_Mutation C C T TCGA-JY-A93D-01A-11D-A387-09 ENST00000239367 p.A328T AHR chr7 17345312 17345313 3'UTR - - A TCGA-JY-A93D-01A-11D-A387-09 ENST00000242057 NULL ABCA13 chr7 48580329 48580329 Nonsense_Mutation T T G TCGA-JY-A93D-01A-11D-A387-09 ENST00000435803 p.Y4820* PCLO chr7 82916666 82916666 Missense_Mutation C C T TCGA-JY-A93D-01A-11D-A387-09 ENST00000333891 p.E3774K ZNF804B chr7 89335430 89335430 Missense_Mutation A A C TCGA-JY-A93D-01A-11D-A387-09 ENST00000333190 p.Q816H CDK14 chr7 91208143 91208143 3'UTR A A - TCGA-JY-A93D-01A-11D-A387-09 ENST00000380050 NULL HBP1 chr7 107182573 107182573 Missense_Mutation C C T TCGA-JY-A93D-01A-11D-A387-09 ENST00000222574 p.P124S KCND2 chr7 120275085 120275085 Silent C C T TCGA-JY-A93D-01A-11D-A387-09 ENST00000331113 p.D151D EPHB6 chr7 142870567 142870567 Missense_Mutation T T A TCGA-JY-A93D-01A-11D-A387-09 ENST00000619012 p.F948I GSTK1 chr7 143268817 143268817 Missense_Mutation G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000358406 p.A221T SNAI2 chr8 48919926 48919926 Missense_Mutation A A C TCGA-JY-A93D-01A-11D-A387-09 ENST00000020945 p.L199V RALYL chr8 84921154 84921154 3'UTR T T - TCGA-JY-A93D-01A-11D-A387-09 ENST00000521268 NULL VPS13B chr8 99274305 99274305 Frame_Shift_Del T T - TCGA-JY-A93D-01A-11D-A387-09 ENST00000358544 p.S875Qfs*2 VPS13B chr8 99274306 99274306 Nonsense_Mutation C C A TCGA-JY-A93D-01A-11D-A387-09 ENST00000358544 p.S875* SLC30A8 chr8 117157716 117157716 Silent C C A TCGA-JY-A93D-01A-11D-A387-09 ENST00000456015 p.I148I BNC2 chr9 16412669 16412669 3'UTR T T C TCGA-JY-A93D-01A-11D-A387-09 ENST00000380672 NULL CDKN2A chr9 21971026 21971027 Frame_Shift_Del GC GC - TCGA-JY-A93D-01A-11D-A387-09 ENST00000304494 p.G111Afs*8 GLIDR chr9 39809423 39809423 RNA G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000625350 NULL PSAT1 chr9 78306356 78306356 Missense_Mutation C C G TCGA-JY-A93D-01A-11D-A387-09 ENST00000376588 p.S147C DAB2IP chr9 121772877 121772877 Silent C C T TCGA-JY-A93D-01A-11D-A387-09 ENST00000408936 p.A783A ABCA2 chr9 137011673 137011673 Missense_Mutation G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000341511 p.T1871I LINC00705 chr10 4660104 4660104 RNA G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000417883 NULL BAMBI chr10 28682196 28682196 Missense_Mutation G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000375533 p.R193H MUC6 chr11 1016412 1016414 In_Frame_Del GAG GAG - TCGA-JY-A93D-01A-11D-A387-09 ENST00000421673 p.S2130del DCHS1 chr11 6626236 6626236 Missense_Mutation C C T TCGA-JY-A93D-01A-11D-A387-09 ENST00000299441 p.R2170H OR4C13 chr11 49952502 49952502 Missense_Mutation T T A TCGA-JY-A93D-01A-11D-A387-09 ENST00000555099 p.V27D LRRC55 chr11 57182172 57182172 Silent T T C TCGA-JY-A93D-01A-11D-A387-09 ENST00000497933 p.D93D SSRP1 chr11 57335213 57335213 5'UTR G G C TCGA-JY-A93D-01A-11D-A387-09 ENST00000278412 NULL TCIRG1 chr11 68049987 68049987 Missense_Mutation A A G TCGA-JY-A93D-01A-11D-A387-09 ENST00000265686 p.D680G TRIM49C chr11 90037944 90037944 Missense_Mutation G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000448984 p.E235K RP11-108O10.8 chr11 111879057 111879057 Nonsense_Mutation G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000622211 p.Q26* OR6M1 chr11 123805559 123805559 Nonsense_Mutation G G T TCGA-JY-A93D-01A-11D-A387-09 ENST00000309154 p.S264* VWF chr12 6019369 6019369 Missense_Mutation G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000261405 p.A1350V RECQL chr12 21474962 21474962 Missense_Mutation C C T TCGA-JY-A93D-01A-11D-A387-09 ENST00000421138 p.A412T CPNE8 chr12 38652503 38652503 3'UTR T T A TCGA-JY-A93D-01A-11D-A387-09 ENST00000331366 NULL ITGA7 chr12 55697811 55697811 Silent G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000555728 p.G475G CFAP54 chr12 96644248 96644248 Missense_Mutation A A G TCGA-JY-A93D-01A-11D-A387-09 ENST00000524981 p.S1463G RPH3A chr12 112847760 112847760 Missense_Mutation C C A TCGA-JY-A93D-01A-11D-A387-09 ENST00000389385 p.L50M BCL7A chr12 122060893 122060894 3'UTR - - A TCGA-JY-A93D-01A-11D-A387-09 ENST00000261822 NULL MTUS2 chr13 29359400 29359400 Missense_Mutation C C T TCGA-JY-A93D-01A-11D-A387-09 ENST00000612955 p.A1025V NBEA chr13 35671269 35671269 3'UTR A A C TCGA-JY-A93D-01A-11D-A387-09 ENST00000400445 NULL NBEA chr13 35672159 35672159 3'UTR A A T TCGA-JY-A93D-01A-11D-A387-09 ENST00000400445 NULL TXNDC16 chr14 52432507 52432507 Missense_Mutation G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000281741 p.R759C DACT1 chr14 58646775 58646775 Missense_Mutation G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000335867 p.A718T FLRT2 chr14 85623228 85623228 Missense_Mutation T T C TCGA-JY-A93D-01A-11D-A387-09 ENST00000330753 p.Y572H GOLGA8A chr15 34381577 34381577 Missense_Mutation G G C TCGA-JY-A93D-01A-11D-A387-09 ENST00000432566 p.P577R PPP1R14D chr15 40828454 40828454 Missense_Mutation C C A TCGA-JY-A93D-01A-11D-A387-09 ENST00000299174 p.R63L TRPM7 chr15 50574684 50574684 Silent C C G TCGA-JY-A93D-01A-11D-A387-09 ENST00000313478 p.T1685T ZNF205 chr16 3118963 3118963 Silent G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000219091 p.S181S MIR6511A2 chr16 16321077 16321077 5'Flank C C T TCGA-JY-A93D-01A-11D-A387-09 ENST00000611011 NULL CDIPT chr16 29864812 29864812 5'Flank T T G TCGA-JY-A93D-01A-11D-A387-09 ENST00000219789 NULL COG4 chr16 70517646 70517646 Missense_Mutation G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000323786 p.R117C PIEZO1 chr16 88717526 88717526 Intron C C T TCGA-JY-A93D-01A-11D-A387-09 ENST00000301015 NULL TP53 chr17 7674221 7674221 Missense_Mutation G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000269305 p.R248W CCDC144NL chr17 20895829 20895829 Silent G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000327925 p.H64H MLLT6 chr17 38716897 38716897 Missense_Mutation G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000621332 p.G523S FAM171A2 chr17 44354988 44354988 Missense_Mutation G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000293443 p.A409V BZRAP1 chr17 58310546 58310546 Missense_Mutation C C A TCGA-JY-A93D-01A-11D-A387-09 ENST00000343736 p.G1222V TCF4 chr18 55350383 55350383 Silent T T C TCGA-JY-A93D-01A-11D-A387-09 ENST00000356073 p.K175K ONECUT2 chr18 57486226 57486226 3'UTR G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000491143 NULL NOTCH3 chr19 15191488 15191488 Silent G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000263388 p.F324F ANO8 chr19 17324926 17324926 Missense_Mutation C C T TCGA-JY-A93D-01A-11D-A387-09 ENST00000159087 p.R1041H ZNF626 chr19 20625496 20625496 Missense_Mutation T T G TCGA-JY-A93D-01A-11D-A387-09 ENST00000601440 p.K127N MAG chr19 35310098 35310098 Missense_Mutation G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000392213 p.V486I ZNF568 chr19 36950236 36950236 Silent T T G TCGA-JY-A93D-01A-11D-A387-09 ENST00000333987 p.P361P SIRT2 chr19 38893879 38893879 Intron G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000249396 NULL BCAM chr19 44813253 44813253 Missense_Mutation G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000270233 p.A170T SIGLEC5 chr19 51612252 51612252 Silent C C T TCGA-JY-A93D-01A-11D-A387-09 ENST00000534261 p.S545S ZNF470 chr19 56578117 56578117 Missense_Mutation A A T TCGA-JY-A93D-01A-11D-A387-09 ENST00000330619 p.K563M USP29 chr19 57129060 57129060 Missense_Mutation A A C TCGA-JY-A93D-01A-11D-A387-09 ENST00000254181 p.I129L ZSCAN18 chr19 58090020 58090020 Missense_Mutation C C T TCGA-JY-A93D-01A-11D-A387-09 ENST00000240727 p.R83H GDAP1L1 chr20 44279797 44279797 3'UTR G G A TCGA-JY-A93D-01A-11D-A387-09 ENST00000342560 NULL MATN4 chr20 45304663 45304663 Missense_Mutation C C T TCGA-JY-A93D-01A-11D-A387-09 ENST00000372754 p.A70T MMP9 chr20 46016515 46016516 3'UTR - - T TCGA-JY-A93D-01A-11D-A387-09 ENST00000372330 NULL CASS4 chr20 56437514 56437514 Silent A A G TCGA-JY-A93D-01A-11D-A387-09 ENST00000360314 p.Q129Q KRTAP19-4 chr21 30496871 30496871 Silent A A G TCGA-JY-A93D-01A-11D-A387-09 ENST00000334058 p.N80N PLA2G6 chr22 38169359 38169359 Missense_Mutation C C T TCGA-JY-A93D-01A-11D-A387-09 ENST00000332509 p.R23Q FAM19A5 chr22 48750155 48750157 3'UTR GAG GAG - TCGA-JY-A93D-01A-11D-A387-09 ENST00000402357 NULL DMD chrX 31206647 31206647 Missense_Mutation C C T TCGA-JY-A93D-01A-11D-A387-09 ENST00000357033 p.R3195H USP51 chrX 55488713 55488713 Missense_Mutation C C T TCGA-JY-A93D-01A-11D-A387-09 ENST00000500968 p.S76N EDA2R chrX 66602675 66602675 Missense_Mutation A A C TCGA-JY-A93D-01A-11D-A387-09 ENST00000374719 p.F159V CAPN6 chrX 111251264 111251264 Missense_Mutation T T G TCGA-JY-A93D-01A-11D-A387-09 ENST00000324068 p.T306P ALG13 chrX 111709039 111709039 Silent T T A TCGA-JY-A93D-01A-11D-A387-09 ENST00000394780 p.T275T MCF2 chrX 139585102 139585102 Silent A A G TCGA-JY-A93D-01A-11D-A387-09 ENST00000370576 p.T903T MEGF6 chr1 3496727 3496727 Missense_Mutation C C T TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000356575 p.G1224R IL22RA1 chr1 24120835 24120835 Silent G G T TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000270800 p.G565G CSMD2 chr1 33614536 33614536 Missense_Mutation C C A TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000241312 p.C1994F TCTEX1D4 chr1 44806554 44806554 Nonsense_Mutation G G A TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000339355 p.R39* NEGR1 chr1 71404595 71404596 3'UTR - - G TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000357731 NULL KCNC4 chr1 110223069 110223069 Missense_Mutation C C T TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000369787 p.R262C SPAG17 chr1 117996698 117996698 Missense_Mutation A A T TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000336338 p.L1608M BNIPL chr1 151043711 151043711 Missense_Mutation C C T TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000368931 p.R279C SCNM1 chr1 151167201 151167201 Missense_Mutation G G A TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000368905 p.E98K UBE2Q1 chr1 154550366 154550366 3'UTR G G A TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000292211 NULL FCRL4 chr1 157575501 157575501 3'UTR C C T TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000271532 NULL OR10K1 chr1 158466180 158466180 Silent T T C TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000289451 p.L207L TBX19 chr1 168300442 168300442 Missense_Mutation C C T TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000367821 p.P229L TNR chr1 175403297 175403297 Silent C C T TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000263525 p.K273K LAMC1 chr1 183108387 183108387 Missense_Mutation G G T TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000258341 p.D279Y BRINP3 chr1 190098226 190098226 Nonsense_Mutation G G T TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000367462 p.S698* ADORA1 chr1 203165426 203165426 Silent C C T TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000309502 p.C169C IRF2BP2 chr1 234608741 234608741 Missense_Mutation G G A TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000366609 p.R252C SOX11 chr2 5697469 5697469 3'UTR A A C TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000322002 NULL PSME4 chr2 53864487 53864487 3'UTR T T C TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000404125 NULL WDR33 chr2 127811096 127811096 5'UTR A A G TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000322313 NULL GTDC1 chr2 144007356 144007356 Missense_Mutation T T C TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000344850 p.E234G ACVR1 chr2 157760956 157760956 Silent G G A TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000263640 p.F396F SCN9A chr2 166227673 166227673 Silent A A G TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000303354 p.V1419V KLHL23 chr2 169735843 169735843 Missense_Mutation A A T TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000272797 p.I277L TLK1 chr2 171023080 171023080 Intron C C T TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000431350 NULL ZNF804A chr2 184938444 184938444 Silent T T C TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000302277 p.T1016T AOX1 chr2 200609117 200609117 Silent C C T TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000374700 p.S347S TNS1 chr2 217836173 217836173 Missense_Mutation C C A TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000171887 p.A891S UGT1A3 chr2 233729585 233729585 Silent C C T TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000482026 p.P153P OR6B2 chr2 240029750 240029750 Missense_Mutation C C T TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000402971 p.R227H CAND2 chr3 12817378 12817378 Missense_Mutation C C T TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000456430 p.P816S FBLN2 chr3 13638092 13638092 3'UTR G G A TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000295760 NULL KAT2B chr3 20095350 20095350 Missense_Mutation C C A TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000263754 p.T173N ACVR2B chr3 38477970 38477970 Missense_Mutation G G C TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000352511 p.V124L CCR9 chr3 45901572 45901572 Missense_Mutation G G A TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000357632 p.V262I APEH chr3 49676175 49676175 Missense_Mutation G G A TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000296456 p.D188N PDZRN3 chr3 73404198 73404198 Silent C C T TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000263666 p.K372K ALDH1L1 chr3 126146842 126146842 Missense_Mutation C C T TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000393434 p.V357I TMPRSS11B chr4 68228766 68228766 Missense_Mutation C C T TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000332644 p.M355I ODAM chr4 70196705 70196705 Missense_Mutation G G A TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000396094 p.R22H GRID2 chr4 93224704 93224704 Missense_Mutation A A C TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000282020 p.S352R ADH1C chr4 99352683 99352683 5'UTR C C - TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000515683 NULL PCDH10 chr4 133191177 133191177 3'UTR A A C TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000264360 NULL GAB1 chr4 143343513 143343513 Intron C C T TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000262994 NULL MND1 chr4 153358497 153358497 Missense_Mutation C C T TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000240488 p.L51F ASIC5 chr4 155863653 155863653 Frame_Shift_Del G G - TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000537611 p.H48Mfs*29 PIK3R1 chr5 68226771 68226772 In_Frame_Ins - - AAT TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000521381 p.N33dup PCDHA8 chr5 140842602 140842603 Frame_Shift_Ins - - CGGGA TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000531613 p.G431Tfs*20 PCDHA10 chr5 140856872 140856872 Missense_Mutation A A T TCGA-VR-AA4D-01A-11D-A37C-09 ENST00000307360 p.E275V PCDHB9 chr5 141189453 141189454 Frame_Shift_Ins - - GCTGT TCGA-VR-AA4D-01A-11D-A37C-09 ENST000