Hugo_Symbol Chromosome Start_Position End_Position Variant_Classification Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 Tumor_Sample_Barcode transcript_name amino_acid_change OMA1 chr1 58539205 58539205 Silent T T C TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000371226 p.T30T SH3RF3 chr2 109437072 109437072 Missense_Mutation C C G TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000309415 p.S585W SCN2A chr2 165344781 165344781 Missense_Mutation A A T TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000283256 p.H930L MUC13 chr3 124910482 124910482 Missense_Mutation T T C TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000616727 p.T424A ADAMTS3 chr4 72414834 72414834 Silent G G C TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000286657 p.S214S ANAPC10 chr4 144995405 144995405 Missense_Mutation T T C TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000309439 p.I176V OTP chr5 77636831 77636831 Missense_Mutation G G C TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000306422 p.S146C ADAMTS19 chr5 129528620 129528620 Missense_Mutation T T A TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000274487 p.M418K GLRA1 chr5 151851559 151851559 Missense_Mutation A A T TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000455880 p.M248K HIST1H1E chr6 26156817 26156817 Missense_Mutation G G T TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000304218 p.G143W IGF2R chr6 160032683 160032683 Missense_Mutation A A G TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000356956 p.I339V LRRN3 chr7 111124252 111124252 Missense_Mutation T T C TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000308478 p.Y494H CAPZA2 chr7 116917725 116917725 Splice_Site A A G TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000361183 p.X241_splice ASPH chr8 61684053 61684053 Missense_Mutation T T C TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000379454 p.Y80C CNBD1 chr8 86905095 86905095 Missense_Mutation A A G TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000518476 p.N58S C9orf171 chr9 132572467 132572467 Missense_Mutation T T C TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000343036 p.V307A PCDH15 chr10 53822521 53822521 Silent G G A TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000320301 p.A1735A CTSD chr11 1757408 1757408 Missense_Mutation G G A TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000236671 p.S207F CRACR2A chr12 3696833 3696833 Missense_Mutation T T A TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000252322 p.Q56L BCAT1 chr12 24836530 24836530 Missense_Mutation A A G TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000261192 p.L295P GTSF1 chr12 54460399 54460399 Silent C C A TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000305879 p.P155P RPH3A chr12 112847734 112847734 Missense_Mutation C C A TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000389385 p.P41H FRY chr13 32061117 32061117 Intron T T C TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000542859 PKD1L2 chr16 81198800 81198800 Silent A A G TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000614230 p.L469L G6PC3 chr17 44075780 44075780 Missense_Mutation G G A TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000269097 p.G260S ZNF440 chr19 11834130 11834130 3'UTR T T - TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000304060 MEGF8 chr19 42337190 42337190 Silent G G A TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000251268 p.P499P ZNF813 chr19 53491716 53491716 Missense_Mutation A A G TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000396403 p.Y495C SCAF4 chr21 31672304 31672304 Missense_Mutation T T C TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000286835 p.T847A CDKL5 chrX 18613268 18613268 Missense_Mutation G G T TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000379989 p.D757Y SH3KBP1 chrX 19569125 19569125 Silent G G A TCGA-OR-A5J6-01A-31D-A29I-10 ENST00000397821 p.L454L ZCCHC17 chr1 31346740 31346740 Missense_Mutation G G T TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000344147 p.G140C FLG chr1 152305740 152305740 Missense_Mutation C C T TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000368799 p.R3049H SEC16B chr1 177960652 177960652 Intron G G A TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000308284 XDH chr2 31350054 31350054 Missense_Mutation G G T TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000379416 p.T934N ST6GAL1 chr3 187075725 187075725 Silent T T C TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000169298 p.H381H TMPRSS11F chr4 68062627 68062627 Intron C C T TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000356291 HNRNPA0 chr5 137754312 137754312 5'UTR C C T TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000314940 HIST1H4E chr6 26204649 26204649 Missense_Mutation C C T TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000615164 p.S2F POLD2 chr7 44116494 44116494 Missense_Mutation T T C TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000406581 p.K266R ZNF703 chr8 37697449 37697449 Missense_Mutation C C T TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000331569 p.S183F KIAA2026 chr9 5969127 5969127 Silent G G C TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000399933 p.T368T RP11-262H14.3 chr9 62897773 62897773 RNA C C - TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000445604 ANKRD26 chr10 27033298 27033298 Missense_Mutation G A A TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000376087 p.T1245M WNK1 chr12 857226 857226 Nonsense_Mutation C C A TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000315939 p.C459* ATF7IP chr12 14425192 14425192 Missense_Mutation A A G TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000261168 p.N426S RECQL chr12 21471077 21471077 Silent A A C TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000421138 p.A563A CTDSP2 chr12 57823681 57823681 Missense_Mutation A A G TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000398073 p.L246P GAS2L3 chr12 100612072 100612072 Missense_Mutation G G C TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000266754 p.A126P CHD8 chr14 21394997 21394998 Frame_Shift_Ins - - CTCTATCTTCATTTGTTCT TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000399982 p.A1769Rfs*19 TLE3 chr15 70057615 70057615 Silent C T T TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000558939 p.A368A C16orf90 chr16 3494745 3494745 Missense_Mutation C C T TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000437192 p.R60H GTF3C1 chr16 27511853 27511869 Frame_Shift_Del CGTTTAAATTCCTTCAG CGTTTAAATTCCTTCAG - TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000356183 p.L336Efs*2 PYCARD chr16 31202637 31202637 Silent C C T TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000247470 p.E18E NF1 chr17 31334931 31334931 Frame_Shift_Del A A - TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000358273 p.R1970Efs*9 PRKCG chr19 53889983 53889983 Frame_Shift_Del C C - TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000263431 p.R166Gfs*10 IGLV2-8 chr22 22823130 22823130 Silent C C A TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000620395 p.P103P SMC1A chrX 53413097 53413097 Silent A A G TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000322213 p.A219A PIN4 chrX 72197507 72197507 Missense_Mutation T T C TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000373669 p.M151T NSDHL chrX 152862687 152862687 Missense_Mutation T T C TCGA-OR-A5LF-01A-11D-A30A-10 ENST00000370274 p.I169T FAM46C chr1 117625476 117625476 3'UTR A A G TCGA-OR-A5LM-01A-11D-A29I-10 ENST00000369448 IQCF6 chr3 51778840 51778840 Missense_Mutation A A G TCGA-OR-A5LM-01A-11D-A29I-10 ENST00000398780 p.L36P PTPRG chr3 62191517 62191517 Missense_Mutation C C T TCGA-OR-A5LM-01A-11D-A29I-10 ENST00000474889 p.T361M DNAJC13 chr3 132461081 132461081 Missense_Mutation C C T TCGA-OR-A5LM-01A-11D-A29I-10 ENST00000260818 p.S530L NLGN1 chr3 174280708 174280708 Missense_Mutation C C A TCGA-OR-A5LM-01A-11D-A29I-10 ENST00000457714 p.T626K TEC chr4 48137476 48137476 Silent G G A TCGA-OR-A5LM-01A-11D-A29I-10 ENST00000381501 p.F612F ANK2 chr4 113353272 113353272 Missense_Mutation G G A TCGA-OR-A5LM-01A-11D-A29I-10 ENST00000357077 p.V1552I ADAMTS16 chr5 5303375 5303375 Missense_Mutation C C A TCGA-OR-A5LM-01A-11D-A29I-10 ENST00000274181 p.P966Q ASCC3 chr6 100725659 100725659 Missense_Mutation C C G TCGA-OR-A5LM-01A-11D-A29I-10 ENST00000369162 p.K594N PSMC2 chr7 103367727 103367727 Silent A A T TCGA-OR-A5LM-01A-11D-A29I-10 ENST00000292644 p.I354I TMEM209 chr7 130181712 130181712 Missense_Mutation T T C TCGA-OR-A5LM-01A-11D-A29I-10 ENST00000397622 p.N344S BRF2 chr8 37847071 37847071 Nonsense_Mutation G G A TCGA-OR-A5LM-01A-11D-A29I-10 ENST00000220659 p.R107* DNA2 chr10 68431910 68431910 Silent G G A TCGA-OR-A5LM-01A-11D-A29I-10 ENST00000358410 p.L645L CRYAB chr11 111911641 111911641 Missense_Mutation G G T TCGA-OR-A5LM-01A-11D-A29I-10 ENST00000227251 p.F28L CRYAB chr11 111911642 111911642 Missense_Mutation A A T TCGA-OR-A5LM-01A-11D-A29I-10 ENST00000227251 p.F28Y ITPR2 chr12 26621159 26621159 Silent C C T TCGA-OR-A5LM-01A-11D-A29I-10 ENST00000381340 p.G1142G ACADS chr12 120738877 120738877 Missense_Mutation G G A TCGA-OR-A5LM-01A-11D-A29I-10 ENST00000242592 p.A331T SPPL3 chr12 120768472 120768472 Missense_Mutation T T C TCGA-OR-A5LM-01A-11D-A29I-10 ENST00000353487 p.Y209C GOLGA3 chr12 132801876 132801876 Missense_Mutation G G A TCGA-OR-A5LM-01A-11D-A29I-10 ENST00000204726 p.S564L SGCG chr13 23250677 23250677 Silent G G A TCGA-OR-A5LM-01A-11D-A29I-10 ENST00000218867 p.A115A SLITRK1 chr13 83882062 83882062 5'UTR G G A TCGA-OR-A5LM-01A-11D-A29I-10 ENST00000377084 C16orf71 chr16 4744971 4744971 Missense_Mutation G G A TCGA-OR-A5LM-01A-11D-A29I-10 ENST00000299320 p.D335N CDT1 chr16 88805827 88805827 Missense_Mutation A A T TCGA-OR-A5LM-01A-11D-A29I-10 ENST00000301019 p.R264W SPOP chr17 49622007 49622007 Missense_Mutation C C G TCGA-OR-A5LM-01A-11D-A29I-10 ENST00000347630 p.E47Q PHEX chrX 22111469 22111469 Missense_Mutation C C T TCGA-OR-A5LM-01A-11D-A29I-10 ENST00000379374 p.T361I CFAP47 chrX 35926169 35926169 Splice_Site G G C TCGA-OR-A5LM-01A-11D-A29I-10 ENST00000297866 p.X134_splice ARHGEF6 chrX 136667975 136667975 3'UTR C C T TCGA-OR-A5LM-01A-11D-A29I-10 ENST00000250617 NXPE3 chr3 101801463 101801463 Missense_Mutation T A A TCGA-OR-A5LH-01A-11D-A29I-10 ENST00000273347 p.F108I MLLT4 chr6 167976333 167976334 3'Flank - - A TCGA-OR-A5LH-01A-11D-A29I-10 ENST00000392112 PSMC2 chr7 103354895 103354895 Missense_Mutation A A C TCGA-OR-A5LH-01A-11D-A29I-10 ENST00000292644 p.K46Q RP1L1 chr8 10610171 10610176 In_Frame_Del TCCTTC TCCTTC - TCGA-OR-A5LH-01A-11D-A29I-10 ENST00000382483 p.E1308_G1309del CPXM2 chr10 123757215 123757215 Frame_Shift_Del G G - TCGA-OR-A5LH-01A-11D-A29I-10 ENST00000241305 p.Q639Rfs*10 ALG10 chr12 34022603 34022603 Missense_Mutation G G A TCGA-OR-A5LH-01A-11D-A29I-10 ENST00000266483 p.A2T RASGRF1 chr15 79046821 79046821 Missense_Mutation C C T TCGA-OR-A5LH-01A-11D-A29I-10 ENST00000419573 p.R268H LRRC36 chr16 67367058 67367058 Missense_Mutation C C T TCGA-OR-A5LH-01A-11D-A29I-10 ENST00000329956 p.P266S PRKAR1A chr17 68530413 68530413 Frame_Shift_Del C C - TCGA-OR-A5LH-01A-11D-A29I-10 ENST00000358598 p.Q371Sfs*70 LINGO3 chr19 2290133 2290133 Silent C C T TCGA-OR-A5LH-01A-11D-A29I-10 ENST00000585527 p.L548L GCDH chr19 12891559 12891566 Intron CTGTTCAG CTGTTCAG - TCGA-OR-A5LH-01A-11D-A29I-10 ENST00000222214 RPN2 chr20 37210094 37210094 Silent T T G TCGA-OR-A5LH-01A-11D-A29I-10 ENST00000237530 p.V305V PHKA2 chrX 18920161 18920161 Missense_Mutation A A G TCGA-OR-A5LH-01A-11D-A29I-10 ENST00000379942 p.F612L DLGAP3 chr1 34900198 34900198 Missense_Mutation C C T TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000235180 p.G395S C1orf141 chr1 67125814 67125814 Silent G G C TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000371006 p.S57S CDC7 chr1 91513972 91513972 Missense_Mutation C C A TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000234626 p.Q283K NBPF9 chr1 149065691 149065691 Splice_Site T T C TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000613595 p.X546_splice APOA2 chr1 161223022 161223022 Silent C C T TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000367990 p.E27E HSD11B1 chr1 209732493 209732493 Missense_Mutation G G T TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000367027 p.G192V ARID4B chr1 235181697 235181697 Silent A A C TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000264183 p.V1074V CNTNAP5 chr2 124902945 124902945 Missense_Mutation C C G TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000431078 p.S1166C YWHAEP5 chr2 138288724 138288724 RNA C C A TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000431545 ATP2B2 chr3 10449529 10449529 Silent G G C TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000352432 p.T5T GOLGA4 chr3 37347191 37347191 Splice_Site A A T TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000361924 p.X2158_splice CCR3 chr3 46265875 46265875 Silent G G C TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000357422 p.R239R FLNB chr3 58142664 58142664 Silent C C G TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000295956 p.A1732A CLSTN2 chr3 140558789 140558789 Missense_Mutation T T C TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000458420 p.L658P SLIT2 chr4 20268851 20268851 Missense_Mutation T T C TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000504154 p.L122P CCNH chr5 87394370 87394371 3'UTR - - A TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000256897 TRIM38 chr6 25966787 25966787 Missense_Mutation C C G TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000357085 p.Q89E SYNGAP1 chr6 33456685 33456685 3'UTR C C A TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000629380 EEF1A1 chr6 73518696 73518698 Splice_Site ACC ACC - TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000309268 p.X258_splice NHSL1 chr6 138432390 138432390 Missense_Mutation G G A TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000427025 p.S656F ADGB chr6 146700948 146700948 Missense_Mutation G G T TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000397944 p.V529L CALD1 chr7 134960096 134960096 Silent A A G TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000361675 p.A728A MSR1 chr8 16175253 16175253 Missense_Mutation C C T TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000262101 p.A51T C9orf57 chr9 72060513 72060513 5'UTR G G A TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000377024 FBP2 chr9 94593586 94593586 Silent C C T TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000375337 p.S47S INPP5E chr9 136429684 136429684 Silent G G A TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000371712 p.S642S CDH23 chr10 71706972 71706972 Missense_Mutation G G A TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000224721 p.R1060H PRAP1 chr10 133352475 133352475 3'UTR C C A TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000433452 KAT5 chr11 65712297 65712297 Intron G G A TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000377046 CNTN5 chr11 100071825 100071825 Missense_Mutation A A C TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000524871 p.K474Q IAPP chr12 21373382 21373382 Missense_Mutation A A C TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000240652 p.I11L SCN8A chr12 51765740 51765740 Missense_Mutation G G T TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000354534 p.V872L PDE1B chr12 54573425 54573425 Silent T T C TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000243052 p.L303L ATP2B1 chr12 89624255 89624255 Silent A A T TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000428670 p.V424V POLE chr12 132673267 132673267 Missense_Mutation G G C TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000320574 p.T457R AHNAK2 chr14 104947014 104947014 Missense_Mutation A A G TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000333244 p.F2813L APBA2 chr15 29053988 29053988 Missense_Mutation A A G TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000558259 p.E35G FMN1 chr15 33066577 33066577 Intron C C G TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000559047 DNAH3 chr16 21049574 21049574 Frame_Shift_Del T T - TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000261383 p.I1486Sfs*3 SUPT6H chr17 28695520 28695520 Missense_Mutation G G C TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000314616 p.D1315H ASB16 chr17 44178293 44178293 Missense_Mutation G G C TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000293414 p.R422P ACTG1 chr17 81511260 81511260 Missense_Mutation C C G TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000331925 p.D244H ABCA7 chr19 1049414 1049414 Silent C C T TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000263094 p.N843N ZNF676 chr19 22179954 22179954 Missense_Mutation G G A TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000397121 p.P588L KLK12 chr19 51029422 51029422 Silent G G T TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000319590 p.V209V ZNF765 chr19 53409031 53409031 Silent A A G TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000396408 p.K492K FKBP1A chr20 1369382 1369382 3'Flank A A - TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000381719 SIRPB2 chr20 1476209 1476209 Silent T T A TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000359801 p.A329A SLC4A11 chr20 3230756 3230756 Missense_Mutation C C T TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000380056 p.A436T SLC9A8 chr20 49877985 49877986 Frame_Shift_Del AT AT - TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000361573 p.F363Cfs*9 MICAL3 chr22 17810809 17810809 Missense_Mutation C C T TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000441493 p.R1817K MICAL3 chr22 17821476 17821476 Missense_Mutation G G A TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000441493 p.P1161L PIWIL3 chr22 24719534 24719534 Missense_Mutation C C T TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000332271 p.V863M ODF3B chr22 50531027 50531027 Missense_Mutation C C G TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000329363 p.L150F DGAT2L6 chrX 70205035 70205035 Missense_Mutation C C A TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000333026 p.L315M RPS6KA6 chrX 84117095 84117095 Missense_Mutation C C A TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000262752 p.R305M ZCCHC16 chrX 112455875 112455875 3'UTR A A G TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000340433 GLUD2 chrX 121049474 121049474 3'UTR G G A TCGA-OR-A5K2-01A-11D-A29I-10 ENST00000328078 SLC44A5 chr1 75218542 75218542 Missense_Mutation G G A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000370855 p.P493S DPYD chr1 97098622 97098622 Missense_Mutation C C T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000370192 p.S878N KCND3 chr1 111786990 111786990 Missense_Mutation C C T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000315987 p.R408Q SPTA1 chr1 158672140 158672140 Silent A A G TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000368147 p.H469H C1orf226 chr1 162383426 162383426 Missense_Mutation A A G TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000458626 p.K188E GPR161 chr1 168090664 168090664 Silent C C G TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000367835 p.L368L CDC73 chr1 193141924 193141924 Missense_Mutation C C A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000367435 p.T196N USH2A chr1 215888927 215888927 Silent T T C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000307340 p.L2574L ATAD2B chr2 23863507 23863507 Silent G G C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000238789 p.A451A ALK chr2 29222343 29222343 Splice_Site C C T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000389048 p.X1172_splice POLR1A chr2 86088611 86088611 Missense_Mutation C C T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000263857 p.A229T ANKRD36BP2 chr2 88804443 88804443 RNA G G A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000622311 GPAT2 chr2 96032071 96032071 Missense_Mutation C C G TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000359548 p.V47L AFF3 chr2 99593733 99593733 Missense_Mutation G G C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000409236 p.S643C IL18R1 chr2 102390063 102390063 Missense_Mutation G G T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000233957 p.M319I FBLN7 chr2 112187417 112187417 Missense_Mutation G G C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000331203 p.D411H CLASP1 chr2 121448303 121448303 Missense_Mutation T T A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000263710 p.S572C ERCC3 chr2 127294105 127294105 5'UTR G G C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000285398 MYO7B chr2 127590175 127590175 Missense_Mutation C C A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000409816 p.N646K CCDC74B chr2 130143224 130143224 Intron G G T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000310463 PIKFYVE chr2 208351379 208351379 Missense_Mutation C C G TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000264380 p.P1880R SPAG16 chr2 214410329 214410329 3'UTR C C A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000331683 TMEM169 chr2 216096019 216096019 Missense_Mutation G G A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000295658 p.G19D RNF25 chr2 218668215 218668215 Intron G G C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000295704 KCNH8 chr3 19512973 19512973 Nonsense_Mutation G G T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000328405 p.E695* SCN11A chr3 38925479 38925479 Missense_Mutation G G C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000302328 p.I216M CHMP2B chr3 87245794 87245794 Silent G G A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000263780 p.R69R MYLK chr3 123700367 123700367 Missense_Mutation G G T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000360304 p.T1034N SMC4 chr3 160431146 160431146 Missense_Mutation G G C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000344722 p.E1019Q FXR1 chr3 180970195 180970195 Silent T T A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000357559 p.L480L ATP13A5 chr3 193315041 193315041 Silent A A G TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000342358 p.L697L PIGG chr4 523498 523500 In_Frame_Del CTT CTT - TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000453061 p.L553del SH3D19 chr4 151122100 151122100 Missense_Mutation C C G TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000304527 p.Q788H RAD1 chr5 34913484 34913484 Nonsense_Mutation G G C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000341754 p.S98* EGFLAM chr5 38427019 38427019 Missense_Mutation G G C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000354891 p.L607F CARD6 chr5 40843192 40843192 Frame_Shift_Del G G - TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000254691 p.A110Qfs*13 ELOVL7 chr5 60771969 60771969 Silent T T C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000425382 p.E63E MAP1B chr5 72197164 72197164 Frame_Shift_Del C C - TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000296755 p.L1272Wfs*6 MAP1B chr5 72199354 72199354 Missense_Mutation C C A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000296755 p.T2000K HOMER1 chr5 79376168 79376168 Missense_Mutation C C G TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000334082 p.E302D FAM170A chr5 119629751 119629751 5'UTR A A T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000515256 LECT2 chr5 135954908 135954908 5'UTR G G T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000274507 PCDHB11 chr5 141199967 141199967 Missense_Mutation C C T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000354757 p.R65W PCDHGA5 chr5 141366600 141366600 Missense_Mutation T T G TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000518069 p.V757G SCGB3A2 chr5 147878769 147878769 5'UTR T T G TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000296694 RAB24 chr5 177303338 177303338 5'UTR G G A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000303251 FLT4 chr5 180621131 180621131 Missense_Mutation G G T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000261937 p.D714E NEDD9 chr6 11185420 11185420 Silent G G T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000379446 p.V749V TRIM39 chr6 30335925 30335925 Missense_Mutation G G C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000376656 p.A244P FKBPL chr6 32128780 32128780 Missense_Mutation T T A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000375156 p.K334M PGK2 chr6 49786534 49786534 Silent T T C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000304801 p.A218A DST chr6 56570005 56570007 In_Frame_Del CTT CTT - TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000312431 p.E2319del FILIP1 chr6 75312474 75312474 Missense_Mutation G G C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000237172 p.P1120A BACH2 chr6 89950310 89950310 Missense_Mutation G G A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000257749 p.A599V BACH2 chr6 89950311 89950311 Missense_Mutation C C T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000257749 p.A599T HACE1 chr6 104771339 104771339 Missense_Mutation T T G TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000262903 p.K689Q AHI1 chr6 135404949 135404949 Splice_Site A A C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000265602 p.X996_splice HECW1 chr7 43508953 43508953 Intron T T A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000395891 OGDH chr7 44674534 44674534 Silent C C T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000222673 p.Y304Y LRRD1 chr7 92163944 92163944 Nonsense_Mutation A A C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000430130 p.L420* PARP12 chr7 140037765 140037765 Missense_Mutation G G A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000263549 p.A425V NOS3 chr7 151001305 151001305 Missense_Mutation G G T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000297494 p.K436N SLC20A2 chr8 42437177 42437177 Missense_Mutation G G C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000342228 p.I445M FAM110B chr8 58147344 58147344 3'UTR G G C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000361488 ZNF704 chr8 80641369 80641369 Silent G G A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000327835 p.D412D CHMP4C chr8 81758188 81758188 Missense_Mutation A A G TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000297265 p.N177S MROH5 chr8 141496332 141496332 Missense_Mutation C C T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000621837 p.A84T MPDZ chr9 13192145 13192145 Nonsense_Mutation C C A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000319217 p.E652* IFNA8 chr9 21409581 21409581 Missense_Mutation G G A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000380205 p.M135I PIGO chr9 35092632 35092632 Missense_Mutation C C T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000378617 p.A419T PCSK5 chr9 76295395 76295395 Silent G G A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000545128 p.E1102E OR1K1 chr9 122800177 122800179 In_Frame_Del ACA ACA - TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000277309 p.T20del PAEP chr9 135561814 135561814 Silent C C T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000277508 p.L5L RET chr10 43111217 43111217 Missense_Mutation T T C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000355710 p.V425A ZNF503 chr10 75401186 75401186 Missense_Mutation C C A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000372524 p.K78N PNLIPRP1 chr10 116594791 116594791 Missense_Mutation C C A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000358834 p.A131D TEX36 chr10 125655866 125655866 3'UTR T T C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000368821 FANK1 chr10 126005019 126005019 Silent G G A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000368693 p.V225V OR52N1 chr11 5788484 5788484 Silent C C G TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000317078 p.G111G EIF3M chr11 32602272 32602272 Splice_Region T T G TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000531120 OOSP2 chr11 60040402 60040402 5'UTR G G A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000278855 EML3 chr11 62608744 62608744 Missense_Mutation C C T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000394773 p.D331N CCDC88B chr11 64344466 64344466 Missense_Mutation G G C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000356786 p.R642T DPP3 chr11 66504628 66504628 Missense_Mutation G G A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000541961 p.G632E RBM14 chr11 66616946 66616946 Missense_Mutation C C G TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000310137 p.L76V OR2AT4 chr11 75089200 75089200 Missense_Mutation C C G TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000305159 p.A172P KMT2A chr11 118473788 118473788 Missense_Mutation G G C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000389506 p.D877H FLI1 chr11 128807183 128807183 Missense_Mutation C C A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000527786 p.P242H CACNA1C chr12 2504849 2504849 Missense_Mutation A A G TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000347598 p.D374G CLEC4C chr12 7729727 7729727 Missense_Mutation C C A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000360345 p.G171C A2ML1 chr12 8843326 8843326 Missense_Mutation G G A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000299698 p.A481T BCAT1 chr12 24849868 24849868 Missense_Mutation T T G TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000261192 p.T198P ITPR2 chr12 26656354 26656354 Missense_Mutation A A C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000381340 p.V796G AQP2 chr12 49951072 49951072 Missense_Mutation T T A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000199280 p.V81D OR6C1 chr12 55321188 55321188 Nonsense_Mutation G G T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000379668 p.G197* OR6C1 chr12 55321189 55321189 Missense_Mutation G G T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000379668 p.G197V CNPY2 chr12 56311396 56311396 Missense_Mutation C C G TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000273308 p.E75Q NAB2 chr12 57092545 57092546 Frame_Shift_Del GA GA - TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000300131 p.S354Hfs*14 LRP1 chr12 57183424 57183424 Missense_Mutation G G T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000243077 p.G1903V SLC6A15 chr12 84863496 84863496 Silent A A T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000266682 p.A587A EEA1 chr12 92809051 92809051 Missense_Mutation C C T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000322349 p.E769K ADGRD1 chr12 131108735 131108735 Missense_Mutation A T T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000261654 p.Q633H SUPT16H chr14 21371920 21371920 Missense_Mutation T T C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000216297 p.E95G MIPOL1 chr14 37267038 37267038 Silent G G T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000327441 p.R40R YLPM1 chr14 74798819 74798819 Silent A A G TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000325680 p.G1174G IFT43 chr14 75985811 75985811 Missense_Mutation G G C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000314067 p.E9Q ISM2 chr14 77484714 77484714 Missense_Mutation G G A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000342219 p.A116V SNW1 chr14 77737044 77737044 Missense_Mutation T T A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000261531 p.N189Y ZNF770 chr15 34983200 34983200 Silent G G A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000356321 p.L79L AKAP13 chr15 85743666 85743666 Missense_Mutation C C A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000394518 p.H2745N MAN2A2 chr15 90907406 90907406 Silent A A G TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000360468 p.Q369Q TMC7 chr16 19044954 19044954 Missense_Mutation G G C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000304381 p.D470H MC1R chr16 89919494 89919494 Missense_Mutation G G A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000555147 p.C79Y FXR2 chr17 7595993 7595993 Missense_Mutation G G T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000250113 p.T221K CCL7 chr17 34271864 34271864 3'UTR T T C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000378569 SPHK1 chr17 76387351 76387353 In_Frame_Del AGA AGA - TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000392496 p.K308del MYADML2 chr17 81941235 81941235 Silent G G A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000330655 p.I169I RAX chr18 59272473 59272474 Frame_Shift_Ins - - T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000334889 p.T144Nfs*7 IZUMO4 chr19 2098828 2098828 Intron T T A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000395301 IZUMO4 chr19 2098829 2098829 Intron C C A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000395301 MYO1F chr19 8539990 8539990 Missense_Mutation C C T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000338257 p.G550E SPHK2 chr19 48628717 48628717 Missense_Mutation C C G TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000245222 p.N303K KCNA7 chr19 49070132 49070132 Silent G G A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000221444 p.D434D LILRB1 chr19 54633033 54633033 Missense_Mutation G G T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000324602 p.V326F EPB41L1 chr20 36188364 36188364 Silent C C T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000338074 p.D297D SLA2 chr20 36614308 36614308 Missense_Mutation T T C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000262866 p.D221G KIAA1755 chr20 38241430 38241430 Missense_Mutation G G T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000279024 p.A234D ETS2 chr21 38817025 38817025 Nonsense_Mutation G G T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000360214 p.E175* TRIOBP chr22 37734999 37734999 Missense_Mutation C C A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000406386 p.P1555T MCHR1 chr22 40679518 40679518 Missense_Mutation A A G TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000249016 p.T25A BRD1 chr22 49804361 49804361 Splice_Site C C A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000216267 p.X456_splice CHKB chr22 50581478 50581478 Missense_Mutation G G T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000406938 p.H175N PHEX chrX 22099009 22099009 Missense_Mutation G G C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000379374 p.D313H KLHL15 chrX 23988474 23988474 Missense_Mutation C C A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000328046 p.G421V FAM47C chrX 37009956 37009956 Missense_Mutation G G C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000358047 p.E516Q GPR82 chrX 41727245 41727245 Missense_Mutation C C G TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000302548 p.I73M IQSEC2 chrX 53254882 53254882 Missense_Mutation G G C TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000396435 p.A350G HUWE1 chrX 53589651 53589651 Missense_Mutation C C T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000262854 p.E1453K NXF4 chrX 102568460 102568460 RNA C C A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000360035 COL4A6 chrX 108204320 108204320 Missense_Mutation C C A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000372216 p.K261N OCRL chrX 129588920 129588920 Silent C C A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000371113 p.L792L APLN chrX 129648674 129648674 Missense_Mutation G G T TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000429967 p.F62L FRMD7 chrX 132127864 132127864 5'UTR C C A TCGA-OR-A5J4-01A-11D-A29I-10 ENST00000298542 SKI chr1 2303896 2303896 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000378536 p.P423L FBXO6 chr1 11668750 11668750 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000376753 p.R31H FHAD1 chr1 15374623 15374623 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000358897 p.R1168H CASP9 chr1 15493946 15493946 Silent G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000333868 p.D368D UBR4 chr1 19153319 19153319 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000375254 p.R2272C WNT4 chr1 22120090 22120090 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000290167 p.R339Q PIGV chr1 26794913 26794913 Silent G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000078527 p.P293P HDAC1 chr1 32326970 32326970 Silent G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000373548 p.T129T AGO3 chr1 35972036 35972036 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000373191 p.V109I SMAP2 chr1 40406739 40406739 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000372718 p.P36L PTPRF chr1 43591852 43591852 Silent G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000359947 p.S524S ZNF326 chr1 89994145 89994145 5'Flank C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000340281 GSTM5 chr1 109708557 109708557 5'Flank A G G TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000256593 RPTN chr1 152156213 152156213 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000316073 p.G296S CLK2 chr1 155268782 155268782 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000368361 p.R138Q PEAR1 chr1 156912952 156912952 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000292357 p.R798C RABGAP1L chr1 174701127 174701127 Intron C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000251507 ASTN1 chr1 176864358 176864358 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000361833 p.D1271N ZNF648 chr1 182056638 182056638 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000339948 p.A458V HMCN1 chr1 185987528 185987528 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000271588 p.S1011F CFH chr1 196690151 196690151 Silent C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000367429 p.C416C ASPM chr1 197090894 197090894 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000367409 p.R3198C KCNH1 chr1 210683401 210683401 Silent C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000271751 p.Q950Q USH2A chr1 216200033 216200033 Missense_Mutation C G G TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000307340 p.R1135S OBSCN chr1 228315864 228315864 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000422127 p.R4344W ZBTB18 chr1 244055080 244055080 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000622512 p.R427C MPV17 chr2 27313058 27313058 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000233545 p.R41Q MSH6 chr2 47799466 47799466 Nonsense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000234420 p.R495* PSME4 chr2 53931908 53931908 Missense_Mutation G T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000404125 p.L415I GMCL1 chr2 69869754 69869754 Silent C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000282570 p.F418F DNAH6 chr2 84672334 84672334 Silent G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000237449 p.P2154P BCL2L11 chr2 111164187 111164187 Nonsense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000393256 p.R185* IL1RN chr2 113127701 113127701 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000409930 p.R26Q AL078621.1 chr2 113597540 113597540 3'Flank T T C TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000613451 NCKAP5 chr2 132784333 132784333 Silent A T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000409261 p.P826P DLX1 chr2 172086759 172086759 Missense_Mutation T C C TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000361725 p.L140S TTN chr2 178728155 178728155 Missense_Mutation T C C TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000591111 p.N6240D COL5A2 chr2 189083985 189083985 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000374866 p.P284L MFSD6 chr2 190437158 190437158 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000281416 p.V377I C3orf20 chr3 14682901 14682901 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000253697 p.P63L SUSD5 chr3 33175050 33175050 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000309558 p.S145L TRANK1 chr3 36831601 36831601 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000429976 p.R2617H DLEC1 chr3 38039418 38039418 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000308059 p.R65C PTPN23 chr3 47412153 47412153 Missense_Mutation A G G TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000265562 p.Y1378C AMT chr3 49422209 49422209 Silent C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000273588 p.A51A SEMA3F chr3 50174248 50174248 Silent C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000002829 p.F118F DNAH1 chr3 52391297 52391297 Missense_Mutation A G G TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000420323 p.D3287G STAB1 chr3 52502650 52502650 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000321725 p.G169E STAB1 chr3 52519324 52519324 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000321725 p.G1699S ITIH1 chr3 52786410 52786410 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000273283 p.T570I PRICKLE2 chr3 64099788 64099788 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000295902 p.R600W LRIG1 chr3 66380200 66380200 3'UTR G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000273261 FILIP1L chr3 99924369 99924369 Nonsense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000354552 p.R156* MYH15 chr3 108455742 108455742 Missense_Mutation G C C TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000273353 p.I772M ZBTB20 chr3 114351731 114351731 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000474710 p.R116H COL6A5 chr3 130405594 130405594 Nonsense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000312481 p.R1430* ARMC8 chr3 138223678 138223678 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000469044 p.R127Q MAEA chr4 1312004 1312004 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000303400 p.R32H LETM1 chr4 1834877 1834877 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000302787 p.A282T ANAPC4 chr4 25418322 25418322 Silent C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000315368 p.A789A SRP72 chr4 56484784 56484784 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000342756 p.E336K CENPC chr4 67493872 67493872 Intron A A G TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000273853 COL25A1 chr4 108889234 108889234 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000399132 p.R321H FABP2 chr4 119319564 119319564 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000274024 p.R107Q IRF2 chr4 184419534 184419534 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000393593 p.A41V FAT1 chr4 186708512 186708512 Missense_Mutation G G T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000441802 p.T439K SLC12A7 chr5 1089068 1089068 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000264930 p.V135I PARP8 chr5 50795083 50795083 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000281631 p.R365H DEPDC1B chr5 60603548 60603548 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000265036 p.R362H SGTB chr5 65704296 65704296 Silent T T G TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000381007 p.A119A GCNT4 chr5 75029405 75029405 Silent C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000322348 p.S211S CKMT2 chr5 81252738 81252738 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000254035 p.E66K HAPLN1 chr5 83641591 83641591 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000274341 p.R324C LMNB1 chr5 126818969 126818969 Silent T T C TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000261366 p.A329A PCDHB11 chr5 141202041 141202041 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000354757 p.T756M CDX1 chr5 150183699 150183699 3'UTR C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000231656 TCOF1 chr5 150376188 150376188 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000377797 p.R667Q RNF145 chr5 159168946 159168946 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000424310 p.V350I GABRB2 chr5 161330951 161330951 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000274547 p.R337C TENM2 chr5 168247401 168247401 Silent C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000518659 p.F2154F FAM193B chr5 177524843 177524843 Silent C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000514747 p.T546T MAML1 chr5 179766192 179766192 Silent C C A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000292599 p.S394S JARID2 chr6 15501110 15501110 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000341776 p.R717W GPANK1 chr6 31662564 31662564 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000375906 p.P258L TREML2 chr6 41198180 41198180 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000483722 p.R102Q SLC35B2 chr6 44254775 44254775 Silent G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000393812 p.Y410Y BEND3 chr6 107069630 107069630 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000369042 p.R521W TULP4 chr6 158479751 158479751 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000367097 p.R343C DNAAF5 chr7 740848 740848 Silent C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000297440 p.G270G SDK1 chr7 4129979 4129979 Silent G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000404826 p.S1337S PHKG1 chr7 56082180 56082180 Silent G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000297373 p.Y207Y GTPBP10 chr7 90352863 90352863 Silent C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000222511 p.S27S POLR2J chr7 102478891 102478891 5'UTR G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000292614 GPR85 chr7 113083507 113083507 3'UTR C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000297146 PLXNA4 chr7 132228396 132228396 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000321063 p.R560W KMT2C chr7 152167367 152167367 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000262189 p.R3177C SGK223 chr8 8328227 8328227 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000622241 p.S852L SOX7 chr8 10726403 10726403 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000304501 p.G168S DLC1 chr8 13092709 13092709 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000276297 p.V1215I SH2D4A chr8 19364198 19364198 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000265807 p.R278H ENTPD4 chr8 23444519 23444519 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000358689 p.A167V AC022616.1 chr8 43363034 43363034 3'Flank A A G TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000583014 YTHDF3 chr8 63186705 63186705 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000539294 p.A232T PREX2 chr8 68027248 68027248 Missense_Mutation G G T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000288368 p.K156N OSR2 chr8 98949455 98949455 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000297565 p.T168M RIMS2 chr8 104251627 104251627 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000262231 p.R1125H UTP23 chr8 116766610 116766610 Missense_Mutation A A T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000309822 p.I3F PLEC chr8 143920799 143920799 Nonsense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000322810 p.R3145* LRRC14 chr8 144519767 144519767 Silent G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000292524 p.Q14Q TESK1 chr9 35609539 35609539 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000336395 p.R560W FBXO10 chr9 37516030 37516030 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000432825 p.R857H ANXA1 chr9 73159368 73159368 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000257497 p.R72Q SPATA31E1 chr9 87888590 87888590 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000325643 p.R1368H HABP4 chr9 96490061 96490061 3'UTR G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000375249 GABBR2 chr9 98496443 98496443 Silent G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000259455 p.N234N ADGRD2 chr9 124477075 124477075 Intron G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000334810 SEC16A chr9 136459783 136459783 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000313050 p.T1722M C9orf172 chr9 136844594 136844594 Silent C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000436881 p.D60D ITIH5 chr10 7566394 7566394 Silent G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000397146 p.N721N MLLT10 chr10 21682256 21682256 Splice_Region C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000307729 p.N566N OTUD1 chr10 23441952 23441952 3'UTR T T C TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000376495 KIAA1217 chr10 24543576 24543576 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000376454 p.V1436M KIAA1462 chr10 30026328 30026328 Silent G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000375377 p.L1274L PARD3 chr10 34111255 34111255 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000374789 p.R1329W GDF10 chr10 47310466 47310466 Silent G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000580279 p.A330A JMJD1C chr10 63215449 63215449 Missense_Mutation A G G TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000399262 p.Y277H MICU1 chr10 72475257 72475257 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000361114 p.R259H GRID1 chr10 85619983 85619983 Silent G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000327946 p.Y748Y MYOF chr10 93343905 93343905 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000359263 p.R1426Q XPNPEP1 chr10 109873404 109873404 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000502935 p.R472Q C10orf120 chr10 122699392 122699392 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000329446 p.R66K NRIP3 chr11 8988260 8988260 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000309166 p.R66K PLEKHA7 chr11 16816808 16816808 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000355661 p.A620T MRGPRX4 chr11 18173902 18173902 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000314254 p.V216M SMTNL1 chr11 57545961 57545961 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000399154 p.R296H C11orf95 chr11 63763811 63763811 Silent G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000433688 p.D548D RPS6KA4 chr11 64360244 64360244 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000334205 p.A70V GAL3ST3 chr11 66043248 66043248 Silent G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000312006 p.R185R SPTBN2 chr11 66715883 66715883 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000309996 p.R86W PIWIL4 chr11 94607603 94607603 Silent C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000299001 p.C601C ATM chr11 108227691 108227691 Nonsense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000278616 p.R23* SORL1 chr11 121588061 121588061 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000260197 p.R1286C CACNA2D4 chr12 1797432 1797432 Silent G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000382722 p.C1033C NRIP2 chr12 2828030 2828030 Missense_Mutation A A G TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000337508 p.L199P CD9 chr12 6233455 6233455 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000009180 p.A106V CDCA3 chr12 6845894 6845894 3'Flank C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000535406 GPRC5A chr12 12912574 12912574 3'UTR C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000014914 ABCC9 chr12 21809895 21809895 Silent A A G TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000261201 p.I1424I ITPR2 chr12 26340270 26340270 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000381340 p.G2639D ITPR2 chr12 26632011 26632011 Missense_Mutation T T C TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000381340 p.Q930R ALG10 chr12 34026956 34026957 3'UTR - - C TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000266483 PLEKHA8P1 chr12 45173309 45173309 RNA C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000256692 KMT2D chr12 49026390 49026390 Silent C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000301067 p.L5192L DHH chr12 49089937 49089937 Silent G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000266991 p.P371P DHH chr12 49090206 49090206 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000266991 p.A282T KRT7 chr12 52233542 52233542 Silent C C A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000331817 p.P82P KRT77 chr12 52694751 52694751 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000341809 p.V319I LRP1 chr12 57187292 57187292 Silent C C A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000243077 p.A2289A LRP1 chr12 57190902 57190902 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000243077 p.R2377C KIF5A chr12 57572088 57572088 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000455537 p.E464K MON2 chr12 62546981 62546981 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000393630 p.V888M MDM2 chr12 68816848 68816848 Nonsense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000258149 p.R71* NAV3 chr12 78122187 78122187 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000397909 p.P1333S MGAT4C chr12 85983534 85983534 Missense_Mutation A A G TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000548651 p.L95S CEP290 chr12 88086082 88086082 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000552810 p.R1465Q RBM19 chr12 113823215 113823215 3'UTR G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000261741 RNFT2 chr12 116836180 116836180 Splice_Site G G C TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000257575 p.X367_splice FBXW8 chr12 117028060 117028060 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000309909 p.A562V GCN1L1 chr12 120176190 120176190 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000300648 p.T289M RHOF chr12 121779578 121779578 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000267205 p.R186W SETD1B chr12 121823729 121823729 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000604567 p.T1717M VPS37B chr12 122867252 122867252 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000267202 p.P241L ZNF664 chr12 124012127 124012127 5'UTR C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000337815 AACS chr12 125142258 125142258 3'UTR G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000316519 ZNF10 chr12 133156978 133156978 3'UTR G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000248211 SLC7A1 chr13 29514537 29514537 Silent C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000380752 p.A611A ARL11 chr13 49630588 49630588 Silent C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000282026 p.N47N ATP11A chr13 112862472 112862472 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000375645 p.R963H RNASE4 chr14 20700157 20700157 3'Flank C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000397995 IRF9 chr14 24162172 24162172 Nonsense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000396864 p.R10* RPL10L chr14 46651536 46651536 Silent G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000298283 p.A67A NID2 chr14 52011601 52011601 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000216286 p.R1168H DACT1 chr14 58647100 58647100 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000335867 p.R826Q NUMB chr14 73277289 73277289 Silent G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000355058 p.T415T TCL6 chr14 95668552 95668552 RNA G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000497248 AHNAK2 chr14 104950075 104950075 Silent G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000333244 p.D1792D CYFIP1 chr15 22932242 22932242 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000610365 p.A364V NPAP1 chr15 24681944 24681944 3'UTR T C C TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000329468 PGBD4 chr15 34104175 34104175 Silent C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000397766 p.Y548Y DUOX2 chr15 45101912 45101912 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000603300 p.S911L TLN2 chr15 62771055 62771090 In_Frame_Del TGCTGGACCAGACCAAGACTCTCGCAGAGTCTGCCT TGCTGGACCAGACCAAGACTCTCGCAGAGTCTGCCT - TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000306829 p.L1764_L1775del IGDCC3 chr15 65329782 65329782 Silent G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000327987 p.I647I CYP11A1 chr15 74339667 74339667 Silent C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000268053 p.A359A RASGRF1 chr15 79031429 79031429 Silent G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000419573 p.Y411Y MESDC2 chr15 80979457 80979457 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000261758 p.R156H MIR6859-4 chr16 16975 16975 3'Flank C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000615957 PRR25 chr16 807545 807545 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000301698 p.P181L C16orf59 chr16 2464192 2464192 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000361837 p.R373Q PAQR4 chr16 2971278 2971278 Silent C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000318782 p.S96S ZNF205 chr16 3120138 3120138 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000219091 p.A493V ZNF213 chr16 3141158 3141158 Silent C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000396878 p.G397G DNAJA3 chr16 4455571 4455571 3'UTR C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000262375 ZNF500 chr16 4752834 4752834 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000219478 p.E329K GTF3C1 chr16 27471904 27471904 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000356183 p.R1457Q ZNF785 chr16 30582937 30582937 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000395216 p.E281K STX1B chr16 30993224 30993224 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000215095 p.R231H PRSS8 chr16 31132510 31132510 Silent G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000317508 p.D208D VPS35 chr16 46663152 46663152 Nonsense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000299138 p.W553* PHKB chr16 47610891 47610891 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000323584 p.R477C KATNB1 chr16 57741746 57741746 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000379661 p.R34W CDH16 chr16 66910391 66910391 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000299752 p.R679H CDH16 chr16 66912724 66912724 Nonsense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000299752 p.R408* ENKD1 chr16 67663468 67663468 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000243878 p.R278C COG8 chr16 69339307 69339307 Silent C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000306875 p.L82L PKD1L3 chr16 71942720 71942720 Silent G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000620267 p.N1388N HPR chr16 72074341 72074341 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000540303 p.R50H GLG1 chr16 74457881 74457881 Silent G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000422840 p.R1086R KARS chr16 75631803 75631803 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000302445 p.R323Q FOXC2 chr16 86568699 86568699 Missense_Mutation A A G TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000320354 p.N455S ANKRD11 chr16 89280551 89280551 Silent C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000301030 p.A1997A SPG7 chr16 89544709 89544709 Silent C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000268704 p.D462D PRPF8 chr17 1658320 1658320 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000304992 p.R1813H SGSM2 chr17 2362259 2362259 Silent G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000426855 p.A149A ATP2A3 chr17 3937507 3937507 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000352011 p.V744M AIPL1 chr17 6425730 6425730 Silent C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000381129 p.P295P KIAA0753 chr17 6624780 6624780 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000361413 p.R267Q TP53 chr17 7670699 7670699 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000269305 p.R337H EVPLL chr17 18383330 18383330 Silent C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000399134 p.D244D MYO18A chr17 29092390 29092390 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000527372 p.E1714K KRT12 chr17 40862589 40862589 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000251643 p.A455T PTRF chr17 42422920 42422920 Missense_Mutation T C C TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000357037 p.K60E ASB16 chr17 44177212 44177212 Silent G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000293414 p.A348A NGFR chr17 49512813 49512813 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000172229 p.A363V ABCC3 chr17 50663982 50663982 Silent G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000285238 p.A403A KIAA0195 chr17 75488784 75488784 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000314256 p.P213L RHBDF2 chr17 76481590 76481590 Intron C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000313080 DNAH17 chr17 78574757 78574757 Missense_Mutation T C C TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000389840 p.I101V PCYT2 chr17 81907580 81907580 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000538936 p.R171W FASN chr17 82081742 82081742 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000306749 p.A2089T GREB1L chr18 21401202 21401202 Silent G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000424526 p.T195T LAMA3 chr18 23876338 23876338 Silent C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000313654 p.T1681T SETBP1 chr18 44951309 44951309 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000282030 p.V657M NDUFS7 chr19 1393180 1393180 Intron C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000233627 AP3D1 chr19 2129404 2129404 Missense_Mutation T C C TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000345016 p.K216E TJP3 chr19 3734402 3734402 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000541714 p.R318Q KDM4B chr19 5143972 5143972 Silent C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000159111 p.C852C SLC25A23 chr19 6452321 6452321 Silent G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000301454 p.A354A TNPO2 chr19 12703476 12703476 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000425528 p.V721I PRDX2 chr19 12799916 12799916 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000301522 p.V152M NR2F6 chr19 17232559 17232559 Silent G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000291442 p.T336T NR2C2AP chr19 19202338 19202338 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000331552 p.S99L CHST8 chr19 33772572 33772572 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000262622 p.E262K RYR1 chr19 38440861 38440861 Silent G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000359596 p.A54A AXL chr19 41220662 41220662 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000301178 p.V38M IRGQ chr19 43592664 43592664 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000422989 p.A412T ZNF225 chr19 44131857 44131857 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000262894 p.R415C ZNF473 chr19 50046682 50046682 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000270617 p.R747C TMC4 chr19 54165448 54165448 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000617472 p.R312C NLRP5 chr19 56033552 56033552 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000390649 p.A820T ZNF135 chr19 58068357 58068357 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000313434 p.R625W ZNF324 chr19 58471417 58471417 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000196482 p.G309S SLC4A11 chr20 3229396 3229396 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000380056 p.A616V SIGLEC1 chr20 3692564 3692564 Silent G G T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000344754 p.A1329A PLCB1 chr20 8628406 8628406 Missense_Mutation T T G TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000338037 p.V120G ISM1 chr20 13288655 13288655 Silent G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000262487 p.S253S RBBP9 chr20 18490436 18490436 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000337227 p.A98V CST9 chr20 23605650 23605650 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000376971 p.R72H EFCAB8 chr20 32893272 32893272 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000400522 p.R286H NCOA6 chr20 34741862 34741862 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000359003 p.S1465L ADA chr20 44622605 44622605 Silent C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000372874 p.T276T PREX1 chr20 48625779 48625779 3'UTR G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000371941 ZBP1 chr20 57611776 57611776 Silent G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000371173 p.H275H SLMO2 chr20 59036542 59036542 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000355937 p.V132M CDH4 chr20 61773093 61773093 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000614565 p.G163R RTEL1 chr20 63666066 63666066 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000370018 p.G201R RTEL1 chr20 63678320 63678320 Silent C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000370018 p.D337D GRIK1 chr21 29689926 29689926 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000399907 p.V116I RRP1B chr21 43687916 43687916 Silent G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000340648 p.P514P TUBA8 chr22 18126597 18126597 Missense_Mutation G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000330423 p.E207K DGCR8 chr22 20086222 20086222 Missense_Mutation A A G TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000351989 p.I87V C22orf15 chr22 23763236 23763236 5'UTR G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000402217 PIWIL3 chr22 24754122 24754122 Missense_Mutation C T T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000332271 p.R290Q SFI1 chr22 31575303 31575303 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000400288 p.R332Q TRIOBP chr22 37725758 37725758 Nonsense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000406386 p.R1068* ALG12 chr22 49913785 49913785 5'UTR G A A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000330817 PPP6R2 chr22 50406740 50406740 Silent C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000216061 p.S93S MXRA5 chrX 3310750 3310750 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000217939 p.V2485I CA5BP1 chrX 15702786 15702786 RNA C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000380334 CDKL5 chrX 18507113 18507113 Missense_Mutation T T G TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000379989 p.I6S NYX chrX 41474587 41474587 Silent C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000342595 p.F378F RBM10 chrX 47180484 47180484 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000377604 p.A409V GATA1 chrX 48791272 48791272 Missense_Mutation G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000376670 p.A55T TSPYL2 chrX 53083075 53083075 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000375442 p.R193W TRO chrX 54925044 54925044 Silent A A G TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000173898 p.E487E TCEAL2 chrX 102127428 102127428 Missense_Mutation G G T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000329035 p.D200Y ZCCHC18 chrX 104114070 104114070 5'UTR G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000537356 FRMPD3 chrX 107554466 107554466 Missense_Mutation C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000276185 p.R275C COL4A5 chrX 108568770 108568770 Silent C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000361603 p.G111G SLC6A14 chrX 116451443 116451443 Missense_Mutation T T C TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000598581 p.V311A SLC25A5 chrX 119468485 119468485 5'UTR C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000317881 BCORL1 chrX 130056076 130056076 Silent C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000218147 p.Y1692Y FHL1 chrX 136210072 136210072 3'UTR T T G TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000345434 TMEM185A chrX 149603903 149603903 Intron G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000600449 MAMLD1 chrX 150470776 150470776 Silent C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000262858 p.P401P HAUS7 chrX 153470492 153470492 Silent G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000370211 p.S32S FLNA chrX 154359636 154359636 Silent G G A TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000369850 p.S1330S AJ271736.1 chrX 156025292 156025292 3'Flank C C T TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000616415 AJ271736.1 chrX 156025371 156025371 3'Flank C C G TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000616415 AJ271736.1 chrX 156025397 156025397 3'Flank C G G TCGA-OR-A5K4-01A-11D-A29I-10 ENST00000616415 TTLL10 chr1 1181740 1181740 Splice_Site G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000379289 p.X252_splice CCNL2 chr1 1398653 1398653 Nonsense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000400809 p.Q103* GNB1 chr1 1815757 1815757 Splice_Region T T G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000378609 p.R68R PANK4 chr1 2508916 2508916 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000378466 p.A751A PANK4 chr1 2514446 2514446 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000378466 p.A465A PRDM16 chr1 3412048 3412048 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000270722 p.T617T TP73 chr1 3723366 3723366 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000378295 p.P210L CCDC27 chr1 3752537 3752537 Frame_Shift_Del G G - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000294600 p.E20Kfs*190 CHD5 chr1 6136796 6136796 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262450 p.L836L DNAJC11 chr1 6701856 6701856 5'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377577 CAMTA1 chr1 7663732 7663732 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000303635 p.Q395H PER3 chr1 7809922 7809922 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361923 p.Y423* VPS13D chr1 12279539 12279539 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000620676 p.L1497L VPS13D chr1 12416779 12416779 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000620676 p.G4095G PRAMEF1 chr1 12794182 12794182 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000332296 p.L185L PRAMEF11 chr1 12827703 12827703 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000619922 p.P141T PRAMEF2 chr1 12859078 12859078 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000240189 p.L23F PRAMEF18 chr1 13225168 13225168 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000624297 p.V187M RP11-219C24.6 chr1 13305967 13305967 RNA G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000437300 RP11-219C24.6 chr1 13306795 13306795 RNA G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000437300 PRAMEF19 chr1 13371071 13371071 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000376101 p.K79N PRAMEF17 chr1 13389823 13389823 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000376098 p.V56L PRAMEF20 chr1 13418488 13418488 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000316412 p.L218L ATP13A2 chr1 16986935 16986935 Silent T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000326735 p.T1035T PADI3 chr1 17267834 17267834 Splice_Region C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000375460 PADI4 chr1 17363865 17363865 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000375448 PAX7 chr1 18691912 18691912 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000420770 p.E249* ALDH4A1 chr1 18882605 18882605 Intron T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000290597 PLA2G5 chr1 20089853 20089853 Nonsense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000375108 p.Q84* VWA5B1 chr1 20343135 20343135 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000375079 p.P790T VWA5B1 chr1 20353801 20353801 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000375079 p.A1067A LDLRAD2 chr1 21812321 21812321 5'UTR G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000344642 HSPG2 chr1 21852743 21852743 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000374695 p.L2227L FAM110D chr1 26162256 26162256 3'UTR C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000374268 CNKSR1 chr1 26183256 26183256 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000374253 p.Q228H WDTC1 chr1 27301385 27301385 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000319394 p.P464P MECR chr1 29194061 29194061 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000263702 p.M361I PTPRU chr1 29317760 29317760 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000345512 p.V1186F PUM1 chr1 30974757 30974757 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000257075 p.G467V PUM1 chr1 31065768 31065769 5'Flank - - G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000257075 ADGRB2 chr1 31731319 31731319 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373658 p.V1287V PTP4A2 chr1 31908852 31908852 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000344035 p.*168* LCK chr1 32275415 32275415 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000336890 p.E125* HMGB4 chr1 33864205 33864205 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000519684 p.I5N C1orf94 chr1 34197353 34197353 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000488417 p.S150Y RSPO1 chr1 37612865 37612865 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000356545 p.A228T MACF1 chr1 39084271 39084271 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000372915 p.R18L MACF1 chr1 39353012 39353012 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000372915 p.K3740N HIVEP3 chr1 41580296 41580296 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000247584 p.S1501I HIVEP3 chr1 41581623 41581623 Silent A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000247584 p.L1059L MPL chr1 43352576 43352577 Frame_Shift_Ins - - C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000372470 p.K573Qfs*40 PTPRF chr1 43597878 43597878 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000359947 p.A648A PTPRF chr1 43597879 43597879 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000359947 p.V649L ELAVL4 chr1 50145145 50145145 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371823 p.F66F ELAVL4 chr1 50193816 50193816 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371823 p.V136F DNAJC6 chr1 65364632 65364632 Splice_Region C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000395325 WDR78 chr1 66840597 66840597 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371026 p.E456K LRRC7 chr1 69919783 69919783 Intron G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000035383 LRRC7 chr1 69980433 69980433 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000035383 p.A218S LRRC7 chr1 70038483 70038483 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000035383 p.P849T LRRC7 chr1 70039662 70039662 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000035383 p.D1242N SRSF11 chr1 70235500 70235500 Splice_Site G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370950 p.X181_splice PTGER3 chr1 70971701 70971701 3'UTR G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000306666 LRRIQ3 chr1 74041910 74041910 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000354431 p.V341L LHX8 chr1 75157033 75157033 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000294638 p.P317P ASB17 chr1 75932168 75932168 Missense_Mutation A A C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000284142 p.C42G ST6GALNAC3 chr1 76412213 76412213 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000328299 p.P140L AK5 chr1 77521902 77521902 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000354567 p.Y463N ADGRL4 chr1 78938121 78938121 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370742 p.T185T ADGRL2 chr1 81907049 81907049 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370717 p.V36L PRKACB chr1 84184043 84184043 Nonsense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370689 p.K82* LPAR3 chr1 84814050 84814050 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370611 p.S286S ODF2L chr1 86376235 86376235 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000317336 p.Q270E GBP4 chr1 89186371 89186371 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000355754 p.L557I ZNF644 chr1 90941113 90941113 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000337393 p.D81Y HFM1 chr1 91401053 91401053 Silent A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370425 p.S10S TGFBR3 chr1 91716592 91716592 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000212355 p.L561L TGFBR3 chr1 91727657 91727657 Splice_Site A A - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000212355 p.X295_splice SNX7 chr1 98698714 98698714 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000306121 p.D283N LPPR4 chr1 99299151 99299151 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370185 p.N219Y LPPR4 chr1 99305983 99305983 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370185 p.T422I LPPR4 chr1 99306183 99306183 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370185 p.G489W LPPR4 chr1 99306477 99306477 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370185 p.G587C LPPR4 chr1 99306702 99306702 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370185 p.E662* SASS6 chr1 100123277 100123277 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000287482 p.R47C TRMT13 chr1 100140889 100140889 Missense_Mutation T T G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370141 p.L180R CDC14A chr1 100499073 100499073 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000336454 p.Q522H S1PR1 chr1 101240609 101240609 3'UTR C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000305352 COL11A1 chr1 102879838 102879838 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370096 p.R1707R COL11A1 chr1 102898149 102898149 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370096 p.G1426G NTNG1 chr1 107407731 107407731 Intron A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370068 NTNG1 chr1 107480809 107480809 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370068 p.L530Q VAV3 chr1 107596341 107596341 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370056 p.E741* VAV3 chr1 107874967 107874967 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370056 p.T85T NBPF4 chr1 108223620 108223620 3'UTR C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000415641 FAM102B chr1 108628199 108628199 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370035 p.E197* PRPF38B chr1 108699883 108699883 Missense_Mutation A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370025 p.R502G AMIGO1 chr1 109507549 109507549 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369862 p.G455Afs*124 GPR61 chr1 109543368 109543368 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000404129 p.R116C GNAT2 chr1 109606008 109606008 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000351050 p.S228C EPS8L3 chr1 109751632 109751632 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361965 KCNC4 chr1 110223731 110223731 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369787 p.A482A FAM19A3 chr1 112724061 112724061 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361886 p.P105Q VANGL1 chr1 115663687 115663687 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000310260 p.T77T ZNF697 chr1 119622805 119622805 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000421812 p.R513L ADAM30 chr1 119893960 119893960 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369400 ITGA10 chr1 145902017 145902017 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369304 p.G385V ITGA10 chr1 145902018 145902018 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369304 p.G385R GJA8 chr1 147908127 147908127 Nonsense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369235 p.Q58* PDE4DIP chr1 149018586 149018586 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369354 p.Q1899E PDE4DIP chr1 149029787 149029787 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369354 p.G2272* PDE4DIP chr1 149031962 149031962 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369354 p.L2340M PSMD4 chr1 151264005 151264005 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368884 p.C87R POGZ chr1 151405374 151405374 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000271715 p.R1221G POGZ chr1 151429659 151429659 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000271715 p.G171A RPTN chr1 152156957 152156957 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000316073 p.P48S FLG chr1 152307593 152307593 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368799 p.T2431T FLG chr1 152310591 152310591 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368799 p.G1432V FLG2 chr1 152351399 152351399 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000388718 p.A2129A FLG2 chr1 152353888 152353888 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000388718 p.Y1300N FLG2 chr1 152354180 152354180 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000388718 p.S1202S FLG2 chr1 152354571 152354571 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000388718 p.R1072Lfs*155 FLG2 chr1 152354572 152354572 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000388718 p.R1072S FLG2 chr1 152357235 152357235 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000388718 p.S184F CRNN chr1 152409537 152409537 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000271835 C1orf68 chr1 152720411 152720411 3'UTR A A C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368775 SPRR2D chr1 153040330 153040330 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000360379 p.Q6L ILF2 chr1 153670963 153670963 5'UTR C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361891 FAM189B chr1 155248128 155248128 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361361 p.R585R TMEM79 chr1 156285614 156285614 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000295694 p.V130L TSACC chr1 156346844 156346844 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368251 p.A80A SH2D2A chr1 156809712 156809712 Silent T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368199 p.K221K FCRL4 chr1 157589253 157589253 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000271532 p.Q86Q CD5L chr1 157834620 157834620 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368174 p.L169I CD5L chr1 157841702 157841702 5'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368174 CD1E chr1 158355870 158355870 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368167 p.P223P OR10T2 chr1 158398559 158398559 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000334438 p.R303I OR10T2 chr1 158399388 158399388 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000334438 p.L27M OR10K2 chr1 158420822 158420822 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000314902 p.L15L OR10K1 chr1 158465618 158465618 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000289451 p.S19S OR10X1 chr1 158579537 158579537 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368150 p.L121F OR10X1 chr1 158579562 158579563 Frame_Shift_Ins - - A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368150 p.C113Lfs*2 SPTA1 chr1 158612814 158612814 Splice_Region G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368147 SPTA1 chr1 158619300 158619300 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368147 p.R2151I SPTA1 chr1 158620293 158620293 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368147 p.D2098E SPTA1 chr1 158622988 158622988 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368147 p.Q2039E SPTA1 chr1 158636674 158636674 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368147 p.E1759D SPTA1 chr1 158683478 158683478 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368147 p.Q95K OR6K2 chr1 158700511 158700511 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000359610 p.V48L OR6N1 chr1 158765907 158765907 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000335094 p.Y259C OR6N2 chr1 158777277 158777277 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000339258 p.Y120F ACKR1 chr1 159205974 159205974 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368122 p.L179L FCER1A chr1 159304099 159304099 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368115 p.K84Nfs*39 APCS chr1 159588211 159588211 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000255040 p.Y59H APCS chr1 159588746 159588746 3'UTR C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000255040 FCRL6 chr1 159808923 159808923 Intron G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368106 FCRL6 chr1 159809602 159809602 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368106 p.Q269E SLAMF9 chr1 159952406 159952406 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368093 p.D174Ifs*75 IGSF8 chr1 160093218 160093218 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000314485 p.A340S ATP1A4 chr1 160155104 160155104 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368081 p.T89T ATP1A4 chr1 160177418 160177418 Intron C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368081 ATP1A4 chr1 160186832 160186832 3'UTR G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368081 NHLH1 chr1 160372396 160372396 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000302101 F11R chr1 161000229 161000229 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368026 p.G170W HSPA6 chr1 161526255 161526255 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000309758 p.A533S FCGR3A chr1 161549835 161549835 Intron C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367967 OLFML2B chr1 161998111 161998111 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000294794 p.Q396H OLFML2B chr1 162017419 162017419 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000294794 p.R176L OLFML2B chr1 162020042 162020042 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000294794 p.V105V NOS1AP chr1 162343853 162343853 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361897 p.V158F HSD17B7 chr1 162792694 162792694 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000254521 p.A24V HSD17B7 chr1 162796635 162796635 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000254521 p.P97L LMX1A chr1 165353197 165353197 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000294816 p.L48L RXRG chr1 165437181 165437181 Intron G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000359842 LRRC52 chr1 165544372 165544372 Missense_Mutation T T G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000294818 p.C26G FAM78B chr1 166070657 166070657 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000338353 p.L124M POGK chr1 166847504 166847504 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367875 p.F90L ILDR2 chr1 166922654 166922654 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000271417 p.A384S DUSP27 chr1 167117360 167117360 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000271385 p.E80* DUSP27 chr1 167127104 167127104 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000271385 p.P658H DUSP27 chr1 167127254 167127254 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000271385 p.P708H RCSD1 chr1 167690065 167690065 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367854 p.A72E XCL1 chr1 168581124 168581124 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367818 p.S83R KIFAP3 chr1 170046733 170046733 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361580 p.R100C PRRX1 chr1 170664378 170664378 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000239461 p.D54H TNFSF18 chr1 173041282 173041282 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000404377 RABGAP1L chr1 174548060 174548060 Intron G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000251507 TNN chr1 175077763 175077763 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000239462 p.L115L TNN chr1 175117049 175117049 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000239462 p.S744T TNN chr1 175123528 175123528 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000239462 p.R927W TNN chr1 175147017 175147017 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000239462 p.E1282D TNR chr1 175379679 175379679 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000263525 p.L612L TNR chr1 175393792 175393792 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000263525 p.S448R TNR chr1 175403251 175403251 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000263525 p.G289C PAPPA2 chr1 176556988 176556988 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367662 p.W222C PAPPA2 chr1 176595052 176595052 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367662 p.G483V ASTN1 chr1 176876555 176876555 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361833 p.D1149Y ASTN1 chr1 176894677 176894677 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361833 p.S942Y TEX35 chr1 178521493 178521493 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000319416 RALGPS2 chr1 178879063 178879063 Intron A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367635 TDRD5 chr1 179650951 179650951 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000294848 p.D629N LHX4 chr1 180271417 180271417 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000263726 p.T163T CACNA1E chr1 181733640 181733640 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367573 p.P1051H CACNA1E chr1 181798680 181798680 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367573 p.S2263Y CACNA1E chr1 181798681 181798681 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367573 p.S2263S ZNF648 chr1 182058006 182058006 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000339948 p.A2E RGSL1 chr1 182530290 182530290 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000294854 p.S724S RGSL1 chr1 182530291 182530291 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000294854 p.M725L COLGALT2 chr1 183938718 183938718 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361927 COLGALT2 chr1 183954793 183954793 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361927 p.P333H TRMT1L chr1 185143402 185143402 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367506 p.E272K PLA2G4A chr1 186911253 186911253 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367466 p.C141F BRINP3 chr1 190098418 190098418 Frame_Shift_Del T T - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367462 p.K634Sfs*28 BRINP3 chr1 190098420 190098420 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367462 p.I633I RGS18 chr1 192158739 192158739 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367460 p.S34R RGS18 chr1 192158747 192158747 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367460 p.A37D RGS18 chr1 192184495 192184495 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367460 p.R217S RGS1 chr1 192579156 192579156 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367459 p.T155N CFHR3 chr1 196779877 196779877 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367425 p.V112L CFHR5 chr1 196995824 196995824 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000256785 p.P239A ASPM chr1 197090865 197090865 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367409 p.G3207G ASPM chr1 197143987 197143987 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367409 p.L137L KIF21B chr1 200974812 200974812 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000422435 p.W1572C KIF21B chr1 201002326 201002326 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000422435 p.G413C CACNA1S chr1 201040670 201040670 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000362061 p.L1726L CACNA1S chr1 201040671 201040671 Missense_Mutation A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000362061 p.L1726P CACNA1S chr1 201078039 201078039 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000362061 p.G487C IGFN1 chr1 201212847 201212847 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000295591 KDM5B chr1 202745934 202745934 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367265 p.K749N ADIPOR1 chr1 202946611 202946611 Splice_Site C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000340990 p.X87_splice PPFIA4 chr1 203059206 203059206 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000447715 p.M790I BTG2 chr1 203307290 203307290 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000290551 p.S110F PRELP chr1 203483310 203483310 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000343110 p.P42P PRELP chr1 203483634 203483634 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000343110 p.P150P ATP2B4 chr1 203683130 203683130 5'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357681 LAX1 chr1 203774074 203774074 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000442561 p.P197H ZC3H11A chr1 203837968 203837968 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000332127 p.G293C LRRN2 chr1 204620000 204620000 5'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367175 NFASC chr1 204968298 204968298 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000339876 p.T252T CNTN2 chr1 205069902 205069902 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000331830 p.W758R MAPKAPK2 chr1 206732545 206732545 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367103 FAIM3 chr1 206913797 206913797 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367091 p.R112L FCAMR chr1 206965749 206965749 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000324852 p.S93S CR2 chr1 207476256 207476256 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367058 p.P854P CR1 chr1 207580379 207580379 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367051 p.P1242P PLXNA2 chr1 208028890 208028890 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367033 p.S1793C LAMB3 chr1 209622652 209622652 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000356082 p.Q862R LAMB3 chr1 209623062 209623062 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000356082 p.G826C TRAF3IP3 chr1 209763071 209763071 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367024 p.Y185* TRAF3IP3 chr1 209763362 209763362 Splice_Site G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367024 p.X193_splice IRF6 chr1 209790800 209790800 Missense_Mutation A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367021 p.F252S KCNH1 chr1 210684099 210684099 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000271751 p.E718Q KCNH1 chr1 211090683 211090683 Silent A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000271751 p.P106P INTS7 chr1 211967938 211967938 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366994 p.Y685C TATDN3 chr1 212791904 212791904 5'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366974 KCNK2 chr1 215234946 215234946 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000444842 p.I361N USH2A chr1 215648718 215648718 Missense_Mutation A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000307340 p.F4798L USH2A chr1 215780034 215780034 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000307340 p.A3583E USH2A chr1 215790086 215790086 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000307340 p.D3385E USH2A chr1 215878942 215878942 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000307340 p.V2794F USH2A chr1 215970700 215970700 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000307340 p.Y2294* USH2A chr1 216217428 216217428 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000307340 p.A1039E USH2A chr1 216325499 216325499 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000307340 p.R317R TGFB2 chr1 218434340 218434340 Splice_Region A A C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366930 p.R216R EPRS chr1 219979498 219979498 Missense_Mutation T T G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366923 p.T1277P EPRS chr1 220005357 220005357 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366923 p.E652* BPNT1 chr1 220074022 220074022 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000322067 p.S57N HHIPL2 chr1 222531966 222531966 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000343410 p.G575R DNAH14 chr1 225079451 225079451 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000445597 p.S824I LIN9 chr1 226309227 226309227 5'UTR C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000328205 CDC42BPA chr1 227073985 227073985 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000334218 p.A872P PRSS38 chr1 227817246 227817246 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366757 p.L117I PRSS38 chr1 227817326 227817326 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366757 p.M143I OBSCN chr1 228277819 228277819 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000422127 p.A2274T OBSCN chr1 228282087 228282087 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000422127 p.Q2784H OBSCN chr1 228300143 228300143 Intron G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000422127 OBSCN chr1 228309215 228309215 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000422127 p.G4286* OBSCN chr1 228319044 228319044 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000422127 p.E4764D PGBD5 chr1 230332900 230332900 Nonsense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000525115 p.W337* TRIM67 chr1 231213845 231213845 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366653 p.T718T DISC1 chr1 231750048 231750048 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000439617 p.A414P ARID4B chr1 235194122 235194122 Silent T T G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264183 p.T672T GGPS1 chr1 235343264 235343264 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000282841 LYST chr1 235741573 235741573 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000389793 p.C2736S LYST chr1 235803013 235803013 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000389793 p.E1203Q LYST chr1 235810463 235810463 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000389793 p.Q119E NID1 chr1 235993801 235993801 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264187 p.R867G ACTN2 chr1 236739466 236739466 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366578 p.T347T ACTN2 chr1 236739515 236739515 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366578 p.E364Q RYR2 chr1 237500756 237500756 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366574 p.R750I RYR2 chr1 237503355 237503355 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366574 p.P821P RYR2 chr1 237638382 237638382 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366574 p.G2273V RYR2 chr1 237648475 237648475 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366574 p.A2458A RYR2 chr1 237707180 237707180 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366574 p.E3271V RYR2 chr1 237727097 237727097 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366574 p.P3579R RYR2 chr1 237784489 237784489 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366574 p.L4259L RYR2 chr1 237784664 237784664 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366574 p.L4318I RYR2 chr1 237791469 237791469 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366574 p.A4506D RYR2 chr1 237791470 237791470 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366574 p.A4506A ZP4 chr1 237885494 237885494 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366570 p.L353V ZP4 chr1 237885861 237885861 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366570 p.V289L RP11-193H5.1 chr1 237926816 237926816 RNA C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000450451 RP11-193H5.1 chr1 237927599 237927599 RNA C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000450451 FMN2 chr1 240208488 240208488 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000319653 p.P1226T KMO chr1 241562312 241562312 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366559 p.I199F CEP170 chr1 243186030 243186030 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366542 p.G439W CEP170 chr1 243191050 243191050 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366542 p.S359I KIF26B chr1 245419718 245419718 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000407071 p.T380I KIF26B chr1 245686060 245686060 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000407071 p.P1026Q KIF26B chr1 245686234 245686234 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000407071 p.S1084Y VN1R5 chr1 247256874 247256874 RNA C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000472952 NLRP3 chr1 247448555 247448555 3'UTR G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000336119 OR2C3 chr1 247531612 247531612 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366487 p.S300R OR2G3 chr1 247605716 247605716 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000320002 p.T44N OR14K1 chr1 247739325 247739325 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000283225 p.S237S OR11L1 chr1 247841141 247841141 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000355784 p.Y252* TRIM58 chr1 247875926 247875926 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366481 p.A300S OR2W3 chr1 247895575 247895575 5'Flank G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000360358 OR2L8 chr1 247949392 247949392 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357191 p.D179Y OR2L8 chr1 247949783 247949783 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357191 p.S309Y OR2L2 chr1 248038386 248038386 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366479 p.G40V OR2L13 chr1 248099715 248099715 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000358120 p.L114M OR2L13 chr1 248100088 248100088 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000358120 p.T239Pfs*6 OR2L13 chr1 248100092 248100092 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000358120 p.T239T OR2M5 chr1 248145374 248145374 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366476 p.S76Y OR2M2 chr1 248180370 248180370 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000359682 p.P129A OR2M3 chr1 248203143 248203143 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000456743 p.F26I OR2M3 chr1 248203240 248203240 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000456743 p.P58R OR2M4 chr1 248238952 248238952 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000306687 p.F8F OR2T12 chr1 248294990 248294990 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000317996 p.M197L OR14C36 chr1 248349281 248349281 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000317861 p.S169S OR2T4 chr1 248362450 248362450 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366475 p.T290T OR2T6 chr1 248387807 248387807 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000355728 p.S67T OR2T6 chr1 248388330 248388330 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000355728 p.C241F OR2T1 chr1 248406578 248406578 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366474 p.I195T OR2T10 chr1 248593008 248593008 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000330500 p.A254V OR2T10 chr1 248593193 248593193 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000330500 p.T192T OR2T10 chr1 248593226 248593226 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000330500 p.V181V OR2T10 chr1 248593577 248593577 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000330500 p.N64K OR2T11 chr1 248626967 248626967 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000330803 p.T54T OR2T11 chr1 248627030 248627030 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000330803 p.L33F SNTG2 chr2 1098379 1098379 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000308624 p.V98V MYT1L chr2 1922961 1922961 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000399161 p.Q270K MYT1L chr2 1922962 1922962 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000399161 p.A269A TSSC1 chr2 3194129 3194129 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000382125 p.V231M TRAPPC12 chr2 3443802 3443802 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000324266 p.R481G SOX11 chr2 5693938 5693938 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000322002 p.S406I SOX11 chr2 5700219 5700219 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000322002 FAM84A chr2 14634181 14634181 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000295092 p.P68T NBAS chr2 15232463 15232463 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000281513 p.L2065L FAM49A chr2 16562110 16562110 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000381323 p.T111Lfs*34 RDH14 chr2 18555389 18555389 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000381249 p.V271V APOB chr2 21005546 21005546 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000233242 p.L3774L ATAD2B chr2 23887951 23887951 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000238789 p.K151N SF3B6 chr2 24076326 24076326 5'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000233468 EFR3B chr2 25103777 25103777 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000403714 p.G118A OTOF chr2 26474021 26474021 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000272371 p.I1126I SLC30A3 chr2 27256423 27256423 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000233535 p.T327T ALK chr2 29275112 29275112 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000389048 p.I676I ALK chr2 29531927 29531927 Frame_Shift_Del G G - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000389048 p.P381Qfs*42 XDH chr2 31387814 31387814 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000379416 p.L216F NLRC4 chr2 32252454 32252454 Nonsense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000360906 p.W76* BIRC6 chr2 32448794 32448794 Splice_Site G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000421745 p.X1495_splice TTC27 chr2 32640343 32640343 Missense_Mutation A A C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000317907 p.K157T RASGRP3 chr2 33527355 33527355 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000402538 p.S342S FAM98A chr2 33585317 33585317 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000238823 p.G339V LINC01317 chr2 33727192 33727192 Intron C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366209 QPCT chr2 37372398 37372398 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000338415 p.L289S SLC8A1 chr2 40429067 40429067 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000332839 p.P405R COX7A2L chr2 42351273 42351273 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000234301 p.G97G STON1-GTF2A1L chr2 48645035 48645035 Splice_Region C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000394754 p.G806G NRXN1 chr2 50207604 50207604 Intron G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000406316 NRXN1 chr2 50346866 50346866 Intron C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000406316 GPR75-ASB3 chr2 53765545 53765545 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000263634 p.T10S GPR75 chr2 53853817 53853817 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000394705 p.A314S MEIS1 chr2 66439917 66439917 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000272369 p.G105V APLF chr2 68577878 68577878 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000303795 p.L464L BMP10 chr2 68865793 68865793 Silent A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000295379 p.I371I ASPRV1 chr2 69961675 69961675 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000320256 p.G5V ZNF638 chr2 71402049 71402049 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264447 p.G931C DYSF chr2 71481880 71481880 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000258104 p.G49A SPR chr2 72888416 72888416 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000234454 p.S136F EGR4 chr2 73292320 73292320 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000545030 p.A303P ALMS1 chr2 73452494 73452494 Silent A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000613296 p.S1989S ALMS1 chr2 73490337 73490337 Frame_Shift_Del G G - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000613296 p.R2793Sfs*20 SLC4A5 chr2 74221455 74221455 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000346834 TLX2 chr2 74514938 74514938 Frame_Shift_Del T T - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000233638 p.H44Qfs*37 DQX1 chr2 74519208 74519208 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000393951 p.T610I LOXL3 chr2 74534211 74534211 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264094 p.A655A LOXL3 chr2 74534212 74534212 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264094 p.A655D TACR1 chr2 75198848 75198848 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000305249 p.A29A LRRTM4 chr2 77518489 77518489 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000409093 p.H460Q LRRTM4 chr2 77519713 77519713 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000409093 p.F52L REG3A chr2 79158340 79158340 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000305165 p.H107D CTNNA2 chr2 79651626 79651626 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000402739 p.V24L LRRTM1 chr2 80303345 80303345 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000295057 p.G159W RETSAT chr2 85350870 85350870 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000295802 p.M169I CAPG chr2 85398774 85398774 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000263867 p.G225G CHMP3 chr2 86542292 86542292 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000263856 p.K22N CD8B chr2 86842173 86842173 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000390655 TEX37 chr2 88529218 88529218 Frame_Shift_Del G G - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000303254 p.E97Rfs*67 IGKV4-1 chr2 88885891 88885891 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000390243 p.S34F IGKV1-17 chr2 89117774 89117774 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000490686 p.L15H IGKV2-29 chr2 89234378 89234378 RNA G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000521304 IGKV1D-42 chr2 90190416 90190416 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000390278 p.P30T IGKV3D-7 chr2 90234886 90234886 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000443397 p.W17L RNU6-1320P chr2 94845398 94845398 3'Flank G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000390838 ADRA2B chr2 96115002 96115002 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000620793 p.C383F STARD7 chr2 96192423 96192423 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000337288 p.R263S ANKRD36 chr2 97118598 97118598 Intron A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000420699 INPP4A chr2 98564678 98564678 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000074304 p.R694S RFX8 chr2 101422415 101422415 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000428343 p.R44W IL1RL2 chr2 102239275 102239275 3'UTR G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264257 SLC9A4 chr2 102473976 102473976 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000295269 p.V73F RGPD3 chr2 106413188 106413188 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000409886 p.I1721N RGPD3 chr2 106424609 106424609 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000409886 p.L1120L ST6GAL2 chr2 106806878 106806878 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361686 p.E464* ST6GAL2 chr2 106843419 106843419 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361686 p.E187* RANBP2 chr2 108767619 108767619 Missense_Mutation A A C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000283195 p.L2360F FBLN7 chr2 112187513 112187513 3'UTR A A C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000331203 RGPD8 chr2 112389583 112389583 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000302558 p.P1121L IL36G chr2 112978667 112978667 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000259205 p.G10V DPP10 chr2 114442691 114442691 5'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000410059 DPP10 chr2 115777812 115777812 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000410059 p.R448Efs*14 CNTNAP5 chr2 124434492 124434492 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000431078 p.V180I CNTNAP5 chr2 124527292 124527292 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000431078 p.P494P CNTNAP5 chr2 124647811 124647811 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000431078 p.R643R MYO7B chr2 127609851 127609851 Splice_Region C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000409816 p.A1009A UGGT1 chr2 128133225 128133225 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000259253 p.V488L RAB6C chr2 129981590 129981590 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000410061 POTEF chr2 130075230 130075230 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357462 p.H748Y CCDC74B chr2 130141217 130141217 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000310463 p.E208D SMPD4 chr2 130154394 130154394 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000409031 p.L553L SMPD4 chr2 130156455 130156455 Intron C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000409031 AMER3 chr2 130762164 130762164 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000321420 p.R31M AMER3 chr2 130764903 130764903 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000321420 ARHGEF4 chr2 130915195 130915195 5'Flank G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000326016 ARHGEF4 chr2 131046095 131046095 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000326016 p.R660Q POTEE chr2 131264040 131264040 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000356920 p.T862N AC073869.20 chr2 131443059 131443059 RNA T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000407594 AC073869.20 chr2 131444342 131444342 RNA C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000407594 ANKRD30BL chr2 132154736 132154736 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000409867 p.R182Efs*10 GPR39 chr2 132417346 132417346 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000329321 p.S102T NCKAP5 chr2 133517472 133517472 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000409261 p.D19H MAP3K19 chr2 134981084 134981084 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000375845 p.T1219T THSD7B chr2 137056964 137056964 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000272643 p.A228A LRP1B chr2 140297821 140297821 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000389484 p.D4318E LRP1B chr2 140358925 140358925 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000389484 p.T3718K LRP1B chr2 140370819 140370819 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000389484 p.K3633K LRP1B chr2 140487623 140487623 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000389484 p.D3079D PABPC1P2 chr2 146587762 146587762 RNA G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000471997 KIF5C chr2 148981451 148981451 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000435030 p.V487L RIF1 chr2 151464467 151464467 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000243326 p.V1649V RIF1 chr2 151465119 151465119 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000243326 p.G1867R NEB chr2 151664770 151664770 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000172853 p.T1778A NEB chr2 151680744 151680744 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000172853 p.A1010S NEB chr2 151706976 151706976 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000172853 p.E353* CACNB4 chr2 151870563 151870563 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000539935 p.V223L RPRM chr2 153478359 153478359 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000325926 p.V69V GALNT13 chr2 154140407 154140407 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000392825 p.Q71Q BAZ2B chr2 159349229 159349229 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000392783 p.G1639R SLC4A10 chr2 161964194 161964194 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000446997 p.Y974* FAP chr2 162203115 162203115 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000188790 p.D360N GRB14 chr2 164497210 164497210 Splice_Site C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000263915 p.X432_splice GRB14 chr2 164497211 164497211 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000263915 p.A432S SCN3A chr2 165091276 165091276 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000360093 p.A1626D SCN3A chr2 165176285 165176285 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000360093 p.P37H SCN2A chr2 165342307 165342307 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000283256 p.G800G SCN2A chr2 165342384 165342384 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000283256 p.F826S CSRNP3 chr2 165679169 165679169 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000314499 p.G392C CSRNP3 chr2 165679460 165679460 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000314499 p.G489S GALNT3 chr2 165770457 165770457 Frame_Shift_Del T T - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000392701 p.I82* TTC21B chr2 165924661 165924661 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000243344 p.Q468H SCN9A chr2 166204130 166204130 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000303354 p.M1533I XIRP2 chr2 167244187 167244187 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000628543 p.T757I XIRP2 chr2 167250907 167250907 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000628543 p.P2997H XIRP2 chr2 167251205 167251205 Nonsense_Mutation T T G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000628543 p.Y3096* CERS6 chr2 168547659 168547659 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000305747 p.P78P G6PC2 chr2 168902495 168902495 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000375363 p.Y90F DHRS9 chr2 169095857 169095857 3'UTR C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357546 LRP2 chr2 169231802 169231802 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000263816 p.C1713* HOXD13 chr2 176093135 176093135 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000392539 p.R82L HOXD8 chr2 176131516 176131516 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000313173 p.D259E OSBPL6 chr2 178344341 178344341 Intron C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000190611 FKBP7 chr2 178477151 178477151 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000424785 p.G95V TTN chr2 178541305 178541305 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000591111 p.P30950H TTN chr2 178557694 178557694 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000591111 p.I27579I TTN chr2 178564708 178564708 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000591111 p.E25501* TTN chr2 178565278 178565278 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000591111 p.V25311I TTN chr2 178572521 178572521 Silent T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000591111 p.T22896T TTN chr2 178617011 178617011 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000591111 p.E14319K TTN chr2 178617012 178617012 Splice_Region A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000591111 p.V14318V TTN chr2 178618231 178618231 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000591111 p.P14102T TTN chr2 178640607 178640607 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000591111 p.P11912S TTN chr2 178652467 178652467 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000591111 p.P11533S TTN chr2 178696238 178696238 Silent A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000591111 p.A9961A TTN chr2 178733321 178733321 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000591111 p.E5007E TTN chr2 178746210 178746210 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000591111 TTN chr2 178751990 178751990 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000591111 TTN chr2 178770097 178770097 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000591111 p.V2868V NCKAP1 chr2 182952865 182952865 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361354 p.M811L ZNF804A chr2 184936221 184936221 Silent T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000302277 p.T275T FSIP2 chr2 185805911 185805911 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000424728 p.N5535K FAM171B chr2 186761151 186761151 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000304698 p.Y351H PMS1 chr2 189854642 189854642 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000441310 p.C457S MSTN chr2 190062304 190062304 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000260950 p.R98M MSTN chr2 190062594 190062594 Translation_Start_Site C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000260950 p.M1? TMEFF2 chr2 191999189 191999189 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000272771 p.C186S TMEFF2 chr2 192179667 192179667 Splice_Site C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000272771 p.X147_splice DNAH7 chr2 195872375 195872375 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000312428 p.T2170S CCDC150 chr2 196646358 196646358 Silent A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000389175 p.T10T ANKRD44 chr2 197099767 197099767 Intron G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000282272 PLCL1 chr2 198085544 198085544 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000428675 p.P676Q NBEAL1 chr2 203175222 203175222 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000449802 p.G2104G ZDBF2 chr2 206305178 206305178 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000374423 p.S217I ZDBF2 chr2 206305544 206305544 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000374423 p.C339Y ZDBF2 chr2 206309298 206309298 Silent T T G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000374423 p.T1590T ADAM23 chr2 206589496 206589496 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264377 p.W647L DYTN chr2 206648804 206648804 3'Flank G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000452335 DYTN chr2 206663135 206663135 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000452335 p.S467R FASTKD2 chr2 206790629 206790629 Silent A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000236980 p.R652R CRYGC chr2 208128219 208128219 Missense_Mutation A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000282141 p.V170A UNC80 chr2 209880958 209880958 Splice_Region T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000439458 CPS1 chr2 210592935 210592935 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000233072 p.T381T CPS1 chr2 210647943 210647943 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000233072 p.K1074N CPS1 chr2 210663122 210663122 Splice_Site G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000233072 p.X1310_splice ERBB4 chr2 211420517 211420517 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000342788 p.E1020V ERBB4 chr2 211713575 211713575 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000342788 p.G319G ERBB4 chr2 211725183 211725183 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000342788 p.V212L ERBB4 chr2 211947462 211947462 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000342788 p.G130V PRKAG3 chr2 218830351 218830351 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000233944 p.T87I WNT10A chr2 218882259 218882259 Missense_Mutation A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000258411 p.Q71R CRYBA2 chr2 218990240 218990240 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000295728 ANKZF1 chr2 219233790 219233790 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000323348 p.P299A PTPRN chr2 219294986 219294986 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000295718 p.L888L PTPRN chr2 219307452 219307452 Missense_Mutation A A C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000295718 p.M91R DNPEP chr2 219374882 219374882 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000273075 p.G460G DNPEP chr2 219374883 219374883 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000273075 p.G460E ASIC4 chr2 219514517 219514517 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000347842 p.R58R CHPF chr2 219540560 219540560 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000243776 p.R384L OBSL1 chr2 219554506 219554506 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000404537 p.S1615Y SLC4A3 chr2 219628519 219628519 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000317151 p.A56S SCG2 chr2 223599211 223599211 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000305409 p.G24G CUL3 chr2 224474160 224474160 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264414 DOCK10 chr2 224796381 224796381 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000258390 p.G1625S SPHKAP chr2 228017880 228017880 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000392056 p.V992L SPHKAP chr2 228018691 228018691 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000392056 p.F721L SPHKAP chr2 228018993 228018993 Nonsense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000392056 p.K621* SPHKAP chr2 228020049 228020049 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000392056 p.E269* PID1 chr2 229025927 229025927 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000354069 p.E153V TRIP12 chr2 229859040 229859040 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000283943 p.S211S C2orf72 chr2 231041389 231041389 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373640 p.C244Afs*18 ALPP chr2 232380675 232380675 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000392027 p.L306L ALPPL2 chr2 232408756 232408756 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000295453 p.L303L ALPI chr2 232458084 232458084 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000295463 p.L315M TIGD1 chr2 232550306 232550306 5'UTR G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000408957 SAG chr2 233320694 233320694 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000409110 p.T82T UGT1A5 chr2 233713304 233713304 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373414 p.H105N SH3BP4 chr2 235042561 235042561 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000344528 p.E598* COL6A3 chr2 237372241 237372241 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000295550 p.V1259D NDUFA10 chr2 240011635 240011635 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000252711 p.T244S OTOS chr2 240139237 240139237 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000319460 p.R68Q KIF1A chr2 240719115 240719115 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000320389 p.R1601L PASK chr2 241127348 241127348 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000234040 p.E523* HDLBP chr2 241252987 241252987 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000391975 p.R448W ATG4B chr2 241666832 241666832 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000404914 p.T242T CHL1 chr3 319804 319804 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000397491 p.L10V SETMAR chr3 4303648 4303648 Intron G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000358065 ITPR1 chr3 4652146 4652146 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000354582 p.R293R GRM7 chr3 6861613 6861613 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357716 p.G75G SETD5 chr3 9442190 9442190 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000402198 p.R341L ARPC4 chr3 9797749 9797749 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000397261 p.R32R WNT7A chr3 13854798 13854798 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000285018 p.R102R VENTXP7 chr3 21405781 21405781 RNA C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000475503 ZCWPW2 chr3 28413326 28413326 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000383768 p.Q86H TGFBR2 chr3 30672134 30672134 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000295754 p.L317F ARPP21 chr3 35684057 35684057 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000187397 SCN11A chr3 38894553 38894553 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000302328 p.Q939K SCN11A chr3 38950184 38950184 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000302328 p.R60K TTC21A chr3 39110079 39110079 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000431162 p.D70Y CCDC13 chr3 42746003 42746003 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000310232 p.D249N ZKSCAN7 chr3 44567928 44567928 Silent A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000273320 p.P203P CSPG5 chr3 47577393 47577393 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000383738 p.D211E COL7A1 chr3 48569611 48569611 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000328333 p.R2532P DNAH1 chr3 52368771 52368771 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000420323 p.R1932R DNAH12 chr3 57472567 57472567 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000351747 p.P585P CADPS chr3 62550025 62550025 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000383710 p.W615L FAM19A1 chr3 68544550 68544550 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000478136 ROBO2 chr3 77558062 77558062 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000461745 p.S450R ROBO1 chr3 78746814 78746814 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000464233 p.G196C CADM2 chr3 86066814 86066814 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000407528 POU1F1 chr3 87273429 87273429 Intron C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000350375 C3orf38 chr3 88149964 88149964 5'UTR A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000318887 EPHA3 chr3 89399523 89399524 Intron - - T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000336596 PROS1 chr3 93898513 93898513 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000394236 p.G262C EPHA6 chr3 97747422 97747422 Splice_Site G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000389672 p.X1043_splice OR5AC2 chr3 98087266 98087266 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000358642 p.V32L OR5H2 chr3 98283276 98283276 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000355273 p.A130D IMPG2 chr3 101229539 101229539 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000193391 p.K1158N MORC1 chr3 109093453 109093453 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000232603 p.M224I SLC9C1 chr3 112179675 112179675 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000305815 p.G925G BOC chr3 113273304 113273304 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000355385 p.S399R SIDT1 chr3 113585251 113585251 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264852 p.G328W LRRC58 chr3 120334869 120334869 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000295628 p.K300N HGD chr3 120628407 120628407 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000283871 p.N437K FBXO40 chr3 121621756 121621756 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000338040 p.T109T CASR chr3 122254103 122254103 5'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000490131 SEMA5B chr3 122961208 122961208 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357599 p.P19H KALRN chr3 124298848 124298848 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000240874 p.G341R ALDH1L1 chr3 126150420 126150420 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000393434 p.A324S UROC1 chr3 126505777 126505777 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000290868 p.T246S PODXL2 chr3 127668460 127668460 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000342480 p.R409L IFT122 chr3 129520237 129520237 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000348417 p.R1233L TMCC1 chr3 129655015 129655015 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000393238 p.E534* TRH chr3 129976868 129976868 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000302649 p.V127V TRH chr3 129976869 129976869 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000302649 p.D128N COL6A5 chr3 130440532 130440532 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000312481 p.T2065N COL6A5 chr3 130440533 130440533 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000312481 p.T2065T MRAS chr3 138402391 138402391 3'UTR G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000289104 PRR23A chr3 139005859 139005859 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000383163 p.V137D PRR23C chr3 139044081 139044081 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000413199 p.P180P CLSTN2 chr3 140448549 140448549 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000458420 p.G273V CLSTN2 chr3 140546566 140546566 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000458420 p.A520D GK5 chr3 142185952 142185952 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000392993 p.V265L ATR chr3 142513591 142513591 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000350721 p.M1517I TRPC1 chr3 142804547 142804547 Missense_Mutation A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000476941 p.I691V CPA3 chr3 148868948 148868948 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000296046 p.V60L CP chr3 149206197 149206197 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264613 p.F393F TM4SF1 chr3 149377466 149377466 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000305366 p.L28I TM4SF1 chr3 149377467 149377467 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000305366 p.L27L P2RY12 chr3 151338181 151338181 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000302632 p.R222T IGSF10 chr3 151448598 151448598 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000282466 p.P461P SUCNR1 chr3 151881556 151881556 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000362032 RAP2B chr3 153162862 153162862 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000323534 p.D57Y GPR149 chr3 154428635 154428635 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000389740 p.M327I MME chr3 155166981 155166981 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000360490 p.M580I TIPARP chr3 156695982 156695982 Nonsense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000295924 p.R402* OTOL1 chr3 161497059 161497059 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000327928 p.L84L SI chr3 165069196 165069196 Splice_Site C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264382 p.X86_splice SLITRK3 chr3 165187806 165187806 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000241274 BCHE chr3 165829517 165829517 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264381 p.G506V WDR49 chr3 167500258 167500258 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000308378 p.P624S SAMD7 chr3 169926795 169926795 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000335556 p.G178V TNIK chr3 171211140 171211140 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000436636 p.P94P KCNMB2 chr3 178825666 178825666 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000358316 p.R46Efs*9 MFN1 chr3 179358964 179358964 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000471841 p.L125F NDUFB5 chr3 179614989 179614989 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000259037 p.G48V CCDC39 chr3 180648263 180648263 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000442201 p.E422K CCDC39 chr3 180651401 180651401 Splice_Region C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000442201 p.K389K SOX2 chr3 181712596 181712596 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000325404 p.W79L MCF2L2 chr3 183295438 183295438 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000328913 p.Q513K ABCC5 chr3 183961509 183961509 Splice_Site A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000334444 p.X793_splice VWA5B2 chr3 184234751 184234751 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000426955 p.R314L ECE2 chr3 184290998 184290998 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000402825 CHRD chr3 184387931 184387931 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000204604 p.G818W SENP2 chr3 185619403 185619403 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000296257 p.G449G HRG chr3 186671705 186671705 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000232003 p.A158A TP63 chr3 189894505 189894505 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264731 CCDC50 chr3 191389565 191389565 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000392455 p.S288S OPA1 chr3 193658974 193658974 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000392438 p.L752L LRRC15 chr3 194360042 194360042 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000347624 p.P334P ACAP2 chr3 195301976 195301976 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000326793 p.G439* MUC4 chr3 195779230 195779230 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000463781 p.D4117V MUC4 chr3 195779231 195779231 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000463781 p.D4117N MUC4 chr3 195782159 195782159 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000463781 p.S3141G PIGZ chr3 196947351 196947351 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000412723 p.L516V KIAA0226 chr3 197675427 197675427 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000296343 p.C912F KIAA0226 chr3 197693730 197693730 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000296343 p.E591K FGFRL1 chr4 1025373 1025373 3'UTR G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264748 UVSSA chr4 1380180 1380180 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000389851 p.R568C POLN chr4 2072033 2072033 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000382865 EVC chr4 5748186 5748186 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264956 p.H326Q ZNF518B chr4 10445345 10445345 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000326756 p.P328P BOD1L1 chr4 13613632 13613632 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000040738 p.G402* CC2D2A chr4 15511344 15511344 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000424120 p.R213T CC2D2A chr4 15511545 15511545 Intron C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000424120 BST1 chr4 15715790 15715790 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265016 p.G232V CLRN2 chr4 17522949 17522949 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000511148 p.L113L DCAF16 chr4 17803985 17803985 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000382247 p.A53S SLIT2 chr4 20528372 20528372 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000504154 SLIT2 chr4 20541463 20541463 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000504154 p.A663P SLIT2 chr4 20549094 20549094 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000504154 p.R819G PACRGL chr4 20709682 20709682 Splice_Site G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000471979 p.X92_splice PPARGC1A chr4 23814276 23814276 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264867 p.E403Q STIM2 chr4 26995473 26995473 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000467087 p.K164N PCDH7 chr4 30722583 30722583 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361762 p.A387A PCDH7 chr4 30723581 30723581 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361762 p.P720H PCDH7 chr4 30724486 30724486 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361762 p.Q1022K ARAP2 chr4 36212473 36212473 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000303965 p.K352N CHRNA9 chr4 40335880 40335880 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000310169 p.E40Q GRXCR1 chr4 42893289 42893289 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000399770 p.P8Q KCTD8 chr4 44175077 44175077 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000360029 p.A379S GABRG1 chr4 46040973 46040973 3'UTR C - - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000295452 GABRG1 chr4 46058290 46058290 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000295452 p.C281* SGCB chr4 52028910 52028910 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000381431 p.Q147H SPATA18 chr4 52078764 52078764 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000295213 p.F350L EXOC1 chr4 55896847 55896847 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000346134 p.R695L POLR2B chr4 57023441 57023443 In_Frame_Del ATG ATG - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000314595 p.N876_E877delinsK ADGRL3 chr4 62044457 62044457 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000514591 p.R1173L TECRL chr4 64314703 64314703 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000381210 p.P166T EPHA5 chr4 65336100 65336100 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000273854 p.Y895C EPHA5 chr4 65601652 65601652 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000273854 p.G300V UBA6 chr4 67626377 67626377 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000322244 p.S834F UBA6 chr4 67663304 67663304 Intron C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000322244 TMPRSS11E chr4 68477401 68477401 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000305363 p.F247Y UGT2A3 chr4 68929827 68929827 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000251566 p.E524Q SULT1E1 chr4 69841993 69841993 3'UTR C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000226444 HTN1 chr4 70054450 70054450 Splice_Region T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000246896 p.H34H MUC7 chr4 70481886 70481886 3'UTR T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000304887 GC chr4 71756889 71756889 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000273951 p.C286Y CNOT6L chr4 77720476 77720476 Silent T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000504123 p.P541P FGF5 chr4 80286584 80286584 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000312465 p.P240H PRKG2 chr4 81169712 81169712 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264399 p.R267W PRKG2 chr4 81204790 81204790 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264399 p.V86V SEC31A chr4 82864460 82864460 Nonsense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000355196 p.Q446* WDFY3 chr4 84705509 84705509 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000295888 p.E2740D WDFY3 chr4 84801837 84801838 Frame_Shift_Ins - - A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000295888 p.A879Cfs*19 SLC10A6 chr4 86823710 86823710 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000273905 p.G371V SLC10A6 chr4 86848795 86848795 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000273905 p.P107P PKD2 chr4 88065754 88065754 Splice_Region A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000237596 PPM1K chr4 88262529 88262529 3'UTR C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000608933 HERC3 chr4 88686780 88686780 Missense_Mutation A A C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264345 p.E851A MMRN1 chr4 89935875 89935875 Missense_Mutation T T G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264790 p.M732R MMRN1 chr4 89936062 89936062 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264790 p.Q794H ATOH1 chr4 93829023 93829023 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000306011 p.P33Rfs*74 PDLIM5 chr4 94576035 94576035 Splice_Site G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000317968 p.X237_splice BMPR1B chr4 95154586 95154586 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264568 p.W474C ADH1B chr4 99314079 99314079 Splice_Region G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000305046 p.V190V ADH1B chr4 99315955 99315955 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000305046 p.V170V NFKB1 chr4 102616563 102616563 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000394820 p.G959V MANBA chr4 102635921 102635921 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000226578 p.T701A CENPE chr4 103110954 103110954 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265148 p.G2533V CENPE chr4 103145088 103145088 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265148 p.D1607Y CENPE chr4 103159131 103159131 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265148 p.M827K CENPE chr4 103181375 103181375 Nonsense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265148 p.R349* GSTCD chr4 105719260 105719260 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000360505 p.G209G DKK2 chr4 106924065 106924065 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000285311 p.H223Q DKK2 chr4 107035529 107035529 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000285311 p.L21L PITX2 chr4 110618283 110618283 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000354925 p.P266A ANK2 chr4 113278553 113278553 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357077 p.A626S ANK2 chr4 113357917 113357917 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357077 p.P3100R ANK2 chr4 113373438 113373438 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357077 p.E3950K UGT8 chr4 114623663 114623663 Silent A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000310836 p.V261V NDST4 chr4 114852779 114852779 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264363 p.E588* SYNPO2 chr4 119057738 119057738 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000307142 p.Q1197L ANXA5 chr4 121672539 121672539 Nonsense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000296511 p.R207* TRPC3 chr4 121932551 121932551 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000379645 p.P236L TRPC3 chr4 121932826 121932826 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000379645 p.D144E KIAA1109 chr4 122305974 122305974 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264501 p.S3257* ANKRD50 chr4 124670121 124670121 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000504087 p.A1052A FAT4 chr4 125449540 125449540 Nonsense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000394329 p.R2842* FAT4 chr4 125451065 125451065 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000394329 p.K3350M INTU chr4 127633034 127633034 5'UTR G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000335251 SCLT1 chr4 129043468 129043468 Splice_Site C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000281142 p.X54_splice PCDH10 chr4 133150423 133150423 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264360 p.L95M PCDH10 chr4 133150767 133150767 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264360 p.G209G PCDH10 chr4 133152696 133152696 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264360 p.P852P PCDH18 chr4 137530775 137530775 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000344876 p.E438D ZNF330 chr4 141233846 141233846 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262990 p.E274* GAB1 chr4 143438595 143438595 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262994 p.R397P MMAA chr4 145642421 145642421 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000281317 p.M166I ARHGAP10 chr4 148046891 148046891 Splice_Site G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000336498 p.X623_splice SFRP2 chr4 153788485 153788485 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000274063 p.L117L DCHS2 chr4 154235456 154235456 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000623607 p.D2611N DCHS2 chr4 154320552 154320552 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000623607 p.H1161L LRAT chr4 154744284 154744284 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000336356 GRIA2 chr4 157303558 157303558 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264426 p.S79Y GRIA2 chr4 157360134 157360134 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264426 p.S761Y GRIA2 chr4 157360135 157360135 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264426 p.S761S FAM198B chr4 158170860 158170860 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000296530 p.L172L TMEM144 chr4 158241572 158241572 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000296529 p.L289Q RXFP1 chr4 158652026 158652026 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000307765 p.Q749K NPY1R chr4 163326026 163326026 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000296533 p.Q177K TKTL2 chr4 163472311 163472311 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000280605 p.R475L TRIM75P chr4 165060131 165060131 RNA C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000503032 TLL1 chr4 166039420 166039420 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000061240 p.W414R TLL1 chr4 166099434 166099434 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000061240 p.V938V DDX60L chr4 168461859 168461859 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000260184 p.G149V NEK1 chr4 169585381 169585381 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000439128 p.A259S GALNTL6 chr4 172813718 172813718 Silent T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000506823 p.P306P WDR17 chr4 176177112 176177112 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000280190 p.S1207S LINC01098 chr4 177960843 177960843 RNA C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000507870 TENM3 chr4 182738531 182738531 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000511685 p.L1122L MTNR1A chr4 186534043 186534043 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000307161 p.D233E MTNR1A chr4 186534085 186534085 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000307161 p.Q219H FAT1 chr4 186618090 186618090 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000441802 p.R2832S FAT1 chr4 186618091 186618091 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000441802 p.R2832M FAT1 chr4 186619912 186619912 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000441802 p.S2225I TRIML1 chr4 188139473 188139473 5'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000332517 TRIML1 chr4 188146919 188146919 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000332517 p.P318P TUBB7P chr4 189982993 189982993 RNA G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000428444 IRX4 chr5 1879638 1879638 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000231357 p.K201R ICE1 chr5 5460853 5460853 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000296564 p.G507C ICE1 chr5 5462245 5462245 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000296564 p.I971F ICE1 chr5 5466472 5466472 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000296564 p.R2011G SEMA5A chr5 9154671 9154671 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000382496 p.R433L SEMA5A chr5 9201974 9201974 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000382496 p.G305C CTNND2 chr5 11364703 11364703 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000304623 p.T455T CTNND2 chr5 11397105 11397105 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000304623 p.L180L DNAH5 chr5 13753235 13753235 Nonsense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265104 p.Q3624* DNAH5 chr5 13841878 13841878 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265104 p.S1766S FBXL7 chr5 15928002 15928002 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000504595 p.I80I MYO10 chr5 16935853 16935853 5'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000513610 CDH18 chr5 19473536 19473536 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000274170 p.R688L GUSBP1 chr5 21461821 21461821 RNA G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000607545 CDH12 chr5 21751709 21751709 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000382254 CDH12 chr5 21755832 21755832 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000382254 p.A548A CDH12 chr5 21783426 21783426 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000382254 p.A442D CDH12 chr5 21854776 21854776 Nonsense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000382254 p.Q181* PRDM9 chr5 23524466 23524466 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000296682 p.Y361* PRDM9 chr5 23526423 23526423 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000296682 p.H445Q PRDM9 chr5 23527328 23527328 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000296682 p.P747H CDH6 chr5 31318006 31318006 Intron C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265071 ADAMTS12 chr5 33576053 33576053 Splice_Site C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000504830 p.X1324_splice ADAMTS12 chr5 33576396 33576396 Nonsense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000504830 p.W1210* ADAMTS12 chr5 33658254 33658254 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000504830 p.R374S ADAMTS12 chr5 33751458 33751458 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000504830 p.V194F UGT3A1 chr5 35968108 35968108 Nonsense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000274278 p.Y74* UGT3A2 chr5 36035539 36035539 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000282507 C5orf42 chr5 37107627 37107627 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000425232 p.S3190C EGFLAM chr5 38418207 38418207 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000354891 p.D546H OSMR chr5 38881675 38881675 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000274276 p.H110L FYB chr5 39202112 39202113 Frame_Shift_Ins - - T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000351578 p.E284Gfs*3 C9 chr5 39308280 39308280 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000263408 p.G397V DAB2 chr5 39394395 39394395 5'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000320816 PTGER4 chr5 40691941 40691941 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000302472 p.I344F CARD6 chr5 40841412 40841412 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000254691 p.I10M HCN1 chr5 45262098 45262098 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000303230 p.R832S HCN1 chr5 45262099 45262099 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000303230 p.R832M HCN1 chr5 45353114 45353114 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000303230 p.D455Y ISL1 chr5 51383520 51383520 5'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000230658 ITGA2 chr5 53072639 53072639 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000296585 p.E791D ESM1 chr5 54979202 54979202 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000381405 GPX8 chr5 55161220 55161220 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000503787 p.G144V ACTBL2 chr5 57482667 57482667 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000423391 p.G14E ACTBL2 chr5 57482718 57482718 5'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000423391 LRRC70 chr5 62580786 62580786 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000334994 p.E450K ADAMTS6 chr5 65188087 65188087 Frame_Shift_Del G G - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000381055 p.R947Gfs*94 ADAMTS6 chr5 65451549 65451549 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000381055 p.L333L ADAMTS6 chr5 65460171 65460171 Splice_Region C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000381055 p.S210S TNPO1 chr5 72903717 72903718 Frame_Shift_Ins - - T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000337273 p.C844Lfs*2 F2RL1 chr5 76833353 76833353 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000296677 p.G249V S100Z chr5 76877712 76877712 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000317593 p.Q60H LHFPL2 chr5 78510219 78510219 5'UTR T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000380345 PAPD4 chr5 79648624 79648624 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000296783 p.E277* CMYA5 chr5 79729378 79729378 Missense_Mutation A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000446378 p.T205A CMYA5 chr5 79735790 79735790 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000446378 p.D2342V THBS4 chr5 80070698 80070698 Missense_Mutation T T G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000350881 p.I503S SSBP2 chr5 81751162 81751162 5'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000320672 VCAN chr5 83490116 83490116 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265077 p.P30Q VCAN chr5 83512203 83512203 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265077 p.L283L VCAN chr5 83536921 83536921 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265077 EDIL3 chr5 84060334 84060334 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000296591 p.T368I MEF2C chr5 88751893 88751893 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000437473 p.G185R POU5F2 chr5 93741446 93741446 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000510627 p.A40S POU5F2 chr5 93741447 93741447 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000510627 p.A39A KIAA0825 chr5 94470033 94470033 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000513200 p.V600V ANKRD32 chr5 94692132 94692132 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265140 p.V857V MCTP1 chr5 94870450 94870450 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000515393 p.K761N FAM81B chr5 95391442 95391442 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000283357 p.S18L FAM81B chr5 95436866 95436866 Nonsense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000283357 p.Q285* TTC37 chr5 95464536 95464536 3'UTR G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000358746 TTC37 chr5 95516587 95516587 Splice_Site C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000358746 p.X839_splice ARSK chr5 95565997 95565997 Splice_Site G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000380009 p.X43_splice SPATA9 chr5 95682851 95682851 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000274432 p.P2A SPATA9 chr5 95682954 95682954 5'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000274432 SLCO6A1 chr5 102458465 102458465 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000379807 p.R350G PPIP5K2 chr5 103173154 103173154 Splice_Site G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000358359 p.X763_splice CTD-2374C24.1 chr5 105099908 105099908 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000522464 TSLP chr5 111071447 111071447 5'Flank G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000344895 APC chr5 112839898 112839898 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000257430 p.R1435T YTHDC2 chr5 113564027 113564027 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000161863 p.V871L LVRN chr5 115983297 115983297 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357872 p.A236T SEMA6A chr5 116478114 116478125 In_Frame_Del TGCCCATGATCC TGCCCATGATCC - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000343348 p.R486_G489del HSD17B4 chr5 119473925 119473925 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000256216 p.D44Y MEGF10 chr5 127420051 127420051 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000274473 p.H478Q MEGF10 chr5 127433479 127433479 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000274473 p.P604A FBN2 chr5 128259787 128259787 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262464 p.V2803F FBN2 chr5 128305041 128305041 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262464 p.G1906C FBN2 chr5 128446564 128446564 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262464 p.G290V FBN2 chr5 128464740 128464740 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262464 p.R270R SLC27A6 chr5 128966458 128966458 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262462 p.T107T LYRM7 chr5 131187040 131187040 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000379380 p.G59C RAD50 chr5 132604964 132604964 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000378823 p.S895P SHROOM1 chr5 132824629 132824629 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000378679 p.Q409H TXNDC15 chr5 134899534 134899534 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000358387 p.I311K H2AFY chr5 135343610 135343610 Intron A A C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000510038 SLC25A48 chr5 135871653 135871653 Intron G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000412661 HNRNPA0 chr5 137754246 137754246 5'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000314940 EGR1 chr5 138466899 138466899 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000239938 p.W150C PCDHA1 chr5 140787542 140787542 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000504120 p.L418L PCDHA2 chr5 140796705 140796705 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000526136 p.V581L PCDHA3 chr5 140801836 140801836 Silent A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000522353 p.T213T PCDHA4 chr5 140807553 140807553 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000530339 p.E122E PCDHA6 chr5 140828650 140828650 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000529310 p.D187N PCDHA8 chr5 140843650 140843650 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000531613 p.P777T PCDHA9 chr5 140853773 140853773 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000532602 PCDHA10 chr5 140858229 140858229 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000307360 p.E727D PCDHA10 chr5 140861363 140861363 Intron G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000307360 PCDHA11 chr5 140869821 140869821 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000398640 p.P240T PCDHB1 chr5 141053495 141053495 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000306549 p.Q675H PCDHB4 chr5 141122992 141122992 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000194152 p.V332I PCDHB16 chr5 141182640 141182640 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000609684 p.G27G PCDHB9 chr5 141189536 141189536 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000316105 p.S740C PCDHB10 chr5 141193929 141193929 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000239446 p.F459L PCDHB10 chr5 141194875 141194875 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000239446 p.D775Y PCDHB12 chr5 141211877 141211877 3'UTR G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000239450 PCDHB13 chr5 141215437 141215437 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000341948 p.T438T PCDHB13 chr5 141215712 141215712 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000341948 p.R530L PCDHB13 chr5 141217387 141217387 3'UTR A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000341948 PCDHB14 chr5 141224549 141224549 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000239449 p.T348T PCDHB15 chr5 141245629 141245629 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000231173 p.L17L PCDHGA1 chr5 141331261 141331261 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000517417 p.E193Q PCDHGA2 chr5 141341162 141341162 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000394576 p.S731C PCDHGA2 chr5 141341235 141341235 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000394576 p.H755L PCDHGA3 chr5 141345911 141345911 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000253812 p.V626V PCDHGB1 chr5 141350799 141350799 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000523390 p.K180M PCDHGB1 chr5 141351566 141351566 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000523390 p.L436M PCDHGB1 chr5 141351693 141351693 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000523390 p.G478V PCDHGA5 chr5 141364575 141364575 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000518069 p.G82V PCDHGA5 chr5 141366022 141366022 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000518069 p.Y564Y PCDHGA6 chr5 141374087 141374087 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000517434 p.A2S PCDHGA7 chr5 141382983 141382983 Silent A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000518325 p.A28A PCDHGA8 chr5 141394404 141394404 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000398604 p.L531M PCDHGA9 chr5 141403153 141403153 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000573521 p.V67V PCDHGA9 chr5 141403775 141403775 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000573521 p.G275R PCDHGB7 chr5 141418820 141418820 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000398594 p.A321S YIPF5 chr5 144162285 144162285 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000274496 p.S182C KCTD16 chr5 144473821 144473821 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000507359 p.P332A LARS chr5 146130120 146130120 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000394434 p.G842G SH3TC2 chr5 149027147 149027147 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000515425 p.A862D SH3TC2 chr5 149027473 149027473 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000515425 p.R753R PCYOX1L chr5 149366112 149366112 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000274569 p.R214L ARHGEF37 chr5 149632136 149632136 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000333677 p.G658V PDGFRB chr5 150125524 150125524 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000261799 p.G576G CCDC69 chr5 151185448 151185448 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000355417 p.R197W SLC36A2 chr5 151317011 151317011 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000335244 p.L420V SLC36A2 chr5 151317012 151317012 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000335244 p.A419A FAT2 chr5 151545761 151545761 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000261800 p.A1789D KIF4B chr5 155013811 155013811 5'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000435029 KIF4B chr5 155017393 155017393 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000435029 p.V1178V PPP1R2P3 chr5 156850592 156850592 RNA C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000522232 ADAM19 chr5 157480942 157480942 3'Flank G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000517905 ADAM19 chr5 157570958 157570958 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000517905 p.P39P EBF1 chr5 158712306 158712306 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000313708 p.S466* GABRA1 chr5 161895769 161895769 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000023897 p.C320W GABRG2 chr5 162149142 162149142 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361925 p.S319R GABRG2 chr5 162153376 162153376 3'UTR T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361925 GABRG2 chr5 162153377 162153377 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361925 CCNG1 chr5 163442508 163442508 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000340828 p.L277L TENM2 chr5 168218288 168218288 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000518659 p.S1466I DOCK2 chr5 169714140 169714140 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000256935 p.G591V FAM196B chr5 169883381 169883381 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377365 p.R173T DOCK2 chr5 170034497 170034497 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000256935 p.R1189L FOXI1 chr5 170106085 170106085 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000306268 p.S43I KCNMB1 chr5 170383779 170383779 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000274629 p.K69R GABRP chr5 170788602 170788602 5'UTR A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265294 GABRP chr5 170788603 170788603 5'UTR G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265294 TLX3 chr5 171309774 171309774 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000296921 p.D137N ERGIC1 chr5 172915677 172915677 Intron G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000393784 EIF4E1B chr5 176643252 176643252 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000318682 p.H62Q ZNF454 chr5 178965687 178965687 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000320129 p.A428D ADAMTS2 chr5 179343798 179343798 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000251582 p.S168Y RP11-798K23.3 chr5 179524873 179524873 RNA G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000505650 C5orf60 chr5 179642971 179642971 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000448248 p.S194Y MAML1 chr5 179768984 179768984 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000292599 p.K622N RASGEF1C chr5 180138170 180138170 Intron C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361132 IRF4 chr6 401669 401669 Nonsense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000380956 p.Q331* BPHL chr6 3140439 3140439 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000380379 p.H240N TUBB2B chr6 3225327 3225327 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000259818 p.A254A CDYL chr6 4953948 4953948 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000328908 p.L563L DSP chr6 7579331 7579331 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000379802 p.A1047A TFAP2A chr6 10414875 10414875 Intron G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000482890 CDKAL1 chr6 21000311 21000311 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000274695 p.E332* NRSN1 chr6 24145964 24145964 3'UTR T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000378478 GPLD1 chr6 24473655 24473655 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000230036 p.G152C SLC17A2 chr6 25918541 25918541 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265425 p.V199L HIST1H2AC chr6 26124438 26124438 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000314088 p.N69I HIST1H2BH chr6 26251850 26251850 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000619466 p.V67D HIST1H3PS1 chr6 26322256 26322256 RNA C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000404612 BTN3A3 chr6 26451673 26451673 Splice_Site A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000244519 p.X340_splice HIST1H2BM chr6 27815251 27815251 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000621112 p.I70F XXbac-BPG308K3.6 chr6 28861547 28861547 RNA C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000440244 GABBR1 chr6 29613453 29613453 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377034 p.K452N HLA-K chr6 29926516 29926516 RNA C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000430151 TRIM40 chr6 30136923 30136923 5'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000376724 TRIM40 chr6 30136925 30136925 5'UTR C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000376724 TRIM10 chr6 30158412 30158412 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000449742 p.R248M VARS2 chr6 30914759 30914759 5'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000321897 MICB chr6 31507169 31507169 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000252229 p.G254A C6orf47 chr6 31659876 31659876 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000375911 p.P24P LY6G5C chr6 31683050 31683050 5'Flank C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000383237 LY6G6E chr6 31713856 31713856 5'Flank C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000383418 VARS chr6 31791636 31791636 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000375663 p.N358N NELFE chr6 31954708 31954708 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000375429 p.D197N NELFE chr6 31958438 31958438 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000375429 p.V3V HLA-DQB2 chr6 32761798 32761798 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000411527 p.Q76E HLA-DQB2 chr6 32761799 32761799 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000411527 p.F75L COL11A2 chr6 33186510 33186510 Intron G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000374708 RXRB chr6 33196605 33196605 Splice_Region C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000374680 p.A274A ZBTB22 chr6 33315581 33315581 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000431845 p.G446W PHF1 chr6 33413238 33413238 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000374516 p.G127A GRM4 chr6 34133398 34133398 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000538487 p.K33N DNAH8 chr6 38923070 38923070 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000359357 p.D3342Y KCNK5 chr6 39194301 39194301 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000359534 p.V168L KCNK16 chr6 39316876 39316876 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373229 p.M189I DAAM2 chr6 39884056 39884056 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000274867 p.Y647F LRFN2 chr6 40392032 40392032 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000338305 p.G761S FOXP4 chr6 41587428 41587428 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000307972 p.A263G KLC4 chr6 43070711 43070711 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000347162 p.P334R SLC22A7 chr6 43298664 43298664 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000372585 p.G102G TJAP1 chr6 43505200 43505200 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000372445 p.R340L POLR1C chr6 43520980 43520980 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000372389 p.R285I TDRD6 chr6 46689445 46689445 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000316081 p.S439S PLA2G7 chr6 46709391 46709391 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000274793 p.V269L ANKRD66 chr6 46749966 46749966 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000565422 p.R47T RHAG chr6 49606847 49606847 Splice_Site C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371175 p.X404_splice CRISP3 chr6 49733849 49733849 Splice_Site C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000433368 p.X116_splice PGK2 chr6 49786503 49786503 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000304801 p.D229Tfs*6 PGK2 chr6 49786998 49786998 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000304801 p.L64V DEFB113 chr6 49968808 49968808 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000398718 p.G40C PKHD1 chr6 51909299 51909299 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371117 p.L2222L PKHD1 chr6 52042913 52042913 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371117 p.L1015I PKHD1 chr6 52042967 52042967 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371117 p.M997L PKHD1 chr6 52043649 52043649 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371117 p.V933F MCM3 chr6 52276468 52276468 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000229854 p.R392C GCLC chr6 53544577 53544577 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000229416 p.R23R FAM83B chr6 54926431 54926431 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000306858 p.A169S HCRTR2 chr6 55174544 55174544 5'UTR G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370862 DST chr6 56561493 56561493 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000312431 p.G2452C DST chr6 56604106 56604106 Intron C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000312431 DST chr6 56615912 56615912 Intron G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000312431 DST chr6 56630308 56630308 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000312431 p.L1235L ZNF451 chr6 57100813 57100813 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370706 EYS chr6 64591094 64591094 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370616 p.A1591A EYS chr6 64945904 64945904 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370616 p.C757S EYS chr6 65344091 65344091 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370616 p.D516H SLC25A51P1 chr6 65788735 65788735 RNA C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000468432 ADGRB3 chr6 69233406 69233406 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370598 p.P866H COL19A1 chr6 69929454 69929454 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000620364 p.K140N COL9A1 chr6 70216818 70216818 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357250 COL9A1 chr6 70272086 70272086 Splice_Region G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357250 p.G356G B3GAT2 chr6 70956078 70956078 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000230053 p.D118Y KHDC3L chr6 73363267 73363267 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370367 p.Q114H COL12A1 chr6 75105249 75105249 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000322507 p.C2741F TTK chr6 80035104 80035104 Silent A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369798 p.L578L SNAP91 chr6 83580520 83580520 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369694 p.P743P TBX18 chr6 84737113 84737113 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369663 p.V466L HTR1E chr6 87015406 87015406 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000305344 p.L24L RARS2 chr6 87569568 87569568 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369536 p.P20L SRSF12 chr6 89117836 89117836 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000452027 p.A18S GABRR2 chr6 89269321 89269321 Intron C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000402938 BACH2 chr6 89950854 89950854 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000257749 p.A418P MAP3K7 chr6 90523724 90523724 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369329 p.S472S FUT9 chr6 96207524 96207524 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000302103 FUT9 chr6 96208470 96208470 3'UTR A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000302103 FUT9 chr6 96210114 96210114 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000302103 FUT9 chr6 96214450 96214450 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000302103 FUT9 chr6 96215450 96215450 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000302103 MMS22L chr6 97151832 97151832 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000275053 p.V1141I PRDM13 chr6 99614611 99614611 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369215 p.L659H MCHR2 chr6 99934458 99934458 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000281806 p.C216F GRIK2 chr6 101676709 101676709 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000421544 p.D210H SCML4 chr6 107720750 107720750 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369020 p.A309V SCML4 chr6 107746840 107746840 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369020 p.R112R NR2E1 chr6 108187567 108187567 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368986 KIAA1919 chr6 111259684 111259684 5'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368847 WISP3 chr6 112054365 112054365 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000230529 p.G3V HS3ST5 chr6 114057591 114057591 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000312719 p.K236I GPRC6A chr6 116795797 116795797 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000310357 p.Q530Kfs*2 GPRC6A chr6 116795803 116795803 Silent A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000310357 p.S527S GPRC6A chr6 116809378 116809378 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000310357 p.G145V ROS1 chr6 117387924 117387924 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368508 p.H624Y TBC1D32 chr6 121242215 121242215 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000398212 p.A715S NKAIN2 chr6 124658283 124658283 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368417 p.P124L LAMA2 chr6 129320620 129320620 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000421865 p.D1381Y LAMA2 chr6 129445715 129445715 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000421865 p.R2108L TMEM200A chr6 130440539 130440539 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000296978 p.P39P TMEM200A chr6 130441681 130441681 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000296978 p.P420H TMEM200A chr6 130441764 130441764 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000296978 p.V448F TAAR5 chr6 132588902 132588902 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000258034 p.L262H TAAR5 chr6 132588969 132588969 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000258034 p.L240M VNN1 chr6 132711746 132711746 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367928 p.P102S EYA4 chr6 133515363 133515363 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367895 p.R515M AHI1 chr6 135433085 135433085 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265602 p.L736F AHI1 chr6 135433186 135433186 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265602 p.A703S TXLNB chr6 139242621 139242621 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000358430 p.P654T ADGRG6 chr6 142370638 142370638 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000230173 p.G305V ADAT2 chr6 143428643 143428643 Silent T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000237283 p.L167L GRM1 chr6 146029454 146029454 5'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000282753 AKAP12 chr6 151351141 151351141 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000253332 p.S917L ESR1 chr6 151880737 151880737 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000206249 p.L242L SYNE1 chr6 152326534 152326534 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367255 p.A5019Qfs*5 SYNE1 chr6 152416394 152416394 Nonsense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367255 p.Q2015* SYNE1 chr6 152472306 152472306 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367255 p.A486A MYCT1 chr6 152721744 152721744 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367245 p.D67Y VIP chr6 152757179 152757179 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000367244 IPCEF1 chr6 154265919 154265919 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265198 p.S10I TIAM2 chr6 155129703 155129703 Silent A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000318981 p.R160R TIAM2 chr6 155137372 155137372 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000318981 p.R464G NOX3 chr6 155443360 155443360 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000159060 p.E133D ARID1B chr6 157184366 157184366 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000350026 p.E1148* RSPH3 chr6 158980918 158980918 Nonsense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000252655 p.Q381* FNDC1 chr6 159225578 159225578 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000297267 p.W310R IGF2R chr6 160047818 160047818 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000356956 p.R753Gfs*16 IGF2R chr6 160047820 160047820 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000356956 p.R753L PLG chr6 160713115 160713115 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000308192 p.L179L PARK2 chr6 161545271 161545271 Intron C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366898 PARK2 chr6 161545331 161545331 Intron T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366898 PDE10A chr6 165388363 165388363 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366882 p.A573S T chr6 166166799 166166799 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000296946 p.Y88* UNC93A chr6 167307835 167307835 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000230256 p.D345Y TTLL2 chr6 167341541 167341541 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000239587 p.K547N KIF25 chr6 168042095 168042095 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000354419 p.A258V THBS2 chr6 169229580 169229580 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366787 p.D751Y TCTE3 chr6 169751312 169751312 Intron C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000366774 MAD1L1 chr7 1936785 1936785 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265854 p.R570L CARD11 chr7 2937145 2937145 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000396946 p.E411D CARD11 chr7 2938780 2938780 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000396946 p.E306Q GRID2IP chr7 6514376 6514376 Splice_Region T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000457091 p.T474T GRID2IP chr7 6521927 6521927 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000457091 p.S317* ICA1 chr7 8218443 8218443 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000396675 p.R147R ICA1 chr7 8218444 8218444 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000396675 p.R147L THSD7A chr7 11379686 11379686 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000423059 p.D1512N THSD7A chr7 11379687 11379687 Silent A A C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000423059 p.P1511P THSD7A chr7 11379688 11379688 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000423059 p.P1511L THSD7A chr7 11541460 11541460 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000423059 p.P594R THSD7A chr7 11636704 11636704 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000423059 p.E150Kfs*6 VWDE chr7 12357347 12357347 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000275358 p.W1148S VWDE chr7 12370307 12370307 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000275358 p.V667I DGKB chr7 14149012 14149012 3'UTR T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000399322 DGKB chr7 14621445 14621445 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000399322 p.N407I TWIST1 chr7 19116702 19116702 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000242261 TMEM196 chr7 19725589 19725589 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000405764 p.L128L ITGB8 chr7 20404670 20404670 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000222573 p.G577A SP8 chr7 20784959 20784959 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361443 p.S268S DNAH11 chr7 21750340 21750340 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000409508 p.M2972I MPP6 chr7 24623665 24623665 Splice_Site G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000222644 DFNA5 chr7 24749571 24749571 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000342947 p.P68P HOXA3 chr7 27108545 27108545 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000317201 p.Q234H EVX1 chr7 27243452 27243452 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000496902 p.S141N CREB5 chr7 28570394 28570394 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357727 p.G107G ADCYAP1R1 chr7 31106694 31106694 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000304166 NEUROD6 chr7 31338381 31338381 Frame_Shift_Del G G - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000297142 p.R297Gfs*35 BMPER chr7 33966502 33966502 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000297161 p.Y115H BMPER chr7 34086016 34086016 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000297161 p.H557N AOAH chr7 36686780 36686780 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000617537 p.V48L ELMO1 chr7 37259197 37259197 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000310758 p.V133L AC004987.9 chr7 39834081 39834081 RNA C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000395959 INHBA chr7 41700213 41700213 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000242208 p.M54I HECW1 chr7 43508923 43508923 Intron C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000395891 ZMIZ2 chr7 44760244 44760244 Intron G G - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000309315 RAMP3 chr7 45183396 45183396 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000242249 p.T144S ADCY1 chr7 45657747 45657747 Missense_Mutation A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000297323 p.E390G ADCY1 chr7 45713695 45713695 Splice_Region G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000297323 p.V1020V IGFBP1 chr7 45892979 45892979 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000275525 p.G223V UPP1 chr7 48094782 48094782 5'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000331803 ABCA13 chr7 48275091 48275091 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000435803 p.P1809A IKZF1 chr7 50400411 50400411 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000331340 p.A448A COBL chr7 51025197 51025197 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265136 p.S1227I COBL chr7 51043589 51043589 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265136 p.S400S POM121L12 chr7 53036671 53036671 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000408890 VSTM2A chr7 54549932 54549932 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000407838 p.A132A VSTM2A chr7 54553961 54553961 Intron C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000407838 LANCL2 chr7 55411986 55411986 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000254770 p.R302L RNU6-389P chr7 55685217 55685217 5'Flank A A - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000517048 CCT6A chr7 56060379 56060379 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000275603 p.R392S ZNF479 chr7 57121132 57121132 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000319636 p.Q95E ZNF733P chr7 63291612 63291612 RNA G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000444809 ZNF727 chr7 64069018 64069018 Splice_Site G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000456806 p.X44_splice ZNF727 chr7 64078331 64078331 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000456806 p.E428* ASL chr7 66089154 66089154 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000304874 p.K299K CRCP chr7 66152231 66152231 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000395326 p.R107R CALN1 chr7 71787689 71787689 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000329008 CALN1 chr7 72106265 72106265 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000329008 p.R50R FKBP6 chr7 73328233 73328233 5'Flank C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000252037 GTF2IRD2 chr7 74822445 74822445 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000451013 p.G185* NCF1C chr7 75160676 75160676 RNA G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000438382 MDH2 chr7 76060455 76060455 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000315758 p.T171I MAGI2 chr7 78501739 78501739 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000354212 p.P268H MAGI2 chr7 78501740 78501740 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000354212 p.P268T HGF chr7 81729744 81729744 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000222390 p.E301* HGF chr7 81729745 81729745 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000222390 p.L300F SEMA3D chr7 84999595 84999595 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000284136 p.L727I SEMA3D chr7 85015135 85015135 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000284136 p.D543Y SEMA3D chr7 85015175 85015175 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000284136 p.L529L GRM3 chr7 86765329 86765329 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361669 p.E62K ABCB4 chr7 87452992 87452992 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265723 p.G163V ABCB1 chr7 87509416 87509416 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265724 p.V1116V DBF4 chr7 87897338 87897338 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265728 p.Q227K ZNF804B chr7 89334588 89334588 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000333190 p.P536S ZNF804B chr7 89336751 89336751 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000333190 p.P1257T SAMD9 chr7 93102761 93102761 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000379958 p.E1113K SAMD9L chr7 93134645 93134645 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000318238 p.V443L CALCR chr7 93443690 93443690 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000359558 p.C273F PEG10 chr7 94665713 94665713 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000482108 SHFM1 chr7 96694892 96694892 Splice_Site C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000248566 p.X26_splice BAIAP2L1 chr7 98315507 98315507 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000005260 p.D198Y ZKSCAN5 chr7 99531582 99531582 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000326775 p.H619Tfs*58 STAG3 chr7 100214046 100214046 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000317296 EPO chr7 100723122 100723122 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000252723 p.G191R EPO chr7 100723123 100723123 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000252723 p.G191V PLOD3 chr7 101212263 101212263 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000223127 p.D373Y PLOD3 chr7 101212264 101212264 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000223127 p.R372R MYL10 chr7 101616239 101616239 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000223167 p.G172C CUX1 chr7 102201460 102201460 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000292535 p.Q721H SPDYE6 chr7 102350766 102350766 Frame_Shift_Del G G - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000563237 p.S240Pfs*52 RELN chr7 103523408 103523408 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000428762 p.C2491W RELN chr7 103553546 103553546 Missense_Mutation A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000428762 p.M1996T ORC5 chr7 104207943 104207943 5'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000297431 PIK3CG chr7 106868590 106868590 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000359195 p.G343G SLC26A3 chr7 107791065 107791065 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000340010 p.L185V LAMB1 chr7 108002944 108002944 5'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000222399 LAMB4 chr7 108043894 108043894 Splice_Region G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000205386 p.I1443I NRCAM chr7 108176540 108176540 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000379028 p.T1014N NRCAM chr7 108239962 108239962 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000379028 p.D35Y PNPLA8 chr7 108479372 108479372 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000257694 p.G629V FOXP2 chr7 114654006 114654006 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000350908 p.K421N ASZ1 chr7 117422319 117422319 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000284629 p.P82P ANKRD7 chr7 118224902 118224902 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265224 p.K24N KCND2 chr7 120274782 120274782 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000331113 p.T50T CPED1 chr7 121130127 121130127 Splice_Region C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000310396 p.L470L PTPRZ1 chr7 121984089 121984089 Nonsense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000393386 p.Y300* SLC13A1 chr7 123117530 123117530 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000194130 p.V531L ASB15 chr7 123630020 123630020 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000275699 p.R499S GRM8 chr7 126439097 126439097 3'UTR C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000339582 GRM8 chr7 126904075 126904075 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000339582 p.W305C GRM8 chr7 127242759 127242759 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000339582 p.G149V PAX4 chr7 127613039 127613039 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000341640 p.W225L PAX4 chr7 127613874 127613874 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000341640 p.L140F LRRC4 chr7 128029509 128029509 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000249363 p.P378T FAM71F2 chr7 128675804 128675804 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000480462 p.G104C SMO chr7 129205752 129205752 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000249373 p.A297V SMO chr7 129206331 129206331 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000249373 p.P368A PLXNA4 chr7 132180625 132180625 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000321063 p.L1200L PLXNA4 chr7 132227521 132227521 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000321063 p.L604L CNOT4 chr7 135398203 135398203 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000315544 p.S282C PTN chr7 137228077 137228077 Splice_Site T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000348225 p.X151_splice SVOPL chr7 138678498 138678498 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000419765 p.A37V KDM7A chr7 140091951 140091951 Missense_Mutation A A C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000397560 p.S862A KDM7A chr7 140111156 140111156 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000397560 p.P456L DENND2A chr7 140546847 140546847 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000275884 p.L710L DENND2A chr7 140569663 140569663 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000275884 p.E508* DENND2A chr7 140569664 140569664 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000275884 p.M507I TAS2R3 chr7 141764722 141764722 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000247879 p.W188C TAS2R38 chr7 141972802 141972802 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000547270 p.I296I MGAM chr7 142059959 142059959 Frame_Shift_Del G G - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000549489 p.G1352Efs*12 MGAM chr7 142105835 142105835 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000549489 p.D1840N PRSS58 chr7 142255209 142255209 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000547058 p.S94S TRPV5 chr7 142909510 142909510 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265310 p.L625L KEL chr7 142941293 142941293 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000355265 p.G720C KEL chr7 142943589 142943589 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000355265 p.V534L KEL chr7 142962288 142962288 5'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000355265 OR9A2 chr7 143026840 143026840 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000350513 p.S98* OR6V1 chr7 143052394 143052394 Silent T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000418316 p.F18F PIP chr7 143139540 143139540 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000291009 p.V113V GSTK1 chr7 143263469 143263469 5'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000358406 TCAF2 chr7 143724729 143724729 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000441159 TCAF1 chr7 143876169 143876169 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000479870 p.G147V TCAF1 chr7 143876170 143876170 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000479870 p.G147C OR2F1 chr7 143960368 143960368 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000392899 p.S133* OR2F1 chr7 143960410 143960410 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000392899 p.T147K OR2A14 chr7 144129558 144129558 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000408899 p.V149E NOBOX chr7 144401554 144401554 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000467773 p.E112E CNTNAP2 chr7 146116905 146116905 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361727 p.G10A CNTNAP2 chr7 148147588 148147588 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361727 p.R884R ZNF467 chr7 149769195 149769195 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000302017 p.E53* SSPO chr7 149789773 149789773 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000378016 p.S1546S SSPO chr7 149821652 149821652 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000378016 p.C4247* SLC4A2 chr7 151074739 151074739 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000413384 p.P982L SMARCD3 chr7 151275252 151275252 Splice_Site C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000392811 PRKAG2 chr7 151781271 151781271 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000287878 p.R116P KMT2C chr7 152250880 152250880 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262189 p.E570* FABP5P3 chr7 152446096 152446096 3'Flank C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000477993 DPP6 chr7 153887735 153887735 Splice_Site G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000404039 p.X17_splice DPP6 chr7 154052876 154052876 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377770 p.P19H DPP6 chr7 154769496 154769496 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377770 p.S321S DPP6 chr7 154807066 154807066 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377770 p.S540R NOM1 chr7 156950375 156950375 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000275820 p.R213L DLGAP2 chr8 1549641 1549641 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000421627 p.H316Q DLGAP2 chr8 1678304 1678304 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000421627 p.E713D KBTBD11 chr8 2003106 2003106 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000320248 KBTBD11 chr8 2003107 2003107 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000320248 MYOM2 chr8 2106303 2106303 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262113 p.C932* MYOM2 chr8 2142396 2142396 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262113 p.K1341N CSMD1 chr8 2942483 2942483 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000520002 p.L3509L CSMD1 chr8 2998101 2998101 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000520002 p.T2764S CSMD1 chr8 3052543 3052543 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000520002 p.L2528I CSMD1 chr8 3359284 3359284 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000520002 p.G1059R AGPAT5 chr8 6741685 6741685 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000285518 p.G174S XKR5 chr8 6812211 6812211 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000618742 p.A350S TNKS chr8 9763233 9763233 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000310430 p.V1121L PRSS55 chr8 10531543 10531543 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000328655 p.A199G RP1L1 chr8 10609689 10609689 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000382483 p.G1470Afs*16 GATA4 chr8 11750196 11750196 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000335135 p.P290H ZNF705D chr8 12112932 12112932 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000400078 p.R226I USP17L2 chr8 12138592 12138592 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000333796 p.P57T KIAA1456 chr8 13021061 13021061 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000524591 p.A128T KIAA1456 chr8 13027504 13027504 3'UTR G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000524591 PCM1 chr8 17938901 17938901 Silent A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000325083 p.S168S NAT2 chr8 18400867 18400867 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000286479 p.L288L DOK2 chr8 21911910 21911910 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000276420 p.A142T XPO7 chr8 21984665 21984665 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000252512 p.L433V PIWIL2 chr8 22290293 22290293 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000356766 p.L376L LOXL2 chr8 23322282 23322282 Splice_Site C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000389131 p.X384_splice NKX3-1 chr8 23681479 23681479 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000380871 p.L149L NKX2-6 chr8 23702517 23702517 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000325017 p.H280Q DOCK5 chr8 25243754 25243754 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000276440 p.E42* SCARA3 chr8 27659466 27659466 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000301904 p.S432S ESCO2 chr8 27788962 27788962 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000305188 p.E416V SCARA5 chr8 27921641 27921641 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000354914 p.A282A NUGGC chr8 28041087 28041087 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000413272 p.R525S PURG chr8 31032395 31032395 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000475541 p.G130C PPAPDC1B chr8 38266223 38266223 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000424479 p.R184S ADAM9 chr8 39023251 39023251 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000487273 p.V280V KAT6A chr8 41932995 41932995 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265713 p.G1742D PXDNL chr8 51320804 51320804 Missense_Mutation A A C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000356297 p.C1414G PXDNL chr8 51372027 51372027 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000356297 p.K1249N RP1 chr8 54625060 54625060 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000220676 p.P393H XKR4 chr8 55451963 55451963 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000327381 XKR4 chr8 55523432 55523432 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000327381 p.R386S TOX chr8 58807645 58807645 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361421 TOX chr8 58838189 58838189 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361421 p.F272L CHD7 chr8 60741877 60741877 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000423902 p.A149S CHD7 chr8 60853101 60853101 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000423902 p.D2126H YTHDF3 chr8 63186491 63186491 Missense_Mutation T T G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000539294 p.S160R VCPIP1 chr8 66664738 66664738 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000310421 p.G741W PPP1R42 chr8 67014474 67014474 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000324682 p.C83S PREX2 chr8 68157405 68157405 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000288368 p.E1439* PRDM14 chr8 70069525 70069525 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000276594 p.P112P NCOA2 chr8 70123933 70123933 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000452400 p.S1415L KCNB2 chr8 72567881 72567881 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000523207 p.L49L KCNB2 chr8 72936793 72936793 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000523207 p.D480Y ZFHX4 chr8 76705375 76705375 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000521891 p.S429S ZFHX4 chr8 76706153 76706153 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000521891 p.G689C ZFHX4 chr8 76707930 76707930 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000521891 p.I993Lfs*7 ZFHX4 chr8 76851127 76851127 Silent T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000521891 p.C1402C ZFHX4 chr8 76851501 76851501 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000521891 p.P1527H ZFHX4 chr8 76852210 76852210 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000521891 p.G1763G ZFHX4 chr8 76854180 76854180 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000521891 p.P2420H ZFHX4 chr8 76864486 76864486 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000521891 p.S3591C ZBTB10 chr8 80500322 80500322 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000430430 p.V601L PMP2 chr8 81447382 81447382 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000256103 p.S2N CA13 chr8 85250768 85250768 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000321764 p.P22P ATP6V0D2 chr8 86150217 86150217 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000285393 p.P249T DCAF4L2 chr8 87872839 87872839 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000319675 p.A378E MMP16 chr8 88041376 88041376 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000286614 MMP16 chr8 88069451 88069451 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000286614 TMEM64 chr8 90625624 90625624 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000458549 TMEM55A chr8 90996739 90996739 Nonsense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000285419 p.S182* LRRC69 chr8 91133291 91133291 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000448384 p.G189* RUNX1T1 chr8 91960460 91960460 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265814 p.R533R RAD54B chr8 94391760 94391760 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000336148 p.A553E FBXO43 chr8 100142100 100142100 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000428847 p.D52Tfs*30 PABPC1 chr8 100713091 100713091 Missense_Mutation T T G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000318607 p.Q245P RIMS2 chr8 103936613 103936613 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262231 p.T652I RIMS2 chr8 104251768 104251768 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262231 p.A1172D DCSTAMP chr8 104348922 104348922 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000297581 p.G124C PKHD1L1 chr8 109444917 109444917 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000378402 p.G1683A PKHD1L1 chr8 109452122 109452122 Splice_Site A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000378402 p.X2117_splice PKHD1L1 chr8 109490006 109490006 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000378402 p.R3312M CSMD3 chr8 112224871 112224871 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000297405 p.A3675G CSMD3 chr8 112503813 112503813 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000297405 p.T1687N CSMD3 chr8 113098845 113098845 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000297405 p.G276G CSMD3 chr8 113314618 113314618 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000297405 p.Y118* CSMD3 chr8 113436842 113436842 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000297405 p.R5S SLC30A8 chr8 117171033 117171033 Splice_Site G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000456015 p.X277_splice MAL2 chr8 119240165 119240165 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000614891 p.D102N MAL2 chr8 119240257 119240257 Silent T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000614891 p.N132N COL14A1 chr8 120203751 120203751 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000297848 p.S307Y TMEM65 chr8 124327393 124327393 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000297632 p.I126I POU5F1B chr8 127415934 127415934 Frame_Shift_Del G G - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000465342 p.A25Rfs*9 POU5F1B chr8 127415938 127415938 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000465342 p.G24G POU5F1B chr8 127415942 127415942 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000465342 p.E26Q ADCY8 chr8 130951994 130951994 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000286355 p.R372L KCNQ3 chr8 132175473 132175473 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000388996 p.D305Y SLA chr8 133038584 133038584 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000338087 p.M257I SLA chr8 133060275 133060275 Intron G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000338087 TG chr8 133133529 133133529 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000220616 p.P2686H FAM135B chr8 138146034 138146034 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000395297 p.L1155L FAM135B chr8 138153049 138153049 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000395297 p.V476F FAM135B chr8 138178649 138178649 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000395297 p.K305N ARC chr8 142613087 142613087 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000356613 p.P395P ARC chr8 142613471 142613471 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000356613 p.F267L TIGD5 chr8 143599671 143599671 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000504548 p.E590* FAM83H chr8 143728992 143728992 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000388913 p.A238P EPPK1 chr8 143867789 143867789 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000615648 p.G1822V PLEC chr8 143916899 143916899 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000322810 p.G4445R PLEC chr8 143917086 143917086 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000322810 p.S4382S GPAA1 chr8 144086040 144086040 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000355091 p.T594N MROH1 chr8 144190831 144190831 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000326134 p.D204Y CYHR1 chr8 144453374 144453374 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000438911 p.P111P KANK1 chr9 712593 712593 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000382297 p.S609S DMRT3 chr9 990798 990798 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000190165 p.R404S PTPRD chr9 8518129 8518129 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000356435 p.P421Q PTPRD chr9 8636699 8636699 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000356435 p.E70D FREM1 chr9 14842324 14842324 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000380880 p.G577A HAUS6 chr9 19063556 19063556 Silent T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000380502 p.S467S LINGO2 chr9 27949238 27949238 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000308675 p.S478R FAM205BP chr9 34835169 34835169 RNA G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000399773 TMEM8B chr9 35842569 35842569 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377988 p.N44I CCIN chr9 36170832 36170832 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000335119 p.V444L SPATA31A1 chr9 39359694 39359694 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000625870 p.W643C PGM5P2 chr9 41074224 41074224 RNA G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000613141 SPATA31A6 chr9 42187325 42187325 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000332857 p.W541C SPATA31A6 chr9 42187621 42187621 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000332857 p.Q640L KLF9 chr9 70413078 70413078 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377126 p.D96H GDA chr9 72195561 72195561 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000358399 p.P62Q RORB chr9 74634630 74634630 Splice_Site G G - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000396204 p.X43_splice TRPM6 chr9 74808108 74808108 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000360774 p.G522C TRPM6 chr9 74816735 74816735 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000360774 p.L414L PRUNE2 chr9 76705687 76705687 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000376718 p.N2196I TLE4 chr9 79706811 79706811 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000376552 p.R283L SPATA31D5P chr9 81915442 81915442 RNA C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000527857 SPATA31D5P chr9 81916014 81916014 RNA G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000527857 SPATA31D5P chr9 81918420 81918420 RNA C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000527857 SPATA31D5P chr9 81919098 81919098 RNA A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000527857 RP11-383M4.6 chr9 81932421 81932421 Intron C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000585776 RP11-383M4.6 chr9 81934445 81934445 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000585776 RP11-383M4.6 chr9 81949894 81949894 Intron C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000585776 SPATA31D1 chr9 81992468 81992468 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000344803 p.V666V SPATA31D1 chr9 81992855 81992855 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000344803 p.K795N SPATA31D1 chr9 81993088 81993088 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000344803 p.H873L SPATA31D1 chr9 81993183 81993183 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000344803 p.A905S NTRK2 chr9 85021442 85021442 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000323115 AGTPBP1 chr9 85547136 85547136 Silent A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357081 p.S1218S DAPK1 chr9 87703142 87703142 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000358077 p.V995V SYK chr9 90874737 90874737 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000375746 p.E357Q NOL8 chr9 92314627 92314627 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000442668 p.K666N NOL8 chr9 92314789 92314789 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000442668 p.S612S ECM2 chr9 92500916 92500916 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000344604 p.P581Q ECM2 chr9 92500917 92500917 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000344604 p.P581T NUTM2G chr9 96932205 96932205 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000372322 p.I169Sfs*83 CCDC180 chr9 97360041 97360041 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000529487 p.Q1185H COL15A1 chr9 98987329 98987329 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000375001 p.P228P COL15A1 chr9 99003552 99003552 Missense_Mutation A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000375001 p.M389V GRIN3A chr9 101628259 101628259 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361820 p.L832Q GRIN3A chr9 101670598 101670598 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361820 p.Y605F OR13C8 chr9 104569330 104569330 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000335040 p.L55M ZNF462 chr9 106984184 106984184 Splice_Site A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000277225 p.X2278_splice SVEP1 chr9 110407589 110407589 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000374469 p.H2671N SVEP1 chr9 110503197 110503197 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000374469 p.R442S MUSK chr9 110785698 110785698 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000374448 p.F586L FKBP15 chr9 113207225 113207225 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000238256 p.H81Y ALAD chr9 113389081 113389081 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000409155 p.Y276F C9orf43 chr9 113413800 113413800 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000288462 p.G65S RGS3 chr9 113591451 113591451 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000350696 COL27A1 chr9 114307739 114307739 Silent T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000356083 p.H1726H AKNA chr9 114381134 114381134 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000307564 p.P67L PAPPA chr9 116187424 116187424 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000328252 p.S229T PAPPA chr9 116235555 116235555 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000328252 p.L884V PAPPA chr9 116334880 116334880 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000328252 p.C1139* ASTN2 chr9 117141415 117141415 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000313400 p.R360P ASTN2 chr9 117291392 117291392 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000313400 p.A188A TLR4 chr9 117713224 117713224 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000355622 p.A366P CNTRL chr9 121125726 121125726 Silent A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000238341 p.A605A MORN5 chr9 122174563 122174563 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373764 p.D125E LHX6 chr9 122209665 122209665 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373755 p.P340P PTGS1 chr9 122392298 122392298 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000362012 p.G518G OR1K1 chr9 122800272 122800272 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000277309 p.I50I ZBTB26 chr9 122918902 122918902 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373654 p.L345F CRB2 chr9 123374628 123374631 Frame_Shift_Del GGCA GGCA - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373631 p.G1147Afs*36 OLFML2A chr9 124787011 124787011 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373580 p.E43* GOLGA1 chr9 124908438 124908438 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373555 p.R335K ZBTB34 chr9 126884165 126884165 3'UTR A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373452 SH2D3C chr9 127738909 127738909 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000314830 p.R807L SPTAN1 chr9 128633219 128633219 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000372731 p.R2435Q ZER1 chr9 128751131 128751131 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000291900 p.R392R HMCN2 chr9 130430592 130430592 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000624552 p.G4859* ASS1 chr9 130466736 130466736 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000352480 p.P144P SETX chr9 132264891 132264891 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000224140 p.K2461M SETX chr9 132334673 132334673 Missense_Mutation A A C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000224140 p.L258W DDX31 chr9 132630306 132630306 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000372153 p.S635L GTF3C4 chr9 132678966 132678966 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000372146 p.Q449H TSC1 chr9 132905673 132905673 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000298552 p.T635T GBGT1 chr9 133154108 133154108 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000372040 p.Q171H OBP2B chr9 133205348 133205348 3'UTR C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000372034 ADAMTS13 chr9 133459051 133459051 Frame_Shift_Del G G - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371929 p.A1386Lfs*10 COL5A1 chr9 134766999 134766999 Splice_Site G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371817 p.X712_splice SOHLH1 chr9 135693691 135693691 3'UTR C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000298466 KCNT1 chr9 135768925 135768925 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000488444 p.V481F SEC16A chr9 136446858 136446858 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000313050 p.P2263P NOTCH1 chr9 136496998 136496998 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000277541 p.L2247L LCN6 chr9 136744726 136744726 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000341206 p.A143G SLC34A3 chr9 137232139 137232139 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361134 p.K51N EHMT1 chr9 137776840 137776840 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000460843 p.G672C ADARB2 chr10 1200263 1200263 Intron C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000381312 AKR1C1 chr10 4963392 4963392 5'UTR T T G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000380872 AKR1C4 chr10 5213001 5213001 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000263126 p.P230T PRKCQ chr10 6479166 6479166 Splice_Site C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000263125 p.X394_splice ITIH5 chr10 7579948 7579948 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000397146 p.P409A ITIH5 chr10 7617264 7617264 Frame_Shift_Del G G - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000397146 p.P224Hfs*14 ITIH2 chr10 7721772 7721772 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000358415 p.L288M ATP5C1 chr10 7799072 7799072 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000356708 p.L102L UPF2 chr10 12004671 12004671 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000356352 p.E455* UCMA chr10 13233734 13233734 Splice_Site C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000378681 p.X42_splice CUBN chr10 16907627 16907627 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377833 p.S2529N CUBN chr10 16928185 16928185 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377833 p.R2081S VIM chr10 17233788 17233788 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000224237 p.A247P HACD1 chr10 17594355 17594355 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361271 p.V212I STAM chr10 17714781 17714781 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377524 MRC1 chr10 17849739 17849739 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000569591 p.D408E MRC1 chr10 17866703 17866703 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000569591 p.P642H SLC39A12 chr10 17965516 17965516 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377369 p.G193* GPR158 chr10 25412326 25412326 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000376351 p.R396S GPR158 chr10 25550975 25550975 Splice_Site G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000376351 p.X469_splice GPR158 chr10 25572739 25572739 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000376351 p.L535L GPR158 chr10 25572740 25572740 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000376351 p.V536L GPR158 chr10 25596667 25596667 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000376351 p.R675G GPR158 chr10 25598166 25598166 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000376351 p.S847Y MYO3A chr10 25952110 25952110 5'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265944 MYO3A chr10 26170503 26170503 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265944 p.Q1121L MYO3A chr10 26211991 26211991 3'UTR G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265944 YME1L1 chr10 27154234 27154234 5'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000326799 SVILP1 chr10 30697466 30697466 RNA G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000422642 ZEB1 chr10 31461186 31461186 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000320985 p.G70W ANKRD30A chr10 37133976 37133976 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000611781 p.Q226H ANKRD30A chr10 37219140 37219140 Missense_Mutation A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000611781 p.N1143S ZNF33A chr10 38016916 38016916 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000458705 p.V19L RET chr10 43113586 43113586 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000355710 p.G597V RASGEF1A chr10 43196985 43196985 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000395809 p.S447C AGAP4 chr10 45826748 45826748 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000448048 p.N387Y TIMM23 chr10 45982564 45982564 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000580018 p.T69T CTGLF12P chr10 48010641 48010641 RNA C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000585227 ARHGAP22 chr10 48450830 48450830 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000249601 p.R433R WDFY4 chr10 48709955 48709955 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000325239 p.L75I WDFY4 chr10 48726048 48726048 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000325239 p.L253L WDFY4 chr10 48743198 48743198 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000325239 p.R703S WDFY4 chr10 48760414 48760414 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000325239 p.R843W WDFY4 chr10 48890692 48890692 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000325239 p.T2427T FAM170B chr10 49133869 49133869 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000311787 p.G17A C10orf71 chr10 49322739 49322739 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000374144 p.G65V SLC18A3 chr10 49611723 49611723 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000374115 p.G328V CHAT chr10 49646642 49646642 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000337653 p.G417R PARG chr10 49832872 49832872 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000402038 p.E860* SGMS1 chr10 50307289 50307289 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361781 p.L365L SGMS1-AS1 chr10 50630028 50630028 RNA G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000443374 A1CF chr10 50814013 50814013 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373993 p.G397G PCDH15 chr10 54020358 54020358 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000320301 p.K862R PCDH15 chr10 54346421 54346421 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000320301 p.D180H BICC1 chr10 58803206 58803206 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373886 p.A715A FAM13C chr10 59269977 59269977 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000618804 p.S242Y FAM13C chr10 59352432 59352432 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000618804 p.L54L ANK3 chr10 60055857 60055857 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000280772 p.G4289A CTNNA3 chr10 66379312 66379312 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000433211 p.A524A CTNNA3 chr10 66379313 66379313 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000433211 p.A524D TET1 chr10 68691010 68691010 Silent A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373644 p.S1869S STOX1 chr10 68884522 68884522 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000298596 p.Q242H TACR2 chr10 69409090 69409090 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373306 COL13A1 chr10 69898738 69898738 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000398978 p.P252P CDH23 chr10 71566923 71566923 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000224721 p.T254K CDH23 chr10 71645834 71645834 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000224721 p.L432M CDH23 chr10 71687700 71687700 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000224721 p.V730V CHST3 chr10 72007227 72007227 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373115 p.D66Y PPP3CB chr10 73479415 73479415 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000360663 p.G63V DUSP13 chr10 75101957 75101957 3'UTR T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000372702 RPS24 chr10 78054786 78054786 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000440692 p.V216F EIF5AL1 chr10 79514003 79514003 3'UTR A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000520547 CDHR1 chr10 84201834 84201834 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000623527 p.R185S BMPR1A chr10 86890154 86890154 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000372037 p.D54H IFIT5 chr10 89417298 89417298 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371795 p.E33E IDE chr10 92479291 92479291 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265986 p.I624V PIPSL chr10 93961212 93961212 RNA A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000480546 ALDH18A1 chr10 95626748 95626748 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371224 p.M369I ZNF518A chr10 96163569 96163569 3'Flank A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000316045 PIK3AP1 chr10 96595581 96595581 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000339364 p.R805P SLIT1 chr10 97006530 97006530 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000266058 p.Q1178K FRAT1 chr10 97320399 97320399 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371021 PYROXD2 chr10 98383827 98383827 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370575 p.V573L PYROXD2 chr10 98400123 98400123 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370575 p.Q150H CWF19L1 chr10 100235675 100235675 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000354105 p.Q488Q PAX2 chr10 100749776 100749777 Frame_Shift_Ins - - A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000428433 p.V26Gfs*28 PAX2 chr10 100809167 100809167 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000428433 p.L307L MRPL43 chr10 100978279 100978279 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000318325 CALHM3 chr10 103476398 103476398 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369783 p.Q147K CFAP43 chr10 104193823 104193823 Intron C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357060 SORCS3 chr10 104977431 104977431 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369699 p.Q298K SORCS3 chr10 105211216 105211216 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369699 p.C781S SORCS1 chr10 106579194 106579194 Intron C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000263054 SORCS1 chr10 106688273 106688273 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000263054 p.I493M SORCS1 chr10 106829616 106829616 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000263054 p.T228T RBM20 chr10 110812716 110812716 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369519 p.K773N ADRA2A chr10 111078254 111078254 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000280155 p.F86F ADRA2A chr10 111078371 111078371 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000280155 p.L125L TDRD1 chr10 114231486 114231486 Frame_Shift_Del A A - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000251864 p.T1181Qfs*17 TDRD1 chr10 114231488 114231488 Missense_Mutation A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000251864 p.T1181A ABLIM1 chr10 114441768 114441768 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000277895 p.S651F AL354873.1 chr10 114684314 114684314 3'Flank G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000618576 GFRA1 chr10 116270860 116270860 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000355422 p.C99F PNLIP chr10 116547345 116547345 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369221 p.W33L PNLIP chr10 116556073 116556073 Missense_Mutation T T G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369221 p.D295E PNLIPRP1 chr10 116591155 116591155 Frame_Shift_Del T T - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000358834 p.F10Sfs*33 PNLIPRP2 chr10 116624041 116624041 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000611850 p.P49H C10orf82 chr10 116664936 116664936 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369210 p.V96L C10orf82 chr10 116664962 116664962 Intron C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369210 C10orf82 chr10 116665707 116665707 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369210 p.A59P VAX1 chr10 117134154 117134154 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369206 p.R287S VAX1 chr10 117136650 117136650 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369206 p.G84V VAX1 chr10 117137825 117137825 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369206 p.L78M KCNK18 chr10 117210144 117210144 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000334549 p.P334T SLC18A2 chr10 117244152 117244152 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000298472 p.T101T EMX2 chr10 117545672 117545672 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000553456 p.A149A PRLHR chr10 118594150 118594150 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000239032 p.T365T PRLHR chr10 118595064 118595064 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000239032 p.G61W NANOS1 chr10 119032625 119032625 3'UTR G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000425699 SFXN4 chr10 119162362 119162362 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000355697 p.S77N SEC23IP chr10 119926092 119926092 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369075 p.E726D TACC2 chr10 122248713 122248713 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000334433 p.A2821A DMBT1 chr10 122643285 122643285 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000338354 p.G2377R HMX2 chr10 123148424 123148424 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000339992 p.G16C HMX2 chr10 123148425 123148425 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000339992 p.G16V HMX2 chr10 123149766 123149766 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000339992 p.V155V CPXM2 chr10 123880237 123880237 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000241305 p.R126L CPXM2 chr10 123880238 123880238 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000241305 p.R126G ADAM12 chr10 126118127 126118127 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368679 p.V175F C10orf90 chr10 126459074 126459074 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000284694 p.S621R MGMT chr10 129766854 129766854 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000306010 p.G192R EBF3 chr10 129840308 129840308 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000355311 p.V566L JAKMIP3 chr10 132117562 132117562 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000298622 p.E207D CFAP46 chr10 132834703 132834703 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368586 p.E2273K CFAP46 chr10 132850398 132850398 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368586 p.G1933E CFAP46 chr10 132851161 132851161 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368586 p.A1907S VENTX chr10 133240351 133240351 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000325980 TUBGCP2 chr10 133292658 133292658 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000252936 p.G352V ECHS1 chr10 133366036 133366036 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000368547 p.E227* RP11-108K14.8 chr10 133396195 133396195 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000468317 p.Q75H SYCE1 chr10 133555300 133555300 Intron T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000343131 ANO9 chr11 418479 418479 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000332826 p.M747I PHRF1 chr11 607214 607214 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264555 p.Q586H MUC6 chr11 1025844 1025844 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000421673 p.S920S MUC5B chr11 1248337 1248337 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000529681 p.M3819I BRSK2 chr11 1443545 1443545 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000528841 p.R230R C11orf40 chr11 4571438 4571438 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000307616 p.L213F OR51E1 chr11 4655136 4655136 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000396952 OR51A4 chr11 4946948 4946948 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000380373 p.I51I OR51A2 chr11 4955561 4955561 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000380371 p.I51I HBG1 chr11 5249586 5249586 Missense_Mutation G T T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000330597 p.L33M OR52E8 chr11 5857428 5857428 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000537935 p.W92S FAM160A2 chr11 6224017 6224017 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000449352 p.E124* APBB1 chr11 6402481 6402481 Intron C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000609360 APBB1 chr11 6402482 6402482 Intron C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000609360 DCHS1 chr11 6640440 6640440 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000299441 p.D392Y OR2D3 chr11 6921727 6921727 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000317834 p.I242I OR5P2 chr11 7796093 7796093 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000329434 p.L284M NLRP10 chr11 7960291 7960292 Frame_Shift_Ins - - T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000328600 p.P441Tfs*9 ADM chr11 10306613 10306613 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000278175 p.P177Q SPON1 chr11 14041633 14041633 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000576479 p.G153E INSC chr11 15176042 15176042 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000379554 p.E167* SOX6 chr11 16234672 16234672 Splice_Site C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000528429 p.X149_splice USH1C chr11 17531165 17531165 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000318024 p.V126F OTOG chr11 17612673 17612673 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000399391 p.V2128L NELL1 chr11 21574981 21574981 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357134 p.V798F SLC17A6 chr11 22341574 22341574 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000263160 p.E45Q SLC17A6 chr11 22377460 22377460 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000263160 p.G490V KCNA4 chr11 30012607 30012607 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000328224 p.Q24H DCDC1 chr11 30894329 30894329 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000406071 p.V711V WT1 chr11 32392694 32392694 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000332351 p.Q437H CCDC73 chr11 32614402 32614402 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000335185 p.P639H QSER1 chr11 32935178 32935178 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000399302 p.R1178L KIAA1549L chr11 33542916 33542916 Silent A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000321505 p.S154S PAMR1 chr11 35432393 35432393 Missense_Mutation A A C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000619888 p.L709R PAMR1 chr11 35436074 35436074 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000619888 p.P388T RAG1 chr11 36575066 36575066 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000299440 p.D588Y LRRC4C chr11 40116217 40116217 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000278198 p.L26M LRP4 chr11 46859165 46859165 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000378623 p.D1846Y OR4S1 chr11 48306538 48306538 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000319988 p.G106R FOLH1 chr11 49173462 49173462 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000256999 p.L374L RP11-574M7.2 chr11 50420239 50420239 RNA A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000532521 OR4C46 chr11 54603453 54603453 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000328188 p.L182F OR4C11 chr11 55604225 55604225 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000302231 p.S50N OR4C6 chr11 55665353 55665353 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000314259 p.F63I OR4C6 chr11 55665546 55665546 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000314259 p.P127H OR4C6 chr11 55665547 55665547 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000314259 p.P127P OR5D16 chr11 55838834 55838834 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000378396 p.P28L OR5W2 chr11 55913736 55913736 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000344514 p.P283A OR8H1 chr11 56291024 56291024 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000313022 p.I13I OR8U1 chr11 56375672 56375672 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000302270 p.L17I OR5R1 chr11 56417771 56417771 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000312253 p.L154L OR1S2 chr11 58203205 58203205 Nonstop_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000302592 p.*326Sext*? OR5B3 chr11 58402981 58402981 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000309403 p.A143A OR5B2 chr11 58423047 58423047 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000302581 p.S72Y OR5B12 chr11 58439660 58439660 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000302572 p.L164L OR5AN1 chr11 59365158 59365158 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000313940 p.G234C MS4A12 chr11 60507194 60507194 3'UTR T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000016913 CCDC86 chr11 60849963 60849963 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000227520 p.E304D RPLP0P2 chr11 61637004 61637004 RNA G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000496593 MYRF chr11 61766205 61766205 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000278836 p.A128S SLC22A24 chr11 63119019 63119019 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000326192 p.Y241* FLRT1 chr11 64118079 64118079 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000246841 p.G604G NRXN2 chr11 64607749 64607749 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265459 p.P1529L NRXN2 chr11 64635445 64635445 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000265459 p.T1137T ZFPL1 chr11 65088045 65088045 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000294258 p.R288R FAM89B chr11 65573516 65573516 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000530349 p.G149C TMEM151A chr11 66294656 66294656 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000327259 p.A137E ACTN3 chr11 66559323 66559323 Missense_Mutation A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000513398 p.E455G CCS chr11 66599222 66599222 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000533244 p.A73A SPTBN2 chr11 66699450 66699450 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000309996 p.I1244M C11orf86 chr11 66976434 66976434 3'UTR C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000308963 RHOD chr11 67071490 67071490 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000308831 p.R174Q GPR152 chr11 67452205 67452205 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000312457 p.V174I CABP4 chr11 67455385 67455385 5'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000325656 FGF3 chr11 69810661 69810661 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000334134 p.H122N SHANK2 chr11 70485687 70485687 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000423696 p.G1157W KRTAP5-9 chr11 71548689 71548689 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000528743 p.G11V UCP2 chr11 73976864 73976864 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000310473 p.K164M CHRDL2 chr11 74718878 74718878 Intron C T T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000376332 ARRB1 chr11 75267689 75267689 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000420843 p.T370S UVRAG chr11 75851959 75851959 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000356136 p.Y65F TMEM135 chr11 87302443 87302443 Splice_Site G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000305494 p.X233_splice CTSC chr11 88312531 88312531 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000227266 p.V114V GRM5 chr11 88508868 88508868 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000305447 p.I1121I NOX4 chr11 89490467 89490467 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000263317 p.Q48H RP11-313I2.11 chr11 89753949 89753949 3'Flank G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000527332 FAT3 chr11 92801225 92801225 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000525166 p.V2588I FAT3 chr11 92883288 92883289 Frame_Shift_Ins - - G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000525166 p.V4130Rfs*33 IZUMO1R chr11 94306518 94306518 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000440961 p.I48I CNTN5 chr11 100071755 100071755 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000524871 p.Q450H PDGFD chr11 103947715 103947715 Nonsense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000393158 p.Q174* PDGFD chr11 103947716 103947716 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000393158 p.F173L ATM chr11 108365417 108365417 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000278616 p.S3027I ARHGAP20 chr11 110611321 110611321 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000260283 p.M232I TIMM8B chr11 112085448 112085448 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000504148 p.M33I BCO2 chr11 112216287 112216287 Missense_Mutation A A C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357685 p.E528A ATF4P4 chr11 113789428 113789428 RNA C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000393544 FXYD6 chr11 117820859 117820859 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000614497 p.R137K SCN2B chr11 118168136 118168136 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000278947 p.P133A TECTA chr11 121128111 121128111 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264037 p.V712L SC5D chr11 121304293 121304293 Intron A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264027 GRAMD1B chr11 123526007 123526007 5'UTR C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000529750 OR10S1 chr11 123977285 123977285 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000531945 p.R136L VWA5A chr11 124145273 124145273 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000392748 p.V731L OR8A1 chr11 124570343 124570343 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000284287 p.S92F SLC37A2 chr11 125063311 125063311 5'UTR C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000403796 NTM chr11 132335099 132335099 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000374786 p.V330F CACNA2D4 chr12 1885016 1885016 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000382722 p.L377M FGF6 chr12 4445385 4445385 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000228837 p.R62R GALNT8 chr12 4720792 4720792 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000252318 p.G39C KCNA6 chr12 4811199 4811199 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000280684 p.G386G KCNA1 chr12 4918253 4918253 3'Flank G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000382545 KCNA5 chr12 5044643 5044643 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000252321 p.D166Y NTF3 chr12 5495108 5495108 3'UTR A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000331010 ANO2 chr12 5921070 5921070 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000356134 p.E164D VWF chr12 5969221 5969221 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000261405 p.S2573R VWF chr12 6016196 6016196 Nonsense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000261405 p.S1783* LAG3 chr12 6774657 6774657 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000203629 p.S192C CD163L1 chr12 7375762 7375762 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000313599 p.P875L C3AR1 chr12 8059786 8059786 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000307637 p.R134G MFAP5 chr12 8660879 8660879 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000359478 p.V26V PZP chr12 9182102 9182102 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000261336 p.A521D PZP chr12 9200415 9200415 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000261336 p.P235Q GABARAPL1 chr12 10221893 10221893 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000266458 STYK1 chr12 10629612 10629612 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000075503 p.G172W ATF7IP chr12 14425161 14425161 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000261168 p.E416* PDE3A chr12 20370239 20370239 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000359062 p.E319* SLCO1C1 chr12 20733097 20733097 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000266509 p.Y459N SOX5 chr12 23740881 23740881 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000451604 p.Q243K LINC00477 chr12 24584123 24584123 RNA C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000483544 MANSC4 chr12 27762739 27762739 Nonstop_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000381273 p.*341Lext*? CCDC91 chr12 28257092 28257092 5'Flank A T T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000381259 CCDC91 chr12 28452654 28452654 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000381259 p.Q367H CCDC91 chr12 28549298 28549298 3'UTR G T T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000381259 OVCH1 chr12 29445342 29445342 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000318184 p.R939S OVCH1 chr12 29454917 29454917 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000318184 p.Q818H OVCH1 chr12 29475159 29475159 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000318184 p.S501* TMTC1 chr12 29755825 29755825 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000539277 p.L205F KIAA1551 chr12 31981600 31981600 Silent A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000312561 p.P215P KIAA1551 chr12 31983973 31983973 Silent A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000312561 p.T1006T KIF21A chr12 39301554 39301554 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361418 p.V1619V CNTN1 chr12 41070032 41070032 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000347616 p.F1018L ADAMTS20 chr12 43427418 43427418 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000389420 p.D1333Y PUS7L chr12 43748569 43748569 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000344862 p.A317A TWF1 chr12 43796991 43796991 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000395510 p.M289I DBX2 chr12 45050629 45050629 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000332700 p.G100A ANO6 chr12 45348259 45348259 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000320560 p.D193H DHH chr12 49091227 49091227 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000266991 p.R156S NCKAP5L chr12 49801898 49801898 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000335999 p.S101C FAM186A chr12 50352754 50352754 Missense_Mutation C G G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000327337 p.G1360R SLC4A8 chr12 51461352 51461352 Intron T T G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000453097 KRT6C chr12 52469723 52469723 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000252250 p.A457A KRT74 chr12 52573431 52573431 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000305620 p.T116I KRT73 chr12 52618482 52618482 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000305748 p.G15W IGFBP6 chr12 53101098 53101098 Nonsense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000301464 p.R180* ERBB3 chr12 56093404 56093404 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000267101 p.S445F GNS chr12 64728997 64728997 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000258145 p.N387Y GRIP1 chr12 66444587 66444587 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000359742 p.A562P LGR5 chr12 71578883 71578883 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000266674 p.H454D LGR5 chr12 71584638 71584638 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000266674 p.I876M TRHDE chr12 72286714 72286714 Missense_Mutation T T G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000261180 p.H271Q SLC6A15 chr12 84861986 84861986 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000266682 p.S613R RP11-1016B18.1 chr12 97732633 97732633 RNA G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000550548 TMPO chr12 98546388 98546388 Silent A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000556029 p.V340V SLC5A8 chr12 101209775 101209775 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000536262 p.S25* MYBPC1 chr12 101661258 101661258 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000550270 p.I651I MYBPC1 chr12 101661259 101661259 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000550270 p.L652I ALDH1L2 chr12 105030354 105030354 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000258494 p.P829H APPL2 chr12 105236051 105236051 5'UTR C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000258530 BTBD11 chr12 107610194 107610194 Missense_Mutation G T T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000280758 p.D550Y TRPV4 chr12 109793953 109793953 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000261740 p.G521W ACAD10 chr12 111692779 111692779 Missense_Mutation A A C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000313698 p.T24P HECTD4 chr12 112264176 112264176 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000550722 p.Q742E RPH3A chr12 112866837 112866837 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000389385 p.R147R TBX5 chr12 114355709 114355709 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000310346 p.S460S TBX3 chr12 114674352 114674352 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000257566 p.G528A MED13L chr12 116006359 116006360 Frame_Shift_Ins - - C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000281928 p.P764Rfs*4 RNFT2 chr12 116836224 116836224 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000257575 p.G381V NOS1 chr12 117330471 117330471 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000317775 p.G200V SUDS3 chr12 118403429 118403429 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000543473 p.E239* SRRM4 chr12 119156528 119156528 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000267260 p.P522P CCDC60 chr12 119488789 119488789 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000327554 p.L160L WDR66 chr12 121975649 121975649 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000288912 p.V990V DNAH10 chr12 123850919 123850919 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000409039 p.R1927L TMEM132B chr12 125650765 125650765 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000299308 p.R571S POLE chr12 132675455 132675455 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000320574 p.Q390R PHF2P2 chr13 19048102 19048102 Splice_Region C A A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000444553 ANKRD20A19P chr13 23941466 23941466 RNA G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000442969 RNF17 chr13 24789356 24789356 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000255324 p.R264R SHISA2 chr13 26046419 26046419 3'UTR C A A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000319420 CDK8 chr13 26349135 26349135 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000381527 p.D90Y MTUS2 chr13 29025064 29025064 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000612955 p.Q132H MTUS2 chr13 29025292 29025292 Silent A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000612955 p.L208L MTUS2 chr13 29026486 29026486 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000612955 p.G606G MTUS2 chr13 29480339 29480339 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000612955 p.S1135T DCLK1 chr13 36125829 36125829 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000360631 p.Q103H SERTM1 chr13 36696075 36696075 3'UTR T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000315190 EXOSC8 chr13 37008138 37008138 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000389704 p.R190I FREM2 chr13 38690481 38690481 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000280481 p.G1046V NAA16 chr13 41358424 41358424 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000379406 p.S403I ENOX1 chr13 43322383 43322383 Splice_Site C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000261488 p.X421_splice TSC22D1 chr13 44573631 44573631 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000458659 p.S815L KIAA0226L chr13 46377930 46377930 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000389908 LRCH1 chr13 46723309 46723309 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000389798 p.E581D HTR2A chr13 46895728 46895728 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000378688 p.C60F ITM2B chr13 48256338 48256338 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000378565 p.E136D CYSLTR2 chr13 48707918 48707918 3'UTR C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000282018 ARL11 chr13 49630934 49630934 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000282026 p.P163A TPTE2P3 chr13 52531672 52531672 RNA G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000441562 PCDH8 chr13 52846606 52846606 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377942 p.H611N PCDH8 chr13 52848139 52848139 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377942 p.P100T OLFM4 chr13 53050308 53050308 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000219022 p.T357K PCDH17 chr13 57634335 57634335 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377918 p.V597L PCDH17 chr13 57634626 57634626 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377918 p.R694G PCDH17 chr13 57666722 57666722 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377918 p.D896Y PCDH9 chr13 66631351 66631351 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377865 p.G1067C KLHL1 chr13 69707661 69707661 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377844 p.M717I KLHL1 chr13 69707662 69707662 Missense_Mutation A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377844 p.M717T KLHL1 chr13 70107215 70107215 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377844 p.G162Dfs*13 KLHL1 chr13 70107217 70107217 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377844 p.E161D DACH1 chr13 71440633 71440633 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000613252 DACH1 chr13 71489058 71489058 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000613252 p.P554L DACH1 chr13 71489059 71489059 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000613252 p.P554T TBC1D4 chr13 75341142 75341142 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377636 p.I532V EDNRB chr13 77918548 77918548 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000334286 p.G9A POU4F1 chr13 78602381 78602381 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377208 p.L98L POU4F1 chr13 78603368 78603368 5'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377208 RNF219 chr13 78616977 78616977 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000282003 p.E262* SLITRK1 chr13 83881334 83881334 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377084 p.S58S SLITRK6 chr13 85794863 85794863 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000400286 p.P549H GPC5 chr13 91399066 91399066 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377067 p.P7H GPC5 chr13 91693556 91693556 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377067 p.G232V DCT chr13 94468838 94468838 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377028 p.G168V HS6ST3 chr13 96091297 96091297 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000376705 p.R145R GPR183 chr13 99295841 99295841 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000376414 p.A102G NALCN chr13 101083759 101083759 Missense_Mutation T T G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000251127 p.K1179Q NALCN chr13 101103225 101103225 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000251127 p.Q1002K NALCN chr13 101104899 101104899 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000251127 p.Q877H NALCN chr13 101376995 101376995 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000251127 p.R146L CCDC168 chr13 102736006 102736006 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000322527 p.P4897P CCDC168 chr13 102736320 102736320 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000322527 p.H4793N CCDC168 chr13 102738782 102738782 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000322527 p.P3972H CCDC168 chr13 102745984 102745984 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000322527 p.G1571G SLC10A2 chr13 103049422 103049422 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000245312 p.T262T COL4A1 chr13 110198606 110198606 Silent A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000375820 p.G382G ATP11A chr13 112854420 112854420 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000375645 p.L711L PCID2 chr13 113185515 113185515 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000337344 p.L171L GRK1 chr13 113668031 113668031 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000335678 p.L215L OR11H12 chr14 18601632 18601632 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000550708 p.L172L OR4N2 chr14 19827859 19827859 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000315947 p.N137K TEP1 chr14 20377484 20377484 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262715 p.G1962W MYH6 chr14 23407043 23407043 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000356287 p.A61P CPNE6 chr14 24072936 24072936 5'UTR C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000397016 RNF31 chr14 24148352 24148352 Missense_Mutation A A C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000324103 p.Q145P DTD2 chr14 31457312 31457312 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000310850 p.D28N EGLN3 chr14 33950365 33950365 Intron C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000250457 EAPP chr14 34536103 34536103 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000250454 p.L83L FAM177A1 chr14 35078998 35078998 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000382406 p.D137H LRFN5 chr14 41887280 41887280 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000298119 p.A219P LRFN5 chr14 41887627 41887627 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000298119 p.S334S FSCB chr14 44505392 44505392 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000340446 p.E532D MIS18BP1 chr14 45224387 45224387 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000310806 p.E734K MIS18BP1 chr14 45242242 45242242 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000310806 p.G312A MDGA2 chr14 46873444 46873444 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000399232 p.G845A ABHD12B chr14 50888827 50888827 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000337334 p.C235Y NID2 chr14 52019144 52019144 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000216286 p.W982L NID2 chr14 52020098 52020098 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000216286 p.Q919K ARID4A chr14 58365262 58365262 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000355431 p.C1058S DHRS7 chr14 60165346 60165346 5'UTR G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000216500 C14orf39 chr14 60466919 60466919 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000321731 p.A298E GPHB5 chr14 63312965 63312965 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000314140 p.A119G SYNE2 chr14 64225040 64225040 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000344113 p.E6815D AKAP5 chr14 64468508 64468508 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000320636 p.K38N AL391261.1 chr14 66013148 66013148 5'Flank C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000458915 VTI1B chr14 67653483 67653483 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000554659 p.E186* SLC8A3 chr14 70048912 70048912 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000381269 p.G754G SLC8A3 chr14 70167306 70167306 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000381269 p.A373S ADAM21 chr14 70459403 70459403 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000603540 p.L635H ADAM20 chr14 70523427 70523427 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000256389 p.G494V SIPA1L1 chr14 71661426 71661426 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000555818 p.I738I PAPLN chr14 73244659 73244659 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000554301 p.R24R NUMB chr14 73284106 73284106 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000355058 p.K308K LTBP2 chr14 74552257 74552257 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000261978 p.S443S TTLL5 chr14 75683626 75683626 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000298832 p.S114F LRRC74A chr14 76826692 76826692 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000393774 NRXN3 chr14 78709240 78709240 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000554719 p.I42I SERPINA4 chr14 94563811 94563811 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000298841 p.T110N SERPINA4 chr14 94563812 94563812 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000298841 p.T110T SERPINA5 chr14 94587902 94587902 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000329597 p.T180T SYNE3 chr14 95450087 95450087 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000334258 p.A431A ATG2B chr14 96347240 96347240 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000359933 p.Q88H PAPOLA chr14 96562881 96562881 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000216277 p.L710L RTL1 chr14 100884781 100884781 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000534062 p.E3G DIO3 chr14 101561422 101561422 5'UTR C A A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000510508 DIO3 chr14 101561925 101561925 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000510508 p.P143P DIO3 chr14 101562557 101562557 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000510508 DIO3 chr14 101562655 101562655 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000510508 MARK3 chr14 103465581 103465581 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000429436 p.D189N TDRD9 chr14 104004263 104004263 Silent G T T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000409874 p.G503G ASPG chr14 104095611 104095611 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000551177 p.F128F KIF26A chr14 104175408 104175408 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000423312 p.G874R KIF26A chr14 104175539 104175539 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000423312 p.A917A AHNAK2 chr14 104952654 104952654 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000333244 p.G933C IGHG1 chr14 106211359 106211359 Intron A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000618756 IGHV4-28 chr14 106324656 106324656 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000390612 p.V11V IGHV1-46 chr14 106511399 106511399 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000390622 p.L23L IGHV2-70 chr14 106775335 106775335 5'Flank C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000617374 POTEB3 chr15 21427713 21427713 Silent T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000611217 p.L366L POTEB3 chr15 21439688 21439688 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000611217 p.C108* TUBGCP5 chr15 23017990 23017990 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000615383 p.T513T MAGEL2 chr15 23644695 23644695 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000532292 p.P1016P NPAP1 chr15 24679509 24679509 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000329468 NPAP1 chr15 24679770 24679770 3'UTR C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000329468 GABRB3 chr15 26621465 26621465 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000311550 p.L104V GABRA5 chr15 26937321 26937321 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000335625 p.T239T GABRA5 chr15 26948246 26948246 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000335625 GABRG3 chr15 27326978 27326978 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000615808 p.P147H HERC2P9 chr15 28641551 28641551 RNA G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000529624 APBA2 chr15 29054002 29054002 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000558259 p.G40C APBA2 chr15 29108308 29108308 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000558259 p.V652V TRPM1 chr15 31002866 31002866 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000397795 p.T1256T OTUD7A chr15 31484536 31484536 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000307050 p.V513V FMN1 chr15 33008015 33008015 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000559047 p.Q741L RYR3 chr15 33652793 33652793 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000389232 p.N1406K RYR3 chr15 33819786 33819786 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000389232 p.S3579S CHRM5 chr15 34063001 34063001 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000383263 p.R95L GPR176 chr15 39801825 39801825 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000561100 p.L285L INO80 chr15 40980240 40980240 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361937 p.P1552S MAPKBP1 chr15 41823999 41823999 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000456763 p.P1390L SPTBN5 chr15 41866096 41866096 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000320955 p.R2255L EHD4 chr15 41953867 41953867 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000220325 p.M104L EHD4 chr15 41953868 41953868 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000220325 p.V103V PLA2G4D chr15 42072335 42072335 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000290472 p.L459L TMEM87A chr15 42211750 42211750 Splice_Site C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000389834 p.X543_splice TTBK2 chr15 42827978 42827978 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000267890 p.D163Y DUOX2 chr15 45113037 45113037 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000603300 p.R37L DUOXA2 chr15 45114584 45114584 5'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000323030 DUOXA1 chr15 45117535 45117535 3'Flank G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000560572 SLC24A5 chr15 48139151 48139151 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000341459 p.L352M FBN1 chr15 48510164 48510164 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000316623 p.D532Y SHC4 chr15 48843428 48843428 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000332408 p.G488G DTWD1 chr15 49634625 49634625 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000251250 p.N168Mfs*22 ATP8B4 chr15 49920369 49920369 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000284509 p.Y600Y TRPM7 chr15 50604938 50604938 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000313478 p.W972C TRPM7 chr15 50648886 50648886 Splice_Site C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000313478 p.X41_splice UNC13C chr15 54013241 54013241 Missense_Mutation A A C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000260323 p.N113T VPS13C chr15 61907241 61907241 Intron C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000261517 C2CD4A chr15 62067694 62067694 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000355522 p.R27R TLN2 chr15 62739545 62739545 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000306829 p.Q1295H CILP chr15 65196628 65196628 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000261883 VWA9 chr15 65591678 65591678 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000313182 p.N347I NOX5 chr15 69055374 69055374 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000388866 p.L680L THSD4 chr15 71141472 71141472 5'UTR C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000355327 PKM chr15 72209764 72209764 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000335181 p.W158C CYP11A1 chr15 74337867 74337867 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000268053 ULK3 chr15 74840610 74840610 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000440863 p.W167C ULK3 chr15 74840611 74840611 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000440863 p.W167L TBC1D2B chr15 77998261 77998261 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000300584 p.E931K CTSH chr15 78944950 78944950 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000220166 p.G11E ANKRD34C chr15 79293300 79293300 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000421388 p.T6S ANKRD34C chr15 79297405 79297405 3'UTR C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000421388 KIAA1024 chr15 79456814 79456814 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000305428 p.E223Q KIAA1024 chr15 79468483 79468483 3'UTR A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000305428 ST20-MTHFS chr15 79924122 79924122 5'Flank G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000479961 ARNT2 chr15 80475031 80475031 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000303329 p.E144Q ARNT2 chr15 80508235 80508235 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000303329 p.R234R ARNT2 chr15 80576951 80576951 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000303329 p.S533S CEMIP chr15 80925724 80925724 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000220244 p.R797S CEMIP chr15 80931955 80931955 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000220244 p.T903T SAXO2 chr15 82262981 82262981 Intron A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000339465 SAXO2 chr15 82282232 82282232 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000339465 p.P123S AKAP13 chr15 85581612 85581612 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000394518 p.E1182K KLHL25 chr15 85769647 85769647 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000337975 p.R55L AGBL1 chr15 86154543 86154543 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000441037 p.R80S AGBL1 chr15 86247685 86247685 Nonsense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000441037 p.R135* AGBL1 chr15 86256980 86256980 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000441037 p.G242V NTRK3 chr15 87880411 87880411 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000360948 p.M731I ACAN chr15 88843611 88843611 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000439576 p.P338P FANCI chr15 89281841 89281841 Splice_Region T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000310775 UNC45A chr15 90942659 90942659 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000418476 NR2F2 chr15 96333269 96333269 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000394166 ADAMTS17 chr15 99976256 99976256 Intron A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000268070 CERS3 chr15 100455989 100455989 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000284382 p.Y301* LRRK1 chr15 101024919 101024919 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000388948 p.L728L PCSK6 chr15 101382181 101382181 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000611716 p.V481V WASIR2 chr16 24406 24406 RNA G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000527434 PDIA2 chr16 285179 285179 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000219406 p.L258L CAPN15 chr16 552138 552138 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000219611 p.A811A C16orf13 chr16 634529 634529 3'UTR G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000301686 CHTF18 chr16 791110 791110 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262315 TELO2 chr16 1501664 1501664 Missense_Mutation A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262319 p.T455A CRAMP1L chr16 1656046 1656047 Frame_Shift_Ins - - C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000293925 p.R431Pfs*39 CRAMP1L chr16 1656049 1656049 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000293925 p.R431L SLC9A3R2 chr16 2029599 2029599 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000424542 p.K77N E4F1 chr16 2234351 2234351 Missense_Mutation A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000301727 p.Y519C SRRM2 chr16 2766142 2766142 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000301740 p.T1872S SRRM2 chr16 2767253 2767253 Frame_Shift_Del T T - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000301740 p.L2242Qfs*13 SRRM2 chr16 2767255 2767255 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000301740 p.A2243T MEFV chr16 3246527 3246527 Splice_Region G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000219596 p.H536H ADCY9 chr16 4114588 4114588 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000294016 p.G285G TEKT5 chr16 10676024 10676024 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000283025 p.A341S TEKT5 chr16 10676025 10676025 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000283025 p.L340L CIITA chr16 10906833 10906833 Missense_Mutation T T G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000324288 p.F447L RRN3 chr16 15094248 15094248 5'UTR G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000198767 KIAA0430 chr16 15639090 15639090 Splice_Region C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000396368 p.T48T AC138969.4 chr16 16331727 16331727 5'Flank C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000381497 XYLT1 chr16 17134583 17134583 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000261381 p.D639E C16orf62 chr16 19616718 19616718 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000417362 p.V378V GP2 chr16 20315982 20315982 Missense_Mutation A A C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000381362 p.L495R GP2 chr16 20320264 20320264 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000381362 p.E289* ACSM2A chr16 20465613 20465613 Nonsense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000219054 p.Q92* ACSM2B chr16 20537234 20537234 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000329697 RRN3P1 chr16 21800783 21800783 RNA T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000514813 HS3ST2 chr16 22814663 22814663 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000261374 p.R18H HS3ST2 chr16 22915303 22915303 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000261374 p.A282D ERN2 chr16 23704969 23704969 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000256797 p.L304L RBBP6 chr16 24571509 24571509 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000319715 p.E1481D TNRC6A chr16 24815308 24815308 Splice_Region A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000395799 SLC5A11 chr16 24898093 24898093 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000347898 p.S330R C16orf82 chr16 27067263 27067263 RNA G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000505035 C16orf82 chr16 27068375 27068375 RNA C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000505035 C16orf82 chr16 27068880 27068880 RNA C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000505035 KIAA0556 chr16 27698367 27698367 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000261588 p.R327L NFATC2IP chr16 28959046 28959046 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000320805 p.Q349H SPNS1 chr16 28984805 28984805 3'Flank A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000311008 RRN3P2 chr16 29075078 29075078 RNA G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000564580 C16orf92 chr16 30023844 30023844 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000300575 p.A83D FBXL19 chr16 30946929 30946929 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000380310 p.L629L ZNF843 chr16 31436980 31436980 5'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000315678 ARMC5 chr16 31465982 31465982 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000268314 p.R666L RP11-812E19.9 chr16 33844921 33844921 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000569103 p.S71I SHCBP1 chr16 46603606 46603606 Silent A A C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000303383 p.V382V ABCC12 chr16 48100915 48100915 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000311303 p.G999C ABCC12 chr16 48139211 48139211 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000311303 p.P261P ABCC11 chr16 48200379 48200379 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000356608 p.P660L NOD2 chr16 50710646 50710646 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000300589 p.T245T SALL1 chr16 51139202 51139202 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000251020 p.G1007A SALL1 chr16 51141809 51141809 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000251020 p.G138A IRX6 chr16 55326518 55326518 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000290552 p.A76A IRX6 chr16 55329024 55329024 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000290552 p.P349Q CES5A chr16 55846596 55846596 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000290567 p.G528V MT1M chr16 56636930 56636930 3'Flank G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000379818 NUP93 chr16 56748388 56748388 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000308159 p.T47T SLC12A3 chr16 56902448 56902448 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000563236 p.E932E DRC7 chr16 57698988 57698988 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000360716 p.P114P DRC7 chr16 57702004 57702004 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000360716 p.T191T SLC38A7 chr16 58680027 58680027 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000219320 p.A34S GOT2 chr16 58734209 58734209 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000245206 p.G7V CDH8 chr16 61817494 61817494 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000577390 p.T421S FAM65A chr16 67545675 67545675 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000379312 p.R1072W FAM65A chr16 67545676 67545676 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000379312 p.R1072L DPEP3 chr16 67978602 67978602 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000268793 p.Q172K DPEP3 chr16 67978603 67978603 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000268793 p.C171* DUS2 chr16 68023691 68023691 Intron A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000358896 FUK chr16 70465093 70465093 Intron G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000288078 FUK chr16 70478614 70478614 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000288078 p.R965W ATXN1L chr16 71854613 71854613 3'UTR C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000427980 PKD1L3 chr16 71954275 71954275 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000620267 p.E880V PKD1L3 chr16 71998348 71998348 Nonsense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000620267 p.Y114* DHX38 chr16 72111070 72111070 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000268482 p.S1198C ZFHX3 chr16 72959373 72959373 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000268489 p.K258I ADAT1 chr16 75600136 75600136 3'UTR C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000307921 ADAT1 chr16 75603142 75603142 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000307921 p.R440I CNTNAP4 chr16 76452604 76452604 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000611870 p.E390* CNTNAP4 chr16 76521220 76521220 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000611870 p.D816H VAT1L chr16 77879217 77879217 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000302536 p.A292E WWOX chr16 78100148 78100148 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000566780 C16orf74 chr16 85710204 85710204 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000284245 p.T44T ZCCHC14 chr16 87412122 87412122 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000268616 p.S730C ZNF469 chr16 88428177 88428177 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000437464 p.P236R ZNF469 chr16 88428641 88428641 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000437464 p.L391M ZNF469 chr16 88436010 88436010 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000437464 p.K2819M MVD chr16 88652462 88652462 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000301012 OR1A2 chr17 3197935 3197935 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000381951 p.R139R TRPV1 chr17 3566955 3566955 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000399756 p.V794F TRPV1 chr17 3591170 3591170 Intron C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000399756 GSG2 chr17 3725408 3725408 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000325418 p.G491G ITGAE chr17 3751858 3751858 Missense_Mutation A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000263087 p.L562S P2RX1 chr17 3915930 3915930 Intron T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000225538 ZZEF1 chr17 4052022 4052022 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000381638 p.D1850V ZZEF1 chr17 4056346 4056346 Splice_Site C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000381638 p.X1722_splice ZZEF1 chr17 4070688 4070688 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000381638 p.K1357N SPNS3 chr17 4448245 4448245 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000355530 p.G238W MYBBP1A chr17 4550110 4550110 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000254718 p.V423Lfs*26 MYBBP1A chr17 4550111 4550111 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000254718 p.L422F KIF1C chr17 5023526 5023526 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000320785 p.S896* NLRP1 chr17 5532955 5532955 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000572272 p.E1055* TP53 chr17 7675095 7675095 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000269305 p.V173L TP53 chr17 7675216 7675216 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000269305 p.K132N PER1 chr17 8150046 8150046 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000317276 p.E152Q AURKB chr17 8207206 8207206 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000585124 p.R123H PIK3R6 chr17 8838620 8838620 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000614407 p.R45R USP43 chr17 9728284 9728284 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000285199 p.G889V GLP2R chr17 9889618 9889618 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262441 p.P525P MYH13 chr17 10324233 10324233 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000252172 p.R908L MYH8 chr17 10390561 10390561 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000403437 p.Q1903K MYH8 chr17 10400481 10400481 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000403437 p.R1215L MYH8 chr17 10400743 10400743 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000403437 p.E1128* MYH4 chr17 10450512 10450512 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000255381 p.Q1374H MYH4 chr17 10453194 10453194 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000255381 p.T1023T MYH4 chr17 10453794 10453794 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000255381 p.E928G MYH4 chr17 10460087 10460087 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000255381 p.V427V MYH1 chr17 10498685 10498685 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000226207 p.Q1374Q MYH1 chr17 10504972 10504972 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000226207 p.L843L MYH2 chr17 10525528 10525528 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000245503 p.L1487Q MYH3 chr17 10632591 10632591 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000583535 p.R1614L SHISA6 chr17 11557794 11557794 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000409168 p.H331H SHISA6 chr17 11558307 11558307 3'UTR G G - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000409168 DNAH9 chr17 11689631 11689631 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262442 p.S1270Y DNAH9 chr17 11821920 11821920 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262442 p.G2903A DNAH9 chr17 11834721 11834721 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262442 p.V3110V DNAH9 chr17 11869213 11869213 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262442 p.A3338D MYOCD chr17 12752709 12752709 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000343344 p.T474N HS3ST3A1 chr17 13601070 13601070 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000284110 p.S20R COX10 chr17 14069533 14069533 5'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000261643 TBC1D26 chr17 15735348 15735348 Splice_Region G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000469477 PEMT chr17 17512650 17512650 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000395782 p.T72A FLII chr17 18245366 18245366 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000327031 p.L1221L FAM106A chr17 18526582 18526582 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000392176 p.L74L Metazoa_SRP chr17 18603614 18603614 3'Flank C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000578843 AC004702.2 chr17 20321504 20321504 Intron A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000580225 Metazoa_SRP chr17 20335843 20335843 5'Flank A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000618956 KCNJ12 chr17 21415576 21415576 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000331718 p.R79Afs*46 FAM27L chr17 22298798 22298798 RNA G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000426869 FAM27L chr17 22299550 22299550 RNA G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000426869 TBC1D3P5 chr17 27422184 27422184 RNA G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000586223 SLC13A2 chr17 28494000 28494000 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000314669 PIPOX chr17 29056205 29056205 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000323372 p.G358E PIPOX chr17 29056206 29056206 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000323372 p.G358G GIT1 chr17 29574810 29574812 In_Frame_Del GGC GGC - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000225394 p.A726del EFCAB5 chr17 30080828 30080828 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000394835 p.N1091N CPD chr17 30421822 30421822 Silent A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000225719 p.V432V CRLF3 chr17 30793459 30793459 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000324238 p.V273L SPACA3 chr17 32995436 32995436 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000269053 p.P21H ASIC2 chr17 33291848 33291848 Intron C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000359872 UNC45B chr17 35171356 35171356 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000268876 p.T577N UNC45B chr17 35177554 35177554 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000268876 p.Q735H SLC35G3 chr17 35193474 35193474 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000297307 p.H278H SLFN5 chr17 35265220 35265220 Nonsense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000299977 p.Q670* SLFN13 chr17 35441224 35441224 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000285013 p.Q689E TBC1D3B chr17 36169136 36169136 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000611257 p.Q236K CCL4L1 chr17 36212338 36212338 Intron G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000620250 CCL4L1 chr17 36212421 36212421 Intron T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000620250 STARD3 chr17 39662282 39662282 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000336308 p.L391F MED24 chr17 40023169 40023169 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000394128 p.M738V WIPF2 chr17 40273999 40273999 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000323571 p.D394Y KRT20 chr17 40885053 40885053 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000167588 p.R45C KRTAP9-8 chr17 41238150 41238150 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000254072 p.C33W KRT36 chr17 41489631 41489631 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000328119 p.V78V KRT14 chr17 41586381 41586381 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000167586 p.Q152E KRT16 chr17 41610212 41610212 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000301653 p.G435G P3H4 chr17 41807999 41807999 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000355468 p.D308N ACLY chr17 41897786 41897786 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000352035 p.V464V GHDC chr17 42192442 42192442 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000301671 p.G230R ITGA2B chr17 44374660 44374660 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262407 p.Q981L ADAM11 chr17 44770003 44770003 Nonsense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000200557 p.Y112* EFTUD2 chr17 44853334 44853335 Frame_Shift_Ins - - TC TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000426333 p.D841Efs*18 RP11-707O23.5 chr17 45601188 45601188 RNA G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000580257 KANSL1 chr17 46039841 46039841 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000574590 p.Q688H WNT3 chr17 46768760 46768760 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000225512 p.G210W OSBPL7 chr17 47817262 47817262 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000007414 p.T232T IGF2BP1 chr17 49044015 49044015 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000290341 p.V417L ITGA3 chr17 50077417 50077417 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000320031 p.E703D SGCA chr17 50169165 50169165 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262018 p.A220S CACNA1G chr17 50599831 50599831 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000359106 p.G1221E KIF2B chr17 53823392 53823392 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000268919 p.P120R KIF2B chr17 53823485 53823485 Frame_Shift_Del G G - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000268919 p.E152Kfs*39 TOM1L1 chr17 54937161 54937161 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000575882 p.S323I NOG chr17 56594479 56594479 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000332822 p.D86Y LPO chr17 58249157 58249157 Silent T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262290 p.I141I SEPT4 chr17 58521280 58521280 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000317268 p.R363P TEX14 chr17 58599528 58599528 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000240361 p.E612V HEATR6 chr17 60060035 60060035 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000184956 p.S493C TBX4 chr17 61483718 61483718 3'UTR G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000240335 NACA2 chr17 61590785 61590785 Silent A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000521764 p.S132S EFCAB3 chr17 62406668 62406668 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000305286 p.L226H GH2 chr17 63880771 63880771 Splice_Site C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000423893 p.X152_splice ABCA6 chr17 69097928 69097928 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000284425 p.D1038Y ABCA5 chr17 69289202 69289202 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000392676 p.G626V ABCA5 chr17 69289203 69289203 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000392676 p.G626R KCNJ16 chr17 70134459 70134459 3'UTR T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000283936 KCNJ2 chr17 70175652 70175652 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000243457 p.D205Y SDK2 chr17 73338784 73338784 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000392650 p.G2108C GPR142 chr17 74372214 74372214 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000335666 p.A335S CD300LB chr17 74526030 74526030 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000392621 p.G30W CD300E chr17 74617361 74617361 Missense_Mutation A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000392619 p.W49R RAB37 chr17 74729344 74729344 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000340415 p.A54V FADS6 chr17 74879558 74879558 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000612771 p.R269L OTOP2 chr17 74927892 74927892 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000331427 OTOP2 chr17 74930761 74930761 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000331427 p.A376P SLC16A5 chr17 75100179 75100179 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000329783 p.F172F TRIM47 chr17 75875452 75875452 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000254816 p.L408L UBE2O chr17 76396547 76396547 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000319380 p.G797V ENGASE chr17 79083017 79083017 Splice_Region C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000579016 RBFOX3 chr17 79115534 79115534 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000580155 p.E61V RBFOX3 chr17 79115535 79115535 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000580155 p.E61* GAA chr17 80117692 80117692 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000302262 p.P808P BAHCC1 chr17 81461029 81461029 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000584436 p.L2153L HEXDC chr17 82435750 82435750 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000327949 p.T170M TBCD chr17 82752130 82752130 5'UTR C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000355528 COLEC12 chr18 321761 321761 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000400256 p.P704T CLUL1 chr18 627305 627305 Missense_Mutation A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000338387 p.Q211R MYOM1 chr18 3067396 3067396 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000356443 p.G1642C C18orf42 chr18 5145577 5145577 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000434239 p.K65N LAMA1 chr18 6986200 6986200 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000389658 p.E1772D ANKRD12 chr18 9258890 9258890 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262126 p.L1875V CHMP1B chr18 11852167 11852167 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000526991 CIDEA chr18 12277153 12277153 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000320477 p.A181A PTPN2 chr18 12817253 12817253 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000309660 p.G203V POTEC chr18 14533179 14533179 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000358970 p.V313I ANKRD30B chr18 14748440 14748440 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000358984 p.A7A ANKRD30B chr18 14787091 14787091 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000358984 p.W575C ANKRD30B chr18 14851982 14851982 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000358984 p.E1227E GREB1L chr18 21395431 21395431 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000424526 p.M134I TTC39C chr18 24066072 24066072 Missense_Mutation A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000317571 p.T93A SS18 chr18 26035920 26035920 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000415083 p.H295R CDH2 chr18 27985597 27985597 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000269141 p.P636T CDH2 chr18 28013783 28013783 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000269141 p.A100D DSG1 chr18 31326941 31326941 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000257192 p.W51L DSG3 chr18 31469328 31469328 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000257189 p.L626F RNF125 chr18 32068400 32068400 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000217740 WBP11P1 chr18 32512302 32512302 RNA G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000567636 WBP11P1 chr18 32513042 32513042 RNA C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000567636 WBP11P1 chr18 32513198 32513198 RNA G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000567636 KLHL14 chr18 32770444 32770444 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000359358 p.V50M ASXL3 chr18 33743374 33743374 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000269197 p.R1176R ASXL3 chr18 33745225 33745225 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000269197 p.E1793Q DTNA chr18 34851912 34851912 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000399113 p.L479I ZNF271P chr18 35309623 35309623 RNA G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000399070 FHOD3 chr18 36717980 36717980 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000359247 p.R702S KIAA1328 chr18 37066926 37066926 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000280020 p.V205L CELF4 chr18 37273125 37273125 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000420428 p.A280A PIK3C3 chr18 41987847 41987847 Silent A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262039 p.K189K SLC14A2 chr18 45627146 45627146 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000255226 p.R174W SLC14A2 chr18 45639768 45639768 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000255226 p.G289V EPG5 chr18 45878422 45878422 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000282041 p.I1966V LOXHD1 chr18 46524792 46524792 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000300591 p.N441K TCEB3B chr18 47034955 47034955 Nonsense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000332567 p.Q104* ME2 chr18 50932320 50932320 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000321341 p.V459V DCC chr18 52752109 52752109 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000442544 p.A49A DCC chr18 53459237 53459237 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000442544 p.R1133P CDH20 chr18 61554530 61554530 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262717 p.T747T TNFRSF11A chr18 62368856 62368856 Silent A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000586569 p.V313V SERPINB7 chr18 63793210 63793210 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000336429 p.S90Y SERPINB8 chr18 63986356 63986356 Intron T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000353706 SERPINB8 chr18 63987032 63987032 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000353706 p.D293E CDH7 chr18 65809709 65809709 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000323011 p.H72Q CDH7 chr18 65863030 65863030 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000323011 CDH19 chr18 66572140 66572140 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262150 p.A22E DSEL chr18 67511892 67511892 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000310045 p.W916L CCDC102B chr18 68897361 68897361 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000319445 p.R399I NETO1 chr18 72858961 72858961 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000327305 p.P112T ZNF407 chr18 75063295 75063295 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000299687 p.P1858P CTDP1 chr18 79715469 79715469 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000613122 p.R670L STK11 chr19 1220444 1220444 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000326873 p.P179R OAZ1 chr19 2271847 2271847 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000602676 p.Q119H SGTA chr19 2757764 2757764 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000221566 p.S252S NFIC chr19 3449049 3449049 Nonsense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000443272 p.K332* PTPRS chr19 5238990 5238990 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357368 p.R593L KHSRP chr19 6416651 6416651 Splice_Site C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000398148 p.X443_splice VAV1 chr19 6853948 6853948 Frame_Shift_Del G G - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000602142 p.G779Efs*? CLEC4M chr19 7767678 7767678 Intron C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000327325 MUC16 chr19 8949527 8949527 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000397910 p.T9081T MUC16 chr19 8951863 8951863 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000397910 p.G8303C MUC16 chr19 8959658 8959658 Silent A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000397910 p.T5704T OR7D2 chr19 9187315 9187315 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000344248 COL5A3 chr19 9986353 9986353 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264828 p.A772S COL5A3 chr19 9996074 9996074 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264828 p.G509W TYK2 chr19 10365547 10365547 Nonsense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000264818 p.W327* SMARCA4 chr19 11039525 11039525 Intron G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000344626 CACNA1A chr19 13455152 13455152 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000360228 p.E118D SLC1A6 chr19 14972727 14972727 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000221742 p.T62S PGLYRP2 chr19 15475839 15475839 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000340880 p.L277L CYP4F3 chr19 15641492 15641492 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000221307 p.G26E SIN3B chr19 16862411 16862411 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000379803 p.F373Y MYO9B chr19 17192858 17192858 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000594824 p.H975L FAM129C chr19 17532363 17532363 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000335393 p.R127L ZNF90 chr19 20118089 20118089 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000418063 p.G179C ZNF675 chr19 23662178 23662178 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000359788 p.T54T TSHZ3 chr19 31276761 31276761 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000240587 p.T1011S TSHZ3 chr19 31277217 31277217 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000240587 p.T859K TSHZ3 chr19 31278103 31278103 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000240587 p.L564V TSHZ3 chr19 31278104 31278104 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000240587 p.S563S ZNF599 chr19 34769555 34769555 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000329285 p.A7S MAG chr19 35295622 35295622 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000392213 p.G19V TMEM147 chr19 35546864 35546864 Intron G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000222284 HCST chr19 35904185 35904185 3'UTR C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000246551 COX7A1 chr19 36152486 36152486 5'UTR C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000292907 ZFP82 chr19 36393272 36393272 Silent A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000392161 p.H356H ZNF382 chr19 36609928 36609928 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000292928 p.G5V SIPA1L3 chr19 38081984 38081984 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000222345 p.R140Q RYR1 chr19 38463786 38463786 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000359596 p.D908Y MAP4K1 chr19 38612612 38612612 Splice_Region T T G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000591517 p.R222R PAPL chr19 39098991 39098991 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000331256 p.S118R SUPT5H chr19 39469153 39469153 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000432763 p.E406D SERTAD1 chr19 40423206 40423206 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357949 p.S114F PSG3 chr19 42740452 42740452 5'UTR G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000327495 PSG9 chr19 43262110 43262110 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000270077 p.S153R MARK4 chr19 45297896 45297896 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262891 p.G607W GPR4 chr19 45591132 45591132 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000323040 p.L245L DACT3 chr19 46652756 46652756 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000391916 p.C135S MEIS3 chr19 47417236 47417236 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000558555 p.P43A RPL13A chr19 49490817 49490817 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000391857 p.L99V CPT1C chr19 49706379 49706379 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000323446 p.A437T IL4I1 chr19 49901655 49901655 5'Flank G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000391826 KLK7 chr19 50977662 50977662 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000391807 p.R212S SIGLEC8 chr19 51455527 51455527 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000321424 p.E314D SIGLEC8 chr19 51458111 51458111 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000321424 p.Q93E FPR2 chr19 51769046 51769046 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000340023 p.P130A ZNF578 chr19 52451304 52451304 5'Flank C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000421239 MIR517A chr19 53712282 53712282 RNA C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000385001 TTYH1 chr19 54419192 54419192 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000376530 p.V64A KIR3DX1 chr19 54543699 54543699 3'UTR G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000221567 NLRP2 chr19 54970126 54970126 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000448584 p.H37Q NLRP4 chr19 55858109 55858109 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000301295 p.G239A NLRP8 chr19 55954893 55954893 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000291971 p.D279Y NLRP8 chr19 55955340 55955340 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000291971 p.V428F NLRP5 chr19 56027964 56027964 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000390649 p.E577D NLRP5 chr19 56027965 56027965 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000390649 p.E578* NLRP5 chr19 56058329 56058329 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000390649 p.V1130E PEG3 chr19 56813604 56813604 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000326441 PEG3 chr19 56813731 56813731 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000326441 p.Q1571E PEG3 chr19 56823616 56823616 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000326441 p.P153Q DUXA chr19 57160691 57160691 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000554048 p.T44T AURKC chr19 57234959 57234959 Frame_Shift_Del G G - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000302804 p.D221Ifs*34 ZNF17 chr19 57421174 57421174 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000601808 p.R561I ZNF530 chr19 57606118 57606118 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000332854 p.R198T ZNF211 chr19 57640967 57640967 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000347302 p.A161T ZNF551 chr19 57688274 57688274 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000282296 p.E667K A1BG chr19 58352987 58352987 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000263100 p.R94H SIRPB2 chr20 1477330 1477330 Splice_Region A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000359801 SIRPB1 chr20 1619966 1619966 5'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000381605 SIRPG chr20 1630294 1630294 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000303415 p.S365C TGM6 chr20 2417501 2417501 Missense_Mutation A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000202625 p.I536V TMC2 chr20 2561861 2561861 Silent A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000358864 p.S135S SLC4A11 chr20 3237939 3237939 5'Flank A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000380056 ATRN chr20 3644168 3644168 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262919 p.P1355P PROKR2 chr20 5302376 5302376 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000217270 p.T273T CHGB chr20 5923349 5923349 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000378961 p.G402V CHGB chr20 5923668 5923668 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000378961 p.S508S CHGB chr20 5923669 5923669 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000378961 p.H509N HAO1 chr20 7895212 7895212 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000378789 p.R245M PLCB1 chr20 8789519 8789519 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000338037 p.E1094* PLCB4 chr20 9437037 9437037 Silent A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000278655 p.K871K LAMP5 chr20 9529653 9529653 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000246070 p.P226T LAMP5 chr20 9529654 9529654 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000246070 p.P226Q LAMP5 chr20 9529849 9529849 3'UTR T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000246070 PAK7 chr20 9563010 9563010 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000353224 p.R499R ESF1 chr20 13771394 13771394 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000202816 p.S447N RRBP1 chr20 17636667 17636667 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377807 p.V316V DZANK1 chr20 18453756 18453756 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262547 p.W150C SCP2D1 chr20 18810062 18810062 5'Flank T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377428 INSM1 chr20 20370081 20370081 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000310227 INSM1 chr20 20370082 20370082 3'UTR G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000310227 RALGAPA2 chr20 20520952 20520952 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000202677 p.S1350L FOXA2 chr20 22582522 22582522 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377115 p.T234T CD93 chr20 23084981 23084981 Silent A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000246006 p.D404D CST8 chr20 23491711 23491711 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000246012 p.P15L CST8 chr20 23491724 23491724 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000246012 p.V19V CST9 chr20 23603575 23603575 Missense_Mutation A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000376971 p.C139R DEFB119 chr20 31388977 31388977 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000376321 BCL2L1 chr20 31721662 31721662 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000307677 p.G186Afs*30 BPIFB6 chr20 33044026 33044026 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000349552 p.M447I CDK5RAP1 chr20 33379527 33379527 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357886 p.V361V ACSS2 chr20 34920645 34920645 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000360596 p.G360V CEP250 chr20 35502723 35502723 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000397527 p.E1452* RBM12 chr20 35654181 35654181 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000359646 p.Q381L PHF20 chr20 35947526 35947526 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000374012 p.P980S CNBD2 chr20 35980536 35980536 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373973 p.V107V PPP1R16B chr20 38902720 38902720 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000299824 p.M208I MAFB chr20 40687896 40687896 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373313 p.P319A PTPRT chr20 42352183 42352183 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373187 p.G555C MYBL2 chr20 43687032 43687032 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000217026 p.G154R TOX2 chr20 44054428 44054428 Nonsense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000358131 p.Q270* C20orf62 chr20 44461932 44461932 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000372910 p.D156Tfs*? RIMS4 chr20 44756280 44756280 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000372851 p.E222Q ZNF334 chr20 46501783 46501783 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000347606 p.C519F OCSTAMP chr20 46546059 46546059 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000279028 p.L105L SLC2A10 chr20 46725916 46725916 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000359271 p.A294S EYA2 chr20 47072242 47072242 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000327619 p.S158I EYA2 chr20 47143109 47143109 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000327619 p.F313L ZMYND8 chr20 47347872 47347872 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000311275 p.I3M SULF2 chr20 47683109 47683109 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000359930 p.D317Y SULF2 chr20 47757196 47757196 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000359930 p.V56V PREX1 chr20 48645880 48645880 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371941 p.H1161Q PREX1 chr20 48700877 48700877 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371941 p.L265I B4GALT5 chr20 49640515 49640515 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371711 p.R253W SALL4 chr20 51791892 51791892 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000217086 p.S197R PCK1 chr20 57564335 57564335 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000319441 p.P376P GNAS chr20 58853319 58853319 Frame_Shift_Del C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371100 p.P20Lfs*670 ZNF831 chr20 59193862 59193862 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371030 p.A948E ZNF831 chr20 59194014 59194014 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371030 p.G999C ZNF831 chr20 59194163 59194163 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371030 p.P1048P ZNF831 chr20 59253060 59253060 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371030 p.D1370E ZNF831 chr20 59254440 59254440 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371030 p.A1577A PHACTR3 chr20 59774281 59774281 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371015 p.R322L FAM217B chr20 59944017 59944017 Missense_Mutation A A C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000358293 p.Q25P CDH4 chr20 61873895 61873895 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000614565 p.R349R TAF4 chr20 62006658 62006658 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000252996 p.A692V LAMA5 chr20 62338016 62338016 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000252999 p.A631S OGFR chr20 62812909 62812909 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000290291 p.G432C DIDO1 chr20 62881242 62881242 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000266070 p.E1572* DIDO1 chr20 62905526 62905526 Intron G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000266070 YTHDF1 chr20 63202940 63202940 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370339 p.R334G BIRC7 chr20 63238413 63238413 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000217169 p.R156L BIRC7 chr20 63238468 63238468 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000217169 p.L174L ARFGAP1 chr20 63287709 63287709 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370283 p.D353N TPTE chr21 10592373 10592373 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000618007 p.Q390H TPTE chr21 10605570 10605570 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000618007 ANKRD30BP2 chr21 13042516 13042516 5'Flank G T T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000471407 TMPRSS15 chr21 18294636 18294636 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000284885 p.D760Y TMPRSS15 chr21 18294637 18294637 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000284885 p.Q759Q GRIK1 chr21 29939495 29939495 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000399907 p.E2D KRTAP24-1 chr21 30282897 30282897 Silent A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000340345 p.P12P KRTAP13-3 chr21 30425468 30425468 Missense_Mutation G C C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000390690 p.P149A KRTAP15-1 chr21 30440609 30440609 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000334067 p.S94S KRTAP15-1 chr21 30440610 30440610 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000334067 p.L95I KRTAP11-1 chr21 30881221 30881221 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000332378 p.R102R GART chr21 33524647 33524647 Intron C A A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000381815 RIPPLY3 chr21 37013614 37013614 Missense_Mutation G T T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000329553 p.V79L DSCAM chr21 40347755 40347755 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000400454 p.M375I WDR4 chr21 42876752 42876752 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000330317 p.L35L TRPM2 chr21 44353674 44353674 5'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000300482 TRPM2 chr21 44375844 44375844 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000300482 p.P261P TRPM2 chr21 44425784 44425784 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000300482 p.P1251H TSPEAR chr21 44567918 44567918 Missense_Mutation C A A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000323084 p.R57L KRTAP10-9 chr21 44627882 44627882 Silent T G G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000397911 p.P237P FAM207A chr21 44935080 44935080 5'Flank C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000291634 SSR4P1 chr21 45072005 45072005 RNA C A A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000599569 COL6A1 chr21 46003129 46003129 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361866 p.C815F KB-7G2.8 chr22 16697531 16697531 5'Flank C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000423580 CLTCL1 chr22 19233319 19233319 Splice_Site C A A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000427926 p.X457_splice PRAME chr22 22548088 22548088 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000398741 p.C503* PRAME chr22 22548307 22548307 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000398741 p.L430L IGLV2-11 chr22 22792951 22792951 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000390314 p.A101D IGLL3P chr22 25318279 25318279 RNA T T G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000412472 MYO18B chr22 25768792 25768792 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000536101 p.T292T MYO18B chr22 26026831 26026831 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000536101 p.A2286D SEZ6L chr22 26365554 26365554 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000248933 p.P928A TTC28 chr22 28163444 28163444 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000397906 p.V363V AP1B1 chr22 29349311 29349311 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000405198 p.M448I C22orf42 chr22 32151020 32151020 Splice_Site C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000382097 p.X156_splice BPIFC chr22 32432378 32432378 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000300399 p.D382H LARGE chr22 33316089 33316089 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000354992 p.D483Y TMPRSS6 chr22 37069197 37069197 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000346753 p.L672L SH3BP1 chr22 37647298 37647298 Silent A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357436 p.P356P EIF3L chr22 37888552 37888552 3'UTR C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000624234 SYNGR1 chr22 39377719 39377719 Intron C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000328933 XPNPEP3 chr22 40882036 40882036 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357137 p.I150L ZC3H7B chr22 41327293 41327293 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000352645 p.A125P C22orf46 chr22 41693691 41693691 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000402966 p.P149S NFAM1 chr22 42385203 42385203 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000329021 p.F257L SCUBE1 chr22 43214209 43214209 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000360835 p.Q645L EFCAB6 chr22 43755804 43755804 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262726 p.R157C SAMM50 chr22 43996391 43996391 3'UTR C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000350028 PARVB chr22 43999323 43999323 5'UTR A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000406477 PARVG chr22 44206350 44206350 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000422871 p.R307M KIAA0930 chr22 45202995 45202995 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000336156 p.E283K UPK3A chr22 45295655 45295655 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000216211 p.T267K RIBC2 chr22 45426141 45426141 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000614167 p.R290L CELSR1 chr22 46439409 46439409 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262738 p.E1396K C22orf34 chr22 49624651 49624651 RNA G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000343999 PLXNB2 chr22 50275807 50275807 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000359337 p.I1805N ARSA chr22 50627239 50627239 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000216124 p.G131V ACR chr22 50744654 50744654 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000216139 p.G238E PPP2R3B chrX 361581 361581 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000390665 p.R112W CD99 chrX 2719696 2719696 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000381192 p.G62* MXRA5 chrX 3311081 3311081 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000217939 p.P2374P MXRA5 chrX 3323597 3323597 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000217939 p.V696V MXRA5 chrX 3330073 3330073 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000217939 p.P218P NLGN4X chrX 6151585 6151585 5'UTR A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000275857 AMELX chrX 11298762 11298762 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000380714 p.P120L FAM9C chrX 13038464 13038464 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000333995 p.G160R ZRSR2 chrX 15823020 15823020 Silent A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000307771 p.K409K GRPR chrX 16150353 16150353 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000380289 p.L154L PHKA2 chrX 18893557 18893557 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000379942 p.M1212I PHKA2 chrX 18924124 18924124 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000379942 p.G575G ADGRG2 chrX 19028200 19028200 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000379869 p.E133* MAGEB6P1 chrX 26160647 26160647 RNA G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000416929 MAGEB6P1 chrX 26160783 26160783 RNA T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000416929 MAGEB6P1 chrX 26160941 26160941 RNA C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000416929 MAGEB6 chrX 26194536 26194536 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000379034 p.K230N MAGEB6 chrX 26194663 26194663 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000379034 p.E273* DCAF8L1 chrX 27980716 27980716 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000441525 p.R207S MAGEB3 chrX 30235861 30235861 Splice_Region C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361644 MAGEB3 chrX 30236994 30236994 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361644 MAGEB1 chrX 30250523 30250523 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000378981 p.R10R TAB3 chrX 30831500 30831500 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000378933 p.C689F TAB3 chrX 30846053 30846053 Intron C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000378933 FTHL17 chrX 31071891 31071891 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000359202 p.I21M DMD chrX 31204002 31204002 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357033 p.G3256S DMD chrX 31496871 31496871 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357033 p.Q2822K DMD chrX 32342202 32342202 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357033 p.G1940G DMD chrX 32342203 32342203 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357033 p.G1940V FAM47B chrX 34942852 34942852 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000329357 p.Q7H FAM47B chrX 34943798 34943798 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000329357 p.P323T CFAP47 chrX 35953688 35953688 Missense_Mutation T T G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000297866 p.F381L CFAP47 chrX 36301176 36301176 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000378653 p.G2571V FAM47C chrX 37010036 37010036 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000358047 p.S542R PRRG1 chrX 37441944 37441944 Intron A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000378628 USP9X chrX 41166213 41166213 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000324545 p.R776T MAOA chrX 43656256 43656256 5'UTR C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000338702 CXorf36 chrX 45151637 45151637 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000398000 CHST7 chrX 46574258 46574258 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000276055 p.T109T SLC9A7 chrX 46682431 46682431 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000328306 p.V144L NDUFB11 chrX 47142623 47142623 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377811 p.P110H NDUFB11 chrX 47142728 47142728 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377811 p.G75V RBM10 chrX 47173131 47173131 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000377604 p.R146S WASF4P chrX 47804751 47804751 RNA G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000444248 ZNF81 chrX 47846286 47846286 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000338637 p.A7S ZNF630 chrX 48059871 48059871 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000409324 p.L191I SLC38A5 chrX 48460658 48460658 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000595796 p.V353V RBM3 chrX 48575180 48575180 5'UTR C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000376755 WDR13 chrX 48597930 48597930 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000376729 WAS chrX 48689420 48689420 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000376701 p.A480V GLOD5 chrX 48773465 48773465 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000303227 HDAC6 chrX 48818054 48818054 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000334136 p.D647Y HDAC6 chrX 48820234 48820234 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000334136 p.G772G PQBP1 chrX 48898482 48898482 5'UTR C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000218224 OTUD5 chrX 48957051 48957051 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000156084 p.G174C KCND1 chrX 48966287 48966287 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000218176 p.E496Q GRIPAP1 chrX 48976287 48976287 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000376423 p.Q713L GRIPAP1 chrX 48997325 48997325 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000376423 p.M77I PRAF2 chrX 49071958 49071958 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000553851 p.E150Q WDR45 chrX 49077877 49077877 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000376372 p.R30R CACNA1F chrX 49217915 49217915 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000376265 p.G1018R CCDC22 chrX 49250431 49250431 3'UTR C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000376227 PPP1R3F chrX 49285876 49285876 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000055335 p.D396Y CLCN5 chrX 50086400 50086400 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000307367 p.R293C AKAP4 chrX 50193185 50193185 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000358526 p.Q510K CCNB3 chrX 50311083 50311083 Frame_Shift_Del G G - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000276014 p.G972Efs*14 DGKK chrX 50378629 50378629 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000611977 p.V975V SHROOM4 chrX 50634405 50634405 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000289292 p.G556G NUDT10 chrX 51333020 51333020 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000356450 p.R19R CXorf67 chrX 51407686 51407686 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000342995 p.L224I CXorf67 chrX 51407812 51407812 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000342995 p.P266T CXorf67 chrX 51407852 51407852 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000342995 p.R279P GSPT2 chrX 51743953 51743953 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000340438 p.P109P MAGED1 chrX 51896632 51896632 Frame_Shift_Del G G - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000326587 p.R326Sfs*17 GPR173 chrX 53076808 53076808 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000332582 p.D63Y KDM5C chrX 53224970 53224970 5'UTR G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000375401 IQSEC2 chrX 53248820 53248820 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000396435 p.G787V IQSEC2 chrX 53250544 53250544 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000396435 p.G678C IQSEC2 chrX 53250784 53250784 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000396435 p.P598A HUWE1 chrX 53534172 53534172 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262854 p.R4286H HUWE1 chrX 53575777 53575777 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262854 p.D1966Y WNK3 chrX 54202098 54202098 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000354646 p.D1656Y WNK3 chrX 54237356 54237356 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000354646 p.E1404Q WNK3 chrX 54237466 54237466 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000354646 p.S1367Y GNL3L chrX 54560519 54560519 Splice_Site G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000336470 p.X556_splice ITIH6 chrX 54774103 54774103 Missense_Mutation A A C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000218436 p.M294R ITIH6 chrX 54790944 54790944 Nonsense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000218436 p.L170* ALAS2 chrX 55031033 55031033 5'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000330807 USP51 chrX 55486715 55486715 3'UTR T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000500968 KLF8 chrX 56233340 56233340 Splice_Region C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000468660 p.V2V SPIN3 chrX 56994440 56994440 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000374919 p.P170T SPIN2A chrX 57135933 57135933 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000374906 p.S222C FAAH2 chrX 57286778 57286778 5'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000374900 ZXDB chrX 57595125 57595125 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000374888 ZXDA chrX 57910600 57910600 5'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000358697 HEPH chrX 66192286 66192286 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000343002 p.R407I HEPH chrX 66266741 66266741 3'UTR C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000343002 FAM155B chrX 69529031 69529031 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000252338 p.S300R OTUD6A chrX 70063036 70063036 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000338352 p.R171L GDPD2 chrX 70426710 70426710 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000374382 p.V175V TAF1 chrX 71463867 71463867 Frame_Shift_Del G G - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373790 p.D1814Tfs*31 OGT chrX 71557014 71557014 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373719 p.D410V NHSL2 chrX 72134554 72134554 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000510661 p.V17M ZCCHC5 chrX 78657143 78657143 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000321110 p.I426I TBX22 chrX 80023177 80023177 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373294 p.G98V BRWD3 chrX 80676526 80676526 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373275 BRWD3 chrX 80716195 80716195 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373275 p.V763F VDAC1P1 chrX 80929671 80929671 RNA G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000439229 VDAC1P1 chrX 80930182 80930182 RNA C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000439229 SATL1 chrX 85107964 85107964 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000395409 p.S148R DACH2 chrX 86149064 86149064 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373125 p.T148T KLHL4 chrX 87635618 87635618 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373119 p.F590I PABPC5 chrX 91434673 91434673 5'Flank G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000312600 PCDH11X chrX 91877647 91877647 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373094 p.S469S PCDH11X chrX 91878493 91878493 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373094 p.V751V PCDH11X chrX 91878564 91878564 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373094 p.S775* BRDTP1 chrX 96337832 96337832 RNA G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000605735 DIAPH2 chrX 97469709 97469709 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000324765 XRCC6P5 chrX 99719758 99719758 RNA A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000435236 PCDH19 chrX 100406495 100406495 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373034 p.I701M TNMD chrX 100599703 100599703 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373031 p.L314M TSPAN6 chrX 100635219 100635219 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000373020 p.E104* SYTL4 chrX 100675994 100675994 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000263033 CSTF2 chrX 100838280 100838280 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000372972 p.Q551H ARL13A chrX 100988249 100988249 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000450457 p.S237* DRP2 chrX 101254507 101254507 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000395209 p.P687H TAF7L chrX 101269113 101269113 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000372907 BTK chrX 101360089 101360089 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000308731 p.E280* ARMCX3 chrX 101625267 101625267 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000341189 p.A96A ARMCX2 chrX 101656685 101656685 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000328766 p.V302F NXF5 chrX 101841090 101841090 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000263032 p.D136Y TCEAL2 chrX 102126828 102126828 5'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000329035 BEX5 chrX 102154067 102154067 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000333643 p.D67N NXF4 chrX 102566909 102566909 Splice_Region C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000360035 NXF4 chrX 102566970 102566970 RNA C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000360035 NXF4 chrX 102567967 102567967 RNA G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000360035 GPRASP1 chrX 102654882 102654882 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361600 p.A323A GPRASP2 chrX 102715800 102715800 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000332262 p.E311* BEX1 chrX 103062965 103062965 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000372728 p.S104G NXF3 chrX 103079231 103079231 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000395065 p.V456V BEX4 chrX 103216464 103216464 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000372691 p.R104L BEX4 chrX 103216952 103216952 3'UTR G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000372691 RAB40A chrX 103500260 103500260 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000304236 p.S166Y TCEAL4 chrX 103586033 103586033 Intron C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000415568 TCEAL1 chrX 103629926 103629926 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000372625 p.P4T SLC25A53 chrX 104105209 104105209 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000594199 p.R17R TEX13A chrX 105219497 105219497 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000600991 p.A233S TEX13A chrX 105220367 105220367 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000600991 p.G11W IL1RAPL2 chrX 105767216 105767216 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000372582 p.S539Y NRK chrX 105888294 105888294 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000243300 p.D85Y NRK chrX 105909833 105909833 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000243300 p.W731L NRK chrX 105934376 105934376 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000243300 p.S1144C NRK chrX 105944001 105944001 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000243300 p.A1340E NRK chrX 105953078 105953078 Missense_Mutation A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000243300 p.I1520V NRK chrX 105955623 105955623 3'UTR A A G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000243300 SERPINA7 chrX 106035370 106035370 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000327674 p.P213L MUM1L1 chrX 106207776 106207776 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000337685 MUM1L1 chrX 106207777 106207777 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000337685 MUM1L1 chrX 106208171 106208171 3'UTR C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000337685 TBC1D8B chrX 106840174 106840174 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357242 p.G494* CLDN2 chrX 106928873 106928873 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000336803 p.P215P MORC4 chrX 106942681 106942681 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000355610 p.S737Y MORC4 chrX 106999693 106999693 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000355610 p.A53A FRMPD3 chrX 107601956 107601956 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000276185 p.R1339L COL4A6 chrX 108176867 108176867 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000372216 p.G888V COL4A6 chrX 108438218 108438218 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000372216 COL4A5 chrX 108668341 108668341 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361603 p.L1209F IRS4 chrX 108733727 108733727 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000372129 p.P873L GUCY2F chrX 109465288 109465288 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000218006 p.R296R AMMECR1 chrX 110264548 110264548 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262844 p.C175W RGAG1 chrX 110453107 110453107 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000465301 p.M830I RGAG1 chrX 110453435 110453435 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000465301 p.Q940K CAPN6 chrX 111247502 111247502 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000324068 p.V537L DCX chrX 111410316 111410316 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000338081 p.S109N DCX chrX 111411115 111411115 5'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000338081 ALG13 chrX 111721712 111721712 Splice_Site G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000394780 p.X479_splice TRPC5 chrX 111781963 111781963 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262839 p.R691Q ZCCHC16 chrX 112454509 112454509 5'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000340433 ZCCHC16 chrX 112455000 112455000 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000340433 p.A91E ZCCHC16 chrX 112455363 112455363 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000340433 p.C212S HTR2C chrX 114823549 114823549 Intron C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000276198 RBMXL3 chrX 115190359 115190359 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000424776 p.S306R LUZP4 chrX 115306259 115306259 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371920 p.E133Q CT83 chrX 116462835 116462835 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371894 p.A8T DOCK11 chrX 118566635 118566635 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000276202 p.M311I ZCCHC12 chrX 118825729 118825729 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000310164 p.A162E KIAA1210 chrX 119081412 119081412 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000402510 p.V1683L KIAA1210 chrX 119087830 119087830 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000402510 p.Q1134K KIAA1210 chrX 119088742 119088742 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000402510 p.E830* PGRMC1 chrX 119236684 119236684 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000217971 p.Y107* PGRMC1 chrX 119240398 119240398 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000217971 p.D140H SEPT6 chrX 119629370 119629370 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000343984 p.G410S UPF3B chrX 119834860 119834860 3'UTR T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000276201 NDUFA1 chrX 119876594 119876594 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371437 AKAP14 chrX 119914869 119914869 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371431 p.T144T ZBTB33 chrX 120257218 120257218 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000326624 ZBTB33 chrX 120257490 120257490 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000326624 CT47B1 chrX 120875335 120875335 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371311 p.T112T GRIA3 chrX 123398720 123398720 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000541091 p.R333R THOC2 chrX 123613517 123613517 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000245838 p.S1520F THOC2 chrX 123621180 123621180 Nonsense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000245838 p.S1398* TENM1 chrX 124523435 124523435 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371130 p.V988L TENM1 chrX 124529937 124529937 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371130 p.P900T TENM1 chrX 124547024 124547024 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371130 p.C834F TENM1 chrX 124737003 124737003 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371130 p.L244L DCAF12L2 chrX 126165552 126165552 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000360028 p.V125L DCAF12L1 chrX 126552243 126552243 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371126 p.V122V PRR32 chrX 126820984 126820984 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371125 p.A116S ACTRT1 chrX 128051787 128051787 Missense_Mutation A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371124 p.H140Q ACTRT1 chrX 128052048 128052048 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371124 p.Q53Q SMARCA1 chrX 129515951 129515951 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371122 p.L158M APLN chrX 129647545 129647545 3'UTR C C - TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000429967 XPNPEP2 chrX 129739165 129739165 5'UTR C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371106 XPNPEP2 chrX 129739172 129739172 5'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371106 XPNPEP2 chrX 129754480 129754480 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000371106 p.D372D ZDHHC9 chrX 129806407 129806407 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000357166 p.P353Q UTP14A chrX 129919196 129919196 Missense_Mutation G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000394422 p.E187K BCORL1 chrX 130013258 130013258 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000218147 p.L162F BCORL1 chrX 130013259 130013259 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000218147 p.D163Y BCORL1 chrX 130014868 130014868 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000218147 p.P699Q BCORL1 chrX 130020997 130020997 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000218147 p.P1152T BCORL1 chrX 130039182 130039182 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000218147 p.W1506C ELF4 chrX 130081345 130081345 5'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000308167 AIFM1 chrX 130155236 130155236 Intron C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000287295 ENOX2 chrX 130709271 130709271 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000338144 p.W7C ARHGAP36 chrX 131088764 131088764 Silent C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000276211 p.G541G IGSF1 chrX 131285906 131285906 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361420 p.I80I OR13H1 chrX 131544343 131544343 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000338616 p.P90P OR13H1 chrX 131544344 131544344 Missense_Mutation T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000338616 p.Y91N FRMD7 chrX 132080255 132080255 Missense_Mutation T T C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000298542 p.Q306R RAP2C chrX 132214235 132214235 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000342983 p.R162M FAM127A chrX 135033224 135033224 3'UTR G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000257013 FAM127A chrX 135033465 135033465 3'UTR G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000257013 FAM127B chrX 135051595 135051595 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370775 ZNF75D chrX 135287064 135287064 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370766 ZNF449 chrX 135348448 135348448 Intron C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000339249 DDX26B chrX 135545422 135545422 Splice_Site G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370752 p.X64_splice DDX26B chrX 135545572 135545572 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370752 p.Q113H DDX26B chrX 135545573 135545573 Splice_Site G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370752 p.X113_splice DDX26B chrX 135574062 135574062 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370752 p.D544H SAGE1 chrX 135910083 135910083 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000324447 p.A593S SLC9A6 chrX 136016695 136016695 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370698 p.M397I SLC9A6 chrX 136030151 136030151 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370698 p.Q514K FHL1 chrX 136206470 136206470 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000345434 p.P13R MAP7D3 chrX 136231799 136231799 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000316077 p.P386P ADGRG4 chrX 136346053 136346053 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370652 p.V783L ADGRG4 chrX 136348403 136348403 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370652 p.P1566Q ADGRG4 chrX 136392316 136392316 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370652 p.P2666T FGF13 chrX 138667789 138667789 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000315930 FGF13 chrX 138708831 138708831 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000315930 p.E95D MCF2 chrX 139617560 139617560 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370576 p.R318R MAGEC1 chrX 141905447 141905447 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000285879 p.L15V MAGEC2 chrX 142203343 142203343 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000247452 p.T215T SPANXN3 chrX 143517363 143517363 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370503 p.G10V SLITRK4 chrX 143629701 143629701 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000338017 p.D470N UBE2NL chrX 143884164 143884164 RNA G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000618570 SLITRK2 chrX 145822605 145822605 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370490 p.P60P SLITRK2 chrX 145823575 145823575 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370490 p.G384W SLITRK2 chrX 145823652 145823652 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370490 p.N409K MIR892B chrX 145997262 145997262 RNA G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000401279 MIR509-3 chrX 147259707 147259707 RNA C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000390725 FMR1 chrX 147948826 147948826 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370475 p.L627L AFF2 chrX 148904310 148904310 Intron C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370460 AFF2 chrX 148967692 148967692 Splice_Region G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370460 p.L1089L IDS chrX 149501007 149501007 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000340855 p.P150Q CXorf40A chrX 149549472 149549472 3'Flank C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000450602 MAGEA11 chrX 149715662 149715662 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000355220 p.T84N MAMLD1 chrX 150471077 150471077 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000262858 p.Q502K MTM1 chrX 150649776 150649776 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370396 p.D310H MTMR1 chrX 150736758 150736758 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370390 p.T407K GPR50 chrX 151180096 151180096 Nonsense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000218316 p.Y171* GPR50 chrX 151180903 151180903 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000218316 p.K440N FATE1 chrX 151722722 151722722 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370350 p.A172G CNGA2 chrX 151743116 151743116 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000329903 p.V205F CNGA2 chrX 151743449 151743449 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000329903 p.E316* CNGA2 chrX 151744297 151744297 Silent G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000329903 p.Q598Q CNGA2 chrX 151744644 151744644 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000329903 MAGEA4 chrX 151923799 151923799 Silent T T A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000276344 p.P45P PNMA5 chrX 152990868 152990868 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361887 p.S244C PNMA3 chrX 153058155 153058155 Missense_Mutation C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000424805 p.P367L PNMA3 chrX 153058388 153058388 Missense_Mutation G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000424805 p.E445Q PNMA3 chrX 153059895 153059895 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000424805 PNMA6A chrX 153073582 153073583 Frame_Shift_Ins - - G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000421798 p.L175Afs*123 MAGEA1 chrX 153182586 153182586 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000356661 p.T66N TREX2 chrX 153445321 153445321 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000334497 p.R80L HAUS7 chrX 153454908 153454908 Intron C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370211 ATP2B3 chrX 153542419 153542419 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000263519 p.S254* ATP2B3 chrX 153558147 153558147 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000263519 p.S823S PNCK chrX 153671166 153671166 Nonsense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000340888 p.Y213* SLC6A8 chrX 153693352 153693352 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000253122 p.N334K PLXNB3 chrX 153770229 153770229 Silent A A T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361971 p.P589P PLXNB3 chrX 153770615 153770615 Silent C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361971 p.G661G PLXNB3 chrX 153770968 153770968 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361971 p.L714M PLXNB3 chrX 153776961 153776961 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000361971 p.Q1636H IDH3G chrX 153790267 153790267 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000217901 p.R54P L1CAM chrX 153868370 153868370 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000370060 p.P545P AVPR2 chrX 153906812 153906812 3'UTR G G A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000337474 HCFC1 chrX 153944737 153944737 3'Flank C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000310441 HCFC1 chrX 153954648 153954648 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000310441 p.E1251* MECP2 chrX 154092284 154092284 5'UTR G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000303391 ATP6AP1 chrX 154429313 154429313 Intron G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369762 SLC10A3 chrX 154487666 154487666 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000263512 p.N425K G6PD chrX 154534462 154534462 Missense_Mutation C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000393564 p.G174R GAB3 chrX 154699327 154699327 Missense_Mutation G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369575 p.P437T DKC1 chrX 154773224 154773224 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369550 p.P377H DKC1 chrX 154775014 154775014 Intron C C G TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000369550 F8 chrX 154929263 154929263 Silent G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000360256 p.G1509G F8 chrX 154930041 154930041 Missense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000360256 p.S1250I F8 chrX 154947876 154947876 Silent C C T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000360256 p.Q645Q MTCP1 chrX 155065908 155065908 Nonsense_Mutation C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000362018 p.E35* SPRY3 chrX 155777254 155777254 3'UTR G G C TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000302805 SPRY3 chrX 155780777 155780777 3'UTR C C A TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000302805 IL9R chrX 156005370 156005370 Silent G G T TCGA-OR-A5KB-01A-11D-A30A-10 ENST00000244174 p.L224L USP48 chr1 21728567 21728567 Splice_Region G G C TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000308271 UTP11L chr1 38016397 38016397 Missense_Mutation G G T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000373014 p.K34N PTBP2 chr1 96806913 96806913 Missense_Mutation G G A TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000426398 p.D376N PRMT6 chr1 107058325 107058325 3'UTR C C T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000370078 PRMT6 chr1 107058326 107058326 3'UTR C C T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000370078 CD1E chr1 158354395 158354395 Missense_Mutation C C A TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000368167 p.S26Y OR6K6 chr1 158755640 158755640 Missense_Mutation C C A TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000368144 p.F275L IFI16 chr1 159051941 159051941 Missense_Mutation A A T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000295809 p.E643V IGFN1 chr1 201212910 201212910 Intron G G T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000295591 RAB3GAP2 chr1 220196375 220196375 Missense_Mutation C C G TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000358951 p.D279H ACTN2 chr1 236739510 236739510 Missense_Mutation C C T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000366578 p.P362L OR2G6 chr1 248521837 248521837 Missense_Mutation G G T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000343414 p.S64I CAPN14 chr2 31205416 31205416 Missense_Mutation C C A TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000403897 p.W11L HNRNPLL chr2 38573367 38573367 Missense_Mutation G G T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000449105 p.P312H SNRNP200 chr2 96296982 96296982 Missense_Mutation T T C TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000323853 p.Y489C DBI chr2 119366966 119366966 5'UTR A A C TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000355857 XIRP2 chr2 167248152 167248152 Silent C C T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000628543 p.L2079L SGOL2 chr2 200575435 200575435 Silent C C T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000357799 p.F1252F CASP8 chr2 201272822 201272822 Intron A A T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000432109 TOPAZ1 chr3 44242277 44242277 Missense_Mutation G G C TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000309765 p.G75A CADPS chr3 62645762 62645762 Missense_Mutation C C G TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000383710 p.E429Q MYLK chr3 123666342 123666342 Missense_Mutation C C T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000360304 p.M1236I ATP13A5 chr3 193321735 193321735 Missense_Mutation C C A TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000342358 p.V621F MUC4 chr3 195779136 195779136 Silent G G A TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000463781 p.T4148T NCBP2 chr3 196942404 196942404 Intron C C T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000321256 RP11-747H12.1 chr4 8950052 8950052 RNA T T G TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000508957 ENAM chr4 70644807 70644807 Silent G G T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000396073 p.G1127G ANKRD17 chr4 73146871 73146871 Missense_Mutation C C A TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000358602 p.A588S INTU chr4 127687792 127687792 Silent G G A TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000335251 p.Q458Q ARHGEF28 chr5 73873216 73873216 Missense_Mutation C C G TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000426542 p.I928M FNIP1 chr5 131671670 131671671 Frame_Shift_Ins - - T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000510461 p.I925Nfs*6 PCDHA8 chr5 140843433 140843433 Silent C C A TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000531613 p.I704I PCDHB5 chr5 141135481 141135481 Missense_Mutation T T G TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000231134 p.F16C PCDHB16 chr5 141184900 141184900 3'UTR A A T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000609684 TCOF1 chr5 150379314 150379314 Missense_Mutation C C G TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000377797 p.A855G HK3 chr5 176891106 176891106 Silent C C A TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000292432 p.G115G ZNF184 chr6 27451322 27451322 Missense_Mutation C C T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000211936 p.R746K XXbac-BPG308J9.3 chr6 29263702 29263702 Intron C C G TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000441381 CYP21A2 chr6 32039614 32039614 Silent C C G TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000418967 p.S206S TNFRSF21 chr6 47232882 47232882 Missense_Mutation C C A TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000296861 p.E617D MUT chr6 49448877 49448877 Missense_Mutation C C G TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000274813 p.E461D IL17A chr6 52186391 52186391 5'UTR G G A TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000340057 ICK chr6 53006357 53006357 Missense_Mutation T T C TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000350082 p.M568V COL19A1 chr6 70180466 70180466 Missense_Mutation G G T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000620364 p.E906D ASCC3 chr6 100798782 100798782 Missense_Mutation C C G TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000369162 p.R442S SMO chr7 129211679 129211679 Silent C C T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000249373 p.S615S PRKAG2 chr7 151781259 151781259 Missense_Mutation C C T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000287878 p.R120H FAM167A chr8 11424633 11424633 Missense_Mutation C C T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000284486 p.E129K ADRB3 chr8 37966107 37966107 Silent C C A TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000345060 p.V121V CNGB3 chr8 86671018 86671018 Missense_Mutation C C T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000320005 p.R140H EIF3E chr8 108234979 108234979 Intron A A C TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000220849 PRUNE2 chr9 76823679 76823679 Missense_Mutation C C G TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000376718 p.D237H PAPPA chr9 116211818 116211818 Missense_Mutation G G T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000328252 p.D602Y PHRF1 chr11 608465 608465 Missense_Mutation G G C TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000264555 p.K1003N OR5AR1 chr11 56664338 56664338 Missense_Mutation A A G TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000302969 p.Y218C KMT2A chr11 118504129 118504129 Missense_Mutation G G C TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000389506 p.R2743T PPM1H chr12 62737574 62737574 Missense_Mutation G G C TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000228705 p.I294M C14orf159 chr14 91181312 91181312 Missense_Mutation C C A TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000428926 p.P281H AHNAK2 chr14 104948037 104948037 Missense_Mutation C C G TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000333244 p.A2472P HERC2 chr15 28265670 28265670 Silent G G A TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000261609 p.I606I TYRO3 chr15 41561275 41561275 Silent C C T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000263798 p.I91I TMC5 chr16 19440128 19440128 Missense_Mutation G G T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000396229 p.L30F TMC5 chr16 19477446 19477446 Missense_Mutation C C G TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000396229 p.I699M SLC35G6 chr17 7482157 7482157 Missense_Mutation C C T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000412468 p.S58F TP53 chr17 7676152 7676153 Frame_Shift_Ins - - G TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000269305 p.V73Rfs*76 GAS2L2 chr17 35746241 35746241 Missense_Mutation G G C TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000604641 p.S419C MYOM1 chr18 3079309 3079309 Silent C C T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000356443 p.K1506K MUC16 chr19 8979651 8979651 Missense_Mutation G G T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000397910 p.S496R IGFL1 chr19 46230107 46230107 Splice_Site G G C TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000437936 p.X9_splice PPFIA3 chr19 49133820 49133820 Missense_Mutation G G A TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000334186 p.E396K SIGLEC12 chr19 51500282 51500282 Nonsense_Mutation G G C TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000291707 p.S149* ZNF468 chr19 52839900 52839900 3'UTR G G A TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000595646 PNPLA4 chrX 7922099 7922099 Splice_Site C C T TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000381042 p.X61_splice SYTL4 chrX 100700989 100700989 Missense_Mutation T T A TCGA-PK-A5HC-01A-11D-A30A-10 ENST00000263033 p.R149S HIST3H2BB chr1 228458513 228458513 3'UTR C C T TCGA-OR-A5L9-01A-11D-A29I-10 ENST00000620438 MPC1 chr6 166365357 166365357 3'UTR A G G TCGA-OR-A5L9-01A-11D-A29I-10 ENST00000360961 WWP1 chr8 86425250 86425250 Silent T T G TCGA-OR-A5L9-01A-11D-A29I-10 ENST00000265428 p.G363G EFR3A chr8 132010957 132010957 3'UTR T T G TCGA-OR-A5L9-01A-11D-A29I-10 ENST00000254624 NRBP2 chr8 143835655 143835655 3'UTR C C G TCGA-OR-A5L9-01A-11D-A29I-10 ENST00000442628 SRRM4 chr12 119156624 119156625 In_Frame_Ins - - CGGAGC TCGA-OR-A5L9-01A-11D-A29I-10 ENST00000267260 p.S558_R559dup NDRG2 chr14 21020813 21020813 Missense_Mutation C C G TCGA-OR-A5L9-01A-11D-A29I-10 ENST00000298687 p.A147P GMFB chr14 54478037 54478037 3'UTR C T T TCGA-OR-A5L9-01A-11D-A29I-10 ENST00000358056 HDAC6 chrX 48818068 48818068 Missense_Mutation C C A TCGA-OR-A5L9-01A-11D-A29I-10 ENST00000334136 p.H651Q ZMYM3 chrX 71247819 71247819 Missense_Mutation C C T TCGA-OR-A5L9-01A-11D-A29I-10 ENST00000314425 p.R688H G6PD chrX 154532975 154532975 Missense_Mutation C C T TCGA-OR-A5L9-01A-11D-A29I-10 ENST00000393564 p.V340I EIF2D chr1 206611327 206611327 Missense_Mutation G G C TCGA-OR-A5JR-01A-11D-A29I-10 ENST00000271764 p.T35S HSPD1 chr2 197495230 197495230 Intron A A - TCGA-OR-A5JR-01A-11D-A29I-10 ENST00000345042 PANK3 chr5 168579323 168579323 5'UTR G G C TCGA-OR-A5JR-01A-11D-A29I-10 ENST00000239231 ANXA8L1 chr10 46385403 46385403 Missense_Mutation G G T TCGA-OR-A5JR-01A-11D-A29I-10 ENST00000619162 p.K192N AC215219.2 chr12 17743 17743 5'Flank A A G TCGA-OR-A5JR-01A-11D-A29I-10 ENST00000611710 KANSL2 chr12 48681522 48681522 Silent G G A TCGA-OR-A5JR-01A-11D-A29I-10 ENST00000420613 p.H37H FAM179B chr14 45073513 45073513 Silent A A G TCGA-OR-A5JR-01A-11D-A29I-10 ENST00000361577 p.K1705K CILP2 chr19 19545489 19545489 Missense_Mutation G G A TCGA-OR-A5JR-01A-11D-A29I-10 ENST00000291495 p.E982K CHD5 chr1 6130157 6130157 Intron G G C TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000262450 TAS1R1 chr1 6576513 6576513 Silent C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000333172 p.A453A VPS13D chr1 12460221 12460221 Missense_Mutation A A T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000620676 p.S4163C PRAMEF20 chr1 13418209 13418209 Missense_Mutation A A C TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000316412 p.L125F PADI2 chr1 17092478 17092478 Frame_Shift_Del G G - TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000375486 p.A196Pfs*5 IGSF21 chr1 18376810 18376811 Frame_Shift_Ins - - C TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000251296 p.E373Gfs*19 FAM43B chr1 20554579 20554579 3'UTR C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000332947 HSPG2 chr1 21844156 21844156 Missense_Mutation G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000374695 p.R2870W MYOM3 chr1 24108597 24108597 Silent G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000374434 p.R14R NIPAL3 chr1 24460521 24460521 Silent G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000374399 p.L301L ARID1A chr1 26731425 26731425 Nonsense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000324856 p.Q542* MANEAL chr1 37794569 37794569 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000373045 p.M129I MACF1 chr1 39447473 39447473 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000372915 p.Q6448H USP24 chr1 55103949 55103949 Missense_Mutation T T C TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000294383 p.N1651S NFIA chr1 61406705 61406705 Silent T T A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000403491 p.G466G ROR1 chr1 64049877 64049877 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000371079 p.R117L HFM1 chr1 91261326 91261326 Missense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000370425 p.M1424I ARHGAP29 chr1 94174732 94174732 Silent G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000260526 p.L975L S1PR1 chr1 101240744 101240744 3'UTR A A G TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000305352 NRAS chr1 114713909 114713909 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000369535 p.Q61K SELENBP1 chr1 151369475 151369475 Silent C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000368868 p.V47V RPTN chr1 152156162 152156162 Missense_Mutation G G C TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000316073 p.Q313E ATP8B2 chr1 154334521 154334521 Missense_Mutation T T C TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000368489 p.M289T ATP8B2 chr1 154348524 154348524 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000368489 p.D1127Y NES chr1 156675301 156675301 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000368223 p.Q275K CD1C chr1 158293253 158293253 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000368170 p.V311L SPTA1 chr1 158615377 158615377 Missense_Mutation C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000368147 p.M2209I B4GALT3 chr1 161173776 161173776 Intron C C - TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000319769 MROH9 chr1 170996554 170996554 Missense_Mutation A A T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000367758 p.Q462L CENPL chr1 173800411 173800411 3'UTR G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000345664 BRINP2 chr1 177229918 177229918 Silent G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000361539 p.P14P RALGPS2 chr1 178784465 178784465 Missense_Mutation G G C TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000367635 p.K35N SWT1 chr1 185206764 185206764 Splice_Site G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000367500 p.X658_splice CACNA1S chr1 201058493 201058493 Splice_Site T T A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000362061 p.X1176_splice PPFIA4 chr1 203045503 203045503 Missense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000447715 p.R268W C1orf132 chr1 207817369 207817369 RNA G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000608023 USH2A chr1 215888633 215888633 Silent C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000307340 p.L2672L EPRS chr1 220040195 220040195 Missense_Mutation G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000366923 p.H41Y TRIM67 chr1 231208984 231208984 Silent G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000366653 p.R619R TRIM67 chr1 231208985 231208985 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000366653 p.D620Y PCNXL2 chr1 233227225 233227225 Splice_Site C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000258229 p.X835_splice OR2G3 chr1 247605848 247605848 Missense_Mutation C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000320002 p.P88Q OR14C36 chr1 248349327 248349327 Missense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000317861 p.L185F OR2T2 chr1 248453548 248453548 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000342927 p.V251F YWHAQ chr2 9591398 9591398 Missense_Mutation G G C TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000238081 p.R138G APOB chr2 21007966 21007966 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000233242 p.L2968I PRR30 chr2 27137416 27137416 Missense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000335524 p.G305D FBXO11 chr2 47808224 47808224 Missense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000403359 p.G893E TET3 chr2 74080546 74080546 Silent G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000409262 p.T878T REG3A chr2 79158696 79158696 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000305165 p.H50Q CHMP3 chr2 86505860 86505860 Missense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000263856 p.E205K IGKV5-2 chr2 88897695 88897695 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000390244 p.G86W MRPS9 chr2 105038102 105038102 Missense_Mutation C C G TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000258455 p.P4A SAP130 chr2 128000060 128000060 Silent T T A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000259235 p.T394T WIPF1 chr2 174562419 174562419 3'UTR A A C TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000359761 RBM45 chr2 178118154 178118154 Missense_Mutation G G C TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000616198 p.A175P TTN chr2 178589309 178589309 Missense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000591111 p.D19165N PLCL1 chr2 198083779 198083779 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000428675 p.G88C UNC80 chr2 209786126 209786126 Missense_Mutation C C G TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000439458 p.H221D DES chr2 219423776 219423776 Splice_Site G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000373960 p.X415_splice SPEG chr2 219445144 219445144 Silent G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000312358 p.R266R C3orf20 chr3 14714119 14714119 Missense_Mutation A A G TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000253697 p.T425A GOLGA4 chr3 37326338 37326338 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000361924 p.L1484F COL7A1 chr3 48591799 48591799 Frame_Shift_Del C C - TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000328333 p.V461Yfs*6 BSN chr3 49656702 49656702 Silent G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000296452 p.L2382L ITIH1 chr3 52779580 52779580 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000273283 p.V187L TMPRSS7 chr3 112042011 112042011 Silent C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000452346 p.S130S ARGFX chr3 121586208 121586208 Missense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000334384 p.P186S PPP2R3A chr3 136001644 136001644 Missense_Mutation A A T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000264977 p.H49L IL20RB chr3 137010164 137010164 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000329582 p.D293Y IL20RB chr3 137010165 137010165 Missense_Mutation A A C TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000329582 p.D293A ESYT3 chr3 138452058 138452058 Missense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000389567 p.P113L SUCNR1 chr3 151880585 151880585 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000362032 p.W14C GPR149 chr3 154338270 154338270 Missense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000389740 p.R542H MME chr3 155172213 155172213 Splice_Site G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000360490 p.X692_splice CCDC39 chr3 180659479 180659479 Silent C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000442201 p.R237R VWA5B2 chr3 184239547 184239547 Missense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000426955 p.P786S HRG chr3 186677494 186677494 Missense_Mutation C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000232003 p.H397N ZNF595 chr4 86779 86779 Silent G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000610261 p.T425T CCDC149 chr4 24819859 24819859 Missense_Mutation C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000504487 p.G387W RHOH chr4 40243836 40243836 Silent G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000381799 p.E150E GABRA4 chr4 46971159 46971159 Silent C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000264318 p.P266P MUC7 chr4 70480874 70480874 Missense_Mutation G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000304887 p.E44K SHROOM3 chr4 76778843 76778843 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000296043 p.G1886V SPARCL1 chr4 87494253 87494253 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000282470 p.Q183K UNC5C chr4 95202751 95202751 Missense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000453304 p.D706N ANK2 chr4 113355734 113355734 Silent C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000357077 p.S2372S FSTL5 chr4 162111317 162111317 Missense_Mutation C C G TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000306100 p.G27A PDLIM3 chr4 185502318 185502318 Silent C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000284770 p.T357T LRRC14B chr5 192299 192299 Missense_Mutation C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000328278 p.P254H ADAMTS16 chr5 5235037 5235037 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000274181 p.C625F DNAH5 chr5 13776619 13776619 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000265104 p.P3065T CDH9 chr5 26988339 26988339 5'UTR G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000231021 DAB2 chr5 39376866 39376866 Missense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000320816 p.D641N VCAN chr5 83580373 83580373 Missense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000265077 p.S3377L ARRDC3 chr5 91376710 91376710 Nonsense_Mutation C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000265138 p.E141* ANKRD32 chr5 94695298 94695298 Missense_Mutation A A G TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000265140 p.M1055V C5orf30 chr5 103277556 103277556 3'UTR A A T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000319933 C5orf30 chr5 103277557 103277557 3'UTR C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000319933 MAN2A1 chr5 109866927 109866927 Missense_Mutation G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000261483 p.G1122S PRR16 chr5 120686241 120686242 Frame_Shift_Ins - - A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000407149 p.N150Kfs*15 ADAMTS19 chr5 129509159 129509159 Missense_Mutation G G C TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000274487 p.R271P KIF20A chr5 138187306 138187306 Silent C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000394894 p.R856R PCDHA11 chr5 140869191 140869191 Nonsense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000398640 p.Q30* RBM27 chr5 146260827 146260827 Missense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000265271 p.P608S IL12B chr5 159316697 159316697 Silent C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000231228 p.V325V DOCK2 chr5 169681865 169681865 Missense_Mutation A A G TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000256935 p.I198V NSD1 chr5 177294446 177294446 Missense_Mutation A A T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000439151 p.R2360W SLC34A1 chr5 177397890 177397890 Silent G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000324417 p.T508T ZNF354B chr5 178883055 178883055 Silent A A G TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000322434 p.L201L OR2Y1 chr5 180739785 180739785 Missense_Mutation T T C TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000307832 p.I92V HIST1H2AC chr6 26124245 26124245 Missense_Mutation G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000314088 p.G5S POM121L2 chr6 27309866 27309866 Nonsense_Mutation C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000444565 p.G769* EHMT2 chr6 31884748 31884748 Missense_Mutation C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000375537 p.A834S DST chr6 56900603 56900603 Missense_Mutation G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000370754 p.R79W POPDC3 chr6 105166673 105166673 Intron C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000254765 KPNA5 chr6 116724322 116724322 Missense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000356348 p.P316S TAAR5 chr6 132589062 132589062 Missense_Mutation A A T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000258034 p.F209I FNDC1 chr6 159225657 159225657 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000297267 p.R336L KIF25 chr6 168038715 168038715 Silent G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000354419 p.A160A FAM183B chr7 38685790 38685790 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000409072 p.H72Q AUTS2 chr7 70790123 70790123 Silent G G C TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000342771 p.P969P MUC17 chr7 101037517 101037517 Missense_Mutation T T C TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000306151 p.I2034T NUP205 chr7 135602851 135602851 Silent C C G TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000285968 p.L853L PDIA4 chr7 149005265 149005265 Silent C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000286091 p.G466G PTPRN2 chr7 158110852 158110852 Silent G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000389418 p.P540P ERICH1 chr8 668622 668622 Missense_Mutation G G C TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000262109 p.P412A MYOM2 chr8 2144948 2144948 Silent C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000262113 p.L1455L GATA4 chr8 11756968 11756968 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000335135 p.S344I ADAM2 chr8 39838222 39838222 5'UTR G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000265708 RP1 chr8 54630155 54630155 Silent C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000220676 p.I2091I CRISPLD1 chr8 75017341 75017341 Missense_Mutation G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000262207 p.A340T RALYL chr8 84529554 84529554 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000521268 p.R78I RMDN1 chr8 86478979 86478979 Nonsense_Mutation G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000406452 p.Q225* RIMS2 chr8 103921700 103921700 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000262231 p.M559I GPT chr8 144505267 144505267 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000394955 p.A173S FREM1 chr9 14842604 14842604 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000380880 p.H484N OSTF1 chr9 75134393 75134393 Nonsense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000346234 p.Q136* SPATA31E1 chr9 87885336 87885336 Missense_Mutation C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000325643 p.N283K SPATA31E1 chr9 87886055 87886055 Missense_Mutation C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000325643 p.T523N TMEM246 chr9 101477022 101477022 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000374847 p.A24D KIAA0368 chr9 111383213 111383213 Splice_Region G G C TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000338205 p.L1267L PAPPA chr9 116187955 116187955 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000328252 p.R406L PTER chr10 16484727 16484727 Missense_Mutation G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000378000 p.E115K ST8SIA6 chr10 17320957 17320957 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000377602 p.P373H ACBD5 chr10 27197365 27197365 3'UTR C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000375888 HNRNPF chr10 43387236 43387236 Missense_Mutation T T C TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000337970 p.R217G WDFY4 chr10 48964011 48964011 Missense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000325239 p.T2798I ANXA2P3 chr10 64826240 64826240 RNA C C G TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000404883 SPOCK2 chr10 72064201 72064201 Missense_Mutation T T A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000317376 p.Q323L GPAM chr10 112160706 112160706 Missense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000348367 p.D553N GFRA1 chr10 116125480 116125480 Missense_Mutation T T A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000355422 p.R171W TIAL1 chr10 119582528 119582528 Silent C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000436547 p.V53V INSC chr11 15235610 15235610 Silent C C G TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000379554 p.T440T MPPED2 chr11 30414259 30414259 Silent G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000358117 p.P245P MPPED2 chr11 30414260 30414260 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000358117 p.P245H RCN1 chr11 32097147 32097147 Silent G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000054950 p.K86K CHST1 chr11 45649752 45649752 Missense_Mutation T T C TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000308064 p.E391G APLNR chr11 57236968 57236968 Frame_Shift_Del C C - TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000257254 p.A13Qfs*64 LPXN chr11 58527538 58527538 Silent C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000395074 p.L359L PTGDR2 chr11 60852788 60852788 Missense_Mutation A A T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000332539 p.L312Q LRRC10B chr11 61510211 61510211 3'UTR G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000378075 UBXN1 chr11 62677715 62677715 Intron C C G TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000301935 SNX32 chr11 65852498 65852498 Missense_Mutation C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000308342 p.L287M FGF3 chr11 69810381 69810381 Missense_Mutation T T A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000334134 p.Q215L CTSC chr11 88294510 88294510 Splice_Site T T C TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000227266 p.X297_splice FAT3 chr11 92764924 92764924 Missense_Mutation C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000525166 p.R1194S FAT3 chr11 92801024 92801024 Missense_Mutation A A G TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000525166 p.N2521D FAT3 chr11 92859319 92859319 Silent G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000525166 p.L3735L MTMR2 chr11 95923913 95923913 Silent C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000346299 p.P14P OR8A1 chr11 124570181 124570181 Missense_Mutation C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000284287 p.A38E IGSF9B chr11 133920640 133920640 Nonsense_Mutation G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000321016 p.Q1029* SLC2A3 chr12 7923025 7923025 Splice_Site C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000075120 p.X357_splice A2ML1 chr12 8846220 8846220 Nonsense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000299698 p.Q561* PRB2 chr12 11393275 11393275 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000389362 p.P268Q BICD1 chr12 32294113 32294113 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000281474 p.L182F RPAP3 chr12 47696319 47696319 Missense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000005386 p.V168M ACVRL1 chr12 51914483 51914483 Missense_Mutation G G C TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000388922 p.E224Q NR4A1 chr12 52056157 52056157 Missense_Mutation A A G TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000243050 p.E335G OR10A7 chr12 55221309 55221309 Silent G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000326258 p.V95V LRP1 chr12 57145016 57145016 Missense_Mutation A A C TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000243077 p.T165P DAO chr12 108885118 108885118 Missense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000228476 p.R38C RBM19 chr12 113966291 113966291 5'UTR G G C TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000261741 SACS chr13 23331414 23331414 Silent T T C TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000382292 p.P4154P FLT3 chr13 28049387 28049387 Missense_Mutation C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000241453 p.V345L FREM2 chr13 38691572 38691572 Missense_Mutation T T A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000280481 p.F1410I ZC3H13 chr13 45985666 45985666 Missense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000242848 p.E451K LRRC63 chr13 46266910 46266910 Silent C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000378805 p.V496V ARL11 chr13 49631721 49631721 3'UTR C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000282026 ARHGEF40 chr14 21083982 21083982 Nonsense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000298694 p.Q1241* SLC22A17 chr14 23351992 23351992 Missense_Mutation C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000206544 p.D75Y LRFN5 chr14 41891653 41891653 Missense_Mutation G G C TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000298119 p.E597Q DACT1 chr14 58646742 58646742 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000335867 p.A707S EXD2 chr14 69209564 69209564 Nonsense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000312994 p.R32* CDCA4 chr14 105011935 105011935 Splice_Region C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000336219 IGHA1 chr14 105707945 105707945 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000390547 p.S169R FAM189A1 chr15 29381821 29381821 Missense_Mutation G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000261275 p.S77L ICE2 chr15 60455138 60455138 Missense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000261520 p.E270K RPS27L chr15 63157447 63157447 5'UTR C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000330964 CSNK1G1 chr15 64207580 64207580 Missense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000303052 p.D232N AGBL1 chr15 86546055 86546055 Silent C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000441037 p.G867G ADAMTS17 chr15 100109005 100109005 Missense_Mutation A A T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000268070 p.V667E CERS3 chr15 100501845 100501845 Missense_Mutation A A T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000284382 p.F2Y LRRK1 chr15 100983648 100983648 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000388948 p.A128S VPS35 chr16 46689187 46689187 5'UTR G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000299138 SLC6A2 chr16 55691959 55691959 Silent C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000379906 p.F275F HYDIN chr16 70882747 70882747 Silent G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000393567 p.G3376G CHST5 chr16 75529288 75529288 Missense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000336257 p.R366H ATP2C2 chr16 84439456 84439456 Missense_Mutation A A T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000262429 p.T381S SPG7 chr16 89532478 89532478 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000268704 p.R389L OR1A2 chr17 3198328 3198328 Silent A A T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000381951 p.A270A MFSD6L chr17 8798739 8798739 Missense_Mutation C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000329805 p.V128L FAM27L chr17 22299562 22299562 RNA G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000426869 TAOK1 chr17 29542939 29542939 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000261716 p.G975W HDAC5 chr17 44078370 44078370 3'UTR G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000586802 KIF18B chr17 44936306 44936306 Silent C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000593135 p.R13R KCNJ2 chr17 70179642 70179642 3'UTR C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000243457 TMC6 chr17 78125201 78125201 Missense_Mutation G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000322914 p.L165F ACTG1 chr17 81512025 81512025 Missense_Mutation C C G TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000331925 p.D81H ANKRD30B chr18 14748542 14748542 Silent G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000358984 p.K41K DSG1 chr18 31355203 31355203 Missense_Mutation C C G TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000257192 p.L1003V DSG4 chr18 31392221 31392221 Missense_Mutation G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000308128 p.D296N NETO1 chr18 72865584 72865584 Intron G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000327305 R3HDM4 chr19 901464 901464 Silent T T A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000361574 p.P103P SBNO2 chr19 1112930 1112930 Missense_Mutation C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000361757 p.R756L GIPC3 chr19 3590130 3590130 Silent C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000322315 p.P293P ZFR2 chr19 3834851 3834851 Silent G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000262961 p.P62P WDR62 chr19 36090521 36090521 Splice_Site G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000270301 p.X678_splice TBCB chr19 36115593 36115593 Silent G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000221855 p.V11V ZNF793 chr19 37537339 37537339 Silent C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000445217 p.H227H PSG4 chr19 43195121 43195121 Silent G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000405312 p.R288R TEX101 chr19 43418316 43418316 Silent G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000598265 p.G223G TGM6 chr20 2397921 2397921 Missense_Mutation G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000202625 p.E183K CST1 chr20 23747816 23747816 Nonstop_Mutation C C G TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000304749 p.*142Yext*80 FOXS1 chr20 31845409 31845410 Frame_Shift_Del TA TA - TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000375978 p.Y45Pfs*38 FOXS1 chr20 31845411 31845411 Silent G G A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000375978 p.I44I IFT52 chr20 43624033 43624033 Missense_Mutation A A T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000373030 p.H304L WFDC10B chr20 45685981 45685981 Silent C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000330523 p.Q4Q MIR1-1 chr20 62553466 62553466 5'Flank C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000362147 IGHV1OR21-1 chr21 10649701 10649701 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000622028 p.Q18K TIAM1 chr21 31251844 31251844 Missense_Mutation C C G TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000286827 p.A437P TXNRD2 chr22 19883359 19883359 Missense_Mutation A A G TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000400521 p.V351A AC245028.1 chr22 22857007 22857007 3'Flank C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000385097 C22orf42 chr22 32154293 32154293 Nonsense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000382097 p.W86* TRIOBP chr22 37724685 37724685 Missense_Mutation C C T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000406386 p.S710F ADSL chr22 40363057 40363057 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000623063 p.V363F STS chrX 7334066 7334066 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000217961 p.C446F FAM47A chrX 34131608 34131608 Missense_Mutation C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000346193 p.R224L SSX6 chrX 48113194 48113194 Splice_Region T T C TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000412590 SPANXN5 chrX 52797298 52797298 Silent A A G TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000375511 p.C17C LONRF3 chrX 119017547 119017547 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000371628 p.G713C LONRF3 chrX 119017548 119017548 Missense_Mutation G G T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000371628 p.G713V TFDP3 chrX 133217862 133217862 Missense_Mutation A A C TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000310125 p.V133G ZIC3 chrX 137570044 137570044 Missense_Mutation C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000287538 p.P460T MAMLD1 chrX 150470282 150470282 Nonsense_Mutation A A T TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000262858 p.K237* PNMA6A chrX 153076390 153076390 3'Flank C C A TCGA-P6-A5OG-01A-22D-A29I-10 ENST00000421798 KIF17 chr1 20687475 20687475 Silent G G A TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000247986 p.A617A BPNT1 chr1 220062888 220062909 Frame_Shift_Del GAAACCCAAAGGCGCCTAAACC GAAACCCAAAGGCGCCTAAACC - TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000322067 p.G174Sfs*2 BPNT1 chr1 220062888 220062888 Missense_Mutation G G C TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000322067 p.Q181E BPNT1 chr1 220062910 220062910 Silent T T C TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000322067 p.L173L SOX11 chr2 5701359 5701359 3'UTR C C G TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000322002 RAB6C chr2 129982140 129982140 3'UTR T T - TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000410061 PGAP1 chr2 196842724 196842724 Nonsense_Mutation G G C TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000354764 p.S876* FZD7 chr2 202037663 202037663 3'UTR A A - TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000286201 TKTL2 chr4 163473327 163473327 Missense_Mutation C C T TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000280605 p.M136I TRIP13 chr5 911923 911923 Missense_Mutation A A G TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000166345 p.K316R NLN chr5 65810134 65810134 Missense_Mutation C C G TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000380985 p.C604W RAD17 chr5 69389141 69389141 Silent A A T TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000380774 p.S345S CMYA5 chr5 79733557 79733557 Missense_Mutation G G A TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000446378 p.V1598I SLC35B3 chr6 8417464 8417464 Missense_Mutation A A G TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000379660 p.Y271H CCAR2 chr8 22617717 22617717 Missense_Mutation C C T TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000308511 p.S671L STMN2 chr8 79641425 79641425 Missense_Mutation G G C TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000220876 p.E55Q BNC2 chr9 16418995 16418995 Silent T T A TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000380672 p.V1098V KIAA0368 chr9 111366289 111366289 Missense_Mutation G G T TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000338205 p.A1753D RPP38 chr10 15103498 15103498 Missense_Mutation G G T TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000378197 p.D62Y KLHL42 chr12 27797867 27797867 Missense_Mutation C C T TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000381271 p.R407C LARP4 chr12 50428959 50428959 Missense_Mutation T T C TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000398473 p.I64T MARS chr12 57514812 57514812 Missense_Mutation T T G TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000262027 p.L687R NCOR2 chr12 124420003 124420003 Missense_Mutation T T C TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000405201 p.Y479C OLFM4 chr13 53028905 53028905 Silent G G A TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000219022 p.G23G MAPK7 chr17 19378898 19378898 Splice_Region A A T TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000308406 NF1 chr17 31206308 31206308 Silent T T C TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000358273 p.F443F RARA chr17 40352011 40352035 Frame_Shift_Del GTGCGCAAAGCGCACCAGGAAACCT GTGCGCAAAGCGCACCAGGAAACCT - TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000254066 p.V191Sfs*71 SYT4 chr18 43274248 43274248 Missense_Mutation C C T TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000255224 p.D61N MYLK2 chr20 31826609 31826609 Missense_Mutation T T C TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000375985 p.M326T NLGN4X chrX 5903447 5903447 Nonsense_Mutation C C A TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000275857 p.E411* FAM155B chrX 69505383 69505383 Missense_Mutation G C C TCGA-OR-A5JK-01A-11D-A29I-10 ENST00000252338 p.C34S CCDC18 chr1 93180795 93180795 Intron C C T TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000343253 LCE2A chr1 152699393 152699393 3'UTR C C T TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000368779 FCRL2 chr1 157770655 157770655 Frame_Shift_Del G G - TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000361516 p.V23Wfs*14 C2orf71 chr2 29073017 29073017 Silent T T A TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000331664 p.S415S SLC5A7 chr2 108010822 108010822 Silent C C T TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000264047 p.S568S IWS1 chr2 127523741 127523741 Missense_Mutation C C G TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000295321 p.G29R CCDC140 chr2 222304869 222304869 3'UTR C C A TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000295226 PDCD6IP chr3 33836184 33836184 Silent C C T TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000307296 p.D325D CTNNB1 chr3 41224645 41224645 Missense_Mutation T T C TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000349496 p.S45P DNASE1L3 chr3 58210914 58210914 5'UTR C C T TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000394549 GABRB1 chr4 47406819 47406819 Missense_Mutation G G A TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000295454 p.A325T RAD50 chr5 132592030 132592030 Silent T T C TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000378823 p.L597L PCDHB5 chr5 141135987 141135987 Missense_Mutation C C T TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000231134 p.R185C RANBP17 chr5 171221793 171221793 Missense_Mutation A A G TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000523189 p.N792S CALD1 chr7 134960240 134960240 Intron A A G TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000361675 SLC25A16 chr10 68483531 68483531 Silent G G C TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000609923 p.L300L SCGB1A1 chr11 62419069 62419069 5'UTR C C T TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000278282 NTF3 chr12 5494927 5494927 Missense_Mutation G G A TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000331010 p.R238Q VWF chr12 6065238 6065238 Missense_Mutation T T A TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000261405 p.S398C OR4K5 chr14 19920982 19920982 Missense_Mutation A A C TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000315915 p.I126L TTLL5 chr14 75752902 75752902 Silent C C T TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000298832 p.L499L CHD2 chr15 92978331 92978331 Missense_Mutation A A G TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000394196 p.Q892R FLCN chr17 17227952 17227952 Missense_Mutation G G T TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000285071 p.S62R EIF1 chr17 41690807 41690807 Missense_Mutation T T C TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000469257 p.L108P KCNJ16 chr17 70133689 70133689 3'UTR A A T TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000283936 SERPINB12 chr18 63556263 63556263 Missense_Mutation T T C TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000269491 p.L35P SPTBN4 chr19 40557253 40557253 Silent C C T TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000352632 p.F1840F TRIB3 chr20 388009 388009 Splice_Site A A G TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000217233 p.X1_splice SPECC1L chr22 24313396 24313396 Missense_Mutation C C G TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000314328 p.C79W SERPINA7 chrX 106033584 106033584 Missense_Mutation A A T TCGA-OR-A5L3-01A-11D-A29I-10 ENST00000327674 p.D388E CCNL2 chr1 1399211 1399211 Silent C C A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000400809 p.S32S C1orf158 chr1 12755759 12755759 Missense_Mutation C C A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000614859 p.F57L MACF1 chr1 39385516 39385516 Missense_Mutation G G T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000372915 p.G4649V RPRD2 chr1 150470690 150470690 Missense_Mutation G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000369068 p.S581N INTS3 chr1 153748728 153748728 Missense_Mutation G G C TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000318967 p.S186T HAPLN2 chr1 156623565 156623565 Silent A A G TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000255039 p.Q25Q GPA33 chr1 167073402 167073402 Missense_Mutation G G T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000367868 p.L61I TNN chr1 175077537 175077537 Missense_Mutation T T A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000239462 p.V40D ZNF281 chr1 200408888 200408888 Missense_Mutation G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000294740 p.S273F CENPF chr1 214643090 214643090 Silent C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000366955 p.L1584L OBSCN chr1 228375805 228375805 Silent T T C TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000422127 p.I7589I HEATR1 chr1 236559084 236559084 Missense_Mutation C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000366582 p.V1608M OR2L13 chr1 247990894 247990894 Intron C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000366478 CPSF3 chr2 9440545 9440545 Missense_Mutation C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000238112 p.S272L CCDC121 chr2 27627424 27627424 Missense_Mutation C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000324364 p.E126K FAM179A chr2 29051780 29051780 Missense_Mutation G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000379558 p.R916Q SRBD1 chr2 45574657 45574657 Missense_Mutation T T C TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000263736 p.D380G KRCC1 chr2 88028052 88028052 Nonsense_Mutation G G C TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000347055 p.S171* CNNM4 chr2 96809448 96809448 Silent C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000377075 p.D753D PDCL3 chr2 100576430 100576430 Silent C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000264254 p.D218D NR4A2 chr2 156329419 156329419 Silent G G T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000339562 p.S256S TTN chr2 178580394 178580394 Missense_Mutation C C A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000591111 p.A20688S PGAP1 chr2 196841108 196841108 3'UTR C C G TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000354764 SPEG chr2 219489710 219489710 Missense_Mutation A A G TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000312358 p.T2898A ARPP21 chr3 35689318 35689318 Nonsense_Mutation G G T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000187397 p.E140* ALS2CL chr3 46689465 46689465 Splice_Region C C G TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000318962 CCDC14 chr3 123931423 123931423 Silent C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000488653 p.V517V CCDC39 chr3 180654808 180654808 Missense_Mutation G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000442201 p.T295M MCF2L2 chr3 183224184 183224184 Missense_Mutation C C G TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000328913 p.D708H RTP1 chr3 187199831 187199831 Missense_Mutation C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000312295 p.R185W C4orf50 chr4 5959558 5959558 Silent A A T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000324058 p.G216G BLOC1S4 chr4 6716559 6716559 Missense_Mutation G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000320776 p.G117D CORIN chr4 47786767 47786767 Missense_Mutation T T A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000273857 p.T123S TEC chr4 48170274 48170274 Missense_Mutation C C A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000381501 p.C143F FRAS1 chr4 78519390 78519390 Missense_Mutation C C G TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000512123 p.I3483M GK2 chr4 79406782 79406782 Silent G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000358842 p.S473S MMRN1 chr4 89951633 89951633 Silent G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000264790 p.P1049P CFI chr4 109761708 109761708 Intron A A G TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000394634 ZGRF1 chr4 112584007 112584007 Silent T T C TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000445203 p.P1423P GLRB chr4 157153000 157153000 Missense_Mutation G G T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000264428 p.S396I DDX60L chr4 168448739 168448739 Missense_Mutation A A C TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000260184 p.V346G ACSL1 chr4 184764882 184764882 Missense_Mutation C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000281455 p.C468Y IRX4 chr5 1879558 1879558 Nonsense_Mutation C C A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000231357 p.E228* FAM173B chr5 10239068 10239068 Missense_Mutation A A T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000511437 p.I102N MAP3K1 chr5 56859770 56859770 Missense_Mutation C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000399503 p.A230V FBXL21 chr5 135941284 135941284 Silent C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000620812 p.F305F HARS2 chr5 140695746 140695746 Silent C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000230771 p.D178D PCDHGB7 chr5 141418398 141418398 Missense_Mutation T T C TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000398594 p.L180S RP11-1379J22.7 chr5 179651707 179651707 RNA G G T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000418535 BLOC1S5-TXNDC5 chr6 7904647 7904647 Missense_Mutation C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000539054 p.V42I SKIV2L chr6 31961218 31961218 Silent A A G TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000375394 p.G207G XXbac-BPG246D15.9 chr6 32814537 32814537 Silent G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000452392 p.H749H NFYA chr6 41089671 41089671 Missense_Mutation C C G TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000341376 p.I134M CUL9 chr6 43213739 43213739 Missense_Mutation C C G TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000252050 p.P1839A PKHD1 chr6 52025772 52025772 Silent G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000371117 p.N1346N SERINC1 chr6 122451751 122451780 Splice_Site ATTCCTACAAAAAAAAAAAAAAAAAAATAT ATTCCTACAAAAAAAAAAAAAAAAAAATAT - TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000339697 p.X254_splice MED23 chr6 131593128 131593128 Nonsense_Mutation C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000368068 p.W1092* C6orf118 chr6 165293407 165293407 Splice_Region A A C TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000230301 POM121 chr7 72890971 72890971 5'UTR A A G TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000395270 RFC2 chr7 74235601 74235601 Silent G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000055077 p.I295I MOSPD3 chr7 100614979 100614979 Silent T T A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000223054 p.P208P MYOM2 chr8 2092438 2092438 Missense_Mutation C C A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000262113 p.L641M COL22A1 chr8 138780966 138780966 Silent C C A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000303045 p.L537L UHRF2 chr9 6460639 6460639 Missense_Mutation G G C TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000276893 p.L237F UHRF2 chr9 6460721 6460721 Missense_Mutation G G C TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000276893 p.D265H GADD45G chr9 89605478 89605478 Nonsense_Mutation C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000252506 p.Q34* BAAT chr9 101362579 101362579 Missense_Mutation G G T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000259407 p.S369Y OR13C3 chr9 104536656 104536656 Missense_Mutation A A G TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000374781 p.I53T DFNB31 chr9 114423426 114423426 Missense_Mutation G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000362057 p.A505V TRIM32 chr9 116698634 116698634 Missense_Mutation C C G TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000373983 p.P298A USP20 chr9 129875460 129875460 Silent C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000315480 p.T733T ABL1 chr9 130884786 130884786 Silent C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000318560 p.H832H LIPN chr10 88768888 88768888 Missense_Mutation T T C TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000404459 p.I211T IFIT1B chr10 89383879 89383879 Missense_Mutation A A T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000371809 p.D189V CFAP58 chr10 104399413 104399413 Missense_Mutation A A T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000369704 p.E576D TCF7L2 chr10 112951591 112951591 Nonsense_Mutation C C A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000355995 p.S122* KRTAP5-4 chr11 1621043 1621043 3'UTR G G T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000399682 OR56A3 chr11 5947826 5947826 Silent T T C TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000329564 p.T160T CTR9 chr11 10775275 10775275 Missense_Mutation G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000361367 p.R985H MUC15 chr11 26559833 26559833 3'UTR G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000455601 C11orf96 chr11 43943455 43943455 3'Flank C C A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000339446 C11orf96 chr11 43943456 43943456 3'Flank C C A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000339446 RP11-707M1.1 chr11 49807655 49807655 Splice_Region G G C TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000527477 OR5L2 chr11 55827650 55827650 Silent G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000378397 p.L144L TNKS1BP1 chr11 57321898 57321898 5'UTR A A G TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000358252 OR9Q1 chr11 58181334 58181334 3'UTR G G C TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000335397 SHANK2 chr11 70487290 70487290 Silent G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000423696 p.Y622Y ZW10 chr11 113757823 113757823 Missense_Mutation G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000200135 p.P255L USP28 chr11 113809074 113809074 Missense_Mutation G G C TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000003302 p.S718C VSIG2 chr11 124748686 124748686 Nonsense_Mutation G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000326621 p.Q222* SCNN1A chr12 6348732 6348732 Missense_Mutation C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000228916 p.V542I CD163L1 chr12 7369455 7369455 Missense_Mutation C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000313599 p.R1314Q HDAC7 chr12 47795954 47795954 Silent T T G TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000427332 p.T247T KIF5A chr12 57583151 57583151 Missense_Mutation C C G TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000455537 p.P1024R SYCP3 chr12 101728956 101728956 Missense_Mutation G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000266743 p.R228W NOS1 chr12 117288173 117288173 Missense_Mutation G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000317775 p.P343L SRRM4 chr12 119145464 119145464 Silent C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000267260 p.Y285Y GCN1L1 chr12 120151241 120151241 Missense_Mutation C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000300648 p.V1405M CLIP1 chr12 122328361 122328361 Missense_Mutation C C G TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000540338 p.S978T GSX1 chr13 27793795 27793795 Silent C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000302945 p.G214G HOMER2 chr15 82859033 82859033 Missense_Mutation G G C TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000304231 p.Q175E ABCC6 chr16 16208819 16208819 Missense_Mutation C C A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000205557 p.D235Y VPS35 chr16 46671734 46671734 Missense_Mutation G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000299138 p.R499C DNAJA2 chr16 46971536 46971536 Missense_Mutation T T A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000317089 p.N59Y ABCC11 chr16 48227839 48227839 Nonsense_Mutation G G C TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000356608 p.S121* RP11-219A15.2 chr17 16801068 16801068 5'Flank C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000582895 CTD-2303H24.2 chr17 18513329 18513329 RNA C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000425211 NOS2 chr17 27783011 27783011 Missense_Mutation A A T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000313735 p.F188Y ASIC2 chr17 33291434 33291434 Intron G G C TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000359872 AATF chr17 36953121 36953121 Missense_Mutation G G C TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000619387 p.E173D C17orf78 chr17 37377935 37377935 Missense_Mutation G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000615133 p.V39M KRT32 chr17 41462884 41462884 Missense_Mutation C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000225899 p.R388Q TBX21 chr17 47744337 47744337 Missense_Mutation C C G TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000177694 p.A304G WFIKKN2 chr17 50839553 50839553 Missense_Mutation G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000311378 p.V89M TOM1L1 chr17 54915811 54915811 Missense_Mutation G G C TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000575882 p.L223F VMP1 chr17 59841215 59841216 3'Flank - - T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000262291 TBX4 chr17 61483325 61483325 Nonsense_Mutation C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000240335 p.R483* PITPNC1 chr17 67687066 67687066 Intron A A G TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000581322 RBFOX3 chr17 79097710 79097710 Missense_Mutation C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000580155 p.G202R NPLOC4 chr17 81610240 81610240 Silent C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000331134 p.L135L SLC25A52 chr18 31760804 31760804 5'UTR C C A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000269205 LOXHD1 chr18 46538323 46538323 Missense_Mutation T T C TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000300591 p.I199V CD209 chr19 7743185 7743185 Missense_Mutation C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000315599 p.A357T PRR19 chr19 42309884 42309884 Silent C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000341747 p.P100P KLK11 chr19 51024080 51024080 Missense_Mutation A A G TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000594768 p.L175P NLRP4 chr19 55858063 55858063 Nonsense_Mutation G G T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000301295 p.E224* CDS2 chr20 5190168 5190168 Silent C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000460006 p.I424I NOL4L chr20 32527866 32527866 Silent G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000621426 p.V123V WFDC8 chr20 45555769 45555769 Missense_Mutation C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000289953 p.R126K ARFRP1 chr20 63702140 63702140 Silent C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000618838 p.A114A SON chr21 33552513 33552513 Silent G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000356577 p.S1094S FAM207A chr21 44935818 44935818 5'Flank G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000291634 COMT chr22 19968764 19968764 3'UTR C C T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000361682 C22orf31 chr22 29058829 29058829 Missense_Mutation C C G TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000216071 p.Q262H CSF2RB chr22 36937507 36937507 Missense_Mutation C C G TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000403662 p.P567A CACNA1I chr22 39670225 39670225 Missense_Mutation G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000402142 p.R1461H ENTHD1 chr22 39744101 39744101 Silent G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000325157 p.L468L MAGEB4 chrX 30243082 30243082 Missense_Mutation G G A TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000378982 p.G316E FOXP3 chrX 49251222 49251222 3'UTR C C G TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000376207 PIN4 chrX 72197413 72197413 Missense_Mutation C C G TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000373669 p.Q120E SPANXN3 chrX 143517378 143517378 Missense_Mutation G G T TCGA-OR-A5L2-01A-11D-A30A-10 ENST00000370503 p.T5N CNTNAP5 chr2 124763784 124763784 Missense_Mutation C C G TCGA-OR-A5JL-01A-11D-A29I-10 ENST00000431078 p.R782G FSTL5 chr4 161459219 161459219 Missense_Mutation G G A TCGA-OR-A5JL-01A-11D-A29I-10 ENST00000306100 p.T570I WDR27 chr6 169613599 169613599 Missense_Mutation T T C TCGA-OR-A5JL-01A-11D-A29I-10 ENST00000448612 p.I761V LAMB1 chr7 107929275 107929275 Intron T T G TCGA-OR-A5JL-01A-11D-A29I-10 ENST00000222399 GCNT1 chr9 76506708 76506708 3'UTR A A G TCGA-OR-A5JL-01A-11D-A29I-10 ENST00000376730 KCTD19 chr16 67301791 67301791 Missense_Mutation C C A TCGA-OR-A5JL-01A-11D-A29I-10 ENST00000304372 p.G259C TM4SF5 chr17 4782553 4782553 Nonsense_Mutation C C G TCGA-OR-A5JL-01A-11D-A29I-10 ENST00000270560 p.Y103* TP53 chr17 7670705 7670705 Frame_Shift_Del C C - TCGA-OR-A5JL-01A-11D-A29I-10 ENST00000269305 p.R335Lfs*10 PRKAR1A chr17 68515530 68515554 Frame_Shift_Del AGAGACCCATGGCATTCCTCAGGGA AGAGACCCATGGCATTCCTCAGGGA - TCGA-OR-A5JL-01A-11D-A29I-10 ENST00000358598 p.E44Dfs*77 CEP104 chr1 3816294 3816294 Missense_Mutation G G A TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000378230 p.P883L MACF1 chr1 39433147 39433148 Frame_Shift_Ins - - T TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000372915 p.L5750Ifs*13 ANKRD34A chr1 145959575 145959575 3'UTR T T C TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000606888 GTF3C2 chr2 27337327 27337327 Nonsense_Mutation G G C TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000264720 p.Y348* LCLAT1 chr2 30606147 30606147 Intron G G T TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000309052 SLC6A1 chr3 11031176 11031176 Splice_Site G G T TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000287766 p.X442_splice GMPPB chr3 49719623 49719623 3'Flank C C T TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000308388 PRICKLE2 chr3 64147397 64147397 Silent G G A TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000295902 p.L365L RNF4 chr4 2513851 2513854 3'UTR GACA GACA - TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000314289 H2AFZ chr4 99948959 99948959 Intron C C T TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000296417 ALPK1 chr4 112431826 112431826 Frame_Shift_Del G G - TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000177648 p.R760Sfs*41 IMPG1 chr6 75923702 75923702 Missense_Mutation G G C TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000369950 p.P750A ANKIB1 chr7 92345022 92345022 Silent G G A TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000265742 p.V347V TTC26 chr7 139187491 139187491 Missense_Mutation G G C TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000464848 p.G502A MSR1 chr8 16110127 16110127 Silent G G C TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000262101 p.A438A NOV chr8 119416459 119416459 5'UTR G G C TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000259526 GRM5 chr11 88653394 88653394 Missense_Mutation C C G TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000305447 p.W307C CEP128 chr14 80743155 80743155 Missense_Mutation T T C TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000281129 p.K909R SPN chr16 29665058 29665058 3'UTR T T - TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000360121 CNEP1R1 chr16 50035516 50035516 3'UTR G G A TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000427478 ATP6V0A1 chr17 42514381 42514381 Missense_Mutation G G A TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000343619 p.A781T PRKAR1A chr17 68515558 68515559 Frame_Shift_Ins - - T TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000358598 p.E55* RFX1 chr19 13978024 13978024 Missense_Mutation C C G TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000254325 p.E299D MYO9B chr19 17212008 17212009 Frame_Shift_Ins - - C TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000594824 p.R2060Pfs*140 MIR512-2 chr19 53669200 53669200 RNA G G T TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000384912 CLDN5 chr22 19523904 19523904 Missense_Mutation C C G TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000618236 p.A118P IGLC2 chr22 22901115 22901115 Frame_Shift_Del C C - TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000390323 p.V49Sfs*24 IGLC3 chr22 22906481 22906481 Frame_Shift_Del C C - TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000390325 p.V49Sfs*24 ATRX chrX 77683830 77683830 Nonsense_Mutation G G A TCGA-OR-A5KT-01A-11D-A29I-10 ENST00000373344 p.Q476* ADGRL2 chr1 81952992 81952992 Silent A A G TCGA-OR-A5K1-01A-11D-A29I-10 ENST00000370717 p.Q596Q GTF2A1L chr2 48617833 48617833 5'Flank G A A TCGA-OR-A5K1-01A-11D-A29I-10 ENST00000403751 GABRA1 chr5 161850842 161850842 Missense_Mutation T T A TCGA-OR-A5K1-01A-11D-A29I-10 ENST00000023897 p.L11H ZFP62 chr5 180848938 180848938 Missense_Mutation A A T TCGA-OR-A5K1-01A-11D-A29I-10 ENST00000502412 p.S853T TRPA1 chr8 72055533 72055533 Missense_Mutation C C T TCGA-OR-A5K1-01A-11D-A29I-10 ENST00000262209 p.G478S CYP11B1 chr8 142875776 142875776 Missense_Mutation C C T TCGA-OR-A5K1-01A-11D-A29I-10 ENST00000292427 p.E353K GADD45G chr9 89605754 89605754 Frame_Shift_Del C C - TCGA-OR-A5K1-01A-11D-A29I-10 ENST00000252506 p.Q82Rfs*11 ENO2 chr12 6915878 6915878 Missense_Mutation G G A TCGA-OR-A5K1-01A-11D-A29I-10 ENST00000229277 p.G16R MGST1 chr12 16363996 16363999 Frame_Shift_Del TCTT TCTT - TCGA-OR-A5K1-01A-11D-A29I-10 ENST00000010404 p.L142Pfs*7 PRKAG1 chr12 49018833 49018833 5'UTR C C G TCGA-OR-A5K1-01A-11D-A29I-10 ENST00000548065 GPHN chr14 67111914 67111914 Silent T C C TCGA-OR-A5K1-01A-11D-A29I-10 ENST00000315266 p.D456D CCP110 chr16 19536479 19536479 Frame_Shift_Del G G - TCGA-OR-A5K1-01A-11D-A29I-10 ENST00000381396 p.A271Lfs*4 BCO1 chr16 81262315 81262315 Intron C C T TCGA-OR-A5K1-01A-11D-A29I-10 ENST00000258168 PRDM15 chr21 41834536 41834536 Intron C C A TCGA-OR-A5K1-01A-11D-A29I-10 ENST00000269844 KRTAP10-5 chr21 44580187 44580187 Missense_Mutation C C T TCGA-OR-A5K1-01A-11D-A29I-10 ENST00000400372 p.C131Y USP26 chrX 133025733 133025733 Missense_Mutation C G G TCGA-OR-A5K1-01A-11D-A29I-10 ENST00000370832 p.V830L NHLH2 chr1 115840334 115840334 5'UTR G G A TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000320238 ITLN2 chr1 160952655 160952655 Missense_Mutation C C A TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000368029 p.C53F KCTD3 chr1 215608123 215608123 Silent C C A TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000259154 p.S472S ADD2 chr2 70706402 70706402 Missense_Mutation C C T TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000264436 p.E3K LYG2 chr2 99244032 99244032 Missense_Mutation A A G TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000333017 p.F163L NFE2L2 chr2 177232373 177232374 Intron - - A TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000397062 BZW1 chr2 200823259 200823259 3'UTR T T C TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000409600 RBMS3 chr3 29988221 29988221 Missense_Mutation G G A TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000383767 p.E393K CTNNB1 chr3 41224612 41224612 Missense_Mutation G G C TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000349496 p.G34R ADCY5 chr3 123291228 123291228 Missense_Mutation G G A TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000462833 p.A1071V RNF212 chr4 1113435 1113435 Silent G G A TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000433731 p.C10C C1QTNF7 chr4 15442592 15442592 Silent C C T TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000429690 p.F221F GK2 chr4 79407831 79407831 Missense_Mutation C C T TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000358842 p.E124K UNC5C chr4 95242530 95242530 Missense_Mutation C C T TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000453304 p.R336H FAT4 chr4 125446359 125446359 Silent C C T TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000394329 p.S2420S TLR2 chr4 153703191 153703191 Missense_Mutation C C G TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000260010 p.S95C MYO10 chr5 16701392 16701392 Silent G G A TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000513610 p.D1001D SLC1A3 chr5 36671131 36671131 Missense_Mutation T T C TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000265113 p.I141T SNX18 chr5 54519295 54519295 Missense_Mutation C C T TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000326277 p.T448M PPAP2A chr5 55534683 55534683 5'UTR G G A TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000307259 SV2C chr5 76298792 76298792 Splice_Site A A G TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000502798 p.X501_splice HMGN4 chr6 26545968 26545968 3'UTR G G A TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000377575 ZNF391 chr6 27400667 27400667 Silent C C T TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000244576 p.H99H HSPA1A chr6 31817884 31817884 3'UTR C C A TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000375651 COL21A1 chr6 56059162 56059162 Splice_Region C C A TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000244728 SEC63 chr6 107872848 107872848 Nonsense_Mutation G G T TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000369002 p.S700* PEX7 chr6 136872221 136872221 Silent G G A TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000318471 p.V257V DNAH11 chr7 21636025 21636025 Missense_Mutation G G T TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000409508 p.C1552F CADPS2 chr7 122886171 122886171 Frame_Shift_Del G G - TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000449022 p.S56Lfs*2 TRPA1 chr8 72069113 72069113 Silent G G T TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000262209 p.L118L PTPRD chr9 8376721 8376721 Missense_Mutation C C A TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000356435 p.K1464N FAM25G chr10 47491628 47491628 Missense_Mutation C C A TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000452267 p.R16L FAM178A chr10 100917097 100917097 Frame_Shift_Del T T - TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000238961 p.L238Cfs*3 GLB1L2 chr11 134371015 134371015 Missense_Mutation A A G TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000339772 p.K408R C12orf49 chr12 116723168 116723168 Missense_Mutation G G A TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000261318 p.P56L GCN1L1 chr12 120178897 120178897 Silent G G A TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000300648 p.H160H RB1 chr13 48360058 48360058 Nonsense_Mutation C C T TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000267163 p.Q217* OTX2 chr14 56802256 56802256 Missense_Mutation G G C TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000408990 p.P117A DICER1 chr14 95105083 95105083 Frame_Shift_Del G G - TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000343455 p.P1086Lfs*9 GP2 chr16 20324252 20324252 Silent A A G TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000381362 p.Y33Y RBBP6 chr16 24569549 24569549 Missense_Mutation A A C TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000319715 p.L953F MARVELD3 chr16 71640898 71640898 3'Flank G G A TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000268485 TOP2A chr17 40404833 40404833 Silent G G A TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000423485 p.F668F GOSR2 chr17 46935028 46935028 Splice_Site G G A TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000393456 p.X113_splice C1QTNF1 chr17 79047797 79047797 Silent C T T TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000339142 p.F185F ROCK1 chr18 21049170 21049170 Missense_Mutation C C T TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000399799 p.M112I ZNF558 chr19 8811727 8811727 Missense_Mutation T T C TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000301475 p.K255E SLC35C2 chr20 46350485 46350492 Frame_Shift_Del CTGGAGCC - - TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000243896 p.G334Pfs*16 PNMA6A chrX 153074988 153074988 3'UTR T T C TCGA-OR-A5JS-01A-11D-A29I-10 ENST00000421798 STXBP3 chr1 108746704 108746704 5'UTR A A G TCGA-OR-A5LN-01A-11D-A29I-10 ENST00000370008 SLCO6A1 chr5 102480340 102480340 Silent G G A TCGA-OR-A5LN-01A-11D-A29I-10 ENST00000379807 p.Y151Y FRMD1 chr6 168079119 168079119 5'UTR G G A TCGA-OR-A5LN-01A-11D-A29I-10 ENST00000283309 KCNK9 chr8 139702901 139702901 Missense_Mutation G G C TCGA-OR-A5LN-01A-11D-A29I-10 ENST00000303015 p.S31W SPATA31E1 chr9 87884949 87884949 Missense_Mutation C C A TCGA-OR-A5LN-01A-11D-A29I-10 ENST00000325643 p.H154Q ASAH2 chr10 50214801 50214801 Missense_Mutation C C T TCGA-OR-A5LN-01A-11D-A29I-10 ENST00000395526 p.R361H OR52M1 chr11 4545936 4545936 Missense_Mutation G G C TCGA-OR-A5LN-01A-11D-A29I-10 ENST00000360213 p.C249S ZNF385A chr12 54384518 54384518 Silent C C T TCGA-OR-A5LN-01A-11D-A29I-10 ENST00000338010 p.P19P STON2 chr14 81270858 81270858 Missense_Mutation G G T TCGA-OR-A5LN-01A-11D-A29I-10 ENST00000267540 p.H809N KCNK10 chr14 88185785 88185785 Missense_Mutation C C T TCGA-OR-A5LN-01A-11D-A29I-10 ENST00000340700 p.R456K STX4 chr16 31033803 31033803 5'UTR G G - TCGA-OR-A5LN-01A-11D-A29I-10 ENST00000313843 AC092071.1 chr19 40941542 40941542 5'Flank G G A TCGA-OR-A5LN-01A-11D-A29I-10 ENST00000597260 SIGLEC5 chr19 51629409 51629409 Missense_Mutation G G A TCGA-OR-A5LN-01A-11D-A29I-10 ENST00000534261 p.R217C DCAF8L1 chrX 27981103 27981103 Missense_Mutation C C G TCGA-OR-A5LN-01A-11D-A29I-10 ENST00000441525 p.D78H HDAC6 chrX 48815065 48815065 Intron C C T TCGA-OR-A5LN-01A-11D-A29I-10 ENST00000334136 ZP4 chr1 237885568 237885568 Missense_Mutation C C T TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000366570 p.G328D ROBO2 chr3 77477516 77477516 Missense_Mutation C C G TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000461745 p.T164S SPICE1 chr3 113468870 113468870 Missense_Mutation T T C TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000295872 p.R261G SI chr3 164991371 164991371 Missense_Mutation G G C TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000264382 p.A1697G KLHL6 chr3 183508062 183508062 Missense_Mutation A A T TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000341319 p.N302K MUC4 chr3 195783962 195783962 Missense_Mutation G G A TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000463781 p.R2540C HSP90AB2P chr4 13336987 13336987 RNA C C T TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000507090 PDCL2 chr4 55592176 55592176 5'UTR C C G TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000295645 TECRL chr4 64280156 64280156 Missense_Mutation C C A TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000381210 p.W336C FHDC1 chr4 152967998 152967998 Silent G G A TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000260008 p.T373T ANKRD55 chr5 56100158 56100158 3'UTR C C G TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000341048 TMEM232 chr5 110513899 110513899 Intron G G C TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000455884 SPINK5 chr5 148101366 148101366 Missense_Mutation A A G TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000256084 p.E411G PKHD1 chr6 51830977 51830977 Missense_Mutation G G C TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000371117 p.A2729G GRID2IP chr7 6551324 6551324 Missense_Mutation G G A TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000457091 p.A38V BBS9 chr7 33349102 33349102 Missense_Mutation C C A TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000242067 p.A455D ZNF425 chr7 149126259 149126259 5'UTR G G A TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000378061 PPP1R3C chr10 91633045 91633045 5'UTR C C - TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000238994 AC215219.2 chr12 17513 17513 RNA A A C TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000611710 HNRNPA1 chr12 54283174 54283174 Missense_Mutation G G A TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000340913 p.G283R HAGH chr16 1822356 1822356 Missense_Mutation G G T TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000397356 p.D86E DNAH3 chr16 21031240 21031240 Silent G G C TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000261383 p.P1748P FHOD1 chr16 67234215 67234215 Silent G G C TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000258201 p.P496P CD300LG chr17 43852997 43852997 Silent C C T TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000317310 p.T155T POLRMT chr19 629898 629898 Missense_Mutation G G A TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000588649 p.A155V MUC16 chr19 8957463 8957463 Missense_Mutation C C A TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000397910 p.G6436V CTD-2027I19.2 chr19 24162411 24162411 RNA C C A TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000598671 KIF16B chr20 16273256 16273256 Silent C C T TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000354981 p.G1317G APCDD1L chr20 58461436 58461436 Missense_Mutation G G A TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000371149 p.S287L CABLES2 chr20 62391339 62391339 Missense_Mutation C C A TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000279101 p.Q402H DIDO1 chr20 62905935 62905935 Missense_Mutation C C G TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000266070 p.V514L TMPRSS2 chr21 41466081 41466081 3'UTR G G A TCGA-OR-A5JV-01A-11D-A29I-10 ENST00000332149 KCNQ4 chr1 40831084 40831084 Missense_Mutation C C G TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000347132 p.S431R ATP5F1 chr1 111456691 111456691 Missense_Mutation T T C TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000369722 p.I150T TRIM33 chr1 114405519 114405519 Nonsense_Mutation C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000358465 p.E887* PHGDH chr1 119712021 119712021 5'UTR C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000369409 NBPF15 chr1 144439952 144439952 Missense_Mutation G G T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000488031 p.L18I HHIPL2 chr1 222540263 222540263 Silent C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000343410 p.S399S OBSCN chr1 228317488 228317488 Missense_Mutation C C G TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000422127 p.A4529G OR2T4 chr1 248362078 248362078 Silent C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000366475 p.V166V ALK chr2 29531965 29531965 Silent G G A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000389048 p.H368H ALMS1P chr2 73673916 73673916 RNA A A G TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000450720 AMER3 chr2 130762281 130762281 Missense_Mutation C C T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000321420 p.A70V ANKRD30BL chr2 132161594 132161594 Missense_Mutation C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000409867 p.D38Y PABPC1P2 chr2 146588843 146588843 RNA C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000471997 KCNH7 chr2 162836751 162836751 Missense_Mutation A A C TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000332142 p.I31M HECW2 chr2 196257868 196257868 Missense_Mutation C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000260983 p.G1125V SF3B1 chr2 197416857 197416857 Missense_Mutation C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000335508 p.V184F ADAM23 chr2 206589415 206589415 Missense_Mutation C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000264377 p.A620E SMARCAL1 chr2 216468038 216468038 Nonsense_Mutation G G T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000357276 p.E746* TTLL4 chr2 218753216 218753216 Intron T T G TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000258398 BTD chr3 15642045 15642045 Missense_Mutation C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000303498 p.F149L DLEC1 chr3 38063896 38063896 Missense_Mutation T T C TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000308059 p.Y384H RUVBL1 chr3 128123653 128123653 Silent C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000322623 p.L24L HLTF chr3 149046159 149046159 Missense_Mutation T T A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000310053 p.I665F CLCN2 chr3 184358017 184358017 Missense_Mutation G G T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000265593 p.A187D CLDN1 chr3 190321988 190321988 Silent C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000295522 p.L73L FGFBP2 chr4 15962704 15962704 Missense_Mutation C A A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000259989 p.Q142H NUDT9 chr4 87451725 87451725 Missense_Mutation A A T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000302174 p.D260V GSTCD chr4 105825798 105825798 Nonsense_Mutation G G T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000360505 p.G510* ENPEP chr4 110549535 110549535 Missense_Mutation C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000265162 p.R745S MARCH1 chr4 164197066 164197066 Intron C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000503008 SPEF2 chr5 35644525 35644525 Missense_Mutation G G T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000356031 p.K195N ZSWIM6 chr5 61535522 61535522 Missense_Mutation G G C TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000252744 p.E762Q SLCO6A1 chr5 102419968 102419968 Missense_Mutation C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000379807 p.V444F KCTD16 chr5 144206950 144206950 Missense_Mutation G G T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000507359 p.G79V KIAA0319 chr6 24580956 24580956 Nonsense_Mutation C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000378214 p.E417* TTBK1 chr6 43262929 43262929 Missense_Mutation C C T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000259750 p.A522V TULP4 chr6 158479778 158479778 Missense_Mutation C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000367097 p.H352N GPNMB chr7 23256968 23256968 Silent C C T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000381990 p.T148T ZNF277 chr7 112342576 112342576 Silent C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000361822 p.T400T EXOC4 chr7 134007734 134007734 Silent C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000253861 p.I862I OR2A14 chr7 144129154 144129154 Silent G G A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000408899 p.P14P COL22A1 chr8 138596947 138596947 Silent G G T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000303045 p.T1463T IFNA1 chr9 21440923 21440923 Missense_Mutation C C G TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000276927 p.S139C PGM5 chr9 68529674 68529674 3'UTR C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000396396 WNK2 chr9 93263626 93263626 Silent T T C TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000297954 p.F1157F GLT6D1 chr9 135626130 135626130 Missense_Mutation G G T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000371763 p.L66M FAM157B chr9 138219312 138219312 Intron C C T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000446912 NRAP chr10 113604731 113604731 Missense_Mutation C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000359988 p.A1369S JAKMIP3 chr10 132117430 132117430 Silent C C T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000298622 p.G163G TUB chr11 8101503 8101503 Missense_Mutation C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000299506 p.Q469K OR1S2 chr11 58203264 58203264 Missense_Mutation C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000302592 p.R306S DHCR7 chr11 71438904 71438904 Missense_Mutation G G A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000355527 p.A269V FAT3 chr11 92799803 92799803 Missense_Mutation C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000525166 p.L2114I C11orf88 chr11 111513511 111513511 5'Flank A A T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000375618 PRKAG1 chr12 49002800 49002800 3'UTR G G T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000548065 KDM2B chr12 121444507 121444507 Missense_Mutation G G C TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000377071 p.D711E TMEM132D chr12 129073920 129073920 Nonsense_Mutation G G T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000422113 p.C1085* SSTR1 chr14 38210035 38210035 Missense_Mutation G G A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000267377 p.A216T FOXN3 chr14 89350791 89350791 Silent C C G TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000261302 p.S187S CCDC88C chr14 91273160 91273160 Missense_Mutation G G A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000389857 p.P1851L BEGAIN chr14 100545029 100545029 Nonsense_Mutation G G A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000355173 p.Q72* RYR3 chr15 33670528 33670528 Missense_Mutation G G T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000389232 p.Q1944H SLC30A4 chr15 45522081 45522081 Missense_Mutation C C G TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000261867 p.V92L DMXL2 chr15 51463450 51463450 Missense_Mutation G G A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000251076 p.L2618F CHD2 chr15 92979147 92979147 Missense_Mutation C C T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000394196 p.R914C SNN chr16 11676997 11676997 3'UTR C C T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000329565 DNAH3 chr16 20963601 20963601 Missense_Mutation G G T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000261383 p.A3428D CHD9 chr16 53292947 53292947 Missense_Mutation A A G TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000398510 p.Q1802R TANGO6 chr16 68974072 68974072 Missense_Mutation G G T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000261778 p.D916Y CMC2 chr16 80981852 80981852 Missense_Mutation T T C TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000219400 p.Y36C SPNS2 chr17 4533119 4533119 Missense_Mutation G G T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000329078 p.A360S TP53 chr17 7675994 7675994 Splice_Region C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000269305 p.T125T CFAP52 chr17 9638690 9638690 Silent C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000352665 p.I518I NF1 chr17 31233097 31233097 Nonsense_Mutation G G T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000358273 p.E1198* KRT17 chr17 41624307 41624307 Missense_Mutation C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000311208 p.G68V APPBP2 chr17 60447647 60447647 Silent G G A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000083182 p.P564P EVPL chr17 76007658 76007658 Missense_Mutation C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000301607 p.M1849I ST6GALNAC2 chr17 76563223 76563223 3'Flank G G T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000225276 GREB1L chr18 21473057 21473057 Nonsense_Mutation G G T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000424526 p.E737* ZNF236 chr18 76925446 76925446 Missense_Mutation G G C TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000253159 p.D1305H FUT3 chr19 5844066 5844066 Missense_Mutation C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000303225 p.E258D HSPBP1 chr19 55274407 55274407 Missense_Mutation C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000255631 p.A211S ISOC2 chr19 55453196 55453196 3'UTR G G C TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000425675 LAMA5 chr20 62325544 62325544 Splice_Region C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000252999 p.G1767G MAP7D2 chrX 20025953 20025953 Splice_Site C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000379651 p.X295_splice CFAP47 chrX 35975758 35975758 Missense_Mutation C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000297866 p.S853Y DYNLT3 chrX 37840526 37840526 3'UTR C C A TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000378578 NUDT10 chrX 51336306 51336306 3'UTR G G T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000356450 CXorf67 chrX 51407220 51407220 Silent C C T TCGA-OR-A5J8-01A-11D-A29I-10 ENST00000342995 p.S68S DMAP1 chr1 44218429 44218429 Missense_Mutation T G G TCGA-OR-A5KS-01A-11D-A30A-10 ENST00000315913 p.F171C SPATA1 chr1 84526100 84526100 RNA G G - TCGA-OR-A5KS-01A-11D-A30A-10 ENST00000370638 GBP2 chr1 89121223 89121229 Frame_Shift_Del TCCAGAT TCCAGAT - TCGA-OR-A5KS-01A-11D-A30A-10 ENST00000370466 p.I78Cfs*14 CACNA1E chr1 181758026 181758026 Missense_Mutation G A A TCGA-OR-A5KS-01A-11D-A30A-10 ENST00000367573 p.R1470H NLRP3 chr1 247424228 247424228 Missense_Mutation G G A TCGA-OR-A5KS-01A-11D-A30A-10 ENST00000336119 p.R262Q CLK1 chr2 200861826 200861826 Missense_Mutation C C T TCGA-OR-A5KS-01A-11D-A30A-10 ENST00000321356 p.D13N IL5RA chr3 3090176 3090176 Intron C G G TCGA-OR-A5KS-01A-11D-A30A-10 ENST00000256452 TGFBR2 chr3 30672025 30672025 Missense_Mutation A A G TCGA-OR-A5KS-01A-11D-A30A-10 ENST00000295754 p.Y281C NUDT9 chr4 87457926 87457926 Missense_Mutation C C G TCGA-OR-A5KS-01A-11D-A30A-10 ENST00000302174 p.L320V IRF2 chr4 184418187 184418187 Missense_Mutation C C T TCGA-OR-A5KS-01A-11D-A30A-10 ENST00000393593 p.D131N LRRC14B chr5 194726 194726 Silent G G A TCGA-OR-A5KS-01A-11D-A30A-10 ENST00000328278 p.L306L NIPAL4 chr5 157472400 157472400 Missense_Mutation T T C TCGA-OR-A5KS-01A-11D-A30A-10 ENST00000311946 p.Y281H HEBP2 chr6 138405210 138405210 Missense_Mutation G G A TCGA-OR-A5KS-01A-11D-A30A-10 ENST00000607197 p.M56I FAM185A chr7 102749182 102749186 5'Flank CTGAG CTGAG - TCGA-OR-A5KS-01A-11D-A30A-10 ENST00000413034 KCNQ3 chr8 132132226 132132226 Missense_Mutation A A T TCGA-OR-A5KS-01A-11D-A30A-10 ENST00000388996 p.I613N SPTAN1 chr9 128630189 128630189 Intron G G T TCGA-OR-A5KS-01A-11D-A30A-10 ENST00000372731 OR5M11 chr11 56542785 56542785 Missense_Mutation T T C TCGA-OR-A5KS-01A-11D-A30A-10 ENST00000528616 p.Q158R RERG chr12 15109119 15109119 Silent G G A TCGA-OR-A5KS-01A-11D-A30A-10 ENST00000256953 p.I197I NFE2 chr12 54292840 54292840 Missense_Mutation C C T TCGA-OR-A5KS-01A-11D-A30A-10 ENST00000312156 p.R219Q TMEM132C chr12 128415481 128415481 Missense_Mutation G G A TCGA-OR-A5KS-01A-11D-A30A-10 ENST00000435159 p.D279N ST8SIA5 chr18 46680342 46680342 Silent G G A TCGA-OR-A5KS-01A-11D-A30A-10 ENST00000315087 p.F277F NDUFS7 chr19 1395489 1395491 3'UTR CGC CGC - TCGA-OR-A5KS-01A-11D-A30A-10 ENST00000233627 AP1M1 chr19 16228170 16228170 Missense_Mutation G G A TCGA-OR-A5KS-01A-11D-A30A-10 ENST00000291439 p.E284K HHIPL2 chr1 222547868 222547868 Missense_Mutation C A A TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000343410 p.E59D GALNT2 chr1 230279475 230279475 3'UTR C G G TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000366672 LRRN1 chr3 3845891 3845891 Missense_Mutation A T T TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000319331 p.D417V MUC4 chr3 195790874 195790874 Missense_Mutation A C C TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000463781 p.S236A CMYA5 chr5 79733578 79733578 Missense_Mutation G G C TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000446378 p.D1605H ATP10B chr5 160622534 160622534 Missense_Mutation C C A TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000327245 p.A558S DAXX chr6 33320847 33320847 Nonsense_Mutation G A A TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000266000 p.Q310* FUT9 chr6 96210487 96210487 3'UTR C T T TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000302103 CDK19 chr6 110632159 110632159 Missense_Mutation C G G TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000368911 p.D173H LAMA4 chr6 112134601 112134601 Silent G T T TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000230538 p.I1141I GTF2I chr7 74705172 74705172 Missense_Mutation G G C TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000573035 p.V199L CUX1 chr7 102178509 102178509 Missense_Mutation T T C TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000292535 p.V290A PAX4 chr7 127611035 127611035 3'UTR C C G TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000341640 RP1 chr8 54627796 54627796 Missense_Mutation T T C TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000220676 p.L1305P SMARCA2 chr9 2077741 2077741 Missense_Mutation G G T TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000349721 p.A717S FAM69B chr9 136722322 136722322 Intron G G T TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000371692 CTSC chr11 88293955 88293955 3'UTR A C C TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000227266 UPK2 chr11 118958267 118958267 3'UTR A G G TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000264031 ATF7IP chr12 14457257 14457257 Missense_Mutation A A C TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000261168 p.E707A GOLGA6L6 chr15 20534878 20534878 Missense_Mutation T T A TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000619213 p.E519V SETD1A chr16 30965624 30965624 Silent C C T TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000262519 p.D581D BCAR1 chr16 75235698 75235698 Missense_Mutation C C G TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000162330 p.D401H MINK1 chr17 4895165 4895165 Missense_Mutation G A A TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000355280 p.R1003Q CRHR1 chr17 45830515 45830515 Silent G A A TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000398285 p.V247V PGS1 chr17 78398265 78398265 Missense_Mutation A G G TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000262764 p.E142G MUC16 chr19 8949780 8949780 Missense_Mutation G G T TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000397910 p.T8997K OR10H1 chr19 15807727 15807727 Missense_Mutation G G A TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000334920 p.S104F ZNF233 chr19 44273705 44273705 Missense_Mutation C C T TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000391958 p.R349W NR1H2 chr19 50378601 50378607 Frame_Shift_Del TGTGGGG TGTGGGG - TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000253727 p.V185Rfs*33 NR1H2 chr19 50378608 50378608 Missense_Mutation C C A TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000253727 p.P187T NR1H2 chr19 50378609 50378609 Missense_Mutation C C A TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000253727 p.P187Q CDR1 chrX 140783601 140783601 Missense_Mutation T C C TCGA-OR-A5K8-01A-11D-A29I-10 ENST00000370532 p.T256A ATP1A2 chr1 160135530 160135530 Missense_Mutation G G A TCGA-OR-A5KQ-01A-11D-A30A-10 ENST00000361216 p.V738I ECEL1 chr2 232482460 232482460 Missense_Mutation G G A TCGA-OR-A5KQ-01A-11D-A30A-10 ENST00000304546 p.A585V MTHFD1L chr6 150972003 150972003 Silent T T C TCGA-OR-A5KQ-01A-11D-A30A-10 ENST00000367321 p.S690S SLC26A3 chr7 107767845 107767845 Missense_Mutation A A C TCGA-OR-A5KQ-01A-11D-A30A-10 ENST00000340010 p.F709C ZNF705A chr12 8177245 8177245 Missense_Mutation C C T TCGA-OR-A5KQ-01A-11D-A30A-10 ENST00000359286 p.R189W KLRC2 chr12 10432165 10432165 Silent C C T TCGA-OR-A5KQ-01A-11D-A30A-10 ENST00000381902 p.V175V ARHGAP11A chr15 32629697 32629697 Missense_Mutation A A G TCGA-OR-A5KQ-01A-11D-A30A-10 ENST00000361627 p.K347R OMG chr17 31295380 31295380 Missense_Mutation G G C TCGA-OR-A5KQ-01A-11D-A30A-10 ENST00000247271 p.L318V CCDC120 chrX 49064394 49064394 Missense_Mutation C C T TCGA-OR-A5KQ-01A-11D-A30A-10 ENST00000496529 p.R117C MECP2 chrX 154030423 154030423 Missense_Mutation G G A TCGA-OR-A5KQ-01A-11D-A30A-10 ENST00000303391 p.P469S ECE1 chr1 21272758 21272759 Frame_Shift_Ins - - GT TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000374893 p.R145Hfs*28 C1orf87 chr1 60033590 60033590 Missense_Mutation C C A TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000371201 p.L305F LRRC7 chr1 70028274 70028274 Missense_Mutation G G A TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000035383 p.R595H COL11A1 chr1 103021729 103021729 Missense_Mutation C C G TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000370096 p.G429A RPRD2 chr1 150472264 150472264 Missense_Mutation G G A TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000369068 p.V1106I SLC26A9 chr1 205914794 205914802 3'UTR CTGGGTGTG CTGGGTGTG - TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000367135 DNAH14 chr1 225340605 225340605 Missense_Mutation G G C TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000445597 p.D2632H LIN9 chr1 226309221 226309221 5'UTR C C G TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000328205 TMEM214 chr2 27034182 27034182 Silent G G A TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000238788 p.K89K ASPRV1 chr2 69960995 69960995 Missense_Mutation C C T TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000320256 p.D232N DPP10 chr2 115689891 115689891 Silent C C T TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000410059 p.Y182Y LCT chr2 135833147 135833147 Missense_Mutation C C G TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000264162 p.E228D DOCK10 chr2 224852423 224852424 Frame_Shift_Del CA CA - TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000258390 p.C699Hfs*2 CCR3 chr3 46265429 46265429 Missense_Mutation A A C TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000357422 p.I91L STX19 chr3 94014737 94014737 Missense_Mutation G G C TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000315099 p.S178C SEC22A chr3 123271587 123271587 Missense_Mutation C C G TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000309934 p.I263M IL1RAP chr3 190629528 190629528 Intron C C A TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000072516 ZDHHC19 chr3 196198563 196198563 Intron G G A TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000296326 NSUN7 chr4 40808407 40808409 In_Frame_Del AGA AGA - TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000381782 p.K547del ENPEP chr4 110488629 110488629 Missense_Mutation A A G TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000265162 p.I245V TDO2 chr4 155908998 155908998 Missense_Mutation G G C TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000536354 p.D139H PDLIM4 chr5 132272160 132272160 Silent G G A TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000253754 p.A308A RAD50 chr5 132604954 132604955 Frame_Shift_Del TG TG - TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000378823 p.V892Gfs*5 RBM27 chr5 146251875 146251875 Missense_Mutation G G C TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000265271 p.D482H F13A1 chr6 6174771 6174771 Missense_Mutation A A G TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000264870 p.V519A RPP21 chr6 30345289 30345289 Intron C C A TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000433076 NOTCH4 chr6 32198498 32198498 Missense_Mutation G G A TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000375023 p.A1560V FBXO9 chr6 53095520 53095520 Missense_Mutation T T G TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000244426 p.L364R MLIP chr6 54230805 54230805 Missense_Mutation C C T TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000274897 p.T402I IBTK chr6 82211555 82211555 Missense_Mutation A A C TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000306270 p.V770G SLC2A12 chr6 134052429 134052429 Missense_Mutation T T A TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000275230 p.T18S AMPH chr7 38426956 38426956 Missense_Mutation G G C TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000356264 p.Q405E ZMIZ2 chr7 44760488 44760488 Missense_Mutation A A T TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000309315 p.T379S ZNF804B chr7 89335288 89335288 Missense_Mutation T T C TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000333190 p.I769T TRPV6 chr7 142877802 142877802 Intron G G T TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000359396 TSTA3 chr8 143613752 143613752 Splice_Region G G A TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000425753 p.S243S OR2S2 chr9 35958065 35958065 Missense_Mutation C C G TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000341959 p.G12R SPATA31D5P chr9 81914407 81914407 RNA G G A TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000527857 ZCCHC6 chr9 86340078 86340079 Frame_Shift_Del AA AA - TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000375963 p.F389Pfs*3 CYP2C8 chr10 95043067 95043067 Silent C C T TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000371270 p.Q324Q PIK3AP1 chr10 96648709 96648709 Missense_Mutation C C A TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000339364 p.A379S PPRC1 chr10 102141509 102141509 Missense_Mutation C C G TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000278070 p.P1001A NELL1 chr11 21229417 21229417 Nonsense_Mutation C C A TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000357134 p.C504* PYGM chr11 64751371 64751371 Silent G G A TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000164139 p.L641L PRB3 chr12 11268136 11268136 Missense_Mutation C C A TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000381842 p.G38V LINC01559 chr12 13373305 13373305 RNA T T A TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000318426 OVCH1 chr12 29451371 29451371 Missense_Mutation T T C TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000318184 p.E910G MYBPC1 chr12 101649350 101649350 Silent A A G TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000550270 p.G404G HECTD4 chr12 112252430 112252430 Silent G G T TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000550722 p.R1048R FREM2 chr13 38878216 38878216 Silent T T C TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000280481 p.F2918F TBPL2 chr14 55436624 55436624 Missense_Mutation G G T TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000247219 p.S182Y C14orf169 chr14 73492592 73492592 Silent G G T TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000304061 p.G525G TGFB3 chr14 75980759 75980759 Silent T T G TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000238682 p.G45G CEP128 chr14 80580391 80580391 Missense_Mutation C C T TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000281129 p.E947K AHNAK2 chr14 104948950 104948950 Silent G G C TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000333244 p.A2167A PDCD7 chr15 65133809 65133809 5'UTR G G C TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000204549 CHRNA5 chr15 78590373 78590373 Missense_Mutation A A G TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000299565 p.I328V CRAMP1L chr16 1674079 1674079 3'UTR G G A TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000293925 KCTD19 chr16 67303110 67303110 Intron G G A TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000304372 KCNG4 chr16 84222699 84222699 Silent G G A TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000308251 p.L360L TP53 chr17 7670693 7670694 Frame_Shift_Ins - - CGAAG TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000269305 p.E339Afs*8 KCNJ12 chr17 21419296 21419297 3'Flank GT GT - TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000331718 NF1 chr17 31337403 31337403 Nonsense_Mutation G G T TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000358273 p.E2155* GPATCH8 chr17 44400567 44400572 In_Frame_Del CTGAAA CTGAAA - TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000591680 p.V502_S503del TMEM104 chr17 74790262 74790262 Silent C C T TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000335464 p.Y104Y FDXR chr17 74866537 74866537 Missense_Mutation T T C TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000293195 p.H101R SEH1L chr18 12986995 12986995 3'UTR C C A TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000262124 SMAD7 chr18 48921471 48921471 Silent G G A TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000262158 p.T394T C19orf57 chr19 13889711 13889711 Missense_Mutation C C T TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000586783 p.R382K GIPC1 chr19 14480347 14480347 Missense_Mutation G G A TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000345425 p.R205C CYP4F8 chr19 15628354 15628354 Missense_Mutation C C T TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000612078 p.R390W NFKBID chr19 35889889 35889889 Splice_Site C C - TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000396901 p.X296_splice VN1R2 chr19 53259337 53259337 Missense_Mutation T T G TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000341702 p.V321G PCK1 chr20 57561494 57561494 Missense_Mutation G G C TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000319441 p.R28T CDH4 chr20 61254853 61254853 Missense_Mutation G G A TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000614565 p.E29K C21orf62 chr21 32794130 32794130 Missense_Mutation G G C TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000479548 p.L98V ZBTB21 chr21 41992421 41992421 Missense_Mutation C C G TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000310826 p.A559P NF2 chr22 29661324 29661324 Silent G G A TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000338641 p.S265S SOX10 chr22 37978126 37978126 Silent G G A TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000360880 p.N146N RBM3 chrX 48575187 48575187 Missense_Mutation T T A TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000376755 p.S3T RRAGB chrX 55731578 55731578 Missense_Mutation C C G TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000262850 p.R198G SLC6A14 chrX 116436700 116436700 5'UTR G G T TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000598581 SLC6A14 chrX 116436701 116436701 5'UTR G G T TCGA-OR-A5JP-01A-11D-A29I-10 ENST00000598581 GNB1 chr1 1789107 1789107 Missense_Mutation C C A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000378609 p.G288W GNB1 chr1 1789108 1789108 Silent A A C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000378609 p.A287A CSMD2 chr1 33633487 33633487 Missense_Mutation A A G TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000241312 p.V1672A KIF2C chr1 44761956 44761956 Missense_Mutation C C T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000372224 p.T575I CYP4A22 chr1 47146113 47146113 Missense_Mutation C C A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000371891 p.Q442K HMGCS2 chr1 119752663 119752663 Missense_Mutation C C G TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000369406 p.D436H CCT3 chr1 156333602 156333602 Silent A A T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000295688 p.I83I OLFML2B chr1 161984867 161984867 Missense_Mutation C C T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000294794 p.V530I SELL chr1 169703304 169703304 Silent G G C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000236147 p.T314T CEP350 chr1 180014361 180014361 Missense_Mutation G G C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000367607 p.Q636H PTGS2 chr1 186677678 186677678 Missense_Mutation G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000367468 p.P204S PTPRC chr1 198742338 198742338 Silent C C A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000442510 p.R890R TRAF3IP3 chr1 209775356 209775356 Missense_Mutation C C A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000367024 p.S261Y DTL chr1 212072210 212072210 Nonsense_Mutation G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000366991 p.W344* EPRS chr1 220046389 220046389 5'UTR C C A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000366923 OR2T33 chr1 248273718 248273718 Missense_Mutation C C T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000318021 p.V33I MYT1L chr2 1943123 1943123 Missense_Mutation C C T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000399161 p.E122K RRM2 chr2 10123751 10123751 Missense_Mutation G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000304567 p.D112N USP39 chr2 85645038 85645038 Silent C C T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000323701 p.D506D RANBP2 chr2 108763948 108763948 Missense_Mutation C C T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000283195 p.P1137S SMPD4 chr2 130153746 130153746 Missense_Mutation C C T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000409031 p.E656K NR4A2 chr2 156326161 156326161 Missense_Mutation G G C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000339562 p.A510G SPC25 chr2 168889259 168889259 Silent G G T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000282074 p.R56R DHRS9 chr2 169083445 169083445 Missense_Mutation G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000357546 p.V144M DNAH7 chr2 195875745 195875745 Missense_Mutation C C G TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000312428 p.W2072C ERBB4 chr2 211725146 211725146 Missense_Mutation G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000342788 p.P224L FARSB chr2 222640887 222640888 Frame_Shift_Ins - - TT TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000281828 p.I105Kfs*5 VILL chr3 38001824 38001824 Missense_Mutation C C A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000283713 p.F481L CTNNB1 chr3 41224641 41224664 In_Frame_Del TCCTTCTCTGAGTGGTAAAGGCAA TCCTTCTCTGAGTGGTAAAGGCAA - TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000349496 p.S45_P52del PDZRN3 chr3 73388002 73388002 Missense_Mutation T T C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000263666 p.N495S FRG2C chr3 75665650 75665650 Missense_Mutation G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000308062 p.C153Y ZPLD1 chr3 102453090 102453090 Missense_Mutation T T C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000466937 p.I93T BCHE chr3 165830493 165830493 Missense_Mutation A A G TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000264381 p.F181L ZNF639 chr3 179334060 179334060 Missense_Mutation A A G TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000326361 p.T366A ATP13A4 chr3 193457088 193457088 Silent T T C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000342695 p.T609T MUC4 chr3 195784508 195784508 Missense_Mutation C C T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000463781 p.A2358T UGT2A3 chr4 68951716 68951716 Silent G G C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000251566 p.L15L UGT2A3 chr4 68951717 68951717 Missense_Mutation A A T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000251566 p.L15H EGFLAM chr5 38463995 38463995 3'UTR G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000354891 C7 chr5 40959503 40959503 Missense_Mutation G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000313164 p.G515E ADGRV1 chr5 90690823 90690823 Nonsense_Mutation G G T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000405460 p.E2245* SLC23A1 chr5 139378675 139378675 Silent G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000348729 p.F361F SLC26A2 chr5 149980541 149980541 Missense_Mutation G G C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000286298 p.L316F HIST1H3H chr6 27810078 27810078 Missense_Mutation C C G TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000369163 p.A2G ABCF1 chr6 30589858 30589858 Missense_Mutation C C T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000326195 p.T706M TNXB chr6 32055969 32055969 Missense_Mutation C C A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000375244 p.R2783S NOTCH4 chr6 32198521 32198521 Missense_Mutation C C A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000375023 p.W1552C WDR46 chr6 33287611 33287611 Splice_Region G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000374617 CUTA chr6 33418153 33418153 Silent G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000374500 p.G11G PPARD chr6 35420275 35420275 Silent G G T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000311565 p.G93G UNC5CL chr6 41034906 41034906 Missense_Mutation T T G TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000244565 p.T57P PKHD1 chr6 51659936 51659936 Missense_Mutation T T A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000371117 p.Q3397L KHDC1L chr6 73225408 73225408 Translation_Start_Site T T C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000370388 p.M1? REV3L chr6 111372701 111372701 Frame_Shift_Del G G - TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000358835 p.P1885Qfs*45 MCM9 chr6 118931504 118931504 Missense_Mutation G G C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000316316 p.R74G ARFGEF3 chr6 138210007 138210007 Missense_Mutation C C T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000251691 p.S106L KIF25 chr6 168042035 168042035 Missense_Mutation G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000354419 p.R238H ABCB5 chr7 20742953 20742953 Missense_Mutation G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000404938 p.R1034H NPSR1 chr7 34658550 34658550 Nonsense_Mutation C C G TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000360581 p.Y46* PTCD1 chr7 99435056 99435056 Missense_Mutation T T A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000292478 p.T63S RELN chr7 103603326 103603326 Missense_Mutation C C G TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000428762 p.G1104A KIAA1549 chr7 138917162 138917162 Frame_Shift_Del C C - TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000422774 p.V822Cfs*17 NOS3 chr7 151001903 151001903 Missense_Mutation G G T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000297494 p.G529C SLC4A2 chr7 151074127 151074127 Missense_Mutation G G C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000413384 p.R875T RP1L1 chr8 10608346 10608346 Missense_Mutation C C T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000382483 p.E1918K XPO7 chr8 21987850 21987850 Missense_Mutation G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000252512 p.G594R ENTPD4 chr8 23447854 23447854 Missense_Mutation T T C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000358689 p.T80A KCTD9 chr8 25429830 25429830 3'UTR T T C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000221200 KIF13B chr8 29177535 29177535 Missense_Mutation G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000524189 p.A255V KAT6A chr8 41933499 41933499 Missense_Mutation C T T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000265713 p.G1574D RSPO2 chr8 107958135 107958135 Silent A A G TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000276659 p.C187C C9orf170 chr9 87156596 87156596 RNA G G T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000623052 GALNT12 chr9 98826814 98826814 Missense_Mutation G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000375011 p.A202T GRIN3A chr9 101686882 101686882 Missense_Mutation C C T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000361820 p.E340K C9orf9 chr9 132878151 132878151 5'Flank C C G TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000356311 PRKCQ chr10 6491772 6491772 Missense_Mutation A A T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000263125 p.F234Y ECHDC3 chr10 11763519 11763519 Missense_Mutation C C G TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000379215 p.P296R LYZL1 chr10 29292561 29292561 Missense_Mutation C G G TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000375500 p.A107G ERCC6 chr10 49505961 49505961 Missense_Mutation C C A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000355832 p.E483D ERCC6-PGBD3 chr10 49515669 49515669 Missense_Mutation C C A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000515869 p.W950C DNAJC9 chr10 73248299 73248299 5'UTR G A A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000372950 NDUFB8 chr10 100529837 100529837 Missense_Mutation C C A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000299166 p.R5S C10orf90 chr10 126504774 126504774 Silent G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000284694 p.I142I EPS8L2 chr11 721836 721836 Intron G G T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000318562 CARS chr11 3057402 3057402 5'UTR G G C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000397111 MRGPRE chr11 3228770 3228770 Silent G A A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000389832 p.H10H OR51A4 chr11 4946394 4946394 Missense_Mutation A A C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000380373 p.L236R MICALCL chr11 12293636 12293636 Missense_Mutation G G C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000256186 p.A69P NCAM1 chr11 113233199 113233199 Silent C C G TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000316851 p.A525A BLID chr11 122115958 122115958 5'UTR A A T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000560104 FKBP4 chr12 2801232 2801232 Missense_Mutation A A G TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000001008 p.Y383C CSAD chr12 53161386 53161386 Missense_Mutation C C T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000444623 p.A236T NFE2 chr12 54292408 54292408 Missense_Mutation A A G TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000312156 p.V363A BAZ2A chr12 56611981 56611981 Silent G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000551812 p.V469V HECTD4 chr12 112163103 112163103 Silent A A C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000550722 p.G4219G RASAL1 chr12 113107278 113107278 Intron C C T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000261729 LINC00173 chr12 116534774 116534774 RNA A A G TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000480237 ATP8A2 chr13 25564001 25564001 Silent C C A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000381655 p.P481P DCLK1 chr13 35836099 35836099 Missense_Mutation T T C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000360631 p.E388G EXD2 chr14 69237912 69237912 Missense_Mutation G G C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000312994 p.A544P RTL1 chr14 100882351 100882351 Missense_Mutation A A T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000534062 p.I813N RTL1 chr14 100882743 100882743 Silent G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000534062 p.T682T RYR3 chr15 33772055 33772055 Missense_Mutation A T T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000389232 p.K2984N EMC4 chr15 34225054 34225054 5'UTR G T T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000267750 FANCI chr15 89247702 89247702 Missense_Mutation G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000310775 p.E19K KIF7 chr15 89633752 89633752 Silent A A G TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000394412 p.L842L MGRN1 chr16 4681690 4681690 Silent C C T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000399577 p.S424S PRKCB chr16 23836236 23836236 Missense_Mutation G G T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000321728 p.A21S CACNG3 chr16 24256844 24256844 Silent G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000005284 p.T30T ABCC11 chr16 48167548 48167548 Missense_Mutation C C G TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000356608 p.R1335P CNTNAP4 chr16 76521240 76521240 Missense_Mutation G G C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000611870 p.K822N SCO1 chr17 10697560 10697560 5'UTR T T C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000255390 CNTD1 chr17 42805761 42805761 Missense_Mutation C C G TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000588408 p.L153V PTGES3L-AARSD1 chr17 42953750 42953750 Missense_Mutation T T G TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000421990 p.I502L EPN3 chr17 50536666 50536666 Missense_Mutation G T T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000268933 p.S37I COLEC12 chr18 346782 346782 Silent G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000400256 p.N280N TUBB6 chr18 12325574 12325574 Missense_Mutation G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000317702 p.R262H RFX2 chr19 6047462 6047462 Missense_Mutation G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000303657 p.A12V ACER1 chr19 6333569 6333569 5'UTR C C T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000301452 RPS28 chr19 8321670 8321670 Silent G G C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000600659 p.L18L ZNF846 chr19 9758360 9758360 Silent T T C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000397902 p.S239S ZNF653 chr19 11484049 11484049 Missense_Mutation G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000293771 p.P555S OR10H5 chr19 15794463 15794463 Missense_Mutation C C T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000308940 p.R139W UPF1 chr19 18832219 18832219 Missense_Mutation G G C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000599848 p.E4Q YJEFN3 chr19 19537346 19537346 Missense_Mutation C C T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000514277 p.S241L ZNF607 chr19 37698649 37698649 Missense_Mutation T T C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000355202 p.I494M SAE1 chr19 47169877 47169877 Silent A A G TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000270225 p.A229A LRRC4B chr19 50519328 50519328 Missense_Mutation C C T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000389201 p.A129T TMEM86B chr19 55228213 55228213 Missense_Mutation G G C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000327042 p.I92M ZFP28 chr19 56554399 56554399 Silent T T C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000301318 p.C538C ITCH chr20 34492591 34492591 Missense_Mutation C C G TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000262650 p.L845V PTPRT chr20 42084747 42084747 Silent G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000373187 p.V1357V KRTAP11-1 chr21 30881418 30881418 Missense_Mutation C C A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000332378 p.C36F HUNK chr21 31999000 31999000 Missense_Mutation C C G TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000270112 p.P654R KRTAP10-9 chr21 44627478 44627478 Missense_Mutation G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000397911 p.V103I MIF chr22 23894393 23894393 5'UTR G G C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000215754 MN1 chr22 27796799 27796799 Missense_Mutation C C T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000302326 p.E1249K OSBP2 chr22 30741267 30741267 Missense_Mutation A A T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000332585 p.S251C UPK3A chr22 45286024 45286024 Missense_Mutation C C A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000216211 p.L46I NLGN4X chrX 5903296 5903296 Missense_Mutation G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000275857 p.A461V HDHD1 chrX 7105737 7105737 Missense_Mutation A A C TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000381077 p.L55V FAM9A chrX 8795151 8795151 Missense_Mutation C C A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000381003 p.G253V FRMPD4 chrX 12716702 12716702 Missense_Mutation C C T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000380682 p.A748V DMD chrX 31178731 31178731 Silent C C T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000357033 p.A3387A WDR45 chrX 49077678 49077678 Missense_Mutation C C T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000376372 p.G67D MAGIX chrX 49164963 49164963 Missense_Mutation A A T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000595224 p.E127V ZMAT1 chrX 101884341 101884341 Silent C C T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000372782 p.Q362Q NGFRAP1 chrX 103377940 103377940 3'UTR A A G TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000372635 PAK3 chrX 111196510 111196510 Missense_Mutation C C T TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000262836 p.P441L WDR44 chrX 118398470 118398470 Missense_Mutation C C A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000254029 p.T425K TAZ chrX 154419551 154419551 Missense_Mutation G G A TCGA-OR-A5K9-01A-11D-A29I-10 ENST00000601016 p.V157I CRB1 chr1 197435313 197435313 Missense_Mutation T T G TCGA-OR-A5LE-01A-11D-A29I-10 ENST00000367400 p.H1150Q LGALS8 chr1 236537578 236537578 Missense_Mutation G G A TCGA-OR-A5LE-01A-11D-A29I-10 ENST00000341872 p.A43T RHOB chr2 20448333 20448334 3'UTR AG AG - TCGA-OR-A5LE-01A-11D-A29I-10 ENST00000272233 CTNNB1 chr3 41224645 41224645 Missense_Mutation T T C TCGA-OR-A5LE-01A-11D-A29I-10 ENST00000349496 p.S45P ISL1 chr5 51389651 51389651 Frame_Shift_Del C C - TCGA-OR-A5LE-01A-11D-A29I-10 ENST00000230658 p.I163Sfs*26 APC chr5 112767342 112767342 Missense_Mutation A A G TCGA-OR-A5LE-01A-11D-A29I-10 ENST00000257430 p.N125S DOPEY1 chr6 83120766 83120766 Missense_Mutation C C G TCGA-OR-A5LE-01A-11D-A29I-10 ENST00000349129 p.I358M SNORA15 chr7 65066949 65066949 5'Flank T T C TCGA-OR-A5LE-01A-11D-A29I-10 ENST00000384334 KLRG2 chr7 139480234 139480234 Silent G G A TCGA-OR-A5LE-01A-11D-A29I-10 ENST00000340940 p.Y257Y C9orf172 chr9 136846636 136846637 Frame_Shift_Del GT GT - TCGA-OR-A5LE-01A-11D-A29I-10 ENST00000436881 p.V742Rfs*42 KIAA1279 chr10 68988865 68988865 Missense_Mutation G G C TCGA-OR-A5LE-01A-11D-A29I-10 ENST00000361983 p.E11D PAPSS2 chr10 87715073 87715074 Frame_Shift_Del CT CT - TCGA-OR-A5LE-01A-11D-A29I-10 ENST00000361175 p.L244Pfs*7 SLK chr10 104019795 104019795 Missense_Mutation C C T TCGA-OR-A5LE-01A-11D-A29I-10 ENST00000369755 p.T1065I CREB3L1 chr11 46299956 46299956 Missense_Mutation C C T TCGA-OR-A5LE-01A-11D-A29I-10 ENST00000621158 p.H42Y TMEM134 chr11 67464582 67464582 3'UTR C C T TCGA-OR-A5LE-01A-11D-A29I-10 ENST00000308022 AC215219.2 chr12 17845 17845 5'Flank T T G TCGA-OR-A5LE-01A-11D-A29I-10 ENST00000611710 NTN4 chr12 95710560 95710560 Missense_Mutation C C T TCGA-OR-A5LE-01A-11D-A29I-10 ENST00000343702 p.R354H ATP8A2 chr13 25862334 25862334 Missense_Mutation A A G TCGA-OR-A5LE-01A-11D-A29I-10 ENST00000381655 p.T1037A PDX1 chr13 27920157 27920157 Missense_Mutation T T C TCGA-OR-A5LE-01A-11D-A29I-10 ENST00000381033 p.Y7H BRCA2 chr13 32336552 32336553 In_Frame_Ins - - TCTTCTTCT TCGA-OR-A5LE-01A-11D-A29I-10 ENST00000380152 p.V733_L734insFFF TP53 chr17 7676398 7676398 Frame_Shift_Del G - - TCGA-OR-A5LE-01A-11D-A29I-10 ENST00000269305 p.P27Lfs*17 PTPN2 chr18 12830977 12830977 Missense_Mutation A A T TCGA-OR-A5LE-01A-11D-A29I-10 ENST00000309660 p.V109D DOT1L chr19 2191209 2191209 Silent C C T TCGA-OR-A5LE-01A-11D-A29I-10 ENST00000398665 p.T154T SHROOM4 chrX 50602785 50602785 Missense_Mutation A A T TCGA-OR-A5LE-01A-11D-A29I-10 ENST00000289292 p.S1264T NBPF9 chr1 149063792 149063792 Missense_Mutation G G C TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000613595 p.L623V CAPN2 chr1 223762242 223762242 Missense_Mutation G G C TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000295006 p.L541F CASR chr3 122284860 122284860 Missense_Mutation G G A TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000490131 p.G969D SOX2 chr3 181713439 181713439 3'UTR A A - TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000325404 RP11-346J10.3 chr5 100389543 100389543 RNA C C G TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000614465 PCDHB6 chr5 141157681 141157681 3'Flank G G T TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000231136 BIN3 chr8 22669145 22669145 5'Flank A A G TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000276416 SPATA6L chr9 4625305 4625306 Intron - A A TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000461761 TAF1L chr9 32630738 32630738 Silent C C T TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000242310 p.E1614E SVEP1 chr9 110430418 110430418 Missense_Mutation C C T TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000374469 p.E1796K PARD3 chr10 34312277 34312277 Intron T T G TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000374789 NPY4R chr10 46462259 46462259 Missense_Mutation G G A TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000374312 p.T126M FAM35A chr10 87175934 87175934 Intron C C T TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000298784 CYP17A1 chr10 102830934 102830935 Nonsense_Mutation - - AGCTTACTGACGGTGAG TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000369887 p.Y432Sfs*5 PDE2A chr11 72597584 72597584 Missense_Mutation T T C TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000334456 p.N120S DCP1B chr12 1949092 1949092 Silent G C C TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000280665 p.L589L AVPR1A chr12 63150604 63150604 Missense_Mutation C C T TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000299178 p.R78Q PNN chr14 39181529 39181529 Missense_Mutation C C A TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000216832 p.S607Y C14orf169 chr14 73493377 73493377 3'UTR A A G TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000304061 MYO5A chr15 52397353 52397353 Missense_Mutation C C A TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000399231 p.K389N ARID3B chr15 74573188 74573188 Silent C C T TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000622429 p.V227V DOC2A chr16 30006256 30006256 Missense_Mutation G G C TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000350119 p.A378G HYDIN chr16 70979007 70979007 Silent G G T TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000393567 p.A1515A EEF2 chr19 3976664 3976664 Missense_Mutation C C G TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000309311 p.D823H CFAP61 chr20 20142930 20142930 Silent T T C TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000245957 p.D311D CASS4 chr20 56437180 56437180 Missense_Mutation C C T TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000360314 p.A18V BCR chr22 23285115 23285115 Missense_Mutation C C G TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000305877 p.P774A RBM3 chrX 48575180 48575180 5'UTR C T T TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000376755 GPRASP2 chrX 102716658 102716658 Nonsense_Mutation G T T TCGA-OR-A5LG-01A-11D-A29I-10 ENST00000332262 p.E597* DVL1 chr1 1338068 1338068 Silent C T T TCGA-OR-A5J3-01A-11D-A29I-10 ENST00000378888 p.Q541Q SPTA1 chr1 158611124 158611124 3'UTR A A C TCGA-OR-A5J3-01A-11D-A29I-10 ENST00000368147 ADGRF3 chr2 26314529 26314529 Silent A G G TCGA-OR-A5J3-01A-11D-A29I-10 ENST00000311519 p.L339L DNAH5 chr5 13870884 13870884 Missense_Mutation G G T TCGA-OR-A5J3-01A-11D-A29I-10 ENST00000265104 p.F1239L PPWD1 chr5 65583148 65583148 Silent T T A TCGA-OR-A5J3-01A-11D-A29I-10 ENST00000261308 p.P487P PCDHA12 chr5 140875514 140875514 Silent G G C TCGA-OR-A5J3-01A-11D-A29I-10 ENST00000398631 p.L14L PKHD1 chr6 52055595 52055595 Missense_Mutation A T T TCGA-OR-A5J3-01A-11D-A29I-10 ENST00000371117 p.Y610N AGAP9 chr10 47553434 47553434 5'Flank A A G TCGA-OR-A5J3-01A-11D-A29I-10 ENST00000413193 RBM20 chr10 110781157 110781157 Missense_Mutation C T T TCGA-OR-A5J3-01A-11D-A29I-10 ENST00000369519 p.S183F CNTN5 chr11 100224776 100224776 Missense_Mutation G T T TCGA-OR-A5J3-01A-11D-A29I-10 ENST00000524871 p.D657Y PATE2 chr11 125777341 125777341 3'UTR A G G TCGA-OR-A5J3-01A-11D-A29I-10 ENST00000358524 PPFIA2 chr12 81384067 81384067 Missense_Mutation T T C TCGA-OR-A5J3-01A-11D-A29I-10 ENST00000549396 p.K314E MORF4L1 chr15 78897023 78897023 Missense_Mutation G G A TCGA-OR-A5J3-01A-11D-A29I-10 ENST00000331268 p.D349N ADPRM chr17 10705155 10705155 Missense_Mutation G A A TCGA-OR-A5J3-01A-11D-A29I-10 ENST00000379774 p.D77N PRKAR1A chr17 68530413 68530413 Frame_Shift_Del C - - TCGA-OR-A5J3-01A-11D-A29I-10 ENST00000358598 p.Q371Sfs*70 ARID3A chr19 932572 932572 Missense_Mutation C C G TCGA-OR-A5J3-01A-11D-A29I-10 ENST00000263620 p.R175G IFNAR2 chr21 33262691 33262691 Intron G G A TCGA-OR-A5J3-01A-11D-A29I-10 ENST00000342136 GPR174 chrX 79171164 79171164 Nonsense_Mutation C T T TCGA-OR-A5J3-01A-11D-A29I-10 ENST00000276077 p.R53* SFN chr1 26864366 26864366 3'UTR C C T TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000339276 PTPRF chr1 43591360 43591360 Silent A A G TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000359947 p.G446G JAK1 chr1 64855584 64855584 Missense_Mutation G G A TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000342505 p.H525Y HMCN1 chr1 186078208 186078208 Missense_Mutation G G A TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000271588 p.V2863I ADSS chr1 244420229 244420229 Missense_Mutation C C G TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000366535 p.G244A NIFK chr2 121735713 121735713 Missense_Mutation T T C TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000285814 p.Y48C NEB chr2 151526031 151526031 Missense_Mutation T T A TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000172853 p.Q5662L PID1 chr2 229025969 229025969 Missense_Mutation C C T TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000354069 p.R139Q UGT1A5 chr2 233713285 233713285 Missense_Mutation A A T TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000373414 p.Q98H FAM212A chr3 49804759 49804759 Silent C C T TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000333323 p.D212D SI chr3 165030795 165030795 Missense_Mutation C C G TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000264382 p.E937Q ANK2 chr4 113323784 113323784 Intron G G T TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000357077 PCDHB10 chr5 141192847 141192847 Missense_Mutation A A G TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000239446 p.K99E GRM6 chr5 178992078 178992078 Silent G G A TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000231188 p.P170P CANX chr5 179722879 179722879 Missense_Mutation A A G TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000247461 p.S420G ITPR3 chr6 33689239 33689239 Splice_Region C C T TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000374316 p.G2232G LAMA2 chr6 129059891 129059891 Missense_Mutation C C A TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000421865 p.Q131K TMEM176A chr7 150803796 150803796 Missense_Mutation G G T TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000004103 p.R173S CDC37L1 chr9 4685143 4685143 Silent G G A TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000381854 p.K133K PTPRD chr9 8485824 8485824 Missense_Mutation G G T TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000356435 p.T998K IARS chr9 92223381 92223381 Missense_Mutation T T C TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000375643 p.Y1173C LYZL1 chr10 29311045 29311046 Frame_Shift_Del TG TG - TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000375500 p.C191* CYP26C1 chr10 93061307 93061307 Missense_Mutation C C T TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000285949 p.A15V OR52E2 chr11 5058802 5058802 Missense_Mutation G G A TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000321522 p.L276F OR5D13 chr11 55774143 55774143 Missense_Mutation C C G TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000361760 p.R236G KRT75 chr12 52434242 52434242 Silent C C T TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000252245 p.S21S FAM101A chr12 124314218 124314218 Missense_Mutation C C T TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000546355 p.S34L UBL3 chr13 29772157 29772157 Missense_Mutation G G T TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000380680 p.L60I SOHLH2 chr13 36174795 36174795 Missense_Mutation G G A TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000379881 p.A239V GPALPP1 chr13 44989636 44989636 5'UTR C A A TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000379151 TMEM63C chr14 77256659 77256659 Missense_Mutation C C T TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000298351 p.A785V MPI chr15 74892798 74892798 Silent A A G TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000352410 p.L161L ZNF200 chr16 3233814 3233814 5'UTR A A G TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000414144 CDH13 chr16 83344909 83344909 Silent G G T TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000567109 p.P228P MYH8 chr17 10406924 10406924 Missense_Mutation C C T TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000403437 p.R674Q EVI5L chr19 7850117 7850118 Frame_Shift_Ins - - T TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000270530 p.Q251Afs*44 MUC16 chr19 8952474 8952474 Missense_Mutation G G C TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000397910 p.S8099C PTPRA chr20 2964928 2964928 Silent C C G TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000380393 p.A47A PIGU chr20 34637886 34637889 Frame_Shift_Del CTTT CTTT - TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000217446 p.K139Wfs*7 ARFGEF2 chr20 48989422 48989422 Missense_Mutation C C T TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000371917 p.R891W B4GALT5 chr20 49636431 49636431 Missense_Mutation G G A TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000371711 p.R350W ASB11 chrX 15314437 15314437 Intron C C G TCGA-OR-A5L6-01A-11D-A29I-10 ENST00000480796 NCOA1 chr2 24728451 24728451 Missense_Mutation C C T TCGA-PA-A5YG-01A-11D-A29I-10 ENST00000348332 p.A954V ST6GAL2 chr2 106806789 106806789 Missense_Mutation C C A TCGA-PA-A5YG-01A-11D-A29I-10 ENST00000361686 p.Q493H WSCD2 chr12 108196013 108196013 Missense_Mutation G G T TCGA-PA-A5YG-01A-11D-A29I-10 ENST00000332082 p.G61C SEZ6L2 chr16 29873661 29873661 Missense_Mutation C C T TCGA-PA-A5YG-01A-11D-A29I-10 ENST00000308713 p.V725I KRT12 chr17 40864939 40864939 Missense_Mutation C C T TCGA-PA-A5YG-01A-11D-A29I-10 ENST00000251643 p.R225H TMPRSS6 chr22 37066221 37066221 Silent C C T TCGA-PA-A5YG-01A-11D-A29I-10 ENST00000346753 p.P765P ACVR2B chr3 38477930 38477930 Silent C T T TCGA-OR-A5JW-01A-11D-A29I-10 ENST00000352511 p.N110N OR5H2 chr3 98283068 98283068 Missense_Mutation C A A TCGA-OR-A5JW-01A-11D-A29I-10 ENST00000355273 p.H61N MUC4 chr3 195788206 195788206 Missense_Mutation T T C TCGA-OR-A5JW-01A-11D-A29I-10 ENST00000463781 p.D1125G TKTL2 chr4 163472311 163472311 Missense_Mutation C C T TCGA-OR-A5JW-01A-11D-A29I-10 ENST00000280605 p.R475Q KIF3A chr5 132734291 132734291 Missense_Mutation G G T TCGA-OR-A5JW-01A-11D-A29I-10 ENST00000378746 p.T65N PRPS1L1 chr7 18027284 18027284 Missense_Mutation T T A TCGA-OR-A5JW-01A-11D-A29I-10 ENST00000506618 p.I167F NPC1L1 chr7 44521106 44521106 Missense_Mutation C C G TCGA-OR-A5JW-01A-11D-A29I-10 ENST00000289547 p.C989S C7orf72 chr7 50096471 50096471 Missense_Mutation C C T TCGA-OR-A5JW-01A-11D-A29I-10 ENST00000297001 p.T129I AKAP9 chr7 92017082 92017082 Missense_Mutation C C A TCGA-OR-A5JW-01A-11D-A29I-10 ENST00000356239 p.L1273I GPR37 chr7 124746703 124746703 Missense_Mutation G G A TCGA-OR-A5JW-01A-11D-A29I-10 ENST00000303921 p.P555L BRINP1 chr9 119167497 1191